From owner-acedb@net.bio.net Wed Nov 01 22:00:00 1995 Path: biosci!GREENGENES.CIT.CORNELL.EDU!matthews From: matthews@GREENGENES.CIT.CORNELL.EDU ("Dave Matthews") Newsgroups: bionet.software.acedb Subject: Re: Image storage and overlays with ACEDB Date: 2 Nov 1995 10:14:38 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 38 Sender: daemon@net.bio.net Distribution: world Message-ID: <9511021813.AA06268@greengenes.cit.cornell.edu> > 2. When we specify the image file name with the Pick_me_to_call > (or other) tag, it makes sense to just have the file name rather > than hard-coding the full path name. Is there somewhere we can specify > the pathname for images (e.g., an environment variable) or do we have > to simply be careful of the directory from which the ACEDB session in > invoked? Hi John, Richard answered your question #2 a little while ago: : To: acedb@net.bio.net : From: : Subject: Pick_me_to_call in 4_1 : Date: 31 Aug 1995 19:23:26 +0100 : : There has been some discussion about where Pick_me_to_call looks for : files. In the 4-8 worm distribution we used Pick_me_to_call for JPEG : pictures. Instead of making the second argument "xv" directly, we set : it to be the name a script in wscripts/, "display_script", which : explicitly specifies the directory in which to look: : : xv $ACEDB/pictures/$1 & : : This is preferable to changing directory in the script with which you : invoke acedb, because it is nice to be in your own directory for : writing out files. It also allows people to change the way xv is : invoked, e.g. set options, or change to another image viewer, without : editing the database. : : Richard Apparently Pick_me_to_call now executes the first tag-value, passing it the second tag-value as $1, along with the current environment. $ACEDB/wscripts is placed at the front of the process's $path. This is a lot more flexible than the old behavior. Maybe it will help with question 1. - Dave From owner-acedb@net.bio.net Wed Nov 01 22:00:00 1995 Path: biosci!MH1.LBL.GOV!mccarthy From: mccarthy@MH1.LBL.GOV (John L. McCarthy) Newsgroups: bionet.software.acedb Subject: Image storage and overlays with ACEDB Date: 2 Nov 1995 09:08:48 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 26 Sender: daemon@net.bio.net Distribution: world Message-ID: <199511021707.JAA04254@mh1.lbl.gov> Reply-To: JLMcCarthy@lbl.gov NNTP-Posting-Host: net.bio.net We are going to be storing gel images from SSR screening and mapping experiments for the Amtex Cotton Biotechnology project. We want to be able to access them from our ACEDB lab notebook database. 1. Is Pick_me_to_call still the current working technology? I recall some discussion of more general mechanisms, including the ability to have separate "overlay" layered images, but I wasn't sure whether anyone is doing that in a production setting as yet. 2. When we specify the image file name with the Pick_me_to_call (or other) tag, it makes sense to just have the file name rather than hard-coding the full path name. Is there somewhere we can specify the pathname for images (e.g., an environment variable) or do we have to simply be careful of the directory from which the ACEDB session in invoked? Any other suggestions re image handling also would be appreciated. -John McCarthy +=====================================================================+ | John L. McCarthy. . | Internet:..JLMcCarthy@lbl.gov | | Computer Science R&D MS 50B-3238 | Bitnet: ...JLMCCARTHY@LBL | | Lawrence Berkeley Laboratory .| telephone: (510) 486-5307 | | 1 Cyclotron Road . | | | BERKELEY, CA 94720-9000, U.S.A. | FAX: (510) 486-4004 | +=====================================================================+ From owner-acedb@net.bio.net Wed Nov 01 22:00:00 1995 Path: biosci!GREENGENES.CIT.CORNELL.EDU!matthews From: matthews@GREENGENES.CIT.CORNELL.EDU ("Dave Matthews") Newsgroups: bionet.software.acedb Subject: extra, empty tags in acedumps Date: 2 Nov 1995 13:58:33 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 46 Sender: daemon@net.bio.net Distribution: world Message-ID: <9511022157.AA06803@greengenes.cit.cornell.edu> NNTP-Posting-Host: net.bio.net I'm seeing some unwanted extra stuff in my acedumps, apparently related to the timestamping. For example, the empty tags Authority and Data_source in this record: // data dumped from tree display Probe : "AC1" Locus "Xcnl1-7B" General_remark "Repeat sequences (TG)18" General_remark "Product size 157 in Geneva PI505819" PCR PCR_primers "GCTGTAAACTCCATTGTTTGG" PCR_primers "CACAAATCGGCGAAAAC" Amplification_conditions "Annealing temperature 52 C, 2.50 mM MgCl2" Wheat_polymorphism "5 alleles \/ 18 germplasm lines" Authority "Blake, Tom" Authority Authority "Sorrells, Mark E." Data_source "Blake, Tom" "95.08.24" Data_source Data_source "Sorrells, Mark E." "95.09.13" These are also present when the dump is made from tace. No empty tags are seen when the object is viewed with xace. Tace shows this: Probe : "AC1" <1995-09-22_10:58:33_> Locus Xcnl1-7B General_remark Repeat sequences (TG)18 Product size 157 in Geneva PI505819 Type PCR <1995-09-21_16:07:19_> PCR_primers GCTGTAAACTCCATTGTTTGG CACAAATCGGCGAAAAC <1995-09-22_10:58:33_> Amplification_conditions Annealing temperature 52 C, 2.50 mM MgCl2 Wheat_polymorphism 5 alleles / 18 germplasm lines <1995-09-21_16:07:19_> Clone Authority Blake, Tom <1995-09-22_10:58:33_> Sorrells, Mark E. Data_source Blake, Tom 95.08.24 <1995-09-22_10:58:33_> Sorrells, Mark E. 95.09.13 - Dave From owner-acedb@net.bio.net Mon Nov 13 22:00:00 1995 Path: biosci!biosci!not-for-mail From: staffan@biochem.kth.se (Staffan Bergh) Newsgroups: bionet.announce,bionet.general,bionet.microbiology,sci.med,bionet.software.acedb Subject: MycDB release 4-9 Followup-To: bionet.general Date: 13 Nov 1995 22:03:48 -0800 Organization: Biochemistry, KTH, Stockholm Lines: 119 Sender: biohelp@net.bio.net Approved: bionews-moderator@net.bio.net Distribution: world Message-ID: <487039$if7@sibirien.physchem.kth.se> NNTP-Posting-Host: net.bio.net Summary: Release 4-9 of the integrated mycobacterial database MycDB now available Keywords: MycDB, mycobacteria, ACEDB Xref: biosci bionet.announce:2624 bionet.general:18444 bionet.microbiology:3938 sci.med:100189 bionet.software.acedb:771 [Repost - I tried posting this 2 weeks ago but as I haven't seen it in the news since I assume something went wrong] MycDB 4-9 ========= Stockholm & Paris November 1, 1995 The ninth release of the Mycobacterium database, MycDB, is now available. MycDB is funded by the WHO and the Fondation Raoul Follereau and is maintained jointly by the Unite de Genetique Moleculaire Bacterienne at the Institut Pasteur in Paris, France and the Department of Biochemistry at The Royal Institute of Technology in Stockholm, Sweden. MycDB is available free of charge via Internet network transfer. A complete description of the procedure to retrieve and install the software and database is available through the Internet. MycDB is also available through the WorldWideWeb servers at the Royal Institute of Technology (URL: http://www.biochem.kth.se/MycDB.html) and (through the good offices of the Genome Informatics Group at the National Agricultural Library) on the Agricultural Genome Information Server, AGIS, in Beltsville, Maryland, USA (WorldWideWeb - URL: http://probe.nalusda.gov:8300/other/index.html or gopher - URL: gopher://probe.nalusda.gov:7000/11/genome.databases/mycdb/). Be aware that it may take some time for the update to reach NAL. New in release 4-9: * We are now using version 4.1 of of the database manager, ACEDB. Versions exist for Unix/X11 and Macintosh. A complete package with the Macintosh application and a preloaded database is available. Update files for version 3.0 of the database manager are also available (this support will be discontinued in the near future). Ace 4.1 has the following new features: o Less diskspace needed for the database (size is roughly halved - MycDB 4-9 takes about 25MB of diskspace, compared to 40MB for MycDB 3-9). o Faster display of large KeySets, due to presorting of keys. o Blixem, the alignment display, is now fully integrated in AceDB. MycDB 4-9 contains blastn alignments for all sequences in MycDB against MycDB itself. With the correct external script, it will also fetch sequences not present in the database from an external source. A script for doing this is included, in the wscripts directory. At present, MycDb only contains blastp data for a few sequences. o The Map display is now customizable to a great degree, both regarding the look and what objects to display. o A new, WorldWideWeb-based, help system. This also requires an external script. The old help system is still there, as a backup. * New and edited sequences from EMBL/GenBank/DDBJ, current as of Oct 30, 1995. The number of Sequence objects is now 3234, of which 2891 are nucleotide sequences, and 343 Protein sequences. 591 of the nucleotide sequences contain DNA (the others are subsequences in some form or Peptide sequences). The total amount of sequence is now 2,238,856 nt, an increase of more than 43%. Most of this is due to the inclusion of a number of new cosmid sequences from M. leprae. Blastn searches have been performed on all the sequences in the database, against the complete database itself. This data is included. The data can be visualized with the Blixem tool. * The number of literature citations have increased with 263. Included are citations from MedLine, current up to Oct 4, 1995. The references for sequences have been cleaned up to remove redundancies. * The Locus class now includes some information on the function of the products. In the future this information will move to a new Protein class (for those products that are proteins). * The webserver has a new sequence search facility, where you can make a blast search on all the sequences in MycDB or on strain-specific subsets for M.leprae, M.tuberculosis complex or M.smegmatis. The fasta files used for these searches are also available from the ftp site. For information on earlier releases, see the file MycDB.3-8.Release.txt. The database currently requires a Unix workstation running X-Windows or a Macintosh. A variety of precompiled versions of the ACEDB database software are available through anonymous ftp. See the file MycDB.Retrieval.txt for more info. If you have any questions, problems or comments please contact us, via e-mail, fax, mail or telephone. If you are impatient and are already familiar with internet/ftp, all relevant information can be found at * the WWW server at the Department of Biochemistry, KTH: http://www.biochem.kth.se/MycDB.html * the ftp server at the Department of Biochemistry, KTH: ftp.biochem.kth.se (130.237.52.64) in pub/MycDB * the ftp server at Institut Pasteur: ftp.pasteur.fr (157.99.64.12) in pub/MycDB * or the mirror site at the Weizmann Institute in Israel (thanks Jaime!): bioinformatics.weizmann.ac.il (132.76.55.12) in pub/databases/acedb/mycdb The file MycDB.Retrieval.txt describes in more detail the database system requirements, network retrieval procedures for obtaining the database and methods of obtaining future updates. For more information contact Staffan Bergh or Stewart Cole. Staffan Bergh Biochemistry, Royal Institute of Technology, S-100 44 Stockholm, Sweden Email: staffan@biochem.kth.se Fax: (46 8) 24 54 52 Voice: (46 8) 790 9230 Stewart Cole Unite de Genetique Moleculaire Bacterienne, Institut Pasteur, F-75724 Paris Cedex 15, France Email: stcole@pasteur.fr Fax: (33 1) 45.68.85.93 Voice: (33 1) 45.68.84.46 ------------------------------------------------------------------------------- Last update 1995-11-01 /staffan From owner-acedb@net.bio.net Tue Nov 14 22:00:00 1995 Path: biosci!rutgers!csn!carbon!night.primate.wisc.edu!newsspool.doit.wisc.edu!uwm.edu!vixen.cso.uiuc.edu!usenet.ucs.indiana.edu!news.cs.indiana.edu!purdue!yuma!usenet From: "Martin L. Ferguson" Newsgroups: bionet.software.acedb Subject: Looking for version 3.6 source code Date: 14 Nov 1995 22:37:08 GMT Organization: Colorado State University Lines: 13 Message-ID: <48b5mk$43mg@yuma.ACNS.ColoState.EDU> NNTP-Posting-Host: klab.agsci.colostate.edu Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 1.1N (X11; I; SunOS 5.4 sun4m) X-URL: news:bionet.software.acedb Greetings all, Does anyone know where I can get a version 3.6 source code for ACeDB? Thanks. -- ###################################################################### # # Martin Ferguson Dept. of Entomology # martinf@lamar.colostate.edu Colorado State U. # 970-491-7989 Ft. Collins, CO 80523 # From owner-acedb@net.bio.net Wed Nov 15 22:00:00 1995 Path: biosci!daresbury!not-for-mail From: mieg@kaa.crbm.cnrs-mop.fr (Danielle et Jean Thierry-Mieg) Newsgroups: bionet.software.acedb Subject: ace version 3 Date: 16 Nov 1995 08:18:19 -0000 Lines: 9 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <48es4b$dan@mserv1.dl.ac.uk> Original-To: net@admcnrs.cnrs-mop.fr To obtain a version 3 code: get the distrib source code and recompile it with ACEDB_MACHINE SOLARIS_3 or something_3 see the available list with unsetenv ACEDB_MACHINE setenv ACEDB_SRC source directory make xace the system complains and reports known config, including 3/4 splits From owner-acedb@net.bio.net Tue Nov 21 22:00:00 1995 Path: biosci!rutgers!mcrcr6!shrefw01 From: shrefw01@mcrcr6.med.nyu.edu Newsgroups: bionet.software.acedb Subject: fingerprint data Message-ID: <1995Nov22.105856.8025@mcrcr6> Date: 22 Nov 95 10:58:56 EDT Organization: NYU Medical Center, New York, NY 10016, USA Lines: 9 A novice question: Using the C.elegans database, i'm not able to obtain any fingerprint data. when i choose this option by clicking on a clone in the physical map display a file chooser window pops up, but none of the directories contain the *.cor files that it seems to be looking for. what's wrong? wayne shreffler shrefw01@mcrcr6.med.nyu.edu From owner-acedb@net.bio.net Wed Nov 22 22:00:00 1995 Path: biosci!daresbury!not-for-mail From: GEORGE MURPHY Newsgroups: bionet.software.acedb Subject: Bioinformatics Date: 23 Nov 1995 16:21:57 -0000 Lines: 33 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <492735$si3@mserv1.dl.ac.uk> Sensitivity: Company-Confidential Original-To: acedb@dl.ac.uk (Non Receipt Notification Requested) (IPM Return Requested) SENIOR BIOINFORMATICS POST The John Innes Centre in Norwich, U.K. would like to develop expertise in areas of Bioinformatics relevant to the Centre's mission. Comparative genome analysis is the main area of our research which requires considerable bioinformatics expertise, although other areas such as database structuring, gene nomenclature, genome sequencing, physical mapping and protein structure studies can also benefit from relevant informatics expertise. The JIC has substantial programmes in cereal, legume, Brassica, microbial and Arabidopsis genome analysis, and plays a central role in developing a UK Crop Plant Bioinformatics Network which links scientists mapping traits in a wider variety of species of agronomic importance to experts in data curation and distribution. The JIC Bioinformaticist could play a key role in ensuring the success of this network and in forming close working relationships with other scientists in the field. As there is no relevant expertise at JIC, we wish to appoint someone with an established record in bioinformatics, particularly in the area of developing means of linking genome datasets and displaying colinearity and other important relationships. The species-specific databases are all held in ACeDB formats, therefore experience and interest in ACeDB software, UNIX and programming in PERL and C would be an advantage. The initial period of appointment would be for 5 years, but there is significant potential for long-term employment if the area enjoys success and recognition, and attracts sufficient external funding to build an effective group. In this respect there is a possibility of funding for co-workers in the UK Crop Plant Bioinformatics Network. The appointment would be made according to skills and experience,in Pay Band 5 (16,108-29,117 p.a.). We would appreciate you drawing attention of qualified candidates to this opportunity, and encouraging them to apply. The post will be kept open until a successful candidate is found. Further information can be obtained from bevan@bbsrc.ac.uk, gordon@bbsrc.ac.uk, and jeffery@bbsrc.ac.uk. Michael Bevan for the Search Committee From owner-acedb@net.bio.net Thu Nov 23 22:00:00 1995 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!newsfeed.internetmci.com!EU.net!Norway.EU.net!telepost.no!nntp-oslo.UNINETT.no!nntp-trd.UNINETT.no!daresbury!not-for-mail From: mieg@kaa.crbm.cnrs-mop.fr (Danielle et Jean Thierry-Mieg) Newsgroups: bionet.software.acedb Subject: post doc position Date: 24 Nov 1995 16:26:16 -0000 Lines: 21 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <494rn8$ssb@mserv1.dl.ac.uk> Original-To: net@admcnrs.cnrs-mop.fr I can offer a post doc position for 1 year starting sept 96 to work in Montpellier on sequence analysis/acedb development/ or more generally informatics for the genome Candidates can contact me by email, with short cv and prospective area of work. Montpellier is a nice university town in the south of France The lab is not very large, but we have plenty of collaborators here and there. Contact: Danielle and Jean Thierry-Mieg mail mieg@crbm.cnrs-mop.fr phone (33) 67 61 33 24 fax (33) 67 52 15 59 mail CRBM-CNRS Route de Mende 34033 Montpellier cedex. France From owner-acedb@net.bio.net Sun Nov 26 22:00:00 1995 Path: biosci!agate!news.ucdavis.edu!library.ucla.edu!newsfeed.internetmci.com!in1.uu.net!manquehue.scc.puc.cl!szlachev From: szlachev@puc.cl (system PRIVILEGED account) Newsgroups: bionet.software.acedb Subject: SEARCHING FOR TURBO C Date: 27 Nov 1995 12:14:00 GMT Organization: Pontificia Universidad Catolica de Chile Lines: 4 Message-ID: <49ca28$hil@manquehue.scc.puc.cl> NNTP-Posting-Host: ws6.crisol.puc.cl NNTP-Posting-User: test X-Newsreader: TIN [version 1.2 PL2] hi thre i'm student and i need to do a homework usin turbo c , and i dont know how or where get it if anibody could help me please do it here, maybe somebody have a ftp direction where to get it... From owner-acedb@net.bio.net Sun Nov 26 22:00:00 1995 Path: biosci!GREENGENES.CIT.CORNELL.EDU!matthews From: matthews@GREENGENES.CIT.CORNELL.EDU ("Dave Matthews") Newsgroups: bionet.software.acedb Subject: ACE auto-numbering? Date: 27 Nov 1995 14:01:29 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 5 Sender: daemon@net.bio.net Distribution: world Message-ID: <9511272159.AA14814@greengenes.cit.cornell.edu> NNTP-Posting-Host: net.bio.net Don't I recall that there's some way to say in a .ace file, "Name this object with the next available number, I don't care what it is, just so it's different from all other objects in the database."? - Dave From owner-acedb@net.bio.net Sun Nov 26 22:00:00 1995 Path: biosci!GREENGENES.CIT.CORNELL.EDU!matthews From: matthews@GREENGENES.CIT.CORNELL.EDU ("Dave Matthews") Newsgroups: bionet.software.acedb Subject: Re: ACE auto-numbering? Date: 27 Nov 1995 15:09:24 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 23 Sender: daemon@net.bio.net Distribution: world Message-ID: <9511272307.AA14977@greengenes.cit.cornell.edu> NNTP-Posting-Host: net.bio.net > Dave, > Are you thinking of the "New Class Format" command in aceclient? I > don't know if it exists in xace or tace. > > The "?" (help) command in aceclient says, > > "New Class Format: i.e New Plate ya%%dx.y creates ya8x.y if ya7x.y" Yes, maybe that is what I was thinking of. It doesn't seem to work in xace. If I load Colleague : "Bill" Mail "Here" Colleague : "Bill%%d" Mail "There" , the Colleague who lives There is named Bill%%d. Thanks for the help though, I knew I'd heard of something like this somewhere. - Dave From owner-acedb@net.bio.net Mon Nov 27 22:00:00 1995 Path: biosci!daresbury!not-for-mail From: mieg@kaa.crbm.cnrs-mop.fr (Danielle et Jean Thierry-Mieg) Newsgroups: bionet.software.acedb Subject: a bug Date: 28 Nov 1995 07:58:20 -0000 Lines: 31 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <49efes$s1r@mserv1.dl.ac.uk> Original-To: net@admcnrs.cnrs-mop.fr Sam reports: in xace (4.1), using latest ncbi code: for the model ?Germplasm Date_of_release ?Text we have 10 objects where the ?Text value is 1901 correct query is: find Germplasm Date_of_release = 1901 this however returns empty but: find Germplasm Date_of_release = 1901* ...returns 10 objects -- correct but why? This is clearly a bug It will be fixed, but use that hack in the mean time the reason 1901* works is that it forces comparaison of Text: ?Text is a text, 1901* is a text whereas in Date_of_release = 1901, then Date_of_release is a text when 1901 is a number and the system did not correctly fold back on text comparison Thanks Sam for this well documented bug From owner-acedb@net.bio.net Mon Nov 27 22:00:00 1995 Path: biosci!daresbury!not-for-mail From: mieg@kaa.crbm.cnrs-mop.fr (Danielle et Jean Thierry-Mieg) Newsgroups: bionet.software.acedb Subject: autonumbering Date: 28 Nov 1995 08:02:39 -0000 Lines: 7 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <49efmv$sd8@mserv1.dl.ac.uk> Original-To: net@admcnrs.cnrs-mop.fr There is on the server/cleint a command: "New Class Format: i.e New Plate ya%%dx.y creates ya8x.y if ya7x.y" which allows autonumbering. This command is beeing added in the tace From owner-acedb@net.bio.net Tue Nov 28 22:00:00 1995 Path: biosci!daresbury!is.bbsrc.ac.uk!news From: Couchman@BBSRC.AC.UK (Matt) Newsgroups: bionet.software.acedb Subject: aceclient vs. xace and WWW Date: 29 Nov 1995 12:45:19 GMT Organization: John Innes Centre Lines: 9 Message-ID: <49hkkv$79r@is.bbsrc.ac.uk> NNTP-Posting-Host: pc0559.jic.bbsrc.ac.uk X-Newsreader: WinVN 0.92.1 Is there a quick summary available about the purpose of aceclient and aceserver? I have a lot of technical details about how to set them up. However I'm still unclear as to whether they are intended as an alternative to a local copy of xace and access to WWW. If not what extra features do they offer? Thanks for any help, Matt. From owner-acedb@net.bio.net Tue Nov 28 22:00:00 1995 Path: biosci!daresbury!not-for-mail From: mieg@kaa.crbm.cnrs-mop.fr (Danielle et Jean Thierry-Mieg) Newsgroups: bionet.software.acedb Subject: client/server Date: 29 Nov 1995 14:08:50 -0000 Lines: 33 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <49hphi$q84@mserv1.dl.ac.uk> Original-To: net@admcnrs.cnrs-mop.fr Couchman%bbsrc.ac.uk asks: Is there a quick summary available about the purpose of aceclient and aceserver? I have a lot of technical details about how to set them up. However I'm still unclear as to whether they are intended as an alternative to a local copy of xace and access to WWW. If not what extra features do they offer? No i don t have a summary the client server is a way to use acedb in non graphic mode remotelly, with several users sharing write access. So usage 1 is: have a big lab run one server private to your lab as many users as needed, users often beeing scripts, update the same server in parallel usage 2: have a server on a public site many clients will access the data remotelly in read-only mode actually the www server developped at USDA runs the ace server and query it with a perl-client forwarding the results to the www server knowing the server adress, you can query it direct, using yourself an ace clinet (c.client as well as perl client) by passing enterelly the web layer Jean From owner-acedb@net.bio.net Wed Nov 29 22:00:00 1995 Path: biosci!daresbury!not-for-mail From: jattwood@hgmp.mrc.ac.uk (Mr J. Attwood) Newsgroups: bionet.software.acedb Subject: Tclace Date: 30 Nov 1995 14:23:27 -0000 Lines: 11 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <49keov$rao@mserv1.dl.ac.uk> content-length: 306 Original-To: acedb@dl.ac.uk Hi, Please can anyone tell me where I can get tclace (referred to in Dave Matthews' "Loading Data into Acedb" documentation file) as I can't seem to find it anywhere and the Web crawler has never heard of it. Thanks, John Attwood, MRC Human Biochemical Genetics Unit, London UK john@mrc-hbgu.ucl.ac.uk From owner-acedb@net.bio.net Wed Nov 29 22:00:00 1995 Path: biosci!FRUITFLY.BERKELEY.EDU!suzi From: suzi@FRUITFLY.BERKELEY.EDU (Suzanna Lewis) Newsgroups: bionet.software.acedb Subject: Re: Tclace Date: 30 Nov 1995 13:10:56 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 29 Sender: daemon@net.bio.net Distribution: world Message-ID: <199511302105.NAA15163@fruitfly.berkeley.edu> NNTP-Posting-Host: net.bio.net > > > > Hi, > > > > Please can anyone tell me where I can get tclace (referred to in > > Dave Matthews' "Loading Data into Acedb" documentation file) as I can't > > seem to find it anywhere and the Web crawler has never heard of it. > > > > Thanks, > > > > Good question, John! Suzanna, is tclace available? If so maybe we should > link to it in this Web page. > - Dave > Hi, I just gzipped the executable and put it on our anonymous ftp server. Look on fruitfly.berkeley.edu in pub/tclace. And by the end of the day we should have added a web site that can also be used for ftp. Our home page is simply fruitfly.berkeley.edu, I'll send the full URL once we have it here. The only other people I know of that have experience using tclace are our flybase collaborators at Harvard and Cambridge. Like us they are referencing our version of acedb a.k.a. flydb, a.k.a Encyclopaedia of Drosophila. We are using (read dependent on) version tcl7.4b3 of tcl. Hope this is useful, Suzanna From owner-acedb@net.bio.net Wed Nov 29 22:00:00 1995 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!elroy.jpl.nasa.gov!lll-winken.llnl.gov!overload.lbl.gov!bks From: bks@s27w007.pswfs.gov (Bradley K. Sherman) Newsgroups: bionet.software.acedb Subject: FAQ notes Date: 30 Nov 1995 17:58:54 GMT Organization: Dendrome, A Genome Database for Forest Trees Lines: 20 Distribution: world Message-ID: <49krcv$68q@overload.lbl.gov> NNTP-Posting-Host: s27w007.pswfs.gov Sorry about the late FAQ this month. I probably will skip the December version and do another in January 96. Curators are advised to check their paragraphs in Answer 4 of the FAQ to be sure that they are up to date and have survived recent style changes intact. The USENET is great, but remember that the FAQ is nicest when read on WWW at http://probe.nalusda.gov:8000/acedocs/acedbfaq.html Later, --bks -- Bradley K. Sherman | Institute of Forest Genetics bks@s27w007.pswfs.gov | P.O. Box 245 510-559-6437 FAX:510-559-6440 | Berkeley, CA 94701 USA Dendrome Project From owner-acedb@net.bio.net Wed Nov 29 22:00:00 1995 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!elroy.jpl.nasa.gov!lll-winken.llnl.gov!overload.lbl.gov!acedbfaq From: acedbfaq@s27w007.pswfs.gov (ACEDB FAQ Pseudouser) Newsgroups: bionet.software.acedb,news.answers Subject: ACEDB Genome Database Software FAQ Followup-To: bionet.software.acedb Date: 30 Nov 1995 17:46:13 GMT Organization: Dendrome, A genome database for forest trees Lines: 1138 Approved: news-answers-request@MIT.Edu Message-ID: <49kql5$5vf@overload.lbl.gov> Reply-To: acedbfaq@s27w007.pswfs.gov NNTP-Posting-Host: s27w007.pswfs.gov Summary: Frequently Asked Questions about finding and getting started with the database system ACEDB. ACEDB is used to collect information regarding the molecular biology of the genome. Xref: biosci bionet.software.acedb:785 news.answers:52583 Archive-name: acedb-faq Last-modified: 11/30/95 Version: 1.26 ACEDB FAQ ********* Curated by: Bradley K. Sherman Frequently Asked Questions about ACEDB ++++++++++++++++++++++++++++++++++++++ o Q0 : What is ACEDB? o -------------------- o Q1 : What is the current version of ACEDB? o ------------------------------------------- o Q2 : What hardware/software do I need to run ACEDB? o ---------------------------------------------------- o Q3 : Where can I get ACEDB? o ---------------------------- o Q4 : What ACEDB databases exist? o --------------------------------- o Q5 : What documentation exists for ACEDB? o ------------------------------------------ o Q6 : What other resources are available for ACEDB? o --------------------------------------------------- o Q7 : How should ACEDB be cited? o -------------------------------- o Q8 : Is ACEDB object-oriented? o ------------------------------- o Q9 : How doe one get on/off the ACEDB announcements mailing list? o ------------------------------------------------------------------ o Q10 : When and where is the next ACEDB Workshop? o ------------------------------------------------- o Q11 : Who prepared this document & where is the current version? o ----------------------------------------------------------------- Questions marked with '+' are new, those with '!' have substantially changed answers. Q0: What is ACEDB? ++++++++++++++++++ A0: +++ ACEDB is an acronym for A Caenorhabditis elegans Database. It can refer to a database and data concerning the nematode C. elegans, or to the database software alone. This document is concerned primarily with the latter meaning. ACEDB is being adapted by many groups to organize molecular biology data about the genomes of diverse species [Q4 gives contact information]. ACEDB allows for automatic cross-referencing of items during loading and allows for hypertextual navigation of the links using a graphical user interface and mouse. Certain special purpose graphical displays have been integrated into the software. These reflect the needs of molecular biologists in constructing genetic and physical maps of genomes. ACEDB was written and developed by Richard Durbin (MRC LMB Cambridge, England) and Jean Thierry-Mieg (CNRS, Montpellier, France), beginning circa 1990. It is written in the C programming language and uses the X11 windowing system to provide a platform independent graphical user interface. The source code is publicly available [See Q3]. Durbin & Thierry-Mieg continue to develop the system, with contributions from other groups including Lawrence Berkeley Laboratory and the Integrated Genomic Database (IGD) project headed by Otto Ritter. A description by Durbin & Thierry-Mieg: ACEDB does not use an underlying relational database schema, but a system we wrote ourselves in which data are stored in objects that belong in classes. This is nevertheless a general database management system using caches, session control, and a powerful query language. Typical objects are clones, genes, alleles, papers, sequences, etc. Each object is stored as a tree, following a hierarchical structure for the class (called the "model"). Maps are derived from data stored in tree objects, but precomputed and stored as tables for efficiency. The system of models allows flexibility and efficiency of storage --missing data are not stored. A major advantage is that the models can be extended and refined without invalidating an existing database. Comments can be added to any node of an object. Return to List of Questions Q1: What is the current version of ACEDB? +++++++++++++++++++++++++++++++++++++++++ A1: +++ (This answer refers to the software not the C. elegans data.) Current version is 4_1 (as of 10 August 1995). A test (beta) version of ACEDB 4.0b4 (5/95) is available. A Macintosh version is available as version 2.0b4. To retrieve the software see Q3. To be kept informed of new releases see Q9. Return to List of Questions Q2: What hardware/software do I need to run ACEDB? ++++++++++++++++++++++++++++++++++++++++++++++++++ A2: +++ The software is available as source code, so you may be able to get it working on any machine, with effort. It is also available in binary (pre-compiled) format for a variety of machines. To retrieve the software see Q3. o Unix and X11: o Sun/SunOS 4.x o Sun/Solaris o DEC DECstation3100, 5100 etc. o DEC Alpha/OSF-1 o Silicon