From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!uwm.edu!zaphod.mps.ohio-state.edu!sol.ctr.columbia.edu!destroyer!uunet!munnari.oz.au!uniwa!nuntius From: mike@chi.uwa.edu.au (Mike Schon-Hegrad) Newsgroups: bionet.software Subject: Mac Image Analysis Software Query Message-ID: <1992Jul7.043142.24128@uniwa.uwa.edu.au> Date: 7 Jul 92 04:31:42 GMT Sender: news@uniwa.uwa.edu.au (USENET News System) Organization: Western Australian Research Institute for Child Health Lines: 28 Nntp-Posting-Host: andrew.chi.uwa.edu.au X-Useragent: Nuntius v1.1b2 I would appreciate it a great deal if there is someone out there who is familiar with Image Analysis software for the Macintosh, who let me know of the packages that are available. We hope to set up a system with a video camera connected to a light microscope with which we will be able to do densitometry on individual cells stained with the immunoperoxidase system. I would hope to set up the system with the flexability to use the Mac to capture video of cell cultures and create QuickTime movies etc. I am aware of the product ImageAnalyst. Has anyone used this product and what do you think about it? Are there other software applications out there that do similar things? Thanks in advance for any advice given .......... _________________________________________________ Mike Schon-Hegrad Research Officer Western Australian Research Institute for Child Health Roberts Road, SUBIACO Western Australia 6008 Phone (09) 340 8388 Fax (09) 388 3414 email mike@chi.uwa.edu.au __________________________________________________ From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!uwm.edu!zaphod.mps.ohio-state.edu!sol.ctr.columbia.edu!destroyer!uunet!munnari.oz.au!uniwa!nuntius From: mike@chi.uwa.edu.au (Mike Schon-Hegrad) Newsgroups: bionet.software Subject: Mac Image Analysis Software Query Message-ID: <1992Jul7.043024.24006@uniwa.uwa.edu.au> Date: 7 Jul 92 04:30:24 GMT Sender: news@uniwa.uwa.edu.au (USENET News System) Organization: Western Australian Research Institute for Child Health Lines: 28 Nntp-Posting-Host: andrew.chi.uwa.edu.au X-Useragent: Nuntius v1.1b2 I would appreciate it a great deal if there is someone out there who is familiar with Image Analysis software for the Macintosh, who let me know of the packages that are available. We hope to set up a system with a video camera connected to a light microscope with which we will be able to do densitometry on individual cells stained with the immunoperoxidase system. I would hope to set up the system with the flexability to use the Mac to capture video of cell cultures and create QuickTime movies etc. I am aware of the product ImageAnalyst. Has anyone used this product and what do you think about it? Are there other software applications out there that do similar things? Thanks in advance for any advice given .......... _________________________________________________ Mike Schon-Hegrad Research Officer Western Australian Research Institute for Child Health Roberts Road, SUBIACO Western Australia 6008 Phone (09) 340 8388 Fax (09) 388 3414 email mike@chi.uwa.edu.au __________________________________________________ From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!UMAIL.UMD.EDU!William_D_WARREN From: William_D_WARREN@UMAIL.UMD.EDU (ww40) Newsgroups: bionet.software Subject: Can you index the indecies ? Message-ID: <9207070248.AA04866@umailsrv0.UMD.EDU> Date: 7 Jul 92 02:48:00 GMT Sender: daemon@genbank.bio.net Distribution: bionet Lines: 17 G'day all, I have recently taken the bull by the horns and started to explore GOPHER and it's bridge into WAIS and find it a great resource. However as a non-programmer I don't really have a good grasp of the underlying structure of these systems, so this may be an impossible suggestion but could, for example, a WAIS index of all the WAIS and/or gopher holes be set up so that, when you know the kind of information you are looking for, and don't want to search pseudo-randomly from hole to hole trying to remember where you last came across something appropriate, you enter a few keywords and *hay presto* a short list of matches appears before your eyes ??? My apologies if this already exists and I have yet to find it !!! Bill From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!uwm.edu!zaphod.mps.ohio-state.edu!wupost!uunet!stanford.edu!leland.Stanford.EDU!dov From: dov@leland.Stanford.EDU (Dov Shiffman) Newsgroups: bionet.software Subject: RNA structure Message-ID: <1992Jul6.221545.1839@leland.Stanford.EDU> Date: 6 Jul 92 22:15:45 GMT Sender: news@leland.Stanford.EDU (Mr News) Organization: DSG, Stanford University, CA 94305, USA Lines: 5 I am interested in a program that calculates secondary structures of RNA. Can anyone direct me to such a program or a reference ? Thnx, Dov From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!rutgers!jvnc.net!darwin.sura.net!europa.asd.contel.com!uunet!uunet!bounce-back From: stanley@oce.orst.edu (John Stanley) Newsgroups: news.announce.newgroups,news.groups,bionet.software,comp.dsp,comp.graphics,comp.graphics.visualization,alt.graphics.pixutils,sci.comp-aided,sci.optics Subject: RESULT: sci.image.processing passes 1158: 36 Message-ID: <1992Jul6.181551.28229@uunet.uu.net> Date: 6 Jul 92 18:15:51 GMT Sender: tale@uunet.uu.net (David C Lawrence) Followup-To: news.groups Organization: orst.edu Lines: 1209 Approved: tale@uunet.uu.net Xref: bionet news.announce.newgroups:2367 news.groups:41222 bionet.software:2811 comp.dsp:3674 comp.graphics:20810 comp.graphics.visualization:2067 alt.graphics.pixutils:3781 sci.comp-aided:122 sci.optics:1115 The voting period for sci.image.processing ended on 30 June 1992. There were 1158 yes votes received, and 36 no votes. The margin of yes votes is > 100, and more than 2/3 of the voters voted yes. The vote passes. The 5 day waiting period prior to newgrouping now begins. I wish to thank those who voted, and Jonathan Kamens for collecting the votes. "yes" votes (1158): "MVUC::DUCKSBURY"@HERMES.MOD.UK "MVUD::MVARGA"@HERMES.MOD.UK DetlevHeinemann <196968%DOLUNI1.BITNET@mitvma.mit.edu> 712_jkb2@white.whoi.edu (JON BRODZIAK - NOAA/NMFS/WOODS HOLE) Jim Sullivan <76237.160@CompuServe.COM> 8726688@U.WASHINGTON.EDU 88opensi!sartin@uunet.UU.NET ara (Alastair Allen) <@aberdeen.ac.uk:ara@kelvin> A J Shire Adrian Evans Dima Gromov A_WILLISGT@CCSVAX.SFASU.EDU (Ty Willis) aa@mr.picker.com (anthony "mailman" apicella) abed@venus.wustl.edu (Abed M. Hammoud) abridle@polaris.cv.nrao.edu (Alan Bridle) acidec@umbio.med.miami.edu (Arthur Cideciyan) acooper@rkw-risc.cs.up.ac.za (Antony Cooper) Bill Adkins Aggelos Katsaggelos agl@mayo.EDU (Al Larson) Brainwave Surfer aguarini@mbunix.mitre.org (Andrea Guarini) ahlers@physf.uni-bielefeld.de (Gerhard Ahlers) airglow@phys.ucalgary.ca (AIRGLOW Generic User) Andrew J Wilson Tony Travis AKARPOWICZ@mta.ca akindele@loria^I alan@kaman.com (Alan Piszcz) "Alan Braggins, SDL" alans@juliet.ll.mit.edu ( Alan Stein ) Alberto Accomazzi alberto@ipvvis.unipv.it (Alberto Biancardi) Alan L. Clark alexm@cipr-psych.MGH.Harvard.Edu (Alex Milshteyn) Adrian F Clark allston@babbage.ibd.nrc.ca (Jeff Allston) am1@ukc.ac.uk amartin@huey.WPI.EDU (Allen Martin) amini@newt.hac.com (Afshin Amini) Amit Gulati andersa@isy.liu.se (Anders ]str|m) andersl@saaf.se (Anders Lindquist) andre@cv.ruu.nl andrew@rentec.com (Andrew Mullhaupt) Andrew Verrill andreww@chemical-eng.edinburgh.ac.uk andrey@cco.caltech.edu (Andre T. Yew) Andrew Wallace andys@mph.sm.ucl.ac.uk (Andrew Simmons) Anton Kruger anne@igor.tamri.com (Anne Smith) Antonio Ortega APLer@cup.portal.com arbogast@statsci.com (Emmanuel Arbogast) archerb@uinta.ssc.gov (Bill Archer x2313 120H) Art Hsu armon@wrc.xerox.com (Armon Rahgozar) Noam H. Arzt Abdul Saheed from Waikato NZ ASHVIN@vaxc.cc.monash.edu.au astroman@netcom.com (SignalMan) The Maverick atilgan@Athena.MIT.EDU atreyi@iss.nus.sg (Atreyi Kankanhalli) babcock@cs.montana.edu (Ray S. Babcock) baker@aio.jsc.nasa.gov (Ken Baker) balog@bandit.psc.edu BAMIMPR%BRFAPESP.BITNET@mitvma.mit.edu bandu@acsu.buffalo.edu (Jagath Samarabandu) banks@phys.vuw.ac.nz (Timothy Banks) barrus@tree.egr.uh.edu (Karl L. Barrus) bart@cv.ruu.nl bas@cv.ruu.nl batman@nvl.army.mil (john dome) BAYLISSB@topaz.ucq.edu.au bcr@mda.ca (Brian Robertson) Bob Beason behera@sioux.unl.edu (Siddharth Behera) behling@ariel.bms.com (Ronald W. Behling) Gunter Bellaire bergstro@src.honeywell.com (Pete Bergstrom) beser@aplcomm.jhuapl.edu (Nick Beser) Besier@uaimzb.Mathematik.Uni-Mainz.DE bfh@cogito.b15.ingr.com Vasudev Bhaskara Pratima Bhoj bi299aq@sdcc14.UCSD.EDU (Phyllis Pugh) "Mario A. Bianchet" Guoqiang Bi bilge%trbilun.BITNET@mitvma.mit.edu (Bilge Alp) billb@vasc.bih.harvard.edu (Bill Butler) billp@ncsa.uiuc.edu (Bill Pottenger) billr@ims.com (Bill Rea) Barry J Burbach Bj|rn Reynisson Benny Lovstrom black@seismo.CSS.GOV (Mike Black) blask@ecn.purdue.edu (Steven G Blask) bleier@menu.visus.com (Alan Bleier) bloom@ee (Jeffrey A Bloom) Brian Marshall Sadler bn244@cleveland.Freenet.Edu bng@tropel.gca.com (Siu-Yan Baldwin Ng) bob@ipac.caltech.edu "Bob Billson" bob@sunspot.sunspot.noao.edu (Bob Riegelmann) bobdavis@viewlogic.com (Bob Davis) body@cpsc.ucalgary.ca (Richard Body) bollini@ipvvis.unipv.it (Alessandro Bollini) bollman@wrc.xerox.com (Jim Bollman) borghese%dylink.usc.edu@usc.edu (Borghese) marsmcro!br@uunet.UU.NET (Brian Rosen) brabec@pysgjb.physics.ncsu.edu (Charles Brabec) braun@uts-phys.phys.uts.EDU.AU (Michael Braun) bremel@calshp.cals.wisc.edu bs@mda.ca (Bruce Sharpe) bsb@catinhat.noarl.navy.mil (Brian S. Bourgeois) "Ben Gerber" bsherman@genome.lbl.gov (Brad Sherman) Mark Bullen buming@emx.cc.utexas.edu (Buming Bian) Busato Andre butler@spdc.ti.com (Stephanie Butler) Bruce White 3807 bwallet@apssgi.nswc.navy.mil (Brad Wallet) cah@relito.medeng.wfu.edu (Craig Hamilton) Michael Cammer (Frans v d Wel) can@zaphod.mitre.org (Christopher Nissen) carlos@emmy.UCSD.EDU (Carlos) Caroline McDonnell carroll@asw.ds.boeing.com (Bill Carroll) castalia@gaea.lpl.arizona.edu (Bradford Castalia) catfish!swash!tim@uu.psi.com cattaneo@ipvvis.unipv.it (Pierluca Cattaneo 21315) "T.Laochaiwat" ceg@pnet51.orb.mn.org (Chris Galas) C.E. Hawkins cetin%trbilun.BITNET@mitvma.mit.edu (Enis Cetin) cflatter@laphroaig.AOC.NRAO.EDU (Chris Flatters) Christopher Mullins Chuck Fowler cgu@cernapo.cern.ch (Chuang Gu ) chandra@cerc.wvu.wvnet.edu Charlie_Cochran.McLean_CSD@xerox.com charters@quartz.geology.utoronto.ca (Jim Charters) CHENNING@PRCVM8.VNET.IBM.COM chesters@climate.gsfc.nasa.gov (Dennis Chesters) chiafari@umbc3.umbc.edu (Francis A. Chiafari) CHINN@CHEVAX.CHEME.WASHINGTON.EDU chirst@imagine.matrox.com (Chris Hirst) Christopher Russell chris@ironwood.ntu.edu.au (Chris Devonport) Christopher.Klein@Eng.Sun.COM (Christopher Klein) chuck-grant@llnl.GOV cjk@sunipx.cis.pitt.edu (Carl Joel Kuzmich (624-1885)) CLARIDGE@wronz.org.nz Claude.Fuhrer@info.unine.ch cld@genii.com CLIFF@survey.dn.mu.oz.au Steve Clift clough@csis.dit.csiro.au clunie@ohsu.EDU (David Clunie) Chad Ray McDaniel cmurray@acorn.co.uk (Chris Murray) cn@allgfx.agi.oz (Con Neri) cohen@berlioz.nsc.com (Jeff Cohen) Gregg Cohen Colin Urquhart Coral Bernier courtney@aivru.shef.ac.uk (Patrick_Courtney) Dianne Cox coyne@seismo.CSS.GOV (John Coyne) craigb@resmel.bhp.com.au (Craig Blundell) Craig Hockenberry craigj@cs.sfu.ca CRC@LEICESTER.AC.UK cristy@magick.es.dupont.com (Cristy) croteau@ccwf.cc.utexas.edu (Ed Croteau) csax@peptide.nci.nih.gov (Carl Saxinger) cschneid@nautilus.er.usgs.gov (Chris Schneider) log off my account thankyou CTHOMSON@vax.clarku.edu cullen@cpsc.ucalgary.ca (Cullen Jennings) Ross Cunniff Curtis Heisey cvc@bruna.inescn.pt (Carlos Vaz de Carvalho) "Charles Wiles, Planetary Image Centre, ULO, UCL" CZBRENN%DACTH11.BITNET@mitvma.mit.edu David Nettleton David Walker Douglas Lutz "Jerry Liu" David Erb dah@tko.vtt.fi (David Harwood) dal@mda.ca (Dale Lutz) Dale.O.Anderson@aurora.engr.latech.edu, Ph.D. dan@austin.asd.sgi.com (Dan Baca x1032) Dan_Jacobson@ATT.COM Ron Daniel danielle@chama.eece.unm.edu (Danielle Argiro) danj@welchgate.welch.jhu.edu (Dan Jacobson x-8453) dann@subs.struct.swri.edu (Nicolella) dario@cns.nyu.edu (Dario Ringach) datri@lovecraft.convex.com (Anthony A. Datri) dave@imax.imax.com (Dave Martindale) Dave Childs daves@rsl.geogr.unizh.ch David.Berry@Eng.Sun.COM (David Berry) David.Flinn@West.Sun.COM (David Flinn - Sun SFValley - 818-905-0200) David DeGraff davida@lsl.co.uk davidb@chaos.ncsc.org (David Bennett) David Howard dbauer@sioux.unl.edu (Deanna Bauer) dbb@riscy.nyo.dec.com (dave barrett) dbk@sunpix.East.Sun.COM (Doug Kubel - Sun NC Development Center) dbriggs@zia.AOC.NRAO.EDU (Daniel Briggs) Don DeVoe dean@aoa.utc.com (Dean Wormell) dean@karron.med.nyu.edu deaso@nvl.army.mil (Bob Deaso) debs@ccwf.cc.utexas.edu (Deborah Summa) DEERFIELD@B.PSC.EDU dehon@platon.greco-prog.fr (Dehon Olivier) delisle@eskimo.celestial.com (Ben Delisle) Doron Meyer DENIS@cism.univ-lyon1.fr diaz@sigi.sps.mot.com (Rafael Diaz) dickw@iastate.edu "Diglio A. Simoni" dinosaur@minnie.cs.su.oz.au (Dino John Ho) djc@oxygen.aps1.anl.gov (Daniel J. Ciarlette B362 C-153 x2-4015) djchin@vaxkiller.agi.org Dustin C. Johnston "David J. Savory" "Dominique Thongs" David Bainbridge DKIRSCHT%UVMVM.BITNET@mitvma.mit.edu dkrohn@bgrsu0.er.usgs.gov (Krohn) dlc@ddsdx2.jhuapl.edu (Dave Collard x7468) dlwood@mailbox.syr.edu (David L Wood) "Dr. David Matthews, IPST, Univ. of Maryland, College Park, (301)405-4830, dmatthews@uap.umd.edu" dns@essnj3.essnjay.com (David Sears) dona@nwra.com (Dona) DONG%RADPH6.DECNET@relay.the.net dong@uhibpd.phys.uh.edu (Lei Dong) donna@natasha.eece.u From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!kristoff From: kristoff@genbank.bio.net (David Kristofferson) Newsgroups: bionet.software Subject: Re: NCBI needs help Message-ID: Date: 6 Jul 92 18:11:01 GMT References: <1992Jul2.000544.48208@embl-heidelberg.de> <1992Jul2.153711.26151@ccu.umanitoba.ca> <1992Jul3.164154.7020@ccu.umanitoba.ca> Distribution: bionet Organization: GenBank Online Service Lines: 27 > The proposed limitations on NCBI DO interfere > with the academic software developers. We simply do not have the > resources to produce professional quality tools with slick user-interfaces > and inter-platform compatibility. Toolkits of the type that the > NCBI has developed are a way out of this dilemma. We will not > get them from industry, because it is not in their interest to > create them. Brian, I agree with many of the other points that you make in your thoughtful posting, but I do want to bring up another alternative in the above case. Academic developers can always try to *license* their software to commercial companies. If this goes against their grain to profit from their work, then I can obviously understand their reluctance to do so. For those who are less fastidious, the resources *are* there if their program is sufficiently useful to enough scientists to make it commercially viable. If an NCBI interface was only used on programs with limited appeal, then commercial companies would obviously have no complaints. If the program does have commercial appeal, but the author's scruples prevent him from marketing it, then we have another kettle of fish as to whether or not the taxpayer should subsidize such cases. Dave From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!uwm.edu!wupost!uunet!darwin.sura.net!Sirius.dfn.de!chx400!bernina!neptune!gonnet From: gonnet@inf.ethz.ch (Gaston Gonnet) Newsgroups: bionet.software Subject: Re: Evolution should not be equated with mutation, etc Message-ID: <1992Jul6.165331.10902@neptune.inf.ethz.ch> Date: 6 Jul 92 16:53:31 GMT References: <1992Jul4.231658.6365@ac.dal.ca> Sender: news@neptune.inf.ethz.ch (Mr News) Organization: Dept. Informatik, Swiss Federal Institute of Technology (ETH) Lines: 25 Nntp-Posting-Host: rutishauser-gw.inf.ethz.ch In article <1992Jul4.231658.6365@ac.dal.ca> arlin@ac.dal.ca writes: >Two terminological muddles that warrant clarification: > >1. PAM stands simply for "percent accepted mutations" and not "point accepted >mutations per 100 residues," as Gonnet and colleagues suggest (p. 1444, top >left). I don't know where this interpretation started, but I've seen it many >times before. Obviously, since "percent" is Latin for "per 100", both >statements say exactly the same thing-- the only difference is that Dayhoff's >original coinage conforms smoothly to the acronym "PAM," while the other >coinage does not. =============================================== I do not care too much about the etymology of "PAM", however I dislike the use of the term "percent", as people immediately think of a "percentage" which is now incorrect. It is not a "percentage" of mutated points, else we could not have 250% ! > >2. But there is a more serious problem with terminology, which may reflect an >underlying misunderstanding of the evolutionary process (I hope not!). The >log-odds matrix that appeared in Figure 2 of Gonnet et al. (Science 256: 1444) >is in no correct sense a "mutation" matrix; ================================================= I explained in an earlier posting that there was an error in the labelling of this figure. Gaston H. Gonnet, Informatik, ETH, Zurich. From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!uwm.edu!cs.utexas.edu!uunet!bonnie.concordia.ca!IRO.UMontreal.CA!CC.UMontreal.CA!coady From: coady@ERE.UMontreal.CA (Coady Michael) Newsgroups: bionet.software Subject: Re: Looking for DataMinder Message-ID: <1992Jul6.144625.15873@cc.umontreal.ca> Date: 6 Jul 92 14:46:25 GMT References: <1992Jul4.195206.15024@tamsun.tamu.edu> <1992Jul6.141622.15257@cc.umontreal.ca> Sender: news@cc.umontreal.ca (Administration de Cnews) Organization: Universite de Montreal Lines: 12 Okay, I'll try again as the last effort to write in resulted in garbage. I'm trying to get ahold of the program DataMinder, which was described in a recent CABIOS article. The article said that the program was available for ftp at helix.nih.gov but all I could find in the /pub directory was a /DataMinder subdirectory that was empty. If Dr. Usdin (the author of the program) or the SysAdmin from this group is reading this, could you please get in touch with me to let me know how I can access this program? Thank you. Mike Coady COADY@ERE.UMONTREAL.CA From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!uwm.edu!cs.utexas.edu!uunet!bonnie.concordia.ca!IRO.UMontreal.CA!CC.UMontreal.CA!coady From: coady@ERE.UMontreal.CA (Coady Michael) Newsgroups: bionet.software Subject: Looking for DataMinder Summary: Am unable to find the DataMinder program at helix.nih.gov Message-ID: <1992Jul6.141622.15257@cc.umontreal.ca> Date: 6 Jul 92 14:16:22 GMT References: <1992Jul4.195206.15024@tamsun.tamu.edu> Sender: news@cc.umontreal.ca (Administration de Cnews) Organization: Universite de Montreal I've been trying to get a hold of the program DataMinder, which was However, the article (Hypercard-based data management tools for Lines: 2 Mike Coady COADY@ERE.UMONTREAL.CA From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!FCRFV3.NCIFCRF.GOV!GUNNELL From: GUNNELL@FCRFV3.NCIFCRF.GOV (Mark A. Gunnell) Newsgroups: bionet.software Subject: Re: NCBI needs help Message-ID: <920706104311.21000237@FCRFV3.NCIFCRF.GOV> Date: 6 Jul 92 14:43:11 GMT Sender: daemon@genbank.bio.net Distribution: bionet Lines: 119 Return-Path: Received: from genbank.bio.net by fcrfv1.ncifcrf.gov with SMTP ; Thu, 2 Jul 92 12:22:26 EST Received: by genbank.bio.net (5.65/IG-2.0) id AA16618; Thu, 2 Jul 92 09:03:28 -0700 Received: by genbank.bio.net (5.65/IG-2.0) id AA16612; Thu, 2 Jul 92 09:03:26 -0700 Message-Id: <9207021603.AA16612@genbank.bio.net> To: bio-soft@genbank.bio.net From: frist@ccu.umanitoba.ca Subject: Re: NCBI needs help Date: 2 Jul 92 15:37:11 GMT Sender: news@ccu.umanitoba.ca Nntp-Posting-Host: niven.cc.umanitoba.ca In article <1992Jul2.000544.48208@embl-heidelberg.de> rice@embl-heidelberg.de (Peter Rice) writes: >In article <9206261908.AA19473@rna.cshl.org>, roberts@CSHL.ORG (Dr. Richard >Roberts at Cold Spring Harbor Laboratory) writes: >> >> NCBI in trouble >> >> David Lipman and the NCBI are under attack from Congressman Natcher's >> Appropriations Sub-committee. It is being argued that they should stop >> producing Entrez, BLAST and other software products for distribution to >> the scientific community, because they compete unfairly with commercial >> enterprises that do the same thing. As a result there is a move to delete ... rest of Robert's post deleted... > >I have seen absolutely *no response* to this on the net, apart from an >assurance via Dave Kristofferson (only to bionet.announce) that: > >>I posted a message from Dr. Richard Roberts to this forum the other >>day about the current predicament at NCBI. >> >>I should also say, in the interest of fairness, that a response will >>be made by the Biotechnology Software Manufacturer's Association in >>the very near future. >> >>I would submit that fairness requires your hearing both sides of the >>story before reaching a conclusion and acting on it. > >Nice suggestion, but Rich Roberts asked for responses by 1st July, and >so far there has been no further explanation. > >It all looks reminiscent of what happened around this time last year. >The GCG package was banned by the U.S. Dept. of Commerce as too dangerous >to be released to anyone outside the USA, WHAAAAAT???? Too DANGEROUS? Could we have some elaboration on this one? > and nobody complained (well, all >the customers complained loudly to GCG, but nobody complained publicly). >After three long months of no support (waiting for release 7.0, so I could >test my programs which were included on the tape), it was released to a >restricted list of friendly countries which still excluded several of the >EMBL member states. > >The main reason for the lack of response that time appears to have been CYA, >in the hope that "I won't be next". I wonder how much NCBI did to help that >situation, as now they find themselves in the firing line and hoping to be >rescued, as indeed they should be. > >These are not the only idiocies in US Biotechnology, as seen from outside. We >have also seen the refusal to sign the Biodiversity treaty at Rio because of >the possible financial impact on biotechnology companies, and a curious >clause in the PDB distributors contract. Also I recall GCG leaving the >University of Wisconsin in a hurry to stay ahead of the lawyers in a similar >sounding case to this one. > >The choice is easy here - if we in Europe and the rest of the world can't depend >on the availability of the US products, we will have to do everything ourselves. Be careful- if you start producing your own freeware tools and (shudder) give them away (you commies!), it might be considered economic terrorism! >First the software is hit, then the databases, then the services. When will it >stop? Only when somebody with influence in the US cries *ENOUGH*. One of the many positive things to come from the 60's was the development of an attitude of distrust for industry, which resulted in legislation that prevented monopolies, exploitation, and allowed for greater regulation of workplace and product safety. The propaganda campaigns of Reagan/Bush have completely reversed this attitude in the US. We're returning to "what's good for General Motors is good for the USA." Until this naive assumption can be changed, we will continue to see paranoid policies such as you describe. >What would we do without Entrez, Blast or GCG? We may soon have to find out. In the case of NCBI, it's not just Entrez or Blast but the whole developer's toolkit that they provide. In principle, this should save a great amount of reinvention of the wheel. The whole point here is that you could NEVER get something like that from a commercial firm, because it is not in their best interests to release source code. What they want to do is create more and more products. However, there is only a very limited amount of money to pay for those products. In my opinion, the availability of tools such as those from NCBI is potentially a great boon to science, as well as a very economical step. It costs the taxpayer a lot less if an agency like NCBI produces tools that everyone can use. Shouldn't that be a consideration? > ----------------------------------------------------------------------------- > Peter Rice, EMBL | Post: Computer Group > | European Molecular > Internet: Peter.Rice@EMBL-Heidelberg.DE | Biology Laboratory > | Postfach 10-2209 > Phone: +49-6221-387247 | W-6900 Heidelberg > Fax: +49-6221-387306 | Germany > > ... and occasionally price@crc.ac.uk ... =============================================================================== Brian Fristensky | Department of Plant Science | "Ya don't have to be a rocket surgeon University of Manitoba | ta know who's who!" Winnipeg, MB R3T 2N2 CANADA | frist@ccu.umanitoba.ca | Office phone: 204-474-6085 | - the incomparable Don Cherry FAX: 204-261-5732 | =============================================================================== From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!uwm.edu!wupost!cs.utexas.edu!uunet!mcsun!Germany.EU.net!rrz.uni-koeln.de!biomed.biolan.uni-koeln.de!KHOFMANN From: khofmann@biomed.biolan.uni-koeln.de Newsgroups: bionet.software Subject: Re: Protein structure prediction Message-ID: <1992Jul06.122044.112116@rrz.uni-koeln.de> Date: 6 Jul 92 12:20:44 GMT References: <242@cucrd0.med.columbia.edu> Sender: news@rrz.uni-koeln.de (Usenet News System) Reply-To: khofmann@biomed.biolan.uni-koeln.de Organization: Biochemical Institute, Cologne University Lines: 25 In article <242@cucrd0.med.columbia.edu>, ferenc@cucrd0.med.columbia.edu (Dr. Ferenc Czegledy) writes: > > There are many algorithms available for protein secondary structure >prediction. I am particularly interested in obtaining a program called >AMPHI which I recetly read about (Jahnig, F : Structure prediction of >for membrane proteins. in "Prediction of Protein Structure and the Princ- >iples of Protein Conformtion", ed. Fasman, GD, Plenum Press, New York, >1989). If anyone knows how to obtain this program please let me know(e.g. ftp). >If anyone knows how to obtain other programs for predicting amphipathic >structures (e.g. by Fourier analysis) I would be also be interested in Jaehnigs program AMPHI is available from ftp.embl-heidelberg.de and probably from a lot of other places. His method is also included into the more general protein analysis program PROFILEGRAPH, which has