From owner-acedb@net.bio.net Tue Feb 08 22:00:00 1994 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!agate!overload.lbl.gov!acedbfaq From: acedbfaq@s27w007.pswfs.gov (ACEDB FAQ Pseudouser) Newsgroups: bionet.software.acedb,news.answers Subject: ACEDB Genome Database Software FAQ Followup-To: bionet.software.acedb Date: 9 Feb 1994 17:41:55 GMT Organization: Dendrome, A genome database for forest trees Lines: 701 Approved: news-answers-request@MIT.Edu Message-ID: <2jb793$k8t@overload.lbl.gov> Reply-To: acedbfaq@s27w007.pswfs.gov NNTP-Posting-Host: s27w007.pswfs.gov Summary: Frequently Asked Questions about finding and getting started with the database system ACEDB. ACEDB is used to collect information regarding the molecular biology of the genome. Archive-name: acedb-faq Last-modifed: 2/9/94 Version: 1.8 Xref: biosci bionet.software.acedb:154 news.answers:12475 ---------------------------------------------------------------------- Common Questions and Answers about ACEDB. This document will be posted monthly to the BIOSCI newsgroup bionet.software.acedb and to USENET conference news.answers. It is intended to be used as an index to ACEDB databases and to information about the database software. The latest version of the ACEDB FAQ should be available via anonymous ftp at machine net.bio.net (134.172.2.69) as file pub/BIOSCI/ACEDB/ACEDB.FAQ or at rtfm.mit.edu (18.70.0.209) as pub/usenet.news.answers/acedb-faq. Answer 3 demonstrates a sample FTP session. If you only have electronic mail, the FAQ can be retrieved from mail-server@rtfm.mit.edu. There is an HyperText Markup Language (HTML) version of this document available on the World Wide Web: http://probe.nalusda.gov:8000/plant/acedbfaq.html [Until I get more familiar with HTML, it may not be totally synchronized with the plain FAQ. --bks] Curators of ACEDB databases should take note of Question 4 and keep me apprised of changes. Errors of commission or omission are unintentional. If I have forgotten to give you credit please let me know. Please send comments and corrections to: acedbfaq@s27w007.pswfs.gov --Bradley K. Sherman ---------------------------------------------------------------------- The List of questions in the ACEDB FAQ. Questions marked with + are new, those with ! have substantially changed answers: Q0: What is ACEDB? Q1: What is the current version of ACEDB? Q2: What hardware|software do I need to run ACEDB? Q3: Where can I get ACEDB? Q4: !What ACEDB databases exist? Q5: What written documentation exists for ACEDB? Q6: Where can I find further information about ACEDB? Q7: How should ACEDB be cited? Q8: Is ACEDB object-oriented? Q9: What's all this about Gopher|WAIS|Anonymous ftp|WWW|URL ... Q10: How can I get on the ACEDB announcements mailing list? Q11: !When and where is the next ACEDB Workshop? Q411:Who contributed to this document? ---------------------------------------------------------------------- Q0: What is ACEDB? A0: ACEDB is an acronym for A Caenorhabditis elegans Database. It can refer to a database and data concerning the nematode C. elegans, or to the database software alone. This document is concerned primarily with the latter meaning. ACEDB is being adapted by many groups to organize molecular biology data about the genomes of diverse species [see Q4]. ACEDB allows for automatic cross-referencing of items during loading and allows for hypertextual navigation of the links using a graphical user interface and mouse. Certain special purpose graphical displays have been integrated into the software. These reflect the needs of molecular biologists in constructing genetic and physical maps of genomes. ACEDB was written and developed by Richard Durbin (MRC LMB Cambridge, England) and Jean Thierry-Mieg (CNRS, Montpellier, France), beginning circa 1990. It is written in the C programming language and uses the X11 windowing system to provide a platform independent graphical user interface. The source code is publicly available [See Q3]. Durbin & Thierry-Mieg continue to develop the system, with contributions from other groups including Lawrence Berkeley Laboratory and the European integrated Genome Project. A description by Durbin & Thierry-Mieg: ACEDB does not use an underlying relational database schema, but a system we wrote ourselves in which data are stored in objects that belong in classes. This is nevertheless a general database management system using caches, session control, and a powerful query language. Typical objects are clones, genes, alleles, papers, sequences, etc. Each object is stored as a tree, following a hierarchical structure for the class (called the "model"). Maps are derived from data stored in tree objects, but precomputed and stored as tables for efficiency. The system of models allows flexibility and efficiency of storage -missing data are not stored. A major advantage is that the models can be extended and refined without invalidating an existing database. Comments can be added to any node of an object. Current display modes are: TREE for text type objects: papers, authors, genes etc. GMAP genetic map PMAP physical map (Sulston contig style) SEQ DNA sequence - symbolic, features, sequence and translation GRID hybridisation patterns for a probe to a clone grid BIBLIO bibliography attached to any object display modules under development: CMAP whole chromosome physical map plot GEL agarose gel simulation derived from sequence ---------------------------------------------------------------------- Q1: What is the current version of ACEDB? A1: As of January 1994, ACEDB has undergone a bifurcation. Those involved with C. elegans will want to to track the 2.x series under the stewardship of Richard Durbin and all other groups should probably track the 3.x series of Jean Thierry-Mieg. Thierry-Mieg writes "... 2 and 3 differ only at the level of displays ..." Version 2.0 was released in December, 1993 and version 3.0 was released in January, 1994. To retrieve the software see Q3. To be kept informed of new releases see Q10. [This question refers to the software not the C. elegans data.] ---------------------------------------------------------------------- Q2: What hardware/software do I need to run ACEDB? A2: ACEDB currently runs on the following Unix systems, under X11: Unix: Any machine running SunOS 4.x e.g. Sun SPARCstation 1, 1+, 2, IPC, IPX. SPARCstation 10 under Solaris [Probably all Solaris, then --bks] DEC DECstation3100, 5100 etc. DEC Alpha/OSF-1 Silicon Graphics Iris series PC 386/486 with Linux (free Unix) There exist, or have existed, ports onto Alliant, Hewlett- Packard, IBM R6000, NeXT, Convex. You may have to contact the developer responsible for the port to make these real. MSDOS/Windows/NT: A port to NT is rumored to be in the works. Macintosh: A port to the Macintosh may become available real soon now. For cost savings, a combination of a high-end Intel platform with Linux appears very attractive. Here at the Institute of Forest Genetics we run ACEDB on a Sun Microsystems SPARCstation II, and users can interact using Macintoshes and PC-clones by using X11 implementations for the personal computers and a LAN. [This section should be expanded to have a more thorough discussion of X11 interactions. --bks] ---------------------------------------------------------------------- Q3: Where can I get ACEDB? A3: All the files are available in the following public access accounts (anonymous ftp sites) accessible via Internet: lirmm.lirmm.fr (193.49.104.10) in pub/acedb cele.mrc-lmb.cam.ac.uk (131.111.84.1) in pub/acedb ncbi.nlm.nih.gov (130.14.20.1) in repository/acedb bioinformatics.weizmann.ac.il (132.76.55.12) in pub/databases/acedb. A typical session would be: ftp ncbi.nlm.nih.gov login: anonymous password: your email address cd repository/acedb/ace3 binary ls get README_3 get NOTES get INSTALL get bin.sparc.3.0.tar.Z quit ---------------------------------------------------------------------- Q4: What ACEDB databases exist? A4: [In alphabetic order by Database name --bks] Database : AAnDB-1.0 Species : Aspergillus nidulans PI : Leland Ellis Last_update : Sept. 1993 ACEDB_version : 2.0 URL : http://keck.tamu.edu/ibt.html Database : AAtDB Species : Arabidopsis thaliana Availability : Curator : John Morris Current version: 1-5 Contact : curator@frodo.mgh.harvard.edu Last_update : Sept. 1993 Database : ABtDB-1.0 Species : Bovine, Bos taurus PI : Leland Ellis Last_update : Sept. 1993 URL : http://keck.tamu.edu/ibt.html Database : ACeDB Species : Caenorhabditis elegans Availability : Current version: 1-21 Curator : Jean Thierry-Mieg Curator : Richard Durbin Contact : rd@mrc-lmb.cam.ac.uk Contact : mieg@kaa.cnrs-mop.fr Last_update : Sept. 1993 Database : ChlamyDB Species : Chlamydomonas PI : Elizabeth Harris Contact : chlamy@acpub.duke.edu Availability : Still under construction Last_update : 30 Sept. 1993 Database : EcoDB Species : E. coli PI : Staffan Bergh Contact : staffan@biochem.kth.se Availability : Still under construction Last_update : 11 Oct. 1993 Database : FlyBase Species : Drosophila melanogaster Availability : gopher or gopher+ ftp.bio.indiana.edu Availability : ACeDB-style interface to SyBase server due by end of 1994 Curator : Edward Welbourne Contact : eddy@gen.cam.ac.uk Contact : flybase@morgan.harvard.edu PI : William Gelbart PI : Michael Ashburner PI : Thomas Kaufman PI : Kathy Matthews PI : John Merriam Database : Flydb Species : Drosophila melanogaster Availability : by request only, via ftp Curator : Suzanna E. Lewis Contact : SELewis@lbl.gov Focus : STS content mapping project summary PI : Gerald Rubin PI : Mike Palazzolo PI : Dan Hartl PI : Alan Spradling Last_update : Sept. 1993 Database : GrainGenes Species : Wheat, barley, oats, relatives Availability : Gopher greengenes.cit.cornell.edu port 70 Availability : ACEDB version by ftp, on request from the curators Curator : David E. Matthews PI : Olin D. Anderson Contact : matthews@greengenes.cit.cornell.edu Contact : oandersn@wheat.usda.gov Last_update : Sept. 1993 Database : human.c17 Species : Homo sapiens Availability : the database is under development Contact : lsprilus@weizmann.weizmann.ac.il Focus : mapping & sequencing of Human Chromosome 17 Based_on: acedb.3-0 Last_update : Jan. 1994 Database : Mace Species : Zea mays L. ssp. mays Focus : Maize genome Comment : Mace is the front end for maizedb, a relational (SYBASE) database. It is updated from maizedb by software written by Stan Letovsky. Maizedb is updated daily and will soon be accessible by public login. Curator : Ed Coe Curator : Pat Byrne Curator : Georgia Davis Curator : Mary Polacco Off-Site Curator : Marty Sachs Off-Site Curator : Christiane Fauron Off-Site Curator : Carolyn Wetzel Off-Site Curator : Steve Rodermel Off-Site Curator/Designer : Stan Letovsky Off-Site Curator/Designer : Mary Berlyn Systems Manager : Denis Hancock PI : Ed Coe Contact : maizedb@teosinte.agron.missouri.edu Last_update: 5 October 1993 Database : MycDB Species : Mycobacterium PI : Staffan Bergh PI : Thierry Garnier Contact : staffan@pasteur.fr Last_update : Sept. 1993 Database : RiceGenes Species : Rice (O. sative) Availability : under development, login at own risk Curator : Edie Paul Contact : epaul@nightshade.cit.cornell.edu Last_update : Sept. 1993 Database : SolGenes Coverage: Solanaceae - tomato, potato, pepper (eventually) Availability : Beta ACEDB via login or tar file Curator : Edie Paul Contact : epaul@nightshade.cit.cornell.edu Last_update : Sept. 1993 Database : SoyBase Species : Soybeans Curator : Lisa Lorenzen PI : Randy Shoemaker Contact : lorenzen@mendel.agron.iastate.edu Last_update : Sept. 1993 Database : TreeGenes Species : Forest trees, Pinus taeda Availability : contact curator Curator : Bradley K. Sherman PI : David B. Neale Contact : Dendrome@s27w007.pswfs.gov Contact : bks@s27w007.pswfs.gov Contact : dbn@s27w007.pswfs.gov Last_update : Sept. 1993 Database : 21Bdb Species : Homo sapiens Availability : by request, via ftp, gopher Curator : Donn F. Davy Contact : DFDavy@lbl.gov Contact : aggarwal@genome.lbl.gov Focus : STS content mapping & sequencing of Human Chromosome 21 PI : Jasper Rine PI : Michael Palazzolo PI : Chris Martin PI : Jan-Fang Cheng Last_update : Sept. 1993 Database : VoxPop Species : Populus spp. Availability : contact curator Curator : Carl G. Riches PI : Reinhard F. Stettler Contact : cgr@poplar1.cfr.washington.edu Contact : STETTLER@coyote.cfr.washington.edu Last_update : Sept. 1993 Database : ? Species : Sorghum PI : Leland Ellis Last_update : Sept. 1993 Database : ? PI : Scott Chasalow Species : Potato Contact : Scottish Crop Institute, Dundee Last_update : Sept. 1993 Database : ? PI : George Murphy PI : David Flanders Species : Arabidopsis thaliana Contact : John Innes Center, Norwich, England Last_update : Sept. 1993 Database : ? Species : Homo sapiens Focus : Physical mapping of human chromosomes 22 and X Curator : Ian Dunham Contact : idunham@crc.ac.uk id1@sanger.ac.uk PI : Ian Dunham PI : David Bentley Last_update : 28 Sep 1993 [Curators: Please submit an entire paragraph in this format for inclusion or update. --bks] ---------------------------------------------------------------------- Q5: What written documentation exists for ACEDB? A5: The primary documents are included in the Software distribution in the wdoc subdirectory: acedb -- A C. elegans Database: I. Users' Guide. acedb -- A C. elegans Database: II. Installation Guide. acedb -- A C. elegans Database: III. Configuration Guide. Syntactic Definitions for the ACEDB Data Base Manager --Jean Thierry-Mieg and Richard Durbin (1991-) You will find other interesting documents in the wdoc subdirectory. By anonymous ftp from ncbi.nlm.nih.gov (130.14.20.1) in repository/acedb: doc.1_9.tar.Z Cherry, J.M., Cartinhour, S.W., and Goodman, H.M. (1992) AAtDB, An Arabidopsis thaliana Database. Plant Molecular Biology Reporter 10 (4): 308-309,409-410 Tutorial manual for AAtDB: Cartinhour, S., Cherry, J.M., and Goodman, H.M. (1992) An Introduction to ACeDB: For AAtDB, An Arabidopsis thaliana Database. Massachusetts General Hospital. (Available on request in printed form from the AAtDB curator). A description of ACEDB: Cherry, J.M. and Cartinhour, S.W. (1993) ACEDB, A tool for biological information. in Automated DNA Sequencing and Analysis, edited by M. Adams, C. Fields, and C. Venter. Academic Press (in press). [text is available through ftp or gopher from weeds.mgh.harvard.edu] Another description of ACEDB for physical mapping projects: Dunham, I., Durbin, R., Mieg, J-T & Bentley, D.R. (1993) Physical mapping projects and ACEDB, in Guide to Human Genome Computing. Ed. Bishop, M.J. (Academic Press) (review, in press). [text is available through ftp or gopher from weeds.mgh.harvard.edu] ---------------------------------------------------------------------- Q6: Where can I find further information about ACEDB? A6: There is a Usenet/Biosci conference titled bionet.software.acedb. If you do not have access to the Biosci conferences via a newsreader (e.g. rn, trn) you can participate in the conference by electronic mail. To subscribe to the e-mail version of the conference send email to biosci-server@net.bio.net (UK, European readers use biosci@uk.ac.daresbury or biosci.daresbury.ac.uk) with no subject line and only the message subscribe ACEDB-SOFT in the body. To unsubscribe send the message unsubscribe ACEDB-SOFT to the same address. This is an automated service. Your e-mail address will be taken from the header of the