Graphics Iris series o PC 386/486/Pentium with Linux (free Unix) Jeff Bryer, jbryer@darwin.mbb.sfu.ca and Ken Clark provide a linux version of 4.1 and a complete C. elegans data set at trog.mbb.sfu.ca in /pub/acedb as bin.linux.4_1.tar.Z. o There exist, or have existed, ports onto Alliant, Hewlett- Packard, IBM R6000, Convex. You may have to contact the developer responsible for the port to make these real. o NeXT: contact Patrick Phillips at University of Texas, NeXTmail: patrick@wbar.uta.edu email: phil@decster.uta.edu o Macintosh: o [Contributed by Frank Eeckman] Macace is distributed as a self-extracting archive that contains the application, the wspec files, and a fully up to date database. macace 3.0 is available with an updated 21bdb database. Please send all questions/bug reports to eeckman@llnl.gov A native powerPC version is available as well. Macace needs a macintosh with > 16 MBytes of RAM, and a 17" color monitor is preferred. System 7 or greater is required. For the multimedia extensions Quicktime 1.0 is required. Please add your name to our mailing list by sending email to eeckman@llnl.gov. It is our belief that for cost savings a powerPC mac will beat the advertised linux-intel combination. Macace is fully compatible with xace, but includes some multimedia extensions (picture and movie support) not found in the unix versions. o ACEDB for The NEC EWS4800 is available via anonymous ftp at ftp.nec.co.jp (192.135.93.2) in /pub/packages/acedb/ace2. Contact Tohru Sano Fundamental Research Laboratories NEC Corporation Tsukuba, 305, JAPAN, e-mail: sano@exp.cl.nec.co.jp, FAX: +81-298-56-6136, VOICE: +81-298-50-1507 (Here at the Institute of Forest Genetics we run ACEDB on a Sun Microsystems SPARCstation II, and users can interact using Macintoshes and PC-clones by using X11 implementations for the personal computers and a LAN. --bks) X11 fonts note: ACEDB uses fonts listed in the xfonts.wrm file. If you install new fonts on your machine be sure to run bldfamily(1) so that they are available. Return to List of Questions Q3: Where can I get ACEDB? ++++++++++++++++++++++++++ A3: +++ The standard ACEDB source and binaries are available in the following public access accounts (anonymous ftp sites) accessible via Internet: o lirmm.lirmm.fr in pub/acedb o cele.mrc-lmb.cam.ac.uk in pub/acedb o ncbi.nlm.nih.gov in repository/acedb o bioinformatics.weizmann.ac.il in pub/databases/acedb. MacAce is available from: o genome.lbl.gov in pub/macace o cele.mrc-lmb.cam.ac.uk in pub/acedb/macace Linux; ACEDB version 4.1 (and earlier versions) for Linux 2-10: o trog.mbb.sfu.ca /pub/acedb as bin.linux.4_1.tar.Z. ACEDB for The NEC EWS4800: o ftp.nec.co.jp in /pub/packages/acedb/ace2. Return to List of Questions Q4: What ACEDB databases exist? +++++++++++++++++++++++++++++++ A4: +++ In alphabetic order by Database name ------------------------------------ [Curators, please submit changes as new paragraphs] Database : AaeDB Species : Aedes aegypti (Mosquito) Last_update : December 1994 ACEDB_version : 3.0 WWW : http://klab.agsci.colostate.edu/ Curator : Dennis Knudson, dknudson@lamar.colostate.edu Curator : Martin Ferguson, martinf@lamar.colostate.edu Co-Curator : Dave Severson, dave@aedes.vetsci.wisc.edu Co-Curator : Leonard Munstermann, munst@biomed.med.yale.edu Contact : aaedbmgr@klab.agsci.colostate.edu Database : AAtDB Species : Arabidopsis thaliana Current version : 3-5 Last_update : August 1995 Curator : John Morris Contact : curator@frodo.mgh.harvard.edu Availability : UNIX and Macintosh versions via anonymous ftp FTP : Macintosh version - weeds.mgh.harvard.edu in aatdb/MacAAtDB FTP : UNIX version - weeds.mgh.harvard.edu in aatdb/aatdb.3x FTP : probe.nalusda.gov in pub/aatdb Gopher : weeds.mgh.harvard.edu/ Gopher : probe.nalusda.gov:7004/ Gopher : probe.nalusda.gov:7000/11/genome.databases/ WWW : http://weeds.mgh.harvard.edu/ WWW : http://probe.nalusda.gov:8300/plant/ Database : AboutDB Curator : Staffan Bergh, staffan@biochem.kth.se Subject : ACEDB itself (meta-meta-metadata) ACEDB_version: 3.0 Last_update : July 1995 WWW : http://www.biochem.kth.se/AboutDB.html Database : ACeDB Species : Caenorhabditis elegans Current version: 4-8 Curator : Jean Thierry-Mieg, mieg@kaa.crbm.cnrs-mop.fr Curator : Richard Durbin, rd@mrc-lmb.cam.ac.u Curator : Sylvia Martinelli, sylvia@sanger.ac.uk Last_update : August 1995 Availability: Unix and Macintosh versions via anonymous ftp FTP: USA - ncbi.nlm.nih.gov in repository/acedb FTP: England - ftp.sanger.ac.uk in pub/acedb FTP: France - lirmm.lirmm.fr in genome/acedb Gopher : probe.nalusda.gov:7000/11/genome.databases/ WWW : http://probe.nalusda.gov:8300/other/ DataBase : AceMap Species : Homo sapiens Subject : Physical mapping data for human chromsome X ACEDB_version : 4.1 Curator : Hugues Roest Crollius, croillius@mpimg-berlin-dahlem.mpg.de PI : Hans Lehrach FTP : ftp.icnet.uk in icrf-public/GenomeAnalysis/X/acemap Comment: Get the README file in the directory above. Contact : Max-Planck-Institut fur Moleulare Genetic, Ihnestrasse 73, 14195 Berlin, Germany Availability : beta release of the X chromosome data/models via anonymous ftp FTP : ftp.icnet.uk in icrf-public/GenomeAnalysis/X/acemap Last_update : August 1994 Database : AGsDB (A Genus species Database) Species : Aspergillus nidulans Species : Neurospora crassa Species : Bos taurus (cow) Species : Homo sapiens anchor loci Species : Gossypium hirsutum (cotton) Species : Neurospora crassa Species : Homologs of Aspergillus cell cycle loci for budding and fission yeast Curator : Leland Ellis, leland@straylight.tamu.edu Last_update : March 1994 ACeDB_version : 3.0 Subject: Contains extensions to the Human C21 Models to provide for multiple species, and queries between species via Homologs (e.g., cell cycle loci with links via Homologs between Aspergillus and budding C. cerevisiae) and fission (S. pombe yeast); interacting loci via defined Interactions for each locus Revision : AAnDB for Aspergillus nidulans and ABtDB for Bos taurus (cow) have been folded into AGsDB, and are not being developed futher as individual species databases. Gopher : probe.nalusda.gov:7000/11/genome.databases/ WWW : http://probe.nalusda.gov:8300/other/ WWW : http://keck.tamu.edu/cgi/agsdb/agsdbserver.html Database : Alfagenes Species : Medicago sativa (alfalfa) Curator : D. Z. Skinner, dzolek@ksu.ksu.edu Telephone : (913) 532-7247 ACEDB_version : 3.0 Last_Update : July 1995 FTP : probe.nalusda.gov in pub/alfagenes Gopher : probe.nalusda.gov:7000/11/genome.databases/ WWW : http://probe.nalusda.gov:8300/plant/ Database : BeanGenes Species : Phaseolus and Vigna Curator : Phillip E. McClean, mcclean@beangenes.cws.ndsu.nodak.edu ACEDB_version : 1.0 Last_updated : January 1995 Gopher : probe.nalusda.gov:7000/11/genome.databases/ WWW : http://probe.nalusda.gov:8300/plant/ Database : ChlamyDB Species : Chlamydomonas Curator : Elizabeth Harris Contact : chlamy@acpub.duke.edu ACEDB_version : 3.0 Data_version : 1.2 Last_update : August 1995 Availability : Macintosh and UNIX versions via anonymous ftp FTP : probe.nalusda.gov in pub/chlamydb Gopher : ftp.duke.edu/11/pub/chlamy Gopher : probe.nalusda.gov:7000/11/genome.databases/ WWW : http://probe.nalusda.gov:8300/plant/ Database : CIMMYT (Wheat International Nursery Data) Species : Triticum spp. ACEDB_version : 4.0 Last_update : September 1995 Curator : Hector Sanchez, hsanchez@cimmyt.mx FTP : probe.nalusda.gov in pub/cimmyt Gopher : probe.nalusda.gov:7000/11/genome.databases/ WWW : http://probe.nalusda.gov:8300/related/ Database : CottonDB Species : Gossypium hirsutum (cotton) and related species PI : Russell J. Kohel (rjk0339@acs.tamu.edu), USDA-ARS, Southern Crops Research Laboratory, 2765 F&B Road, College Station, Texas 77845 Curator : Gerard R. Lazo, lazo@tamu.edu Curator : Sridhar Madhavan, msridhar@tamu.edu Phone : 409-260-9311 Fax : 409-260-9333 Last_update : January 1995 (version 95.1) ACEDB_version : 3.0 FTP : probe.nalusda.gov in pub/cottondb Gopher : probe.nalusda.gov:7000/11/genome.databases/ WWW : http://probe.nalusda.gov:8300/plant/ Data_submission_form : http://algodon.tamu.edu/ Database : CSNDB Focus : Cell Signalling Molecules and Interactions Contact : Takako Igarashi, National Insitute of Health Sciences, Division of Chem-Bio Informatics, Setagaya-ku, Tokyo, Japan 158, taka@nihs.go.jp Database : EofD (Encyclopaedia of the Drosophila) Species : Drosophilidae (primarily D. melanogaster) Availability : Macintosh CD-ROM and SunOS executables via anonymous ftp Developer : Suzanna Lewis, suzi@fly2.berkeley.edu Developer : Cyrus Harmon, sly@fly2.berkeley.edu Developer : Edward Welbourne, eddy@gen.cam.ac.uk Collaborator : The FlyBase Consortium, flybase-help@morgan.harvard.edu Collaborator : The Berkeley Drosophila Genome Project, flygenome@maillink.berkeley.edu Gopher : fly.bio.indiana.edu:70+/11/Flybase WWW : http://fly2.berkeley.edu:3512/EofD.html Database : EthnobotDB (orldwide plant uses) Species : wide range of plant species ACEDB_version : 4.0 Last_update : June 1995 Comment : Converted to ACEDB from the original SQL database. Curator : Stephen M. Beckstrom-Sternberg, peosb@ars-grin.gov Curator : James A. Duke, ngrljd@ars-grin.gov Gopher : probe.nalusda.gov:7000/11/genome.databases/ WWW : http://probe.nalusda.gov:8300/related/ Database : FoodplantDB (Native American Food Plants) Species : Over 1,100 plant species ACEDB_version : 4.0 Last_update : May 1995 Curator : Stephen M. Beckstrom-Sternberg, peosb@ars-grin.gov Curator : James A. Duke, ngrljd@ars-grin.gov Comment : Converted to ACEDB from ORACLE. Comment : Data originally from a publication by Yanovsky, Elias. 