a special focus on detection of amphipathic structures and can apply several methods for doing so. PROFILEGRAPH is available from the following places: NETSERV @ EMBL-HEIDELBERG.DE (send message GET DOS_SOFTWARE:PROGRAPH.UAA) or by FTP from BIOMED.BIOLAN.UNI-KOELN.DE FTP.EMBL-HEIDELBERG.DE FTP.BIO.INDIANA.EDU or from a lot of other bio-FTP sites From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!agate!ames!elroy.jpl.nasa.gov!usc!snorkelwacker.mit.edu!thunder.mcrcim.mcgill.edu!sifon!monod!francis From: francis@monod.biol.mcgill.ca (Francis Ouellette) Newsgroups: bionet.software Subject: Re: Who should run a biologically oriented netw Message-ID: <1992Jul5.201252.13361@sifon.cc.mcgill.ca> Date: 5 Jul 92 20:12:52 GMT References: <12937@gazette.bcm.tmc.edu> Sender: news@sifon.cc.mcgill.ca Reply-To: francis@monod.biol.mcgill.ca Organization: The Alpha - Omega Project Lines: 26 Nntp-Posting-Host: monod.biol.mcgill.ca so690561@mbcr.bcm.tmc.edu (Susan Elizabeth Olson) writes: ... [ lots of good stuff removed relating to how to pick the best of CS and Biology ] > I think lots of different kinds of people could do > the job well, but I wouldn't want to put the job squarely on one person's > shoulders. > > Susan Olson > Graduate Student > Department of Microbiology and Immunology > Baylor College of Medicine > Houston, TX here, here! francis --- | B.F. Francis Ouellette | manager, yeast chromosome I project | dept of biology, McGill university, Montreal, Qc, Canada | francis@monod.biol.mcgill.ca From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!agate!ames!tulane!wupost!think.com!news.bbn.com!hsdndev!nmr-z!opal.mgh.harvard.edu!cherry From: cherry@frodo.mgh.harvard.edu (Mike Cherry) Newsgroups: bionet.software Subject: Re: Evolution should not be equated with mutation, etc Message-ID: <5JUL199201241330@opal.mgh.harvard.edu> Date: 5 Jul 92 06:24:00 GMT References: <1992Jul4.231658.6365@ac.dal.ca> Sender: cherry@opal.mgh.harvard.edu (Mike Cherry 726-5955) Organization: Molecular Biology, Massachusetts General Hospital, Boston Lines: 21 News-Software: VAX/VMS VNEWS 1.41 Nntp-Posting-Host: opal.mgh.harvard.edu Just a minor correction. In article <1992Jul4.231658.6365@ac.dal.ca>, arlin@ac.dal.ca writes... >1. PAM stands simply for "percent accepted mutations" and not "point accepted >mutations per 100 residues," as Gonnet and colleagues suggest (p. 1444, top >left). I don't know where this interpretation started, but I've seen it many >times before. Obviously, since "percent" is Latin for "per 100", both >statements say exactly the same thing-- the only difference is that Dayhoff's >original coinage conforms smoothly to the acronym "PAM," while the other >coinage does not. This is not what can be found in the "Atlas of Protein Sequence and Structure" edited by M. Dayhoff. The definition of PAM is stated as a "rearranged acronym for Accepted Point Mutations" and then described as a measure of the number of individual amino acid changes occurring per 100 amino acid residues as a result of evolution. This interpretation started because M. Dayhoff wrote these words, or presumably at least edited these words. Mike Cherry From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!agate!ames!tulane!darwin.sura.net!europa.asd.contel.com!uunet!psinntp!nstn.ns.ca!ac.dal.ca!arlin From: arlin@ac.dal.ca Newsgroups: bionet.software Subject: Evolution should not be equated with mutation, etc Message-ID: <1992Jul4.231658.6365@ac.dal.ca> Date: 5 Jul 92 02:16:58 GMT Organization: Dalhousie University, Halifax, Nova Scotia, Canada Lines: 77 Two terminological muddles that warrant clarification: 1. PAM stands simply for "percent accepted mutations" and not "point accepted mutations per 100 residues," as Gonnet and colleagues suggest (p. 1444, top left). I don't know where this interpretation started, but I've seen it many times before. Obviously, since "percent" is Latin for "per 100", both statements say exactly the same thing-- the only difference is that Dayhoff's original coinage conforms smoothly to the acronym "PAM," while the other coinage does not. 2. But there is a more serious problem with terminology, which may reflect an underlying misunderstanding of the evolutionary process (I hope not!). The log-odds matrix that appeared in Figure 2 of Gonnet et al. (Science 256: 1444) is in no correct sense a "mutation" matrix; also "mutation" is mis-used to describe site differences between two sequences (middle right of p. 1444, and elsewhere). A genetic mutation is a cellular event in which a nucleic acid genomic sequence changes slightly. We also use the term "mutation" to describe the phenotypic effects of such a genetic mutation: for instance, the sudden appearance of a novel alcohol dehydrogenase allele or of a white-eyed fly in a drosophila population would represent "mutation". My own personal way to remain precise and consistent in making distinctions is to reserve "mutation" to describe the molecular mutational process, and use "mutant allele" and "mutant phenotype (or trait)" to describe the effect of this process on a "mutant individual's" genotype and phenotype. Whether or not one chooses to adopt the above set of distinctions, there is no sense in which a "mutation" is an ALLELE REPLACEMENT, the unit step in genetic evolution. Genetic evolution may begin with the process of mutation, but it does not stop there. Most mutant alleles that arise by mutation are neutral or deleterious. Deleterious mutant alleles tend to be removed by selection; only a few rare neutral or advantageous mutant alleles go on to be fixed by selection or drift: the vast majority of the neutral and advantageous mutant alleles that arise by mutation are quickly lost by genetic drift (for reference, see Tables 8.8.2.1 and 8.8.2.2 in Crow and Kimura, _An Introduction to Population Genetics Theory_, p. 422-423). That is, "mutation" is only the first step in the process of genetic evolution, and the vast majority of mutant alleles arising from mutation play no lasting role in evolution. Thus, saying that evolution is a bunch of mutations is in some ways like saying that a garden is a handful of seeds: most seeds are lost, and even those that bear fruit have been carefully planted and tended-- both seeds and gardening are necessary and creative steps in the process. Equating an evolutionary change with a "mutation" recalls a non-Darwinian hypothesis called "mutationism," which died out over 50 years with the advent of evolutionary population genetics. Of course, no one here subscribes to that outmoded view-- but that's the way it sounds, unfortunately. The "A" in "PAM" acknowledges that evolution involves more than mutation by implying that some mutations are "accepted" by a vague sort of evolutionary filtering process, while others are not. Although "accepted mutations" is better than just "mutations", it does not do adequate justice to 70 years of population genetics theory. A consistent and valuable set of terms is as follows: a difference between two amino acid sequences is not a "mutation" but a "difference," or "site difference." We may infer that a difference resulted from a process of "amino acid replacement," which is fundamentally a result of "allele replacement." The number of amino acid replacements necessary to account for the observed level of difference between the sequence is fundamentally a distance measure (see my earlier post on "distance" and "difference"). The sort of probability matrix pioneered by Dayhoff is an "log odds AMINO ACID REPLACEMENT probability matrix", not any kind of "mutational" probability matrix. Many readers will recognize that these suggestions were not invented by me, since Walter Fitch, editor of Molecular Biology and Evolution, used to make prescriptions regarding these terms, insisting that manuscripts refer to observed differences as "differences" rather than as "mutations", and the inferred allele replacements as "nucleotide substitutions" (for genes) or "amino acid replacements" (for proteins), rather than as "mutations" or "differences." Arlin Stoltzfus Department of Biochemistry Dalhousie University Halifax, Nova Scotia arlin@ac.dal.ca From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!agate!ames!tulane!wupost!usc!sol.ctr.columbia.edu!destroyer!ubc-cs!utcsri!torn!csd.unb.ca!morgan.ucs.mun.ca!nstn.ns.ca!ac.dal.ca!arlin From: arlin@ac.dal.ca Newsgroups: bionet.software Subject: Distance metrics should not be equated with time Message-ID: <1992Jul4.230050.6364@ac.dal.ca> Date: 5 Jul 92 02:00:50 GMT Organization: Dalhousie University, Halifax, Nova Scotia, Canada Lines: 38 Traditionally, evolutionary distance is not restricted to units of time (as Larry Moran suggests), nor is it directly observable (as others have implied)-- "difference" is what is directly observable. For instance, it is clear that human and gorilla beta-hemoglobin differ at 1 site in their amino acid sequences (Lys-104 in gorilla vs Arg-104 in humans, if I remember correctly). We may say that the proteins "have a single site DIFFERENCE;" or "are DIFFERENT at 1/146 of sites (they have 146 amino acids, I think);" or "are 0.68% DIFFERENT." An evolutionist may inform us that this manifestly countable DIFFERENCE does not tell the whole evolutionary story; that, actually, due to the small but finite probability of parallel amino acid replacements in both beta-hemoglobins (or forward and backward changes in one of them), a difference of 0.68% corresponds to 0.71% expected amino acid replacements in the divergence of the two sequences: this value, which is calculated from the observed DIFFERENCE, is a DISTANCE. As a distance measure, it would be based on a model that purports to reflect at least some aspects of the actual series of evolutionary events that took place, and accounts for the changes that are hidden, as well as those that are apparent as present-day observable DIFFERENCES. The reason it is may be unwise to equate distance with time is simply that entities evolve at different rates. For instance, pea and cow Histone H2 have a single amino acid difference, just like human and gorilla beta hemoglobin. These two pairwise protein comparisons would therefore yield similar difference and distance values. However, the histone pair has been diverging roughly 100 times as long as the beta-hemoglobin pair (compare 7 MY for human/gorilla with perhaps 700 MY for pea/cow). [Now that I've written this it occurs to me that pea and cow histone H2 may actually have identical amino acid sequences, not a single difference, but this would only strengthen the example.] Arlin Stoltzfus Department of Biochemistry Dalhousie University Halifax, Nova Scotia arlin@ac.dal.ca From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!ucselx!hsb From: hsb@ucselx.sdsu.edu (Hirdeypal S. Bhathal) Newsgroups: bionet.software Subject: summary of intron/exon splice site programs Message-ID: <1992Jul4.222711.7033@ucselx.sdsu.edu> Date: 4 Jul 92 22:27:11 GMT Organization: San Diego State University Computing Services Lines: 260 I got four response for my request about intron/exon splice site programs. I haven't tried any yet. I am bit lazy to send personal mail to people who asked for summary so I am posting all the responses. Thanks to all who responded to my request. ----------------------------------------------------------------------------- - Response #1 try GRAIL =======>>>>> send email "help" to grail@ornl.gov ----------------------------------------------------------------------------- Response #2 Such a program was announced on the bionet.general board in mid-May. It is used via the NetGene mail server. To quote the hlpe info: "The NetGene mail server is a service producing neural network prediction of splice sites in vertebrate genese as described in Brunak, S., et al., 'Prediction of Human mRna Donor and Aceeptor Sites from the DNA Sequence,' J. Mol. Biol 220: 49-65 (1991)." The info can be obtained by e-mail to Jacob Engelbrecht engel@virus.fki.dth.dk Department of Physical Chemistry The Technical University of Denmark A second source of help is the GeneID artificial intelligence system for analyzing vertebrate genomic DNA and predicting exons and gene structure. Obtain more informaton from steen@darwin.bu.edu. This program accepts e-mail inquiries. Hope the infomration is useful. Gregg Wells Department of Pathology University of Pennsylvania Philadelphia, PA 19103-4283 e-mail: pathology@a1.mscf.upenn.edu ------------------------------------------------------------------------------ Response #3 Hi Hirdeypal: I do not know of any programs that are specifically available for this purpose. I can suggest the following. Many computer programs relevant to biological sciences are available at two sites that I know. Although I have not done it before, I was given to understand that you can download the programs by ftp from these sites. I would suggest you check these places. They are ftp.bio.indiana.edu and geneserver.uh.edu I believe you may be helped by a person who knows more about this. May be you can send a mail to him. His address is gilbert@bio.indiana.edu We recently published a paper in June biotechniques that can identify the potential for silent mutagenesis to