message that you send. If you then send mail to acedb@net.bio.net the mail will be distributed to all subscribers and to the electronic conference. Mike Cherry has set up an ACEDB Developer's archive. For anonymous ftp use the hostname weeds.mgh.harvard.edu and look in the acedb_dev directory. If you wish to contribute you can put files in the incoming directory. Send a message to Mike (cherry@genome.stanford.edu) that you have put something in that directory then Mike will move it out for general access. For gopher you can connect to weeds.mgh.harvard.edu (132.183.190.21) and ... --> N. FTP Archives for Molecular Biology/ then --> M. ACEDB Developer's archive/ [N and M are integers which are subject to change.] The bionet.software. acedb.conference is archived and can be searched using WAIS. Here is a Gopher-style link to the WAIS archive. (This is also courtesy of Mike Cherry.): # Type=7 Name=ACEDB BioSci Electronic Conference Path=7/.index/acedb-biosci Host=genome-gopher.stanford.edu Port=70 The AAtDB, Soybase, GrainGenes, Mace, and TreeGenes (see Q4) databases regularly submit data to the Plant Genome Database at the National Agricultural Library (NAL). Nal makes this data available via the WWW using an http server with URL: http://probe.nalusda.gov:8000/index.html You will also find a selection of models.wrm files (schemata) for the various databases here. You will want to get a "mosaic client" to examine this. Other URL's that readers with mosaic clients might want to examine are: http://moulon.inra.fr/acedb/acedb.html for C. elegans data http://moulon.inra.fr/acedb/mycdb.html for Mycobacterium data http://mouIon.inra.fr:8001/acedb/igd.html for an integrated genome database. For information on how these were created see http://moulon.inra.fr/acedb_conf_eng.html" http://moulon.inra.fr/acedb_conf.html (en francais) The Genome Computing Group, Lawrence Berkeley Laboratory has an anonymous ftp service at machine genome.lbl.gov (131.243.224.80) which contains: flydb - LBL's Drosophila Acedb-style database 21bdb - LBL's Human Chromosome 21 Acedb-style database querdb - LBL's query-language extensions to Acedb metadata - LBL's compendium of Acedb database schema variants macace-aatdb-demo.hqx - pre-release Acedb MacIntosh version There is also a repository of contributed software for data conversions and the like. Computer staff for the UC Berkeley Drosophila physical mapping project the LBL Human Chromosome 21 project, and the LBL plant genome projects meet regularly to coordinate their ACEDB extension and development efforts, along with Frank Eeckman, who is working on the Macintosh version of ACEDB (for further information, contact jlmccarthy@lbl.gov). They also keep in close touch (via email, personal visits, etc.) with their counterparts in Cambridge (Richard Durbin et al), Montpellier Jean Thierry-Mieg et al), and the Interated Genome Database project in Heidelburg (Otto Ritter, Detlef Wolf et al). ---------------------------------------------------------------------- Q7: How should ACEDB be cited? A7: From the distribution: We realize that we have not yet published any "real" paper on ACEDB. We consider however that anonymous ftp servers are a form of publication. We would appreciate if users of ACEDB could quote: Richard Durbin and Jean Thierry Mieg (1991-). A C. elegans Database. Documentation, code and data available from anonymous FTP servers at lirmm.lirmm.fr, cele.mrc-lmb.cam.ac.uk and ncbi.nlm.nih.gov. Papers involved in database development could quote more precisely: I. Users' Guide. Included as part of the ACEDB distribution kit, II. Installation Guide. Included as part of the ACEDB distribution III. Configuration Guide. Included as part of the ACEDB distribution and the preprintkit, available by Anonymous FTP from ... Jean Thierry-Mieg and Richard Durbin (1992). Syntactic Definitions for the ACEDB Data Base Manager. Included as part of the ACEDB distribution. --Jean and Richard. ---------------------------------------------------------------------- Q8: Is ACEDB object-oriented? A8: From the ACEDB User's Guide. A major current vogue in computer languages and database design is for ``object-oriented'' systems. It's also a source of lots of argument. We are just trying to build a good system, and don't want to get caught in the crossfire, but we do talk about organising our data into objects and classes. We have undoubtedly been influenced by many of the ideas going around, but it isn't likely our system would be regarded as kosher by the object- oriented community. In particular there is no class hierarchy, nor inheritance, and it is written in a modular but non-ideological way in straight C. However display and disk storage methods are class dependent. In some ways the class hierarchy is replaced by our system of models and trees, which seems to be rather unusual. We think it is very natural for the representation of biological information, where for some members of a class a lot might be known about some aspect, but for most only a little is known. The advantages of our sytem over a relational database, such as Oracle or Sybase, is our ability to refine our descriptions without rebuilding the database and the possibility of organising the storage of data on disk according to their class, i.e. we store in a very different way the tree-objects and the long stretches of DNA sequence. ---------------------------------------------------------------------- Q9: What's all this about Gopher/WAIS/Anonymous ftp/WWW ... A9: These terms all refer to Internet protocols. An excellent introduction to the Internet is: _The Whole Internet User's Guide & Catalog_, by Ed Krol, O'Reilly & Associates, 1992. Or ask your system administrator to provide you with a gopher client or mosaic client and begin navigating on your own. ---------------------------------------------------------------------- Q10: How can I get on the ACEDB announcements mailing list? A10: To get on or off the mailing list send mail to rd@mrc-lmb.cam.ac.uk or mieg@kaa.cnrs-mop.fr. New releases of the software are announced to this list. ---------------------------------------------------------------------- Q11: When and where is the Next ACEDB Workshop? Q11: From Jean Thierry-Mieg: DATES: The acedb '94 workshop will be held july 2 to 16, in Saint Matthieu de Treviers, a small village, 20 km north of Montpellier, at the foot of the Pic Saint Loup. HOUSING: We have booked a place meant for family vacations which includes ample space, a nice conference room and ten studios meant for 5 people (bathroom, shower, kitchenette, terrace, all nice and clean) that we plan to share among 3 to 4 participants. Meals will be taken at a local restaurant. The place is ideal for work and informal discussions and will be well equiped with computers. The situation is nice for hiking and allows volley-ball, ping-pong, tennis and petanque. We can provide lists of possible hotels for those who would prefer more privacy or find ways of accomodating families if you let us know very soon (school ends early july in France). Cost for 2 weeks is 1000 FF (about 200 US dollars) for housing on site plus 2500 FF for full meals. We may get enough funding to reduce this cost, but cannot pay for travel. PROGRAM: Formal presentations and general discussions will take place in the mornings and the evenings, alternating network aspects, data handling, displays and genome data analaysis. The afternoons will be dedicated to data manipulation, programming and writing documentation. The idea is to actually implement during the meeting many of the ideas that will come up, to fuse and coallesce the now numerous acedb-based applications into a working modular package, and to import and consolidate