1936. Food Plants of the North American Indians. USDA Miscellaneous Publication Number 237. Gopher : probe.nalusda.gov:7000/11/genome.databases/ WWW : http://probe.nalusda.gov:8300/related/ Database : GrainGenes Species : Wheat, barley, oats, relatives Curator : David E. Matthews, matthews@greengenes.cit.cornell.edu PI : Olin D. Anderson, oandersn@pw.usda.gov ACEDB_version : 4_1 Data_version : 1.5+ Last_update : November 1995 FTP : probe.nalusda.gov in pub/graingenes Gopher : greengenes.cit.cornell.edu/ Gopher : probe.nalusda.gov:7002 Gopher : probe.nalusda.gov:7000/11/genome.databases/ WWW : http://probe.nalusda.gov:8300/plant/ WWW : http://wheat.pw.usda.gov/graingenes.html Database : IGD (Integrated Genomic Database) Species : Homo sapiens Subject : Chromosome 21 Availability : September 1994 by ftp, on-line server October 1994 Contact : Otto Ritter, o.ritter@dkfz-heidelberg.de Contact : Jean Thierry-Mieg, mieg@kaa.cnrs-mop.fr Contact : Nicole Creau-Goldberg, creau@arthur.citi2.fr Contact : Jean-Maurice Delabar, delabar@arthur.citi2.fr WWW : http://moulon.inra.fr/acedb/igd.html Description : IGD (Integrated Genomic Database) aims to integrate multiple public general molecular biology and human genome specific databases into single logical database with unified interface to existing analysis tools. From data produced by the 4th International Workshop on Chromosome 21 (Genomics,1993,18,735-744) and from data provided by or taken from the following databases and data repositories: GDB, OMIM, EMBL, CEPH, Genethon, UKProbeBank, and RLDB. Database : LeishDB Species : Leishmaia major, L. infantum, L. peruviana, L. donovani and others PI : Jennie Blackwell PI : Al Ivens Last_update : September 1995 ACEDB_version : 4.1 Contact : Matin Aslett, ma10025@cus.cam.ac.uk FTP : ftp://parsun1.path.cam.ac.uk WWW : http://parsun1.path.cam.ac.uk/ Curator : Martin Aslett Curator : Howard Cobb Database : LIGM-DB Curator : Veronique Giudicelli Focus : genetic and physical mapping of loci of Immunoglobulins and Tcell receptors PI : Marie-Paule Lefranc Contact : Veronique Giudicelli LIGM IGMM UMR CNRS 9942 BP 5051 Rte de Mende 34000 Montpellier giudi@ligm.crbm.cnrs-mop.fr Database : MaizeDB Species : Zea mays L. ssp. mays and related species Latest_release : April 1995 Acedb_version : 3.3 Comment : MaizeDB is a periodically extracted ACeDB front end for the Maize Genome Database, MaizeDB, a SYBASE database, implemented using Genera software, developed by Stan Letovsky. Comment : Genera provides (1) up-to-the-minute form internet access to SYBASE databases, both for query (WWW and APT) and data entry (APT only); (2) database design alterations by systems administrators; (3) gopher file extraction. Comment: MaizeDB uses WWW record-to-record hard-links to 16 external databases for (1) annotated sequences: GenBank, dbEST, GenoBase, PIR, SwissProt, Prosite, ENZYME; (2) other species genome information: AAtDB(Arabidopsis), RiceGenes, GrainGenes, SaachDB (yeast), CGSC(E. coli), XLocus, RiceGenes, GrainGenes (3) germplasm: GRIN. Data : Over 100,000 records include: 6513 mapped loci (located to chromosome or better) including 1081 mapped genes and 1937 mapped probed sites (gene candidates); 2448 probes; 2460 map scores; 1551 gel patterns (Probe/Enzyme/Stock); 8777 stocks; 18,100 Variations (alleles, DNA polymorphisms, rearrangements, etc); 596 phenotypes; 317 traits; 715 gene products; 6158 bibliographic references; 2200 researchers with addresses. FTP : probe.nalusda.gov in pub/maizedb Gopher : gopher.agron.missouri.edu Gopher : probe.nalusda.gov:7000/11/genome.databases/ Telnet : telnet teosinte.agron.missouri.edu login as guest, use password: corncob WWW : http://www.agron.missouri.edu/top.html WWW : http://probe.nalusda.gov:8300/plant/ WWW Genera information : http://gdbdoc.gdb.org/letovsky/genera/genera.html Funding : MaizeDB USDA/ARS to E. Coe Funding : Genera NSF BIR 92-01652 to S. Letovsky and M. Berlyn Curator/PI : Ed Coe, ed@teosinte.agron.missouri.edu Curator : Mary Polacco, maryp@teosinte.agron.missouri.edu Assoc Curator : Pat Byrne, byrne@teosinte.agron.missouri.edu QTL data Assoc Curator : Georgia Davis, gdavis@teosinte.agron.missouri.edu Map data Assoc Curator : Marty Sachs, Maize Stock Center, msachs@uiuc.edu Genetic Stock data Assoc Curator : Christiane Fauron, FAURON@GENE1.med.utah.edu Mitochondrion genome Assoc Curator : Carolyn Wetzel, cmwetzel@iastate.edu Chloroplast genome Assoc Curator : Steve Rodermel, S1SRR@ISUVAX.IASTATE.EDU Chloroplast genome Design : Stan Letovsky, letovsky@gdb.org Design : Mary Berlyn, mary@fetalpig.biology.yale.edu Systems Manager : Denis Hancock, dhancock@teosinte.agron.missouri.edu Contact : db_request@teosinte.agron.missouri.edu Last_update : 11 April 1995 Database : Mendel (plant wide gene names) Species : wide range of plant species Subject : standardized designations for sequenced genes Comment : The purpose is to provide a common system of nomenclature for substantially similar genes across the plant kingdom. Mendel is maintained by the Commission on Plant Gene Nomenclature. ACEDB_version : 4.0 Last_update : July 1995 Curator : Carl Price, price@mbcl.rutgers.edu Curator : Ellen Reardon, reardon@mbcl.rutgers.edu Gopher : probe.nalusda.gov:7000/11/genome.databases/ WWW : http://probe.nalusda.gov:8300/related/ Database : Millet Genes Species : Pennisetum Glaucum (Pearl Millet) ACEDB_version : 4.1 Availablity : Local Curator : Matt Couchman, couchman@bbsrc.ac.uk Curator : Katrien Devos, devos@bbsrc.ac.uk DataBase : Mousedb Species : Musculus Musculus Species : Homo Sapiens ACEDB_version : 3.0 with extensions to define and display cytogenetic data. Description : Mouse genome data from the published literature, including mouse genes with phenotypic effects, chromosome anomalies, imprinted regions and man-mouse homologies with associated pathological disorders. The maps are consensus ones. They use data, such as the HIS and anomaly data, to show alignments between the genetic and cytogenetic maps. Curator : Rachael Selley, rselley@har-rbu.mrc.ac.uk PI : Mary Lyon PI : Jo Peters Availability : Mousedb is available publicly from the UK HGMP Resource Centre's computing service via the INTERNET. For user id. please contact Administration, HGMP Resource Centre, Hinxton Hall, Cambridgeshire CB10 1RQ, UK. Tel: (+44) 1223 494520 Fax: (+44) 1223 494510 Contact : Rachael Selley, MRC Radiobiology Unit, Chilton, Didcot, Oxon OX11 ORD Last_update : July 1995 Database : MPNADB (Medicinal Plants of Native America) Species : Over 2,100 plant species Curator : Daniel E. Moerman, dmoerman@umich.edu Curator : Stephen M. Beckstrom-Sternberg, peosb@ars-grin.gov - ACEDB version Comment : MPNADB is based on a two-volume book of the same name published in 1986 by the Museum of Anthropology of the University of Michigan. MPNADB was first developed at the University of Michigan in DBase II. ACEDB_vertion : 4.0 Last_update : June 1995 Gopher : probe.nalusda.gov:7000/11/genome.databases/ WWW : http://probe.nalusda.gov:8300/related/ Database : MycDB Species : Mycobacteria Comment : MycDB is a collation of data on the mycobacteria, causative agents of tuberculosis and leprosy. It is centered on the mapping and sequencing projects under way in M.leprae and M.tuberculosis. Curator : Staffan Bergh, staffan@biochem.kth.se Curator : Stewart Cole, stcole@pasteur.fr Last_update : November 1995 ACEDB_version : 4.1 Data_version : 4-9 (November 1995) FTP : www.biochem.kth.se (130.237.52.64) in pub/MycDB FTP : ftp.pasteur.fr (157.99.64.12) in pub/MycDB FTP : bioinformatics.weizmann.ac.il (132.76.55.12) in pub/databases/acedb/mycdb Gopher : probe.nalusda.gov:7000/11/genome.databases/ WWW : http://www.biochem.kth.se/MycDB.html WWW : http://probe.nalusda.gov:8300/other/ Database : OMIA (Online Mendelian Inheritance in Animals) Species : wide range of animal species Subject : gene and phene (familial trait or phenotype) information Comment : MIA is modeled after Victor McKusick's Mendelian Inheritance in Man (MIM) database and was developed at the University of Sydney, Australia, in Advanced Revelation. Curator : Frank Nicholas, frankn@doolittle.vetsci.su.oz.au Curator : Gail Juvik, gjuvik@nalusda.gov - ACEDB version ACEDB_vertion : 4.0 Last_update : September 1995 Gopher : probe.nalusda.gov:7000/11/genome.databases/ WWW : http://probe.nalusda.gov:8300/animal/ WWW : http://morgan.angis.su.oz.au/BIRX/phenes_form.html Database : PhytochemDB (Plant Chemicals) Species : wide range of plant species Subject : Consists primarily of plant chemical data, including quantity, taxonomic occurence, and chemical activity. Comment : Converted to ACEDB from the original SQL database. ACEDB_version : 4.0 Last_update : June 1995 Data_version : July 1994 Curator : Stephen M. Beckstrom-Sternberg, peosb@ars-grin.gov Curator : James A. Duke, ngrljd@ars-grin.gov Gopher : probe.nalusda.gov:7000/11/genome.databases/ WWW : http://probe.nalusda.gov:8300/related/ Database : PomBase Curator : Sean Walsh, svw@sanger.ac.uk Curator : Marie-Adele Rajendream PI : Bart Barrell, barrell@sanger.ac.uk Species : Schizosaccharomyces pombe ACEDB_version : 4.1 Last_update : September 1995 FTP : ftp.sanger.ac.uk in pub/PomBase Database : PVP (Plant Variety Protection) Species : Glycine max (soybeans) Subject : Data about plant varieties that have been granted a Certificate of Protection by the Plant Variety Protection Office. Curator : Stephen M. Beckstrom-Sternberg, sbeckstr@nalusda.gov - ACEDB version ACEDB_version : 4.0 Last_update : June 1995 Contact: The Plant Variety Protection Office, Room. 500, National Agriculture Library, 10301 Baltimore Blvd., Beltsville, Maryland 20705 Telephone : 301-504-5518 Fax : 301-504-5291 Email : Jeff Strachan, strachan@locus.nalusda.gov Gopher : probe.nalusda.gov:7000/11/genome.databases/ WWW : http://probe.nalusda.gov:8300/related/ Database : RiceGenes Species : Oryza sativa Curator : Edie Paul, epaul@nightshade.cit.cornell.edu PI : Susah McCouch ACEDB_version : 3.0 Last_update : July 1995 FTP : probe.nalusda.gov in pub/ricegenes Gopher : nightshade.cit.cornell.edu Gopher : probe.nalusda.gov:7007 Gopher : probe.nalusda.gov:7000/11/genome.databases/ WWW : http://probe.nalusda.gov:8300/plant/ Database : SacchDB Species : Saccharomyces cerevisiae Subject : Budding (common baker's) Yeast Genome ACEDB_version : UNIX 2.0, MacAce 2.0b4 Last_update : September 1995 Data_version : 2.4.12 Data : All Saccharomyces genes contained in the Registry of Gene Names. Results of the completed chromosomal sequencing projects have been integrated into the database. Physical Maps based on DNA sequencing projects, hybridization to the Olson/Riles prime filter grids, and restriction mapping. For the completely sequenced chromosomes the Olson prime clones have been re-mapped (on the computer) to the DNA sequence. Saccharomyces DNA sequences contained within GenBank are incorporated. Literature references, most including abstracts, for the information contained within the database. Gene protein product information obtained from the YPD database (Garrels and Latter, CSHL) and the literature. Genetic Maps including the underlying two point tetrad data. Including all tetrad data reported in previous additions of the Mortimer Yeast Maps. FTP : genome-ftp.stanford.edu in pub/yeast/SacchDB FTP : ncbi.nlm.nih.gov in repository/SacchDB Gopher : genome-gopher.stanford.edu WWW : http://genome-www.stanford.edu/ Funding : National Center for Human Genome Research, NIH PI : David Botstein, botstein@genome.stanford.edu Project Manager/Curator : Mike Cherry, cherry@genome.stanford.edu