introduce restriction enzyme sites. This program can also be used to identify sites that can be mutated to introduce other small sequences like splice sites. If that is anywhere near what your plans are, go through the paper biotechniques 12:882-884. If you are interesting in getting the program free of cost, send me a diskette (DOS formatted), I will be very happy to send you one. I hope you will find what you are looking for. If you need anything else, let me know. Raj Shankarappa bsh@med.pitt.edu Pathology, University of Pittsburgh, 730B Scaife Hall, Pittsburgh PA 15261. ---------------------------------------------------------------------------- Response #4 Here is a pointer to a good program. It is really for predicting exons but finds likely splice sites in the process. The program is not as good as mine :-) but then mine is still in development. GENEID AND NETGENE ONLINE SYSTEMS FOR PREDICTION OF GENE STRUCTURE version 1.0 2/1/1992 GENEID _______________________________________________________________________________ Geneid is an Artificial Intelligence system for analyzing vertebrate genomic DNA and prediction of exons and gene structure (1). A prototype is implemented as a fast, automatic email-response system. Users have the option of having their DNA sequence analyzed by NetGene (2) simultaneously. REGISTRATION: Before or simultaneously with submitting a sequence for analysis, you need to register your name by sending a line with the word "register", followed by your name and address. Example: register, Don Johnson, Miami Vice, Baywiev Marina Dock A12, Miami, FL 34566- 1234, U.S.A. NOTE>> The line can be longer than 80 characters as long as it contains NO linebreaks, (that is, do NOT press the key until the end of the address.) Send the line in a mail to: geneid@darwin.bu.edu. The registration information will only be used for maintaining a file of the number and geographic distribution of the users. SUBMITTING SEQUENCES: Your sequences must be submitted in the following format (approximately same format as used for fasta, BLAST and GRAIL): You can submit only one sequence per mail. Put the sequence after the keyword "Genomic Sequence" as shown below: Genomic Sequence >seqname TTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCC CGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTG GCCAACTCCATCACTA................... (Restrict the line length to 80 characters. The seqname is limited to 20 characters). NOTE>> IF YOUR MAIL DOES NOT CONTAIN THE KEYWORD "GENOMIC SEQUENCE", OR ANY OTHER KEYWORDS LISTED IN THIS FILE, NO MAIL WILL BE RETURNED TO YOU. If the reply file with the results will exceed the Mail limit of 300 kB, the reply will be split into several files. On a UNIX system you could send the File containing the sequence as follows: mail -v geneid@darwin.bu.edu Date: 4 Jul 92 19:52:06 GMT Sender: news@tamsun.tamu.edu (Read News) Organization: Texas A&M University Lines: 14 Is there anyone out there have a program or information for calculating the Fisher discriminant vectors? The Fisher discriminant vectors is the eigenvectors for the following equation: A*x = lambda*Bx where A is the between class scatter matrix and B is the within class scatter matrix. The rank of B is n for large sample data set, however, the rank of A is usually n-1 or less. Personal e-mail is welcomed. Thank you. Maranatha mchung@ee.tamu.edu From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!agate!ames!elroy.jpl.nasa.gov!swrinde!cs.utexas.edu!uunet!olivea!decwrl!access.usask.ca!ccu.umanitoba.ca!frist From: frist@ccu.umanitoba.ca Newsgroups: bionet.software Subject: Re: NCBI needs help Message-ID: <1992Jul3.164154.7020@ccu.umanitoba.ca> Date: 3 Jul 92 16:41:54 GMT References: <1992Jul2.000544.48208@embl-heidelberg.de> <1992Jul2.153711.26151@ccu.umanitoba.ca> Sender: news@ccu.umanitoba.ca Distribution: bionet Organization: University of Manitoba, Winnipeg, Manitoba, Canada Lines: 261 Nntp-Posting-Host: niven.cc.umanitoba.ca Main points: A. THE LINE BETWEEN PUBLIC AND PRIVATE IS SOMETIMES FUZZY B. THERE IS A PLACE FOR PUBLICLY-SUPPORTED DATABASES AND SOFTWARE TOOLS C. DOES NCBI REALLY COMPETE WITH INDUSTRY? D. THERE IS ALSO A PLACE FOR COMMERCIAL SOFTWARE E. SOFTWARE REPRESENTS A UNIQUE WAY TO SAVE MONEY IN RESEARCH. F. WHERE DO WE DRAW THE LINE BETWEEN WHAT SHOULD BE DONE IN THE PRIVATE SECTOR OR THE PUBLIC SECTOR? In article kristoff@genbank.bio.net (David Kristofferson) writes: >frist@ccu.umanitoba.ca writes: > >>Be careful- if you start producing your own freeware tools and (shudder) >>give them away (you commies!), it might be considered economic terrorism! >Let's "get real," folks. None of the NCBI controversy extends to >academic developers and the public domain software produced by them. I disagree with you here. See B below. A. THE LINE BETWEEN PUBLIC AND PRIVATE IS SOMETIMES FUZZY >You may have forgotten this by now, but the first major public domain >software source (the BIONET lending library) and all of these freely >accessible newsgroups came from the BIONET National Computer Resource >for Molecular Biology under a grant to a **commercial company.** If I >remember correctly, you, Brian, were a donor to the lending library. >The kind of exaggeration provided above simply obscures the issues. >Let's look at some of these now. I acknowledge your point as well taken. Academic researchers have benefited from commercial concerns such as Intelligenetics, as per your example. At the same time, Intelligenetics, while being a commercial firm, has depended heavily on the public sector for support. It was founded using the Stanford MOLGEN programs, and has also had a major influx of funds from the GenBank contract. This is a case of the public sector paying for something to be done, but having it done by a private contractor. In a sense, the NCBI is only one step farther along in the same continuum. They produce things for science with a budget appropriation instead of a contract. They employ people, and hire subcontractors (eg. to produce conpact discs) and put money back into the economy in much the same way that a private firm does. The main difference is that they don't have to show a profit. B. THERE IS A PLACE FOR PUBLICLY-SUPPORTED DATABASES AND SOFTWARE TOOLS >>In the case of NCBI, it's not just Entrez or Blast but the whole >>developer's toolkit that they provide. In principle, this should save a >>great amount of reinvention of the wheel. The whole point here is that >>you could NEVER get something like that from a commercial firm, because >>it is not in their best interests to release source code. What they >>want to do is create more and more products. >>However, there is only a very limited amount of money to pay for those >>products. In my opinion, the availability of tools such as those from NCBI >>is potentially a great boon to science, as well as a very economical >>step. It costs the taxpayer a lot less if an agency like NCBI produces >>tools that everyone can use. Shouldn't that be a consideration? > >I believe that Steve Smith at Harvard (and possibly others out there) >have been working on user interfaces that are freely distributable and >include source code. That is perfectly within Steve's right to do so. Here is one of my main points. There are many tasks that have not been put into commercial packages, because commercial packages have to identify the main things that everybody does and do these things well. (There is some circularity here, because what people do is dependent on what's available to them). This means, though that you can't plug new functionalities into commercial packages, a problem that has been very elegantly solved in Steve Smith's GDE. This brings us to a more general issue, which is that much of the academic software that appears in journals might as well not exist, because of incompatibility between packages, and, more importantly, the enormous amount of effort needed in porting to different systems and in writing user interfaces (easily 90% of the work). Here, NCBI has made a unique contribution: a) In the GenInfo backbone, they have standardized data representation using the ASN.1 protocols, and at the same time provided a link between some very diverse databases. b) They have created a set of tools for interfacing with the backbone, which saves the programmer from having to write routines to access the database and for user interfaces. In the ideal, what this means is that someone like myself can concentrate on writing the code to do some new and useful thing with the database, and not have to waste a lot of time on the nuts and bolts, in particular with the user interface! * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * The proposed limitations on NCBI DO interfere with the academic software developers. We simply do not have the resources to produce professional quality tools with slick user-interfaces and inter-platform compatibility. Toolkits of the type that the NCBI has developed are a way out of this dilemma. We will not get them from industry, because it is not in their interest to create them. * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * C. DOES NCBI REALLY COMPETE WITH INDUSTRY? > >My understanding of *federal* regulations, however, is that the >*government* is not allowed to compete against private industry. NCBI >and the commercial developers (which have been in this field for quite >a few years) have tried to work out ways in which they can cooperate >instead of compete, but this requires a careful delineation of >responsibilities which I understand has been worked out at least in >part. Obviously NCBI plays an important role in database production >and has also produced some very nice database searching software which >we use on GOS (BLAST and IRX). Just how broad of a mandate that they >have, however, is one subject of controversy. I contend, for reasons given in a) and b), that NCBI is not competing with private industry, which I why I was so mad at the suggestion that they were. The creation of the tools and standards mentioned above do not compete with private industry, because these are just not the kind of things that industry can be expected to do. It would not be in their best interests to create a toolkit that anyone can use, unless there was a large enough market to be able to sell it. I would not be against the use of this toolkit by industry to produce their own products. If anything, that would add to the universality and intercomatibility of software for all concerned. What I do not want to happen is for the standards and tools to be undermined by a group of companies who would complain that they are losing a market that doesn't exist in the first place. D. THERE IS ALSO A PLACE FOR COMMERCIAL SOFTWARE >As a hypothetical >example, it would obviously be direct competition with the private >sector if they were to distribute a comprehensive sequence analysis >package because many of these have been available from a variety of >sources for many years. Yes, and on this point I am completely in agreement. The comercial software products are very good, although many of them are outside the budgets of a lot of labs. However, there is obviously a market for them and I think that's fine. NCBI, as far as I know, has not developed any sort of comprehensive seq. analysis package that would compete with PC-GENE or other products. > E. SOFTWARE REPRESENTS A UNIQUE WAY TO SAVE MONEY IN RESEARCH. > >Centrifuges and rotors cost scientists a **lot** of money, much more >than a measly molbio software package, Molbio software is not a measly cost. Several labs can share a centrifuge, but each lab must but its own sequence software, or violate licensing agreements. Few labs are going to buy more than one package, because of the cost. A mini/mainframe system is even harder to set up, because you typically have to have a paid systems person, and pay annual licensing fees. At a great many institutions, it is simply impossible to convince enough people that such a facility is necessary, and that they should cough up the money. Here at the U. of M., our computing costs are subsidized by the University. Consequently, I have been able to put together a sequence analysis/database facility with no budget, consisting ENTIRELY OF FREEWARE. (See pub/psgendb/birch.ps.Z at ccu.umanitoba.ca) > and we all know that resources >are tight these days. Why not, for "the good of science," create a >federal agency that makes centrifuges and rotors and gives them away >for free to all of the researchers in the country or charges at most a >nominal fee??? This would save taxpayers money, right?? Why not do >the same for DNA sequenators which cost in the $100,000 range??? Why >should there be companies such as Beckman, Dupont, and ABI out there >duplicating each other's efforts when we could attract all of the *best* >instrument people to Washington and stop all of this waste and >reinventing of the wheel??? > I would contend that software is unique from other products and services. It costs a lot of money to build centrifuges and rotors, to ship them and service them. Similarly, enzymes and chemicals are consumable items that must constantly be produced. The costs of production