large sets of additional data. Towards this goal, we will broadcast the following announcement ACEDB'94 Genome Database Workshop. Montpellier, July 2-16, 1994 This meeting will cover the use and development of the ACEDB database manager central to several major genome projects, including C.elegans, A.thaliana, human, and a number of other plant and animal species. We wish to encourage people with large sets of data on other organisms to attend this workshop. They will be helped to build, during the meeting, a friendly graphic presentation of their own data, in return for discussing their own experience. ******************************************************************* FORMAT: This meeting will be much longer than the 2 previous acedb workshops (Cambridge 92 and Boston 93), in the hope of initiating new collaborations and allowing concrete results. This format is usual in physics summer schools and often very productive. The workshop may be coupled to a 2 days presentation of acedb, open to the general audience, and yet to be organised. We anticipate at least the participation of people from: Berkeley, Boston, Cambridge, Heidelberg and Montpellier, including Richard Durbin (LMB and Sanger Centre, Cambridge), John McCarthy (LBL, Berkeley), Otto Ritter (DKFZ, Heidelberg), Danielle and Jean Thierry-Mieg (CNRS, Montpellier). Please confirm your participation and forward this announcement to your colleagues. Danielle and Jean Thierry-Mieg CNRS-CRBM BP 5051, 34033 Montpellier, France. email mieg@kaa.cnrs-mop.fr (if this address fails, fall back on mieg@ncbi.nlm.nih.gov) Tel: (33) 67 61 33 24 Fax: (33) 67 52 15 59 ---------------------------------------------------------------------- Q411:Who contributed to this document? [Note to international readers: 411 is the phone number for information in the USA. --bks] A411: Major contributions in getting this FAQ off the ground were made by John McCarthy and Mike Cherry. Other contributors include: Lisa Lorenzen David Matthews Edie Paul Donn Davy Eric De Mund Sam Cartinhour To add or modify information in this document, please send mail to: acedbfaq@s27w007.pswfs.gov Bradley K. Sherman Dendrome Project Institute of Forest Genetics P.O. Box 245, Berkeley, CA, 94701 Phone: 510-559-6437 Fax: 510-559-6440 The Dendrome Project and TreeGenes are funded by the USDA-ARS Plant Genome Database Project. ---------------------End of file acedb-faq---------------------------- From owner-acedb@net.bio.net Tue Feb 08 22:00:00 1994 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!agate!overload.lbl.gov!bks From: bks@s27w007.pswfs.gov (Bradley K. Sherman) Newsgroups: bionet.software.acedb Subject: Re: ACEDB Genome Database Software FAQ Date: 9 Feb 1994 21:36:40 GMT Organization: Dendrome, A Genome Database for Forest Trees Lines: 17 Message-ID: <2jbl18$om3@overload.lbl.gov> References: <2jb793$k8t@overload.lbl.gov> NNTP-Posting-Host: s27w007.pswfs.gov Curators of ACEDB databases who also offer gopher, http or other Internet services might want to reformulate their paragraphs in the ACEDB FAQ to include URL's. This will help me to construct the HTML version of the FAQ. URL's are Universal Resource Locators and are a component of the World-Wide Web project. --bks -- Bradley K. Sherman P.O. Box 245 Computer Scientist Berkeley, CA, 94701 Dendrome Project 510-559-6437 FAX: 510-559-6440 Institute of Forest Genetics Internet: bks@s27w007.pswfs.gov From owner-acedb@net.bio.net Tue Feb 08 22:00:00 1994 Path: biosci!bcm!news.tamu.edu!128.194.15.2!leland From: leland@straylight.tamu.edu (Leland Ellis) Newsgroups: bionet.software.acedb Subject: WWW-AAnDB and WWW-ABtDB Date: 09 Feb 1994 19:05:56 GMT Organization: W.M. Keck Center for Genome Informatics, Institute of Biosciences and Technology, Texas A&M University, Houston Lines: 86 Distribution: world Message-ID: NNTP-Posting-Host: straylight.tamu.edu WWW-AAnDB and WWW-ABtDB WWW-ACeDB Servers for Aspergillus and Cows available on the WWW Server of the W.M. Keck Center for Genome Informatics at the Institute Biosciences and Technology Texas A&M University Houston URL: http://keck.tamu.edu/ibt.html WWW-AAnDB-1.0 is an experimental WWW interface to the data contained in AAnDB-1.0 (implemented in ACeDB-3.0, the latest version of Richard Durbin and Jean Thierry-Mieg's ACeDB) and is a prototype for a database with datatypes useful in the study of Aspergillus nidulans (and potentially other filamentous fungi). It utilizes the elegant ACeDB Server software (nph-acedb3) developed by Guy Decoux at (decoux@moulon.inra.fr). AAnDB-1.0 is a collaboration of Keck-IBT and Tom Adams (Department of Biology, Texas A&M University) and Greg May (Department of Cell Biology, Baylor College of Medicine). WWW-ABtDB-1.0 is an experimental WWW interface to the data contained in ABtDB-1.0, and is also implemented in ACeDB-3.0 and nph-acedb3. It also contains data for human homologs of bovine loci, with links between species. The data models provided in the Human Chromosome 21 ACeDB-3.0 by Otter Ritter and co. were a very useful starting point to use for both new bovine Tags, as well as the addition of homolog functionality. ABtDB-1.0 is a collaboration of Keck- IBT and Jim Womack (College of Veterinary Medicine, Texas A&M University). Both of these WWW-ACeDB servers are accessible via the WWW Server of Keck-IBT. This URL http://keck.tamu.edu/ibt.html will take you to the Keck-IBT HomePage -- clicking on the Keck-IBT logo takes you to our 1st page of information. The link What's New on the Keck-IBT WWW Server leads to an ever-changing page which serves as a running dialog of our experimentation with this interface, and has links to both WWW-AAnDB-1.0 and WWW-AAnDB-1.0, as well as to further information and references about what is in the databases. Also, Jeff Kirk (jkirk@keck.tamu.edu) has put together a Tutorial on how these Servers were set up, with pointers to where the components can be found. Both WWW servers should be regarded as experimental prototypes -- they do work, and we find them useful, but the data models are being experimented with daily, and new data is always being added. Finally, neither db is anywhere near comprehensive in the data included, but is illustrative of the datatypes that we routinely use in the study of these organisms. Any feedback is very welcome at: leland@straylight.tamu.edu or jkirk@keck.tamu.edu Leland Ellis, Ph.D. Professor of Biochemistry and Biophysics Director, W.M. Keck Center for Genome Informatics Institute of Biosciences and Technology Texas A&M University 2121 Holcombe Houston, Texas 77030 email: leland@straylight.tamu.edu URL: http://keck.tamu.edu/ibt.html -- Leland Ellis, Ph.D. Professor of Biochemistry and Biophysics Director, W.M. Keck Center for Genome Informatics Institute of Biosciences and Technology Texas A&M University 2121 Holcombe Houston, Texas 77030 email: leland@straylight.tamu.edu URL: http://keck.tamu.edu/ibt.html From owner-acedb@net.bio.net Tue Feb 08 22:00:00 1994 Path: biosci!daresbury!not-for-mail From: rd@mrc-lmb.cam.ac.uk (Richard Durbin) Newsgroups: bionet.software.acedb Subject: ACEDB update 2-9 data for C. elegans Date: 9 Feb 1994 18:51:56 -0000 Lines: 157 Sender: daemon@mserv1.dl.ac.uk Distribution: bionet Message-ID: <2jbbcc$4rh@mserv1.dl.ac.uk> Original-To: acedb@dl.ac.uk This is a broadcast message to the ACEDB mailing list. If you do not want to be on the list, please send email to rd@mrc-lmb.cam.ac.uk. ACEDB data update 2.9 ===================== There is available a new data update for the C. elegans database. This does not affect version 3 of ACEDB, which is designed for human and other organism data. We plan to have an incremental data update every month, with code updates every three months. The