Curator : Selena Dwight, dwight@genome.stanford.edu Curator : Cathy Ball, ball@genome.stanford.edu Curator : Rita Schmidt, bleb@genome.stanford.edu Curator : Barbara Dunn, bdunn@genome.stanford.edu Curator : Caroline Adler, adler@genome.stanford.edu Programmer : Karen Davis, karen@genome.stanford.edu Sys. Admin : Mark Schroeder, mark@genome.stanford.edu Contact : yeast-curator@genome.stanford.edu Data_Submission : yeast-curator@genome.stanford.edu Database : SolGenes Subject : Solanaceae - tomato, potato, pepper Curator : Clare Nelson, cnelson@nightshade.cit.cornell.edu PI : Steve Tanksley Release : ACEDB 3.0 Last_update : May 1995 FTP : probe.nalusda.gov in pub/solgenes Gopher : nightshade.cit.cornell.edu:71 Gopher : probe.nalusda.gov:7006 Gopher : probe.nalusda.gov:7000/11/genome.databases/ WWW : http://probe.nalusda.gov:8300/plant/ Database : SorghumDB Species : Sorghum bicolor (L.) Moench PI : Keith F. Schertz, schertz@tamvm1.tamu.edu USDA-ARS, Dept. of Soil & Crop Sciences, Texas A&M University, College Station, TX 77843-2474 Phone : (409) 260-9252 FAX : (409) 845-0456 Curator : Najeeb U. Siddiqui, nus6389@tam2000.tamu.edu Southern Crop Improvement Facility, Crop Biotechnology Center, Texas A&M University, College Station, TX 77843-2123 Phone : (409) 862-1523 FAX : (409) 862-4790 Last_update : September 1995 ACEDB_version : 3.0 Data_version : 2.0 FTP : probe.nalusda.gov in pub/sorghumdb Gopher : probe.nalusda.gov:7000/11/genome.databases/ WWW : http://probe.nalusda.gov:8300/plant/ Database : SoyBase Species : Glycine max (Soybeans) and related species PI : Randy Shoemaker Curator : David Grant, dgrant@mendel.agron.iastate.edu Curator : Marica Imsamde, mimsande@mendel.agron.iastate.edu Contact : Dave Schrader, schrader@mendel.agron.iastate.edu ACEDB-Version : 3.7 Last_update : August 1995 FTP : probe.nalusda.gov in pub/soybase Gopher : probe.nalusda.gov:7000/11/genome.databases/ WWW : http://probe.nalusda.gov:8300/plant/ WWW : http://mendel.agron.iastate.edu:8000/main.html Database : Syndb Species : Homo sapiens, Mus musculus Subject : STS content mapping & directed sequencing of Human Chromosomes 21,5 with Mouse for syntenic comparison ACEDB_version : acedb v3.3 plus moulon server Last_update : October 1994 FTP : genome.lbl.gov in pub/acedb/ WWW : http://genome.lbl.gov/Genome/acepage.html Curator : Donn F. Davy, DFDavy@lbl.gov Contact : Arun K. Aggarwal, aggarwal@genome.lbl.gov PI : Michael Palazzolo PI : Chris Martin PI : Jan-Fang Cheng, jcheng@genome.lbl.gov Database : Toxo Species : Toxoplasma gondii PI : Jennie Blackwell PI : Jim Ajioka Last_update : September 1995 ACEDB_version : 4.1 Contact : Martin Aslett, ma10025@cus.cam.ac.uk FTP : parsun1.path.cam.ac.uk WWW : http://parsun1.path.cam.ac.uk/ Curator : Martin Aslett Curator : Howard Cobb Database : TreeGenes Species : Forest trees ACEDB_version : 3.0 Last_update : July 1995 Curator : Bradley K. Sherman, bks@s27w007.pswfs.gov PI : David B. Neale, dbn@s27w007.pswfs.gov Contact : Dendrome@s27w007.pswfs.gov FTP : probe.nalusda.gov in /pub/treegenes Gopher : s27w007.pswfs.gov/ Gopher : probe.nalusda.gov:7508/ Gopher : probe.nalusda.gov:7000/11/genome.databases/ WWW : http://probe.nalusda.gov:8300/plant/ WWW : http://s27w007.pswfs.gov/ Database : Trypbase Species : Trypanosoma brucei PI : Sara Melville Curator : Martin Aslett, ma10025@cus.cam.ac.uk Curator : Howard Cobb, hc102@econ.cam.ac.uk Contact : sm160@mole.bio.cam.ac.uk ACEDB_version : 4.1 (Sun and Linux) FTP : parsun1.path.cam.ac.uk WWW : http://parsu1.path.cam.ac.uk Database : 21Bdb Species : Homo sapiens Subject : STS content mapping and sequencing of Human Chromosome 21 ACEDB_version : acedb.1-10 plus moulon server Curator : Donn F. Davy, DFDavy@lbl.gov Contact : Arun K. Aggarwal, aggarwal@genome.lbl.gov PI : Michael Palazzolo PI : Chris Martin PI : Jan-Fang Cheng, jcheng@genome.lbl.gov Last_update : April 1994 FTP : ftp://genome.lbl.gov in pub/acedb/ WWW : http://genome.lbl.gov/Genome/acepage.html Database : 22ace Species : Homo sapiens Subject : Physical map of human chromosome 22, genomic sequencing and more ACEDB_version : 4.1 Curator : Ian Dunham, id1@sanger.ac.uk Curator : Gareth Maslen, glm@sanger.ac.uk PI : Ian Dunham Last_update : August 1995 FTP : ftp.sanger.ac.uk in pub/human/chr22/physical_map/ WWW : http://www.sanger.ac.uk/hum22/ Database : VoxPop Species : Populus species Curator : Carl G. Riches, cgr@poplar1.cfr.washington.edu PI : Reinhard F. Stettler, STETTLER@coyote.cfr.washington.edu Last_update : September 1993 ACEDB_version : 1.9 FTP : poplar1.cfr.washington.edu in /pub/ Gopher : poplar1.crf.washington.edu Return to List of Questions Q5: What documentation exists for ACEDB? ++++++++++++++++++++++++++++++++++++++++ A5: +++ From Sam Cartinhour: The ACEDB Documentation Server is a repository for documentation concerned with "A C. elegans Data Base", the generic genome database software designed by Richard Durbin (MRC, UK) and Jean Thierry-Mieg (CNRS, France). The server is intended as a resource for developers, curators, and end-users of all (not just plant) databases derived from ace. Eventually we hope to offer all kinds of documentation, from reprints to (technical) gossip. The ACEDB documentation server is sponsored by the Plant Genome Database Project at the National Agricultural Library (USDA). The documentation server is listed on the home page for the Agricultural Genome World Wide Web Server at http://probe.nalusda.gov:8000 . Primary documents from the developers are: o acedb -- A C. elegans Database: I. Users' Guide. o acedb -- A C. elegans Database: II. Installation Guide. o acedb -- A C. elegans Database: III. Configuration Guide. o Syntactic Definitions for the ACEDB Data Base Manager --Jean Thierry-Mieg and Richard Durbin (1991-) Get By anonymous ftp from ncbi.nlm.nih.gov in repository/acedb: ftp://ncbi.nlm.nih.gov/respository/acedb/doc*tar.Z and ftp://weeds.mgh.harvard.edu/acedb_doc . The files are in TeX (Jean Thierry-Mieg suggests latex xxx.tex; dvi2ps xxx.dvi > xxx.ps; lpr xxx.ps) and PostScript. The Proceedings from the May 1995 ACEDB Conference are available at http://probe.nalusda.gov:8000/acedocs/ace95/index.html A final summary report is available at http://probe.nalusda.gov:8000/acedocs/ace95/ace95.final.html . Japanese language guides: _Japanese ACEDB Guide Ver.1.2._ _ACEDB ver.2 for NEC engineering workstation EWS4800 series_ are available in PostScript via anonymous ftp at ftp.nec.co.jp as /pub/packages/acedb/acemanjp.1_2.ps.Z . There is a Japanese language ACEDB FAQ available at http://www.cbi.or.jp/~sano/acemanjp12/index.html SampleDB, by Dave Matthews, is an ACEDB database constructed to demonstrate features of ACEDB, especially map and sequence displays. Anonymous ftp to probe.nalusda.gov:pub/acedocs/sampledb You will find interesting documents in the wdoc subdirectory of the ACEDB distribution. The Australian National Genomic Information Service has prepared good documentation of the C. elegans version as Angistute.ps and angistute.hqx available by anonymous ftp at ncbi.hih.gov in repository/acedb/ace2. Cherry, J.M., Cartinhour, S.W., and Goodman, H.M. (1992) AAtDB, An Arabidopsis thaliana Database. Plant Molecular Biology Reporter 10 (4): 308-309,409-410 Tutorial manual for AAtDB: Cartinhour, S., Cherry, J.M., and Goodman, H.M. (1992) An Introduction to ACeDB: For AAtDB, An Arabidopsis thaliana Database. Massachusetts General Hospital. (Available on request in printed form from the AAtDB curator). URL : http://genome-www.stanford.edu/docs/aatdb_man.html . A description of ACEDB: Cherry, J.M. and Cartinhour, S.W. (1994) ACEDB, A tool for biological information. in Automated DNA Sequencing and Analysis, edited by M. Adams, C. Fields, and C. Venter. Academic Press, pages 347-356. [text is available through ftp or gopher from weeds.mgh.harvard.edu] URL : http://probe.nalusda.gov:8000/acedocs/overview.html . Another description of ACEDB for physical mapping projects: Dunham, I., Durbin, R., Mieg, J-T & Bentley, D.R. (1994) Physical mapping projects and ACEDB, in Guide to Human Genome Computing. Ed. Bishop, M.J. Academic Press, pages 111-158. [text is available through ftp or gopher from weeds.mgh.harvard.edu] Return to List of Questions Q6: What other resources are available for ACEDB? +++++++++++++++++++++++++++++++++++++++++++++++++ A6: +++ Perl and WWW tools ++++++++++++++++++ > The AGIS server at the National Agricultural Library provides a tool set for integrating version 4 of ACEDB with perl and the World-Wide Web. The archive is ftp://probe.nalusda.gov/pub/tools/acelib.tar.gz For a general tool for converting data to ACEDB format input files, Joachim Baumann (joachim.baumann@informatik.uni-stuttgart.de) has written the Perl program TextConvert, available at ftp.informatic.uni.stuttgart.de/pub/DART/TextConvert . The Developers' Archive +++++++++++++++++++++++ Mike Cherry maintains an archive of tools that may be useful in curating ACEDB databases. It can be reached by anonymous ftp at URL ftp://weeds.mgh.harvard.edu/acedb_dev/ or via gopher at gopher://genome-gopher.stanford.edu:70/11/ftp If you have a contribution place it in ftp://weeds.mgh.harvard.edu/acedb_dev/incoming/ and send a message to Mike (cherry@genome.stanford.edu). The Biosci conference bionet.software.acedb +++++++++++++++++++++++++++++++++++++++++++ There is a USENET/Biosci conference titled bionet.software.acedb created expressly for discussion of ACEDB. The best way to interact with the Biosci conferences is via a newsreader like rn, trn, tin or a WWW browser. Consult your system administrator for more information. If you do not have access to the Biosci conferences via a newsreader (e.g. rn, trn, tin) you can participate in the conference by electronic mail. To subscribe to the e-mail version of the conference send email to biosci-server@net.bio.net (UK, European readers use biosci@uk.ac.daresbury or biosci.daresbury.ac.uk) with no subject line and only the message subscribe ACEDB-SOFT in the body. To unsubscribe send the message unsubscribe ACEDB-SOFT to the same address. This is an automated service. Your e-mail address will be taken from the header of the message that you send. If you then send mail to acedb@net.bio.net the mail will be distributed to all subscribers and to the electronic conference. o All of the articles in biosci.software.acedb are archived by Biosci at gopher://gopher.bio.net/1/ACEDB o Mike Cherry makes it possible to search past articles in biosci.software.acedb using WAIS at gopher://genome-gopher.stanford.edu:80/77/.index/acedb-biosci and at URL http://genome-www.stanford.edu/biosci_acedb.html . If your WWW browser is configured properly you may be able to read the newsgroup at news:biosci.software.acedb . And more ++++++++ The AAtDB, Soybase, GrainGenes, Mace, and TreeGenes [see Q4] databases regularly submit data to the Plant Genome Database at the National Agricultural Library (NAL). Nal makes this data available via the WWW using an http server with URL: http://probe.nalusda.gov:8000/index.html You will also find a selection of models.wrm files (schemata) for the various databases here. You will want to get a "mosaic client" to examine this. AboutDB is a stab at an integrated info and project tracking database for the 'Greater ACEDB Community'. It was conceived and implemented by Staffan Bergh (staffan@biochem.kth.se), the 'coordinator', during the ace94 workshop in Montpellier, based on an earlier effort by John McCarthy. The aim is to collect information on all aspects of ACEDB use as a database manager. Currently it contains information on Databases implemented in ACEDB, Colleagues in the community, some Tools for >curators of ACEDB databases and some of the information on 'magic tags' collected during the ace94 workshop. AboutDB can be reached at URL: http://kiev.physchem.kth.se/AboutDB.html Other URL's that readers with mosaic clients might want to examine are: o http://moulon.inra.fr/acedb/acedb.html for C. elegans data o http://kiev.physchem.kth.se/MycDB.html for Mycobacterium data o http://moulon.inra.fr:8001/acedb/igd.html for an integrated genome database. For information on how these were created see http://moulon.inra.fr/acedb_conf_eng.html and en francais http://moulon.inra.fr/acedb_conf.html A how-to manual on the Moulon server is available at http://keck.tamu.edu/cgi/staff/ace-mosaic-howto.html The Genome Computing Group, Lawrence Berkeley Laboratory, has an anonymous ftp service at machine genome.lbl.gov which contains: o flydb - LBL's Drosophila Acedb-style database o 21bdb - LBL's Human Chromosome 21 Acedb-style database o querdb - LBL's query-language extensions to Acedb o metadata - LBL's compendium of Acedb database schema variants o macace-aatdb-demo.hqx - pre-release Acedb MacIntosh version o There is also a repository of contributed software for data conversions and the like. [From Otto Ritter] IGD - the Integrated Genomic Database - is an international project of DKFZ, Heidelberg (Germany), CNRS, Montpellier (France), ICRF, London (UK), LBL, Berkeley (USA), and MRC, London/Cambridge, (UK). IGD is an extensible object-oriented distributed information management system with one global schema, physical data integration at the back-end, and local data management at the front-end. It supports local schema evolution and local data integration, and has a potential for truly virtual "on-the-fly" integration (federation) of its resource databases. Beside data integration, IGD provides graphical user interface, client/server communication, and seamless interface to a growing number of tools for structure, sequence, genetic, physical and comparative mapping analysis. ACEDB is the IGD main software component for data management. As a database, IGD integrates and references genome related data from public sources. As an analysis tool, IGD provides uniform interface to existing programs and program packages for tructure and sequence analysis, genetic and physical map construction and analysis, etc. In addition to the major human and mouse databases already planned SWISS-PROT/PIR, PDB, GDB, OMIM, CitDB, CEPH, CHLC, CEPH-Genethon, Genbase, UK DNA ProbeBank, RLDB2, CAD, MGD, MouseBackcross DB), crossreferences will be maintained to dataabases established around specific model organisms (C.elegans, D. melanogaster, S. cerevisiae, pombe etc.). Refs: o 1/ Ritter,O.: The Integrated Genomic Database. in Computational Methods in Genome Research, edited by S.Suhai, Plenum, 57-73 (1994). o 2/ Ritter,O., Kocab,P., Senger,M., Wolf,D., and Suhai,S.: Prototype Implementation of the Integrated Genomic Database, Computers and Biomedical Research, 27, 97-115 (1994) Computer staff for the UC Berkeley Drosophila physical mapping project the LBL Human Chromosome 21 project, and the LBL plant genome projects meet regularly to coordinate their ACEDB extension and development efforts, along with Frank Eeckman, who is working on the Macintosh version of ACEDB (for further information, contact jlmccarthy@lbl.gov). They also keep in close touch (via email, personal visits, etc.) with their counterparts in Cambridge (Richard Durbin et al), Montpellier Jean Thierry-Mieg et al), and the Interated Genome Database project in Heidelburg (Otto Ritter, Detlef Wolf et al). Return to List of Questions Q7: How should ACEDB be cited? ++++++++++++++++++++++++++++++ A7: +++ From the distribution: We realize that we have not yet published any "real" paper on ACEDB. We consider however that anonymous ftp servers are a form of publication. We would appreciate if users of ACEDB could quote: Richard Durbin and Jean Thierry Mieg (1991-). A C. elegans Database. Documentation, code and data available from anonymous FTP servers at lirmm.lirmm.fr, cele.mrc-lmb.cam.ac.uk and ncbi.nlm.nih.gov. Papers involved in database development could quote more precisely: I. Users' Guide. Included as part of the ACEDB distribution kit, II. Installation Guide. Included as part of the ACEDB distribution III. Configuration Guide. Included as part of the ACEDB distribution and the preprintkit available via anonymous ftp. Jean Thierry-Mieg and Richard Durbin (1992). Syntactic Definitions for the ACEDB Data Base Manager. Included as part of the ACEDB distribution. --Jean and Richard. Return to List of Questions Q8: Is ACEDB object-oriented? +++++++++++++++++++++++++++++ A8: +++ From the ACEDB User's Guide: A major current vogue in computer languages and database design is for ``object-oriented'' systems. It's also a source of lots of argument. We are just trying to build a good system, and don't want to get caught in the crossfire, but we do talk about organising our data into objects and classes. We have undoubtedly been influenced by many of the ideas going around, but it isn't likely our system would be regarded as kosher by the object- oriented community. In particular there is no class hierarchy, nor inheritance, and it is written in a modular but non-ideological way in straight C. However display and disk storage methods are class dependent. In some ways the class hierarchy is replaced by our system of models and trees, which seems to be rather unusual. We think it is very natural for the representation of biological information, where for some members of a class a lot might be known about some aspect, but for most only a little is known. The advantages of our sytem over a relational database, such as Oracle or Sybase, is our ability to refine our descriptions without rebuilding the database and the possibility of organising the storage of data on disk according to their class, i.e. we store in a very different way the tree-objects and the long stretches of DNA sequence. Return to List of Questions Q9: How can I get on/off the ACEDB announcements mailing list? ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ A9: +++ To get on or off the mailing list send mail to rd@mrc-lmb.cam.ac.uk or mieg@kaa.crbm.cnrs-mop.fr. New releases of the software are announced to this list and very little else. The BIOSCI newsgroup bionet.software.acedb [See Q6 for details] is on the mailing list. Return to List of Questions Q10: When and where is the Next ACEDB Workshop? +++++++++++++++++++++++++++++++++++++++++++++++ A10: ++++ The 1996 Workshop is not yet scheduled. If you would like to see some pictures of the ACEDB '94 Workshop in St. Matthieu de Treviers, there are online collections: o by Mike Cherry at http://genome-www.stanford.edu/~cherry/pics/acedb-94.pics.html ; o by John Morris at http://weeds.mgh.harvard.edu/ace94/ace94.image.html ; o and by Brad Sherman at ftp://s27w007.pswfs.gov/ACEDB/ace94pix.html Return to List of Questions Q11:Who prepared this document & where is the current version? ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ A11: ++++ This document will be posted monthly to the BIOSCI newsgroup bionet.software.acedb and to USENET conference news.answers. It is intended to be used as an index to ACEDB databases and to information about the database software. The latest text version of the ACEDB FAQ should be available via anonymous ftp at machine net.bio.net as file pub/BIOSCI/ACEDB/ACEDB.FAQ or at rtfm.mit.edu as pub/usenet/news.answers/acedb-faq . If you only have electronic mail, the FAQ can be retrieved from mail-server@rtfm.mit.edu. There is an HyperText Markup Language (HTML) version of this document available on the World Wide Web: http://probe.nalusda.gov:8000/acedocs/acedbfaq.html and http://s27w007.pswfs.gov/Homepage/acedbfaq.html There is a Japanese language FAQ available at http://www.cbi.or.jp/~sano/acemanjp12/index.html Curators of ACEDB databases should take note of Question 4 and keep me apprised of changes. Errors of commission or omission are unintentional. If I have forgotten to give you credit please let me know. Please send comments and corrections to: acedbfaq@s27w007.pswfs.gov Major contributions in getting this FAQ off the ground were made by Mike Cherry, John McCarthy, and Doug Bigwood. Other contributors include: o Lisa Lorenzen o David Matthews o Edie Paul o Donn Davy o Eric De Mund o Sam Cartinhour Please cite as: Sherman,B.K., ACEDB Genome Database Software FAQ, ftp://rtfm.mit.edu/pub/usenet/news.answers/acedb-faq, http://probe.nalusda.gov:8000/acedocs/acedbfaq.html, 1993,1994,1995 approx. 50K bytes. To add or modify information in this document, please send mail to: acedbfaq@s27w007.pswfs.gov Bradley K. Sherman Dendrome Project Institute of Forest Genetics P.O. Box 245, Berkeley, CA, 94701 Phone: 510-559-6437 Fax: 510-559-6440 The Dendrome Project and TreeGenes are funded by the USDA ARS Plant Genome Research Program. Return to List of Questions End of ACEDB FAQ --bks From owner-acedb@net.bio.net Wed Nov 29 22:00:00 1995 Path: biosci!FRUITFLY.BERKELEY.EDU!suzi From: suzi@FRUITFLY.BERKELEY.EDU (Suzanna Lewis) Newsgroups: bionet.software.acedb Subject: Re: FAQ notes Date: 30 Nov 1995 14:17:49 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 9 Sender: daemon@net.bio.net Distribution: world Message-ID: <199511302212.OAA15576@fruitfly.berkeley.edu> NNTP-Posting-Host: net.bio.net Hi Brad, I forgot one thing else. We now (finally) have a web version of EofD. The url is shoofly.berkeley.edu. We're still touching it up, but its mostly functional though the server itself may be on and off as we add new features. -S From owner-acedb@net.bio.net Thu Nov 30 22:00:00 1995 Path: biosci!internet!biosci!not-for-mail From: biohelp (BIOSCI Administrator) Newsgroups: bionet.software.acedb Subject: IMPORTANT: BIOSCI miniFAQ Date: 1 Dec 1995 02:00:33 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 196 Sender: daemon@net.bio.net Distribution: world Message-ID: <199512011000.CAA24056@net.bio.net> NNTP-Posting-Host: net.bio.net This is a new "miniFAQ" designed to answer the questions that come up the *most frequently*. The main BIOSCI FAQ (Frequently Asked Questions) is accessible on the World Wide Web at URL http://www.bio.net/. Contents: -------- 1) What to do about "spams," i.e., junk mail, ads, etc. 2) Examples of subscribing and unsubscribing to the mailing lists. 