and shipping will be the same regardless of whether it was done by a government agency or a private firm. In contrast, once a program is written, it can be distributed at minimal cost, particularly if available by FTP. In this w From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!agate!ames!elroy.jpl.nasa.gov!sdd.hp.com!nigel.msen.com!yale.edu!cmcl2!rockyd!cucrd0!ferenc From: ferenc@cucrd0.med.columbia.edu (Dr. Ferenc Czegledy) Newsgroups: bionet.software Subject: Re: Protein structure prediction Keywords: protein structure prediction Message-ID: <242@cucrd0.med.columbia.edu> Date: 25 Jun 92 16:09:02 GMT Organization: College of Physicians and Surgeons, Columbia University Lines: 16 There are many algorithms available for protein secondary structure prediction. I am particularly interested in obtaining a program called AMPHI which I recetly read about (Jahnig, F : Structure prediction of for membrane proteins. in "Prediction of Protein Structure and the Princ- iples of Protein Conformtion", ed. Fasman, GD, Plenum Press, New York, 1989). If anyone knows how to obtain this program please let me know(e.g. ftp). If anyone knows how to obtain other programs for predicting amphipathic structures (e.g. by Fourier analysis) I would be also be interested in finding out about an ftp site or some other source. A more general question is: does anyone know of an ftp for math subroutines in the C language (e.g. Fourier analysis, Runge-Kutta, etc.) ? Thanks, Ferenc Czegledy From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!daresbury!news From: JWALKER@EARN.SBBIOVM (Je) Newsgroups: bionet.software Subject: unsub Message-ID: <1992Jul3.210645.20662@gserv1.dl.ac.uk> Date: 3 Jul 92 21:05:00 GMT Sender: list-admin@daresbury.ac.uk Distribution: bionet Lines: 1 Original-To: bio-software@UK.AC.DARESBURY please unsub me Jwalker@sbbiovm. Thanks. From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!agate!ucbvax!cis.ohio-state.edu!zaphod.mps.ohio-state.edu!cs.utexas.edu!uunet!haven.umd.edu!mimsy!biocomp From: dangold1@iastate.edu (Daniel M Goldman) Newsgroups: bionet.biology.computational,bionet.plants,bionet.software Subject: Growth analyis and related subjects Message-ID: Date: 3 Jul 92 15:09:48 GMT Sender: news@mimsy.umd.edu Followup-To: bionet.biology.computational Distribution: bionet Organization: Iowa State University, Ames IA Lines: 9 Approved: comp-bio-moderator@genbank.bio.net Xref: bionet bionet.biology.computational:205 bionet.plants:125 bionet.software:2795 Originator: biocomp@lerkim.umiacs.umd.edu We are interested in exchanging information, insights, speculation, etc. with those interested in growth analysis, carbohydrate partitioning, water relations/pressure volume curves, and related subjects. Areas include theoretical work, as well as applications to germplasm evalua- tion, measurement of responses to experimental treatments/environmental factors, etc., as this relates to growth chamber, greenhouse, and field work. I also am interested in controlled environment agriculture, including artificial lighting. Please mail or post if interested in any exchange, or can make referrals to those who might. Thanks -DmG From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!lhc!ncifcrf!fcs260c2!toms From: toms@fcs260c2.ncifcrf.gov (Tom Schneider) Newsgroups: bionet.software Subject: Re: NCBI needs help Message-ID: <3506@fcs280s.ncifcrf.gov> Date: 3 Jul 92 17:11:55 GMT References: <9206261908.AA19473@rna.cshl.org> <1992Jul2.000544.48208@embl-heidelberg.de> <1992Jul2.153711.26151@ccu.umanitoba.ca> Sender: news@ncifcrf.gov Distribution: bionet Organization: Frederick Cancer Research and Development Center Lines: 60 In article <1992Jul2.153711.26151@ccu.umanitoba.ca> frist@ccu.umanitoba.ca writes: >However, there is only a very limited amount of money to pay for those >products. In my opinion, the availability of tools such as those from NCBI >is potentially a great boon to science, as well as a very economical >step. It costs the taxpayer a lot less if an agency like NCBI produces >tools that everyone can use. Shouldn't that be a consideration? I do not agree with the cost argument, since a contract can specify that software becomes public domain. The issue, as I see it, is whether NCBI should be in the software business or not. First, we now all agree that it is absolutely essential to have a centralized sequence database. This is spread over three physical locations, Japan, EMBL and USA, but they now work (pretty) closely with each other. (The fact that there are still comments in GenBank which have not been translated indicates that this task has not yet been completed.) This is essential to avoid redundant sequence entry. Second, it is impossible to create, maintain and distribute a large database without software. Third, database software should be smartly written. ASN.1 is a great first step in this direction. Fourth, only the database people can write the tools to access the software. This task cannot be separated from their day-to-day work. Fifth, database access software must be in the public domain. It makes no sense to have hundreds of programs with different methods of accessing the data. If the database is changed, the asn1toolkit gets changed and this will save a huge number of programs from being broken. Sixth, there is still plenty to do that software companies could contribute. Examples: 1. A tool, written in OpenWindows PostScript which would let me "fly" around the database and see what is there, with colored symbols. (Unfortunately, this depends on objects in the database having types and names, which the company cannot do.) 2. A service to scientists to help them create the best entries possible (Based on the Definition of GenBank, written by GenBank!!) Seventh: Search software, such as BLAST, is a continuation of David Lipman's research. By doing this research NCBI keeps in touch with current problems in molecular biology. This is very important because it makes them sensitive to what people need. As with the asn1tools, this has to be placed into the public domain, having been done at a government institution. Note that commercial groups could not take over the BLAST project, because they don't have the people who wrote BLAST. Of course they are free to do their own competing research if they want. This line of thinking seems quite clear to me. It leads me to conclude that NCBI should be producing and distributing software. Tom Schneider National Cancer Institute Laboratory of Mathematical Biology Frederick, Maryland 21702-1201 toms@ncifcrf.gov From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!agate!usenet.ins.cwru.edu!magnus.acs.ohio-state.edu!zaphod.mps.ohio-state.edu!wupost!uunet!munnari.oz.au!constellation!aardvark.ucs.uoknor.edu!broe From: broe@aardvark.ucs.uoknor.edu (Bruce Roe) Newsgroups: bionet.software Subject: Re: BLAST/VMS Message-ID: <3JUL199208400451@aardvark.ucs.uoknor.edu> Date: 3 Jul 92 13:40:00 GMT References: <1992Jun30.120201.3336@gserv1.dl.ac.uk> Sender: usenet@constellation.ecn.uoknor.edu (Nets) Distribution: bionet Organization: University of Oklahoma - University Computing Services Lines: 33 News-Software: VAX/VMS VNEWS 1.41 In article <1992Jun30.120201.3336@gserv1.dl.ac.uk>, BIONET@EARN.FRCGM51 writes... > > > Hello again, > > Has anyone here in the net been successful in having the VMS >version of BLAST (available from EMBL) run properly ? Or has anyone heard >of a lab that succeeded in doing so ? > > P.S. Yes I know. Move to UNIX.... > > - J.L. Risler - >bionet@frcgm51.bitnet > Hi, I have done this, with a little help from my friends, and the problem is that once I made the port and sent it off to NCBI, they then made MAJOR changes in BLAST and DID NOT incorporate the VMS compatable code in their release........sigh However, they did put this earlier VMS port on ncbi.nlm.nih.gov for anonymous ftp. Several folks have obtained it and corresponded with me, and I've sent them some "missing" files they failed to get from ncbi. Since we now have 2 sparcstations I've not updated the VMS version of BLAST and really don't want to keep both the GCG and BLAST versions of the databases on our hard disk. Thus have not done any more with it. In addition, BLAST, FASTA, etc also are available via e-mail servers which are very useful and provide excellent searching capabilities without tying up our local CPU and you might look into these. Let me know if I can be of any further assistance. - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - \ Bruce A. Roe Professor of Chemistry and Biochemistry / / University of Oklahoma INTERNET: BROE@aardvark.ucs.uoknor.edu \ - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!information-systems.east-anglia.ac.uk!px From: px@information-systems.east-anglia.ac.uk (Pin Xu) Newsgroups: bionet.software Subject: Test, please skip, a test for my usenet. Message-ID: <12296.9207030948@s1.sys.uea.ac.uk> Date: 3 Jul 92 09:48:31 GMT Sender: daemon@genbank.bio.net Distribution: bionet Lines: 1 test test test .... From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!agate!ucbvax!cis.ohio-state.edu!zaphod.mps.ohio-state.edu!cs.utexas.edu!uunet!psinntp!alsys1!ksksun!ksk From: ksk@ksksun.bioc.aecom.yu.edu (Ken Krauter) Newsgroups: bionet.software Subject: tiff file conversion of Molecular Dynamics Images Keywords: TIFF Phosphor Imager Message-ID: <1016@alsys1.aecom.yu.edu> Date: 2 Jul 92 19:52:43 GMT Sender: news@alsys1.aecom.yu.edu Reply-To: ksk@ksksun.bioc.aecom.yu.edu Organization: Sun Microsystems, Inc. Lines: 8 Nntp-Posting-Host: ksksun.ca.aecom.yu.edu Has anyone written a simple script to convert the virtually useless 16-bit Molecular Dynamics Tiff images produced by their scanners to an 8-bit format? I am not a raster image programer so I do not comprehend the vagueries of Sam Lefflers libtiff functions. However, there is a very nice program in his package which reads a TIFF image and copies it back in a different format. All one needs to do is convert each 16-bit word into an 8-bit word (i.e. word/256??). MD supplies a PC routine to do this however it is SLOWWWWWW. I would rather run it on my SUN. Thanks in advance. ken From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!agate!ames!elroy.jpl.nasa.gov!usc!rpi!newsserver.pixel.kodak.com!psinntp!alsys1!ksksun!ksk From: ksk@ksksun.bioc.aecom.yu.edu (Ken Krauter) Newsgroups: bionet.software Subject: tiff file conversion of Molecular Dynamics Images Keywords: TIFF Phosphor Imager Message-ID: <1015@alsys1.aecom.yu.edu> Date: 2 Jul 92 19:41:09 GMT Sender: news@alsys1.aecom.yu.edu Reply-To: ksk@ksksun.bioc.aecom.yu.edu Organization: Sun Microsystems, Inc. Lines: 8 Nntp-Posting-Host: ksksun.ca.aecom.yu.edu Has anyone written a simple script to convert the virtually useless 16-bit Molecular Dynamics Tiff images produced by their scanners to an 8-bit format? I am not a raster image programer so I do not comprehend the vagueries of Sam Lefflers libtiff functions. However, there is a very nice program in his package which reads a TIFF image and copies it back in a different format. All one needs to do is convert each 16-bit word into an 8-bit word (i.e. word/256??). MD supplies a PC routine to do this however it is SLOWWWWWW. I would rather run it on my SUN. Thanks in advance. ken From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!GENBANK.BIO.NET!kristoff From: kristoff@GENBANK.BIO.NET (Dave Kristofferson) Newsgroups: bionet.software Subject: Re: NCBI needs help Message-ID: Date: 3 Jul 92 03:01:08 GMT Sender: kristoff@genbank.bio.net Distribution: bionet Lines: 7 P.S. - I have also posted my response to BIOFORUM/bionet.general. Let's try to keep all the threads of this discussion in that forum if at all possible. Dave Kristofferson From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!kristoff From: kristoff@genbank.bio.net (David Kristofferson) Newsgroups: bionet.software Subject: Re: NCBI needs help Message-ID: Date: 3 Jul 92 02:51:44 GMT References: <9206261908.AA19473@rna.cshl.org> <1992Jul2.000544.48208@embl-heidelberg.de> <1992Jul2.153711.26151@ccu.umanitoba.ca> Distribution: bionet Organization: GenBank Online Service Lines: 132 frist@ccu.umanitoba.ca writes: >Be careful- if you start producing your own freeware tools and (shudder) >give them away (you commies!), it might be considered economic terrorism! Let's "get real," folks. None of the NCBI controversy extends to academic developers and the public domain software produced by them. You may have forgotten this by now, but the first major public domain software source (the BIONET lending library) and all of these freely accessible newsgroups came from the BIONET National Computer Resource for Molecular Biology under a grant to a **commercial company.