quarterly updates may also contain more complete data, e.g. the genetic map locations have not been updated in this version, although there is more mapping data. We tentatively plan a map revision for the March release. We also have not updated the file of matching proteins (proteins.2-8.tar.Z). ******************************************************************** IMPORTANT: you must get a new copy of INSTALL as well as the update. ******************************************************************** The main items in this data release are: Physical map 18/1/94 C. elegans DNA sequences in EMBL release 36 Mapping data sent to cgc@mrc-lmb.cam.ac.uk Latest CGC strain and subscriber listings and bibliography Abstracts and keywords for many papers 27 cosmid sequences from the genomic sequencing project General edits and fixes (e.g. yk* clones are now on the pmap) Cell lineage and fates Neural wiring data The last two items are entirely new. The cell lineage data is currently preliminary. What we have comes from combining files from Barney Hilken and Thomas Burglin (thank you Thomas). Currently we have division times for embryonic divisions, but not postembryonic ones. Does anybody have these? There is no tool to draw the lineage, but we are thinking about it. The neural wiring data come from two ring reconstructions (the JSH and N2U series of White, Southgate, Thomson and Brenner, 1986). For each cell, there is a list the number of synapses of each type to each target in each reconstruction. Types Send, Send_joint, Receive, Receive_joint refer to chemical synapses; the "_joint" variants indicate that more than one potential post-synaptic partner was present at the synapse (see White et al. for further explanation). The other type, "Gap_junction" refers to a potential direct electrical junction. I have a memory that the Send and Receive numbers don't exactly crosscheck - I haven't checked recently. Remember that you can search all the abstracts (CGC, Worm Meeting and now for many papers) using the "Long Search" button. Code ==== There is no new code release. You should use your existing version of the binary (2_0). ****** IMPORTANT ****** There is a bug in version 2_0 of the code that causes the program to crash ("bus error" or "segmentation violation") in some versions of the binary (particularly sparc) at the very end of reading the updates. This does not lose any data. It does remove the precalculation of the genetic and physical maps, which should speed up their display. You can do this precalculation by hand as follows: After adding the update, as the administrator (the person who installed ACEDB) Select "Write Access" from the main menu Select "Align Maps" from the main menu Press the "Make pMaps" button to make the physical maps Press the "Make gMaps" button to make the genetic maps Select "Save" from the main menu. Solaris versions ================ There are two Solaris versions, one for people with more recent Solaris releases that contain the X11R5 libraries (bin.solaris.2_0.tar.Z) and one for older releases with the X11R4 libraries (bin.solaris.2_0A.tar.Z). Macintosh version ================= There is now a tested Macintosh version. You need a Macintosh with 16Mb of memory and a decent monitor. You also need some way of obtaining the files from an ftp site (e.g. NCSA telnet, Versaterm Pro...) and Stuffit Deluxe, which I am told costs $65 in the USA, and is useful anyway for compressing/decompressing files. It turns out that Stuffit Deluxe can decompress Unix .tar.Z archive files. Frank Eeckman has now made available a .tar.Z archive of a complete C. elegans ACEDB database, with updates already read in. Ftp to genome.lbl.gov, folder pub/macace, and follow the instructions in README. Thank you Frank. Instructions for obtaining updates/the whole thing ================================================== All the files are available in the following public access accounts (anonymous ftp sites) accessible over internet: ncbi.nlm.nih.gov (130.14.20.1) in the USA, in repository/acedb/ace2 cele.mrc-lmb.cam.ac.uk (131.11.84.1) in England, in pub/acedb/ace2 lirmm.lirmm.fr (193.49.104.10) in France, in directory genome/acedb/ace2 In each case, log in as user "anonymous" and give a user identifier as password. Remember to transfer the files in BINARY mode by typing the word "binary" at the start of your ftp session. Many thanks to NCBI for letting us share in their excellent resource. Example: ftp ncbi.nlm.nih.gov login: anonymous password 'your email address' cd repository/acedb/ace2 binary mget * get README y/n answer yes etc ... ... quit If installing for the first time -------------------------------- Get all the update tar.Z and read the files README and NOTES before proceeding further. If updating an existing system ------------------------------ Just get the last update.tar.Z file, plus INSTALL. Always get a copy of the INSTALL script. Move it and the .tar.Z files into the home directory in which you are installing ACEDB. Type "source INSTALL". If you have a problem making the program work, look at the section on problems in NOTES, and if that fails to help, let us know. ****************************************************************** Please send any comments, especially about anything you think is wrong (program or data), to Richard Durbin (rd@mrc-lmb.cam.ac.uk) program Mary O'Callaghan (moc@mrc-lmb.cam.ac.uk) data -------------------- end of message -------------------- From owner-acedb@net.bio.net Thu Feb 10 22:00:00 1994 Path: biosci!biosci!not-for-mail From: leland@straylight.tamu.edu (Leland Ellis) Newsgroups: bionet.mycology,bionet.software.acedb,bionet.announce,comp.infosystems.www Subject: WWW-AAnDB and WWW-ABtDB Date: 10 Feb 1994 16:06:31 -0800 Organization: W.M. Keck Center for Genome Informatics, Institute of Biosciences and Technology, Texas A&M University, Houston Lines: 86 Sender: kristoff@net.bio.net Approved: bionews-moderator@net.bio.net Distribution: world Message-ID: NNTP-Posting-Host: net.bio.net Xref: biosci bionet.mycology:322 bionet.software.acedb:158 bionet.announce:942 comp.infosystems.www:4817 WWW-AAnDB and WWW-ABtDB WWW-ACeDB Servers for Aspergillus and Cows available on the WWW Server of the W.M. Keck Center for Genome Informatics at the Institute Biosciences and Technology Texas A&M University Houston URL: http://keck.tamu.edu/ibt.html WWW-AAnDB-1.0 is an experimental WWW interface to the data contained in AAnDB-1.0 (implemented in ACeDB-3.0, the latest version of Richard Durbin and Jean Thierry-Mieg's ACeDB) and is a prototype for a database with datatypes useful in the study of Aspergillus nidulans (and potentially other filamentous fungi). It utilizes the elegant ACeDB Server software (nph-acedb3) developed by Guy Decoux at (decoux@moulon.inra.fr). AAnDB-1.0 is a collaboration of Keck-IBT and Tom Adams (Department of Biology, Texas A&M University) and Greg May (Department of Cell Biology, Baylor College of Medicine). WWW-ABtDB-1.0 is an experimental WWW interface to the data contained in ABtDB-1.0, and is also implemented in ACeDB-3.0 and nph-acedb3. It also contains data for human homologs of bovine loci, with links between species. The data models provided in the Human Chromosome 21 ACeDB-3.0 by Otter Ritter and co. were a very useful starting point to use for both new bovine Tags, as well as the addition of homolog functionality. ABtDB-1.0 is a collaboration of Keck- IBT and Jim Womack (College of Veterinary Medicine, Texas A&M University). Both of these WWW-ACeDB servers are accessible via the WWW Server of Keck-IBT. This URL http://keck.tamu.edu/ibt.html will take you to the Keck-IBT HomePage -- clicking on the Keck-IBT logo takes you to our 1st page of information. The link