3) How to access BIOSCI/bionet newsgroup archives. 4) The BIOSCI user address and research interest directory. 1) What to do about "spams," i.e., junk mail, ads, etc. ------------------------------------------------------- BIOSCI is a set of parallel USENET newsgroups (the "bionet" groups) and mailing lists. The same postings are distributed on both media (except for a small number of mailing-list-only groups at net.bio.net). Unfortunately it is becoming a despicable practice on the Internet (by a few people out to make a fast buck) to do automated mass postings to thousands of newsgroups and mailing lists. These attempts to grab free advertising are refered to as "spams" in the usual, somewhat boneheaded, net terminology. USENET is more susceptible to this practice, and many spams originate on the USENET groups and then are passed on to the mailing lists. However, spammers also get lists of mailing addresses and hit these too, so neither medium is immune. What should you do personally if you get junk mail? --------------------------------------------------- Just delete it and move on without reading it further. Filing a protest is becoming increasingly useless because spammers are often disguising the addresses where the messages are sent from. Unless you really understand Internet mail systems, your attempt at protest by sending replies to the message will often end up being sent to the address of an innocent person that the spammer is victimizing. What can BIOSCI/bionet do to protect its newsgroups? ---------------------------------------------------- The only solution currently available is to moderate the newsgroup. If this newsgroup is already moderated, then you are in good shape. Moderation protects the newsgroups from about 95% of the spams that are being sent to date. This means that someone has to take the time to review each message before it goes out. We have set up software here that simply allows the moderator to forward to an address at net.bio.net messages that (s)he wishes to have distributed. This takes no more time than that needed to read the message and pass it on, say about 1 min. per message. Most newsgroups currently have a discussion leader who is responsible for their newsgroup. The discussions leaders and their e-mail addresses are listed in the BIOSCI Information Sheet which is available on the Web at http://www.bio.net/. If a newsgroup is being hit with too many junk postings, please contact the discussion leader for that group and see if there is interest in moderating the group. Please do not assume that by simply posting a complaint to the newsgroup itself, anyone on the BIOSCI staff will act on your complaint. With close to 100 newsgroups to run, the BIOSCI staff has to rely on the discussion leaders of each newsgroup to report problems directly to us at biosci-help@net.bio.net. We will moderate any of our newsgroups if the discussion leader tells us that the readership of the group wishes to do so and if a moderator is willing to do the work. For most BIOSCI/bionet groups, this entails only a few minutes of work each day. Moderating a newsgroup will resolve probably 95% of the junk postings. Unfortunately there are easy ways for determined spammers to override the moderation mechanism. We are working on new systems to provide access to our newsgroups over the WWW. These should be available soon, probably November 1995, and will allow you to use your Web browser to look at the news postings. While this will not stop spammers from trying to post to the groups, this will give you yet another way, besides using USENET news, to keep the junk out of your personal mail files. 2) Examples of subscribing and unsubscribing to the mailing lists. ------------------------------------------------------------------ PLEASE NOTE: The BIOSCI management does NOT act on subscription/unsubscription requests that are posted improperly to the newsgroups and mailing lists. People who do this only bother everyone on the lists to no avail. Please be sure to follow the proper procedures below. Gory details are in the BIOSCI Information sheets on the Web at http://www.bio.net. Below we give an example utilizing the METHODS-AND-REAGENTS list at both of our two BIOSCI sites: Users in the Americas and Pacific Rim countries who use the BIOSCI ------------------------------------------------------------------ node at computer net.bio.net: ---------------------------- A) Determine the "listname" which is the <=8 character mail address ^^^^^^^^^^^^^ for the group. These can be found in the BIOSCI Info. Sheet. For the METHODS-AND-REAGENTS group the mailing address is methods@net.bio.net. The listname is the portion of the address to the left of the @ sign, i.e., "methods". The listname is used with the "subscribe" and "unsubscribe" commands illustrated below. B) Mail all commands in the body of a mail message addressed to biosci-server@net.bio.net. Do NOT send commands to the newsgroup posting addresses! Leave the Subject: line blank, any text on it will be ignored. C) In the body of your message put one or more of the following commands with an "end" command on the last line, e.g., subscribe methods unsubscribe methods end Do NOT put your e-mail address or other text on these lines. The server only allows you to cancel your subscription if the address on your mail header matches the address on our mailing list. Please ask for help at biosci-help@net.bio.net if your address has changed, e.g., if you know you are on the list but the server tells you that you are not a member. Users in Europe, Africa, and Central Asia who use the BIOSCI node at -------------------------------------------------------------------- computer daresbury.ac.uk (also known as dl.ac.uk): ------------------------------------------------- To subscribe and unsubscribe to/from the BIOSCI lists, you need to specify the full USENET newsgroup name with "bionet-news." prepended. The USENET newsgroup names are listed in the BIOSCI Information sheet on the Web at http://www.bio.net/. For the METHODS-AND-REAGENTS list the USENET newsgroup name is bionet.molbio.methds-reagnts, thus the appropriate commands are sub bionet-news.bionet.molbio.methds-reagnts unsub bionet-news.bionet.molbio.methds-reagnts These commands are included in a message addressed to mxt@dl.ac.uk, NOT to the newsgroup mailing addresses. As usual, include the text in the body of the message as text on the Subject: line is ignored. To unsubscribe from all the lists at the UK node, use unsub bionet-news Please note that if the address in the list is different than the one in your mail message header, you will not be able to unsubscribe by this method. If you have problems, please mail biosci@daresbury.ac.uk. 3) How to access BIOSCI/bionet newsgroup archives. -------------------------------------------------- Back postings of all BIOSCI/bionet newsgroups can be found on the World Wide Web at URL http://www.bio.net/. There are several searchable newsgroup indices at this site. E-mail users can search the BIOSCI archives by using our waismail e-mail server. For instructions send the message help to waismail@net.bio.net. Leave the Subject: line blank (anything entered on the Subject: line is ignored). 4) The BIOSCI user address and research interest directory. ----------------------------------------------------------- Please take this opportunity to add your name, address, and research interest information to the BIOSCI User Address Database if you have not already done so. You can fill out the address form directly through our Web page at URL http://www.bio.net/adrform.html. The address database is reindexed nightly for WWW access (the URL is http://www.bio.net/). If you are not directly on the Internet but can reach it by e-mail, please use our waismail server to access the user directory. waismail use is described above. You can also request a user address form by e-mail from biosci-help@net.bio.net. Please check your database entry from time-to-time to see if your address information is still up-to-date. Because of our limited personnel resources, we ask that you resubmit a *complete* form to revise your entry; we only replace complete entries and do not have resources to edit old forms. Sincerely, Dave Kristofferson BIOSCI/bionet Manager biosci-help@net.bio.net From owner-acedb@net.bio.net Thu Nov 30 22:00:00 1995 Path: biosci!ns1.faseb.org!lamarck.sura.net!sprout.nalusda.gov!usenet From: Doug Bigwood Newsgroups: bionet.software.acedb Subject: Re: aceclient vs. xace and WWW Date: 1 Dec 1995 14:31:20 GMT Organization: Genome Informatics Group Lines: 25 Message-ID: <49n3jo$7ev@sprout.nalusda.gov> References: <49hkkv$79r@is.bbsrc.ac.uk> NNTP-Posting-Host: locus.gig.usda.gov Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 1.1N (X11; I; SunOS 5.4 sun4m) X-URL: news:49hkkv$79r@is.bbsrc.ac.uk Matt: The purpose of the aceserver/client is simple to allow a remote user access to a database w/o having to have a complete copy of the data locally. This is useful if a database changes frequently and the user doesn't want the bother of keeping a local copy up-to- date. Also, space for a database might be a problem. As you suggest this would be an alternate to tace or WWW. Also, we use the aceserver as a back end to our WWW interface (using the perl aceclient) - see the documentation on http://probe.nalusda.gov . Doug Bigwood Couchman@BBSRC.AC.UK (Matt) wrote: >Is there a quick summary available about the purpose of aceclient and >aceserver? I have a lot of technical details about how to set them up. >However I'm still unclear as to whether they are intended as an >alternative to a local copy of xace and access to WWW. If not what extra >features do they offer? > >Thanks for any help, > >Matt.