What's New on the Keck-IBT WWW Server leads to an ever-changing page which serves as a running dialog of our experimentation with this interface, and has links to both WWW-AAnDB-1.0 and WWW-AAnDB-1.0, as well as to further information and references about what is in the databases. Also, Jeff Kirk (jkirk@keck.tamu.edu) has put together a Tutorial on how these Servers were set up, with pointers to where the components can be found. Both WWW servers should be regarded as experimental prototypes -- they do work, and we find them useful, but the data models are being experimented with daily, and new data is always being added. Finally, neither db is anywhere near comprehensive in the data included, but is illustrative of the datatypes that we routinely use in the study of these organisms. Any feedback is very welcome at: leland@straylight.tamu.edu or jkirk@keck.tamu.edu Leland Ellis, Ph.D. Professor of Biochemistry and Biophysics Director, W.M. Keck Center for Genome Informatics Institute of Biosciences and Technology Texas A&M University 2121 Holcombe Houston, Texas 77030 email: leland@straylight.tamu.edu URL: http://keck.tamu.edu/ibt.html -- Leland Ellis, Ph.D. Professor of Biochemistry and Biophysics Director, W.M. Keck Center for Genome Informatics Institute of Biosciences and Technology Texas A&M University 2121 Holcombe Houston, Texas 77030 email: leland@straylight.tamu.edu URL: http://keck.tamu.edu/ibt.html From owner-acedb@net.bio.net Fri Feb 11 22:00:00 1994 Path: biosci!NET.BIO.NET!biosci-help From: biosci-help@NET.BIO.NET (BIOSCI Administrator) Newsgroups: bionet.software.acedb Subject: test of acedb@net.bio.net Date: 12 Feb 1994 02:18:09 -0000 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 2 Sender: daemon@net.bio.net Distribution: bionet Message-ID: Reply-To: biosci-help@net.bio.net NNTP-Posting-Host: net.bio.net test of acedb@net.bio.net From owner-acedb@net.bio.net Fri Feb 11 22:00:00 1994 Newsgroups: bionet.software.acedb Path: biosci!daresbury!doc.ic.ac.uk!uknet!pipex!uunet!altern!software From: software@altern.com (software) Subject: software Message-ID: <1994Feb11.184330.25118@altern.com> Organization: Altern B , Corp. X-Newsreader: Tin 1.1 PL5 Date: Fri, 11 Feb 1994 18:43:30 GMT Lines: 1 From owner-acedb@net.bio.net Mon Feb 14 22:00:00 1994 Newsgroups: bionet.software.acedb Path: biosci!parc!decwrl!ames!purdue!news.cs.indiana.edu!hh@pmantis.berkeley.edu From: nobody@pmantis.berkeley.edu Subject: (none) Message-ID: <9402151415.AA20733@pmantis.berkeley.edu> Sender: root@news.cs.indiana.edu (Operator) Organization: Computer Science, Indiana University Date: Tue, 15 Feb 1994 06:15:12 -0800 Remailed-By: Eric Hollander Lines: 88 :: subject: Introduction to Blacknet Introduction to BlackNet Your name has come to our attention. We have reason to believe you may be interested in the products and services our new organization, BlackNet, has to offer. BlackNet is in the business of buying, selling, trading, and otherwise dealing with *information* in all its many forms. We buy and sell information using public key cryptosystems with essentially perfect security for our customers. Unless you tell us who you are (please don't!) or inadvertently reveal information which provides clues, we have no way of identifying you, nor you us. Our location in physical space is unimportant. Our location in cyberspace is all that matters. Our primary address is the PGP key location: "BlackNet" and we can be contacted (preferably through a chain of anonymous remailers) by encrypting a message to our public key (contained below) and depositing this message in one of the several locations in cyberspace we monitor. Currently, we monitor the following location: the "Cypherpunks" mailing list (cypherpunks@toad.com). BlackNet is nominally nondideological, but considers nation-states, export laws, patent laws, national security considerations and the like to be relics of the pre-cyberspace era. Export and patent laws are often used to explicity project national power and imperialist, colonialist state fascism. BlackNet believes it is solely the responsibility of a secret holder to keep that secret--not the responsibilty of the State, or of us, or of anyone else who may come into possession of that secret. If a secret's worth having, it's worth protecting. BlackNet is currently building its information inventory. We are interested in information in the following areas, though any other juicy stuff is always welcome. "If you think it's valuable, offer it to us first." - trade secrets, processes, production methods (esp. in semiconductors) - nanotechnology and related techniques (esp. the Merkle sleeve bearing) - chemical manufacturing and rational drug design (esp. fullerines and protein folding) - new product plans, from children's toys to cruise missiles (anything on "3DO"?) - business intelligence, mergers, buyouts, rumors BlackNet can make anonymous deposits to the bank account of your choice, where local banking laws permit, can mail cash directly (you assume the risk of theft or seizure), or can credit you in "CryptoCredits," the internal currency of BlackNet (which you then might use to buy _other_ information and have it encrypted to your special public key and posted in public place). If you are interested, do NOT attempt to contact us directly (you'll be wasting your time), and do NOT post anything that contains your name, your e-mail address, etc. Rather, compose your message, encrypt it with the public key of BlackNet (included below), and use an anonymous remailer chain of one or more links to post this encrypted, anonymized message in one of the locations listed (more will be added later). Be sure to describe what you are selling, what value you think it has, your payment terms, and, of course, a special public key (NOT the one you use in your ordinary business, of course!) that we can use to get back in touch with you. Then watch the same public spaces for a reply. (With these remailers, local PGP encryption within the remailers, the use of special public keys, and the public postings of the encrypted messages, a secure, two-way, untraceable, and fully anonymous channel has been opened between the customer and BlackNet. This is the key to BlackNet.) A more complete tutorial on using BlackNet will soon appear, in plaintext form, in certain locations in cyberspace. Join us in this revolutionary--and profitable--venture. BlackNet -----BEGIN PGP PUBLIC KEY BLOCK----- Version: 2.2 mQA9Ai1bN6oAAAEBgM98haqmu+pqkoqkr95iMmBTNgb+iL54kUJCoBSOrT0Rqsmz KHcVaQ+p4vLIWlrRawAFEbQgQmxhY2tOZXQ8bm93aGVyZUBjeWJlcnNwYWNlLm5p bD4= =yOMI -----END PGP PUBLIC KEY BLOCK----- From owner-acedb@net.bio.net Tue Feb 15 22:00:00 1994 Path: biosci!mrc-lmb.cam.ac.uk!rd From: rd@mrc-lmb.cam.ac.uk (Richard Durbin) Newsgroups: bionet.software.acedb Subject: release announcements Date: 16 Feb 1994 17:38:59 -0000 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 7 Sender: daemon@net.bio.net Distribution: bionet Message-ID: <9402161730.AA17953@cele.mrc-lmb.cam.ac.uk> NNTP-Posting-Host: net.bio.net I strongly support Herzog's suggestion that all ACEDB derived database releases and updates should be announced on this newsgroup. I discovered that the newsgroup was not on the C. elegans release mailing list, so have just added it. Richard Durbin From owner-acedb@net.bio.net Tue Feb 15 22:00:00 1994 Path: biosci!daresbury!bioftp.unibas.ch!rc1.vub.ac.be!rc4!rherzog From: rherzog@rc1.vub.ac.be (Herzog Robert (DBM)) Newsgroups: bionet.software.acedb Subject: Getting aware of new AceDB files? Date: 16 Feb 1994 15:25:28 GMT Organization: Brussels Free Universities (VUB/ULB), Belgium Lines: 12 Message-ID: <2jtdt8$kj7@rc1.vub.ac.be> NNTP-Posting-Host: rc4.vub.ac.be X-Newsreader: TIN [version 1.2 PL2] Is there any possibility to systematically use this list to post announcement of available updates about ACeDB formatted biological databases? I find the software tremendous, but am a bit frustrated about not being aware of updated files that must be flourishing everywhere in the many fields where the AceDB kind of database has been implemented. Any comments ? Herzog EMBnet Belgium From owner-acedb@net.bio.net Wed Feb 16 22:00:00 1994 Newsgroups: bionet.software.acedb Path: biosci!daresbury!bioftp.unibas.ch!biox!doelz From: doelz@comp.bioz.unibas.ch (Reinhard Doelz) Subject: Suitable configuration for ACEDB/WCS? Message-ID: Organization: EMBnet Switzerland [Basel] Date: Thu, 17 Feb 1994 18:51:03 GMT Lines: 15 We have been asked what hardware is needed to run the ACEDB system and the WCS. In particular the latter, which prequisites are there in terms of OS, memory, disk usage? We have some workstations here running SGI's IRIX and DEC's Ultrix and OSF/1. Please mail me and I'll summarize if there is enough interest. Regards Reinhard Doelz EMBnet Switzerland -- +---------------------------+-------------------------------------------+ | Dr. Reinhard Doelz | Tel. x41 61 2672247 Fax x41 61 2672078 | | Biocomputing | electronic Mail doelz@urz.unibas.ch | |Biozentrum der Universitaet+-------------------------------------------+ From owner-acedb@net.bio.net Wed Feb 16 22:00:00 1994 Newsgroups: bionet.software.acedb Path: biosci!bcm!news.msfc.nasa.gov!sol.ctr.columbia.edu!news.kei.com!yeshua.marcam.com!zip.eecs.umich.edu!umn.edu!sunrayce.solar.umn.edu!roman From: roman@sunrayce.solar.umn.edu (username) Subject: OBJ ORIENTED PROG OOPS Message-ID: Sender: news@news.cis.umn.edu (Usenet News Administration) Nntp-Posting-Host: sunrayce.solar.umn.edu Organization: University of Minnesota, Twin Cities X-Newsreader: TIN [version 1.1 PL8] Date: Thu, 17 Feb 1994 16:12:09 GMT Lines: 9 We are working with genetic engineering companies customizing software for theire particular need. We anly do Object Oriented Methodologies usin C++ and Smalltalk.We are looking for more customers to develop custom software for them or we will considere joint ventures or good ideas. Winterfire software inc 244 w 7th st st paul mn 55102 tel 612 222 1734 fax 1625 roman herther... we have 6years of experience with oops..over 20 projects completed. we'd be happy to answer any questions without obligation on your part..thank you... From owner-acedb@net.bio.net Wed Feb 16 22:00:00 1994 Path: biosci!GENOME.STANFORD.EDU!cherry From: cherry@GENOME.STANFORD.EDU (Mike Cherry) Newsgroups: bionet.software.acedb Subject: Re: Suitable configuration for ACEDB/WCS? Date: 17 Feb 1994 23:13:03 -0000 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 17 Sender: daemon@net.bio.net Distribution: bionet Message-ID: <199402172313.PAA07453@stout.Stanford.EDU> References: NNTP-Posting-Host: net.bio.net > We have been asked what hardware is needed to run the ACEDB system > and the WCS. In particular the latter, which prequisites are there in > terms of OS, memory, disk usage? We have some workstations here running > SGI's IRIX and DEC's Ultrix and OSF/1. Please mail me and I'll summarize > if there is enough interest. I believe WCS is only available for SPARCs. They do not give out source. There has also not been an update for two years from the Arizona WCS group. However, I believe Bruce Schatz has now moved to the University of Illinois at least that is what I remember from the hype in Science from last August. The last e-mail address I had was wcs@cs.arizona.edu. I would like to learn if WCS is still alive. To answer your question for a SPARC we run wcs on a IPC with 24Mb RAM, and it requires 34Mb of disk space. Mike From owner-acedb@net.bio.net Thu Feb 17 22:00:00 1994 Path: biosci!BADLANDS.NODAK.EDU!jweiland From: jweiland@BADLANDS.NODAK.EDU (John J Weiland) Newsgroups: bionet.software.acedb Subject: Whereabouts of Colin M. Thacker Date: 18 Feb 1994 14:11:43 -0000 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 6 Sender: daemon@net.bio.net Distribution: bionet Message-ID: NNTP-Posting-Host: net.bio.net Does anyone know of the current address (Email or otherwise) of Colin M. Thacker? He was last heard of working in worms in British Columbia. Thanks! John Weiland jweiland@badlands.nodak.edu From owner-acedb@net.bio.net Mon Feb 21 22:00:00 1994 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!agate!dog.ee.lbl.gov!overload.lbl.gov!bks From: bks@s27w007.pswfs.gov (Bradley K. Sherman) Newsgroups: bionet.software.acedb Subject: Re: Getting aware of new AceDB files? Date: 22 Feb 1994 19:03:52 GMT Organization: Dendrome, A Genome Database for Forest Trees Lines: 48 Message-ID: <2kdkuo$24t@overload.lbl.gov> References: <2jtdt8$kj7@rc1.vub.ac.be> NNTP-Posting-Host: s27w007.pswfs.gov In article eddy@eddy.gen.cam.ac.uk (Edward Welbourne (Genetics)) writes: >This sounds like something that could go into the FAQ posting; it has a section >on the ACeDB `family' with an entry per database. If maintainers of databases >sent the FAQ maintainer a note to be included in their entry, just saying >Last major update to software: 1993/Nov/5 >Last major update to data: 1994/Feb/14 >possibly with an extra line for significant minor updates. This could go >with all the other info about the database, which would be a good place for it. > >Does that seem a good solution ? Exactly! Curators of ACEDB databases are encouraged to design their own paragraphs in the FAQ, and to send in updates. If you have a presence on the World-Wide Web be sure to include URL's. Updated FAQ's are posted to this conference around the second week of each month. Here is part of the introduction for the FAQ, which tells you how to get a copy: [...] This document will be posted monthly to the BIOSCI newsgroup bionet.software.acedb and to USENET conference news.answers. It is intended to be used as an index to ACEDB databases and to information about the database software. The latest version of the ACEDB FAQ should be available via anonymous ftp at machine net.bio.net (134.172.2.69) as file pub/BIOSCI/ACEDB/ACEDB.FAQ or at rtfm.mit.edu (18.70.0.209) as pub/usenet.news.answers/acedb-faq. Answer 3 demonstrates a sample FTP session. If you only have electronic mail, the FAQ can be retrieved from mail-server@rtfm.mit.edu. There is an HyperText Markup Language (HTML) version of this document available on the World Wide Web: http://probe.nalusda.gov:8000/plant/acedbfaq.html [...] --bks -- Bradley K. Sherman P.O. Box 245 Computer Scientist Berkeley, CA, 94701 Dendrome Project 510-559-6437 FAX: 510-559-6440 Institute of Forest Genetics Internet: bks@s27w007.pswfs.gov From owner-acedb@net.bio.net Mon Feb 21 22:00:00 1994 Newsgroups: bionet.software.acedb Path: biosci!s.u-tokyo!news.tisn.ad.jp!news.u-tokyo.ac.jp!sinetnews!daffy!uwvax!uwm.edu!vixen.cso.uiuc.edu!howland.reston.ans.net!pipex!warwick!lyra.csx.cam.ac.uk!pavo.csi.cam.ac.uk!nntp-serv.cam.ac.uk!eddy From: eddy@eddy.gen.cam.ac.uk (Edward Welbourne (Genetics)) Subject: Re: Getting aware of new AceDB files? In-Reply-To: rherzog@rc1.vub.ac.be's message of 16 Feb 1994 15:25:28 GMT Message-ID: Sender: news@infodev.cam.ac.uk (USENET news) Nntp-Posting-Host: eddy.gen.cam.ac.uk Organization: U of Cambridge, England References: <2jtdt8$kj7@rc1.vub.ac.be> Date: Tue, 22 Feb 1994 15:25:11 GMT Lines: 21 In article <2jtdt8$kj7@rc1.vub.ac.be> rherzog@rc1.vub.ac.be (Herzog Robert (DBM)) writes: > Is there any possibility to systematically use this list to post announcement > of available updates about ACeDB formatted biological databases? This sounds like something that could go into the FAQ posting; it has a section on the ACeDB `family' with an entry per database. If maintainers of databases sent the FAQ maintainer a note to be included in their entry, just saying Last major update to software: 1993/Nov/5 Last major update to data: 1994/Feb/14 possibly with an extra line for significant minor updates. This could go with all the other info about the database, which would be a good place for it. Does that seem a good solution ? Eddy. -- ... Few indeed are those who, travelling it, have crossed the dark and yawning Abyss of Implementation to Delivery. Many, yea, many in truth stagnate yet in the Desert of Delay, or linger ever in the ghastly limbo called Perpetual Beta. (from the LOGINATAKA) From owner-acedb@net.bio.net Tue Feb 22 22:00:00 1994 Newsgroups: bionet.software.acedb Path: biosci!daresbury!doc.ic.ac.uk!uknet!pipex!howland.reston.ans.net!sol.ctr.columbia.edu!news.kei.com!newsstand.cit.cornell.edu!cornell!uw-beaver!netnews.nwnet.net!ns1.nodak.edu!plains!mcclean From: mcclean@plains.NoDak.edu (Phillip McClean) Subject: Otto Ritter E-mail address Sender: usenet@ns1.nodak.edu (Usenet login) Message-ID: Date: Tue, 22 Feb 1994 22:31:48 GMT Nntp-Posting-Host: plains.nodak.edu Organization: North Dakota Higher Education Computing Network X-Newsreader: TIN [version 1.2 PL2] Lines: 6 I would like to contact Otto Ritter. The e-mail address that I have is o.ritter@dkfz-heidelberg.de but it bounces back. Does anyone have Otto's current address Phil McClean mcclean@plains.nodak.edu From owner-acedb@net.bio.net Tue Feb 22 22:00:00 1994 Newsgroups: bionet.software.acedb Path: biosci!daresbury!doc.ic.ac.uk!agate!howland.reston.ans.net!sol.ctr.columbia.edu!news.kei.com!newsstand.cit.cornell.edu!cornell!uw-beaver!netnews.nwnet.net!ns1.nodak.edu!plains!mcclean From: mcclean@plains.NoDak.edu (Phillip McClean) Subject: Graphical Pedigrees for ACeDB Sender: usenet@ns1.nodak.edu (Usenet login) Message-ID: Date: Tue, 22 Feb 1994 22:12:55 GMT Nntp-Posting-Host: plains.nodak.edu Organization: North Dakota Higher Education Computing Network X-Newsreader: TIN [version 1.2 PL2] Lines: 8 Is anyone working on code for ACeDB that will permit the graphical display of a given pedigree? I have a graduate student who might be interested in such a project, but we do not want to duplicate any existing efforts. Contact me by e-mail or post here. Either will work fine. Phil McClean mcclean@plains.nodak.edu From owner-acedb@net.bio.net Wed Feb 23 22:00:00 1994 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!agate!overload.lbl.gov!bks From: bks@s27w007.pswfs.gov (Bradley K. Sherman) Newsgroups: bionet.software.acedb Subject: ACEDB on NeXT? Date: 24 Feb 1994 22:25:38 GMT Organization: Dendrome, A Genome Database for Forest Trees Lines: 10 Distribution: world Message-ID: <2kj9h2$ok@overload.lbl.gov> NNTP-Posting-Host: s27w007.pswfs.gov Anyone out there actively porting ACEDB to NeXT machines? --bks -- Bradley K. Sherman P.O. Box 245 Computer Scientist Berkeley, CA, 94701 Dendrome Project 510-559-6437 FAX: 510-559-6440 Institute of Forest Genetics Internet: bks@s27w007.pswfs.gov From owner-acedb@net.bio.net Wed Feb 23 22:00:00 1994 Path: biosci!daresbury!not-for-mail From: semerz@lmcp.jussieu.fr (Michel Semertzidis) Newsgroups: bionet.software.acedb Subject: OMEGA_2 data bank announcement Date: 24 Feb 1994 10:13:39 -0000 Lines: 78 Sender: daemon@mserv1.dl.ac.uk Distribution: bionet Message-ID: <2khukj$hvg@mserv1.dl.ac.uk> Original-To: acedb@dl.ac.uk, bio-info@dl.ac.uk, bio-soft@dl.ac.uk, bionews@dl.ac.uk OMEGA_2 data bank for Mac is now at the genome.inserm-vjf.fr (192.134.32.20) /pub/OMEGA. Log in as `anonymous' and enter your email address as your password. OMEGA_2 data bank is a compilation of recent structural information on proteins. OMEGA_2 data bank was compiled by Michel T. SEMERTZIDIS*, Sylvia DEPLANQUE and Jean-Paul MORNON Département des Macromolécules Biologiques, Laboratoire de Minéralogie - Cristallographie, Université Pierre et Marie Curie (Paris 6) et Denis Diderot (Paris 7), CNRS URA 09, Tour 16, 4 place Jussieu, CASE 115, F-75252 Paris Cedex 05, FRANCE E-mail: "semerz@lmcp.jussieu.fr" *To whom correspondence should be addressed Suggested citations for use of this data bank are: Michel T. SEMERTZIDIS, Sylvia DEPLANQUE and Jean-Paul MORNON (1993) "OMEGA: A 3D Databank for Protein Structures (a complement to PDB)", CABIOS 9, 667-670. RELEASE 1: JUNE, 1993: 401 proteins. RELEASE 2: JANUARY, 1994: 537 proteins. ABSTRACT OMEGA is a compilation of recent structural information on proteins derived from X-ray crystallography or NMR and published in journals referenced by Current Contents. To date, 401 entries have been included ( 334 X-ray, 28 NMR, 5 NMR + X-ray, 5 electron microscopy, 3 neutron scattering, 2 neutron diffraction, 1 electron microscopy + X-ray, 12 model, 11 miscellaneous ), with 5-10 new proteins being added each week. OMEGA can be accessed on Macintosh and is interrogated through 32 key words (space group, resolution, secondary structure, number of residues, etc). This pool of proteins could be used for various purposes, including searches for proteins with a particular set of secondary structures. OMEGA will be continuously updated (every 6 months) and may later include all proteins already reported in the PDB, as well as structures reported in journals with smaller readerships. We would greatly appreciate any ideas for improving future releases. We also apologize in advance for any errors or omissions that may appear in the database, and would be grateful to be informed of any errors. We also welcome submission for entry in OMEGA of any new publication related to the determination of a protein structure, as well as the citing of this paper as a reference for the OMEGA databank. We would appreciate receiving reprints of publications making use of OMEGA. ACKNOWLEDGEMENTS: This work was supported by the Universités Paris 6 and Paris 7, CNRS, INSERM (contrats 889009 et 910912), and Fondation pour la Recherche Médicale. M.T.S. has a Ph.D. grant from the French government (MRE). !!! The first time you will use omega it will take some time for special 4D decompression !!! TTGATTGCTAAACACTGGGCGGCGAATCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG MICHEL T. SEMERTZIDIS Internet: SEMERZ@LMCP.JUSSIEU.FR University of Paris 6 Bitnet: CNRS URA 09, CASE 115 Phone: Tour 16, 4 place Jussieu, Fax: 75252 Paris Cedex 05, System managers do it with PRIVILEGES! F R A N C E DISCLAIMER:As always,I speak only for myself,and,usually,only to myself. LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu From owner-acedb@net.bio.net Wed Feb 23 22:00:00 1994 Path: biosci!bcm!cs.utexas.edu!not-for-mail From: martin@bsm.biochemistry.ucl.ac.uk (Andrew Martin) Newsgroups: bionet.software.acedb Subject: Re: Otto Ritter E-mail address Date: 23 Feb 1994 18:11:57 -0600 Organization: Bloomsbury Computing Consortium Lines: 23 Sender: daemon@cs.utexas.edu Message-ID: <1994Feb23.092858.48750@ucl.ac.uk> References: NNTP-Posting-Host: cs.utexas.edu In article , mcclean@plains.NoDak.edu (Phillip McClean) writes: |> I would like to contact Otto Ritter. The e-mail address that I have is |> o.ritter@dkfz-heidelberg.de but it bounces back. Does anyone have Otto's |> current address |> |> Phil McClean |> mcclean@plains.nodak.edu Otto's address is: dok261@cvx12.dkfz-heidelberg.de o.ritter may well work as an alias for dok261. Andrew -- **************************************************************************** Dr. Andrew C.R. Martin, University College London & SciTech Software INTERNET: martin@bsm.bioc.ucl.ac.uk -OR- amartin@scitec.adsp.sub.org JANET: martin@uk.ac.ucl.bioc.bsm UUCP: {uunet|rutgers}!cbmehq!cbmuk!scitec!amartin ****************************************************************************