** If I remember correctly, you, Brian, were a donor to the lending library. The kind of exaggeration provided above simply obscures the issues. Let's look at some of these now. >In the case of NCBI, it's not just Entrez or Blast but the whole >developer's toolkit that they provide. In principle, this should save a >great amount of reinvention of the wheel. The whole point here is that >you could NEVER get something like that from a commercial firm, because >it is not in their best interests to release source code. What they >want to do is create more and more products. >However, there is only a very limited amount of money to pay for those >products. In my opinion, the availability of tools such as those from NCBI >is potentially a great boon to science, as well as a very economical >step. It costs the taxpayer a lot less if an agency like NCBI produces >tools that everyone can use. Shouldn't that be a consideration? I believe that Steve Smith at Harvard (and possibly others out there) have been working on user interfaces that are freely distributable and include source code. That is perfectly within Steve's right to do so. My understanding of *federal* regulations, however, is that the *government* is not allowed to compete against private industry. NCBI and the commercial developers (which have been in this field for quite a few years) have tried to work out ways in which they can cooperate instead of compete, but this requires a careful delineation of responsibilities which I understand has been worked out at least in part. Obviously NCBI plays an important role in database production and has also produced some very nice database searching software which we use on GOS (BLAST and IRX). Just how broad of a mandate that they have, however, is one subject of controversy. As a hypothetical example, it would obviously be direct competition with the private sector if they were to distribute a comprehensive sequence analysis package because many of these have been available from a variety of sources for many years. Let me address by **analogy** the general philosophical issues raised by Brian above; the following is definitely *NOT* a detailed description of the NCBI/Software Association controversy, but does cast some light on some of the general concerns that may have been raised in the debate. Centrifuges and rotors cost scientists a **lot** of money, much more than a measly molbio software package, and we all know that resources are tight these days. Why not, for "the good of science," create a federal agency that makes centrifuges and rotors and gives them away for free to all of the researchers in the country or charges at most a nominal fee??? This would save taxpayers money, right?? Why not do the same for DNA sequenators which cost in the $100,000 range??? Why should there be companies such as Beckman, Dupont, and ABI out there duplicating each other's efforts when we could attract all of the *best* instrument people to Washington and stop all of this waste and reinventing of the wheel??? Of course, Beckman, Dupont, and ABI are fairly good-sized companies, and, if this hypothetical situation were to occur, they might be a lot harder to persuade that the above course of action is reasonable. They might even object a little. However, "Joe's Rotor Emporium" which employs 20-30 people in a small business might be more inclined to accept the wisdom of the government. Heck, what would you do if you were Joe and the scientific community was sending in FAXes to their Congressman/woman complaining about the potential loss of their free instruments? Consider this question too. Can we cite "the good of science" and simply ignore Joe or force him out of business AND add his people to the unemployment lines just because his company is small, i.e., not a Beckman or a Dupont?? Is Joe greedy or unethical if he expresses his concerns for his business to his Congressman? Should he, instead, just stand aside and say, "I am concerned that what is being done in Washington might possibly lead to the demise of my business in which I have invested many years and dollars. However, for the good of science, I am going to close up shop and go away quietly." Unfortunately for Joe, this kind of unselfishness would not even yield him a Boy Scout merit badge 8-). The "good of science" can obviously do wonders for humanity, but let's be careful that we do not start letting the ends justify the means here. I think that better solutions are possible. I'll let you answer these questions for yourself, Brian. You're obviously a smart guy. Please just note that there are no attacks on academic developers here. I'd like to see a little less emotion and a little more reason on this issue. Finally, I realize that, for those who absolutely despise commercial companies (I too was subject to a lot of negative comments towards them during my academic career), the above explanations may not sway their opinions one way or another. I do have a message for the younger, less-established members of the community however. Academic jobs in biology have been tight. When I joined IntelliGenetics in 1986 after an academic job search (only one offer which I decided against), the average age of the people here was 29. We have probably earned a few gray hairs over the last six years given all that we have been through, but this is definitely not an organization of greedy, cigar-chomping fat cats, nor would this describe the people at the other companies with which I am familiar in this field. I think that, if many of you desire to remain in science after investing much effort into your graduate education, you should strongly consider **supporting** the establishment of biotech industries because it is more likely than not that jobs will be created in this area rather than in academics. One doesn't have to be a conservative Republican to see the wisdom in this. Sincerely, David Kristofferson, Ph.D. GenBank Manager AND a proud employee of IntelliGenetics, Inc. kristoff@genbank.bio.net From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!agate!ames!elroy.jpl.nasa.gov!usc!wupost!uunet!mcsun!uknet!daresbury!news From: postmaster@su.ew.tll.kbfi.bio (Postmaster) Newsgroups: bionet.software Subject: How to unsubscribe? Message-ID: <1992Jul2.213332.14457@gserv1.dl.ac.uk> Date: 2 Jul 92 13:23:16 GMT Sender: list-admin@daresbury.ac.uk Distribution: bionet Lines: 9 Original-To: bio-software@uk.ac.daresbury Can anybody tell me how to unsubscribe from this mailing list (and from other Daresbury bio lists)? I know pretty well that this is not a right question to put in the list, but I have written to biosci@daresbury..., postmaster@daresbury.. etc and have not get any answer. Also I have tried all the LISTSERV commands I know, but without success. Sincerely, Mihkel Tammepuu mihkel@bio.kbfi.tll.ew.su From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!NYSPI.bitnet!OTT From: OTT@NYSPI.bitnet (Jurg Ott) Newsgroups: bionet.software Subject: Linkage course Message-ID: <9207021813.AA25778@genbank.bio.net> Date: 2 Jul 92 19:12:29 GMT Sender: daemon@genbank.bio.net Distribution: bionet Lines: 30 Advanced Linkage Course Jurg Ott October 19-23, 1992 University of Zurich, Switzerland (Ir- chel Campus Computer Center, 12 IBM PS/2's), Proff. Eric Kubli (Zurich) and Jurg Ott (New York). Maximum number of participants is 12. Application deadline: August 25, 1992. TOPICS include: Theory of linkage programs. Practical exercises using the LINKAGE and other programs. Handling of inbreeding loops, age-dependent penetrance, and sex-specific recombination fractions. Problems of interference in multipoint mapping. Models of genetic heterogeneity. Calculation of genetic risks, also under allelic and nonallelic association. Linkage analysis with quantitative trait loci, biological covariates, and pseudo- autosomal loci. Computer simulation methods. Gene mapping in CEPH reference families. Participants must be familiar with IBM PCs or compatible micro- computers. Extensive experience with a linkage program and/or a good background in statistical genetics and linkage analysis are additional criteria for admission. To obtain further information and an application form, contact: Katherine Montague, Course coordinator, Columbia University Unit 58 722 West 168th Street, New York, NY 10032 Tel +1-212-960-2507 Fax +1-212-568-2750 E-mail: OTT@NYSPI.BITNET From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!agate!usenet.ins.cwru.edu!magnus.acs.ohio-state.edu!zaphod.mps.ohio-state.edu!swrinde!mips!darwin.sura.net!wupost!uunet!emba-news.uvm.edu!emba-news.uvm.edu!brianf From: brianf@dna.uvm.edu (Brain Foley) Newsgroups: bionet.software Subject: Re: Re: Gopher and Wais Message-ID: Date: 2 Jul 92 17:56:48 GMT References: <1992Jun26.105351.13252@gserv1.dl.ac.uk> Sender: news@uvm.edu Distribution: bionet Organization: Division of EMBA, University of Vermont Lines: 20 In-Reply-To: candau@es.cica's message of 26 Jun 92 11: 56:17 GMT >Can anybody explain in plain words what Gopher and Wais are? Gopher and Wais are tools that make finding information that is located on computers connected to INTERNET easier. If you think of the information stored on computers throughout the world as a library, these tools are somewhat equivalent of the tools you find in a library, such as Science Citation Index, that help you find information. It is beyond the scope of this discussion group to go into the details of how they work, how they are used, etc... There are specific groups dedicated to discussions of Gopher and Wais. Look in those groups for a FAQ (list of Frequently Asked Questions and their answers). -- ******************************************************************** * Brian Foley * If we knew what we were doing * * Molecular Genetics Dept. * it wouldn't be called research * * University of Vermont * * ******************************************************************** From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!uwm.edu!caen!destroyer!terminator!bryan From: ericm@css.itd.umich.edu (Eric Meininger) Newsgroups: bionet.software Subject: Medical Archives available via anonymous FTP Keywords: mac.archive.umich.edu, macintosh, anonymous, ftp, archives Message-ID: <1992Jul2.162212.10009@terminator.cc.umich.edu> Date: 2 Jul 92 16:22:12 GMT Sender: bryan@terminator.cc.umich.edu (Bryan Beecher) Organization: U of Michigan, ITD Research Systems Lines: 55 NEW ARCHIVE SECTION AT MAC.ARCHIVE.UMICH.EDU! The Mac Archives at University of Michigan is pleased to announce a new collection area for medicine and the health sciences. Currently, the collection is small - I am gradually adding the contents of the AMSA public domain software library, but these files are a few years old. I am seeking any Macintosh programs, utilities, demonstrations, or computer aided instruction related to the health sciences. If you have been developing any type of Macintosh medical software and would like to make it available to the rest of the world, send it to us! I believe this is the only collection of its type, help us to make it the best! You can use ftp to get to these archives (anonymous login, any password). There are currently no restrictions, but for load management reasons, limits may be imposed in the future. The medical directory is located on mac.archive.umich.edu (currently 141.211.164.153) in /mac/etc/medical. If you are using AFS (Andrew File System) you can get to the archive directory with: cd /afs/umich.edu/group/itd/archive/mac/etc/medical Currently, the medical section of the archives is being maintained by myself, Eric Meininger (ericm@umich.edu), a medical student attending the University of Michigan Medical School. If you have any comments or suggestions, don't hesitate to send a message. SUBMITTING FILES TO THE MEDICAL SECTION OF THE ARCHIVES The best way to get files to our archive is to ftp-put them into the incoming directory, then e-mail ericm@umich.edu and let him know that you've placed a file. This way he'll know there are health science files waiting within the directory, and also who to contact if the files don't work "as advertised". Another way is to e-mail the file to ericm@umich.edu. It works just as well. VIRUSES Unlike other Internet "Mac" archives, we test each and every one of the files that appears in our "incoming" directory and in our mailboxes addressed to mac.archive. We use the most-up-to-date virus detection inits and control panels (Disinfectant, Gatekeeper, etc.) to insure that the files that we add to the archive are not carrying anything that can harm your Macintosh and your (and our) work. We also make these public domain/shareware virus detection packages available to you as fast as we receive them in our "utilities/virus" directory. * Questions, Problems and comments regarding the medical archive * specifically should be sent to ericm@umich.edu. General mac.archive * questions should be sent to comments@mac.archive.umich.edu From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!agate!ames!decwrl!access.usask.ca!ccu.umanitoba.ca!frist From: frist@ccu.umanitoba.ca Newsgroups: bionet.software Subject: Re: NCBI needs help Message-ID: <1992Jul2.153711.26151@ccu.umanitoba.ca> Date: 2 Jul 92 15:37:11 GMT References: <9206261908.AA19473@rna.cshl.org> <1992Jul2.000544.48208@embl-heidelberg.de> Sender: news@ccu.umanitoba.ca Distribution: bionet Organization: University of Manitoba, Winnipeg, Manitoba, Canada Lines: 102 Nntp-Posting-Host: niven.cc.umanitoba.ca In article <1992Jul2.000544.48208@embl-heidelberg.de> rice@embl-heidelberg.de (Peter Rice) writes: >In article <9206261908.AA19473@rna.cshl.org>, roberts@CSHL.ORG (Dr. Richard >Roberts at Cold Spring Harbor Laboratory) writes: >> >> NCBI in trouble >> >> David Lipman and the NCBI are under attack from Congressman Natcher's >> Appropriations Sub-committee. It is being argued that they should stop >> producing Entrez, BLAST and other software products for distribution to >> the scientific community, because they compete unfairly with commercial >> enterprises that do the same thing. As a result there is a move to delete ... rest of Robert's post deleted... > >I have seen absolutely *no response* to this on the net, apart from an >assurance via Dave Kristofferson (only to bionet.announce) that: > >>I posted a message from Dr. Richard Roberts to this forum the other >>day about the current predicament at NCBI. >> >>I should also say, in the interest of fairness, that a response will >>be made by the Biotechnology Software Manufacturer's Association in >>the very near future. >> >>I would submit that fairness requires your hearing both sides of the >>story before reaching a conclusion and acting on it. > >Nice suggestion, but Rich Roberts asked for responses by 1st July, and >so far there has been no further explanation. > >It all looks reminiscent of what happened around this time last year. >The GCG package was banned by the U.S. Dept. of Commerce as too dangerous >to be released to anyone outside the USA, WHAAAAAT???? Too DANGEROUS? Could we have some elaboration on this one? > and nobody complained (well, all >the customers complained loudly to GCG, but nobody complained publicly). >After three long months of no support (waiting for release 7.0, so I could >test my programs which were included on the tape), it was released to a >restricted list of friendly countries which still excluded several of the >EMBL member states. > >The main reason for the lack of response that time appears to have been CYA, >in the hope that "I won't be next". I wonder how much NCBI did to help that >situation, as now they find themselves in the firing line and hoping to be >rescued, as indeed they should be. > >These are not the only idiocies in US Biotechnology, as seen from outside. We >have also seen the refusal to sign the Biodiversity treaty at Rio because of >the possible financial impact on biotechnology companies, and a curious >clause in the PDB distributors contract. Also I recall GCG leaving the >University of Wisconsin in a hurry to stay ahead of the lawyers in a similar >sounding case to this one. > >The choice is easy here - if we in Europe and the rest of the world can't depend >on the availability of the US products, we will have to do everything ourselves. Be careful- if you start producing your own freeware tools and (shudder) give them away (you commies!), it might be considered economic terrorism! >First the software is hit, then the databases, then the services. When will it >stop? Only when somebody with influence in the US cries *ENOUGH*. One of the many positive things to come from the 60's was the development of an attitude of distrust for industry, which resulted in legislation that prevented monopolies, exploitation, and allowed for greater regulation of workplace and product safety. The propaganda campaigns of Reagan/Bush have completely reversed this attitude in the US. We're returning to "what's good for General Motors is good for the USA." Until this naive assumption can be changed, we will continue to see paranoid policies such as you describe. >What would we do without Entrez, Blast or GCG? We may soon have to find out. In the case of NCBI, it's not just Entrez or Blast but the whole developer's toolkit that they provide. In principle, this should save a great amount of reinvention of the wheel. The whole point here is that you could NEVER get something like that from a commercial firm, because it is not in their best interests to release source code. What they want to do is create more and more products. However, there is only a very limited amount of money to pay for those products. In my opinion, the availability of tools such as those from NCBI is potentially a great boon to science, as well as a very economical step. It costs the taxpayer a lot less if an agency like NCBI produces tools that everyone can use. Shouldn't that be a consideration? > ----------------------------------------------------------------------------- > Peter Rice, EMBL | Post: Computer Group > | European Molecular > Internet: Peter.Rice@EMBL-Heidelberg.DE | Biology Laboratory > | Postfach 10-2209 > Phone: +49-6221-387247 | W-6900 Heidelberg > Fax: +49-6221-387306 | Germany > > ... and occasionally price@crc.ac.uk ... =============================================================================== Brian Fristensky | Department of Plant Science | "Ya don't have to be a rocket surgeon University of Manitoba | ta know who's who!" Winnipeg, MB R3T 2N2 CANADA | frist@ccu.umanitoba.ca | Office phone: 204-474-6085 | - the incomparable Don Cherry FAX: 204-261-5732 | =============================================================================== From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!agate!ames!purdue!mentor.cc.purdue.edu!aclcb.purdue.edu!WESTERM From: westerm@aclcb.purdue.edu (Rick Westerman) Newsgroups: bionet.software Subject: TFD on GCG? Message-ID: <53043@mentor.cc.purdue.edu> Date: 2 Jul 92 15:26:35 GMT Sender: news@mentor.cc.purdue.edu Reply-To: westerm@aclcb.purdue.edu Organization: Purdue University AIDS Center Lines: 30 This message is a request for GCG-based software to manipulate the TFD (transcriptional factors database). Aside #1: My apologies to anyone seeing this message multiple times. It is being sent to two mailing lists and one NetNews group. The TFD appears to have a lot more information in it than the GCG package (version 7, VMS) uses. Specifically, the GCG package only uses a reformatted file of the TFD "sites" data. The other TFD data ("polypeptides","clones", "domains","references") are not used. Thanks to Blane & Weise of the Univeristy of Georgia, there is now a program ("tfd4gcgmotifs") that reformats the "sites" data into something that the Motifs program can use; this is much more useful than using the Find program. Aside #2: Blane and/or Weise. Please send me your email address. But there still doesn't seem to be any easy way to use the rest of the TFD. I looked, via anonymous FTP, on ftp.bio.indiana.edu and ncbi.nlm.nih.gov to no avail. My question: is there a GCG-compatible program to manipulate the *entire* TFD? Thanks, -- Rick Rick Westerman System Manager of the AIDS Center Laboratory westerm@aclcb.purdue.edu for Computational Biochemistry (ACLCB), BCHM (317) 494-0505 bldg., Purdue University, W. Lafayette, IN 47907 From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!agate!ames!elroy.jpl.nasa.gov!swrinde!zaphod.mps.ohio-state.edu!menudo.uh.edu!Elroy.UH.EDU!BCHS1B From: bchs1b@Elroy.UH.EDU (Michael Benedik) Newsgroups: bionet.software Subject: Re: restriction enzyme mapping Message-ID: <1992Jul2.034815.21000@menudo.uh.edu> Date: 2 Jul 92 03:48:15 GMT References: <199207010426.AA17004@alsys1.aecom.yu.edu> Sender: usenet@menudo.uh.edu (USENET News System) Reply-To: bchs1b@Elroy.UH.EDU Distribution: bionet Organization: University of Houston Lines: 28 Nntp-Posting-Host: elroy.uh.edu In article <199207010426.AA17004@alsys1.aecom.yu.edu>, ness@aecom.yu.edu (Seth Ness) writes: >i'm looking for a program that does restriction mapping, but with a twist. >every program i've looked at will generate a restriction map and show you >fragments sizes etc. i'd like to input a size range and a certain specific >segments to include and have the program tell me what enzymes to cut with >to get that fragment. (this is for subcloning). i'd prefer a Mac program and >public domain program if possible. also if this can be done on the GCG program >i have access to that. >thanks. > >-- > Seth L. Ness Ness Gadol Hayah Sham > Ness@aecom.yu.edu You can do something vaguely similar to this with GCG, depending upon precisely what you need to do. With GCG programs like Map or Mapsort you can Exclude a certain region, i.e. have the program tell you all enzymes which cut a fragment of DNA but will not cut within a certain specified segment. This way you only need to look at enzymes cutting in the flanking region (I assume this is what you need). You can further reduce the trash by specifying MINCUT or MAXCUT or whatever is appropriate to your application. --------------------------------------------------- Michael Benedik Department of Biochemical and Biophysical Sciences University of Houston INTERNET: Benedik@UH.EDU BITNET: Benedik@UHOU From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!agate!stanford.edu!snorkelwacker.mit.edu!thunder.mcrcim.mcgill.edu!sifon!monod!francis From: francis@monod.biol.mcgill.ca (Francis Ouellette) Newsgroups: bionet.software Subject: new structures (was: Gaps and PAMs) Message-ID: <1992Jul2.003445.28265@sifon.cc.mcgill.ca> Date: 2 Jul 92 00:34:45 GMT References: <1571.2a51d0f6@mbcl.rutgers.edu> Sender: news@sifon.cc.mcgill.ca Reply-To: francis@monod.biol.mcgill.ca Organization: The Alpha - Omega Project Lines: 37 Nntp-Posting-Host: monod.biol.mcgill.ca goldman@mbcl.rutgers.edu (Adrian Goldman) writes: >One only has to look (has someone made this point already?) at the >recently-published yeast chromosome. They found similarities for only a small >percentage of their ORFs but I would be prepared to bet that the structures of >many, if not most, of the longer ORFs will turn out to be related to >already-solved structures. ^^^^^^^^^^^^^^^^^^^^^^^^^^^ but what do you mean here? Obviously they found helices, and beta-turns and things of sub-molecular level of organization, but the genome projects of yeast, C. elegans, drosophila and the likes will produce many many "putative" protein sequences that where *never* sequenced before and therefore have no "homologue" (this term used very loosely) in the databases, because they are not there, because they are not globins, histones, ras, kinases, phosphatases ... the genes that people have been going after over the last 20 or so years. And the genome projects are the _only_ way to get these genes (quick_asbestos_suit_on) the only way to put new patterns in the databases. (ok, ok, ok, ok, I admit I may be a bit biased here :) regards, francis --- | B.F. Francis Ouellette | manager, yeast chromosome I project | dept of biology, McGill university, Montreal, Qc, Canada | francis@monod.biol.mcgill.ca From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!kristoff From: kristoff@genbank.bio.net (David Kristofferson) Newsgroups: bionet.software Subject: Re: NCBI needs help Message-ID: Date: 2 Jul 92 00:12:30 GMT References: <9206261908.AA19473@rna.cshl.org> <1992Jul2.000544.48208@embl-heidelberg.de> Distribution: bionet Organization: GenBank Online Service Lines: 9 I have replied to Peter's message on BIONEWS/bionet.announce where it was also crossposted. Sincerely, Dave Kristofferson GenBank Manager kristoff@genbank.bio.net From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!uwm.edu!linac!att!rutgers!mbcl!goldman From: goldman@mbcl.rutgers.edu Newsgroups: bionet.software Subject: Re: Gaps and PAMs Message-ID: <1571.2a51d0f6@mbcl.rutgers.edu> Date: 1 Jul 92 19:36:22 GMT References: <1992Jun28.192435.26352@gpu.utcs.utoronto.ca> <1992Jun29.100048.5323@neptune.inf.ethz.ch> <1992Jun29.165400.23251@bas-a.bcc.ac.uk> Lines: 28 In article <1992Jun29.165400.23251@bas-a.bcc.ac.uk>, ucbcdtj@ucl.ac.uk (David T Jones) writes: > Gaston Gonnet writes: >>yes, I agree, but with "subjective terms" we cannot do science. The >>least controversial definition of "significance" is one which relates >>the probability of an homology against the (null hypothesis) probability >>of a random coincidence. As the model of homology gets more precise, >>or you start including information of other nature (e.g. 3-d structure) >>then the probabilities may be computed differently. But the definition >>remains the same. > > Alignments can be significant and yet be wrong. I agree 100% . large deletion to save net.bandwidth.. > I don't think alignment technology has reached a point where an > automatic procedure can take as input an entire protein sequence > databank and generate as output a complete set of accurately aligned protein > sequence families. The alignments may well be statistically significant, > and may well look highly plausible, but these observations alone cannot > guarantee the correctness of alignments. One only has to look (has someone made this point already?) at the recently-published yeast chromosome. They found similarities for only a small percentage of their ORFs but I would be prepared to bet that the structures of many, if not most, of the longer ORFs will turn out to be related to already-solved structures. Adrian Goldman From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!uwm.edu!linac!att!rutgers!mbcl!goldman From: goldman@mbcl.rutgers.edu Newsgroups: bionet.software Subject: Re: Gaps and PAMs Message-ID: <1569.2a51cf9d@mbcl.rutgers.edu> Date: 1 Jul 92 19:30:37 GMT References: <1992Jun28.192435.26352@gpu.utcs.utoronto.ca> <1992Jun29.100048.5323@neptune.inf.ethz.ch> Lines: 30 In article , eddy@boulder.Colorado.EDU (Sean Eddy) writes: > gonnet@inf.ethz.ch (Gaston Gonnet) writes: ..stuff deleted to save net.bandwidth... >>I am afraid that you >>tend to imply that alignment is "black magic" or "art". I disagree >>strongly with this view. We should establish models, compute the >>parameters for these models, verify/reject the models against reality >>and move into better models when the old ones become unsuitable to >>describe reality. This is the way that science makes progress, not >>with "subjective measures". There are hundreds of examples of this >>methodology in science. > > What "reality" are you going to test, for determining the accuracy > of your methods for aligning distantly similar sequences? Is there > a set of sequences with distantly related sequences but similar > enough 3D structures to permit a confident structure-based alignment? > I'd love to know of one (seriously). Actually, there are some examples. If you believe Farber & Petsko in TIBS, you could take all the TIM barrel enzymes. They claim that all of them are related by divergent evolution. (I personally don't buy it.) Alternatively, take a look at Protein Engineering, vol5, p197-211, 1992. In it, we (yes, I'm sorry to say, this is a commercial!) discuss a new protein fold where four of the five members of the fold were not known to be related before their structures were solved. And indeed meaningful structural alignments can be made (that will have *enormous* insertions in them: some of these insertions, by the way, in the *interior* of the proteins). Adrian Goldman From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!uwm.edu!linac!att!rutgers!mbcl!goldman From: goldman@mbcl.rutgers.edu Newsgroups: bionet.software Subject: Structure-based PAM scores: was (And now for something completely diffe Message-ID: <1568.2a51cc1f@mbcl.rutgers.edu> Date: 1 Jul 92 19:15:43 GMT References: <1992Jun23.171414.4745@jhunix.hcf.jhu.edu> Lines: 38 In article <1992Jun23.171414.4745@jhunix.hcf.jhu.edu>, johnk@jhunix.hcf.jhu.edu (John J Kuszewski) writes: > I remember a few posts (before the current thread began) about how to > calculate the "cost" of an insertion during sequence comparisons. In > general, the cost is of the form a + bx, where a is a constant cost > for making any insertion, b is the cost per inserted residue, and x is > the number of residues inserted. > > This doesn't seem to make a whole lot of sense. An insertion at a site > on the surface of a protein should be a lot less expensive to make than > at an interior site. > > Are there programs that, given a particular structure, will find sequence > relatives (ala David Eisenberg), using a cost function that varies with the > three-dimensional position of the insertion? Since residue exposure is > one of Eisenberg's environment criteria, this should be straightforward to > implement. Well, forgive me if I have this upside down, but let's look at the false positive rate. In the limit, you have a sequence that is *completely unrelated* to the sequence/structure you are comparing it with. The region you are scanning is inside, but you are moving it past the outside region of the test structure. Consequently, your gap weight & extension weight (or other parameters, however defined) go low. Shall we say, for argument's sake, that they go to zero? Then you'll get a perfect match between regions (by inserting lots of *long* gaps) that are completely unrelated. Plus (go look at a structure) outside is a *very* temporary thing on a protein surface. For instance: on a beta-strand on the edge of the protein, every second amino-acid could be an "inside" amino acid. Or in an alpha-helix that's mostly buried, ~1/4 amino-acids will be outside. > > It might even make for better alignments. > All in all, I don't think so. Adrian Goldman Goldman@MBCL.Rutgers.Edu From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!daresbury!bioftp.unibas.ch!embl-heidelberg.de!rice From: rice@embl-heidelberg.de (Peter Rice) Newsgroups: bionet.software Subject: Re: NCBI needs help Message-ID: <1992Jul2.000544.48208@embl-heidelberg.de> Date: 1 Jul 92 23:05:44 GMT References: <9206261908.AA19473@rna.cshl.org> Distribution: bionet Organization: EMBL, European Molecular Biology Laboratory Lines: 97 In article <9206261908.AA19473@rna.cshl.org>, roberts@CSHL.ORG (Dr. Richard Roberts at Cold Spring Harbor Laboratory) writes: > > NCBI in trouble > > David Lipman and the NCBI are under attack from Congressman Natcher's > Appropriations Sub-committee. It is being argued that they should stop > producing Entrez, BLAST and other software products for distribution to > the scientific community, because they compete unfairly with commercial > enterprises that do the same thing. As a result there is a move to delete > as much as 50% of their funding. This would wreck NCBI and cause the rest > of us to be deprived of the resources currently being provided by NCBI. I > strongly oppose this move since I believe that companies actually benefit > from the free software and services provided by NCBI. A company would need > to be very insecure to find the existence of NCBI threatening. > > To help avoid the potential destruction of NCBI I would urge all readers of > this column to write directly to Congressman Natcher in support of NCBI and > to ask colleagues also to write in support. This is the most effective way > to avoid a potentially disastrous situation. > > > Write before July 1st to: > > Congressman William H. Natcher > Chairman > Appropriations Committee on Labor, Health and Human Services, > Education and Related Agencies > 2358, Rayburn House Office Building > Washington DC 20515 > > FAX # (202) 225-3509 > > Note that there is some urgency here because the committee > meets very soon > > Rich Roberts I have seen absolutely *no response* to this on the net, apart from an assurance via Dave Kristofferson (only to bionet.announce) that: >I posted a message from Dr. Richard Roberts to this forum the other >day about the current predicament at NCBI. > >I should also say, in the interest of fairness, that a response will >be made by the Biotechnology Software Manufacturer's Association in >the very near future. > >I would submit that fairness requires your hearing both sides of the >story before reaching a conclusion and acting on it. Nice suggestion, but Rich Roberts asked for responses by 1st July, and so far there has been no further explanation. It all looks reminiscent of what happened around this time last year. The GCG package was banned by the U.S. Dept. of Commerce as too dangerous to be released to anyone outside the USA, and nobody complained (well, all the customers complained loudly to GCG, but nobody complained publicly). After three long months of no support (waiting for release 7.0, so I could test my programs which were included on the tape), it was released to a restricted list of friendly countries which still excluded several of the EMBL member states. The main reason for the lack of response that time appears to have been CYA, in the hope that "I won't be next". I wonder how much NCBI did to help that situation, as now they find themselves in the firing line and hoping to be rescued, as indeed they should be. These are not the only idiocies in US Biotechnology, as seen from outside. We have also seen the refusal to sign the Biodiversity treaty at Rio because of the possible financial impact on biotechnology companies, and a curious clause in the PDB distributors contract. Also I recall GCG leaving the University of Wisconsin in a hurry to stay ahead of the lawyers in a similar sounding case to this one. The choice is easy here - if we in Europe and the rest of the world can't depend on the availability of the US products, we will have to do everything ourselves. First the software is hit, then the databases, then the services. When will it stop? Only when somebody with influence in the US cries *ENOUGH*. Come on Dave, let's see that response from the other side, and some more background, like who are the Biotechnology Software Manufacturers' Association and how are they involved in this affair? Maybe even a posting or two from NCBI - do they want help or not? What would we do without Entrez, Blast or GCG? We may soon have to find out. ----------------------------------------------------------------------------- Peter Rice, EMBL | Post: Computer Group | European Molecular Internet: Peter.Rice@EMBL-Heidelberg.DE | Biology Laboratory | Postfach 10-2209 Phone: +49-6221-387247 | W-6900 Heidelberg Fax: +49-6221-387306 | Germany ... and occasionally price@crc.ac.uk ... From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!uwm.edu!wupost!gumby!yale!yale.edu!ira.uka.de!gmd.de!bartels From: bartels@gmd.de (Eric Bartels) Newsgroups: sci.bio,bionet.jobs,bionet.molbio.proteins,bionet.software,misc.jobs.resumes Subject: WANTED: PRACTICAL TRAINING/JOB IN COMPUTATIONAL BIOLOGY Message-ID: Date: 1 Jul 92 20:44:56 GMT Sender: news@gmd.de (USENET News) Organization: GMD, Sankt Augustin, Germany Lines: 46 Xref: bionet sci.bio:6161 bionet.jobs:978 bionet.molbio.proteins:343 bionet.software:2774 misc.jobs.resumes:10148 Nntp-Posting-Host: gmdzi Hi everybody out there ! I am a computer science student at the University of Bonn, Germany. Before graduating (M.Sc.) next spring, I would like to do some practical training and/or studies in the field of computational molecular biology at a research institute either in Europe or the U.S. . I took some university courses in theoretical biology, genetics and on algorithms for DNA sequencing/comparing/distance measuring. I would like to get some practical experience in this area, especially I like to work on models for protein folding. I have got good programming knowledge (C, PASCAL, FORTRAN, C*, PARIS) on different operating systems ( UNIX,MSDOS,VMS ) and different computers ( PCs, Macs, SUNs, VAX and the Connection Machine CMII parallel computer). I have also been engaged in research on neural networks, structural complextiy and artifical intelligence. I'd like to start the training in the beginning of 1993 for 2 to 6 months. For a practical training in Europe there is a possibility for financal support by the European Community's "COMETT II" program. I'll be grateful for any tip where to apply for such a training. thanx Eric (Please e-mail all replies directly to me ! I'll post a summary if necessary.) e-mail: bartels@theory.cs.bonn.edu bartels@theory.cs.uni-bonn.de bartels@gmdzi.gmd.de surface mail: Eric Bartels Am Jesuitenhof 1/522 5300 Bonn 1 GERMANY From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!bcm!mbcr.bcm.tmc.edu From: so690561@mbcr.bcm.tmc.edu (Susan Elizabeth Olson) Newsgroups: bionet.software Subject: Who should run a biologically oriented network?? Message-ID: <12937@gazette.bcm.tmc.edu> Date: 1 Jul 92 18:23:21 GMT Sender: usenet@bcm.tmc.edu Distribution: usa Organization: Baylor College of Medicine, Houston, Tx Lines: 53 Nntp-Posting-Host: mbcr.bcm.tmc.edu Having recently received my BS in biology (1991) from an extremely computationally oriented school (Carnegie Mellon), I can say that this whole issue of who should run a network at a biologically oriented institution hits very close to home. Prior to the days in which a program in computational biology was started at my alma mater, most of us who went into biology did not know much about computers, and the introductory (compulsory) programming courses were extremely difficult (some of my friends who were CS majors even agreed that many computer science professors find it difficult to come down to their (my friends) level, much less our level and teach) so that we were somewhat discouraged from taking courses that would help to broaden us and make us better scientists. In fact, complaints are still raised by future computational biologists that most of their CS courses still don't help them to write better biology-oriented programs (final programming projects are often to write games, not sequence analysis packages, or some relatively limited but useful scientifically oriented program). Surprisingly, although both full fledged biologists and computer scientists realize the importance of the merging of their respective disciplines, this has yet to be implemented to any great degree at both the graduate and undergraduate levels. The people who are in these programs right now are some of the best candidates for running a network, but until they graduate and until the curriculum for computational biologists is fine tuned, you won't see too many of them around. Given that problem, you probably need two people (minimum) to have a strong network - a CS person and a biologist, two people who are willing to learn how to speak each others jargon to some degree and can handle the basics in both fields. Of course this means twice the cost in terms of salaries, etc.,but it is how the most successful mbcrs (ie GenBank) are operated. As for individuals going back and training in another discipline, I'm all for that (I admit that despite the ubiquitous presence of the Internet at my undergraduate school, I did not learn how to use emacs or 'speak' Unix until I came to graduate school this year, and fortunately I have been able to have access to a rare person who understands both fields and can gauge my experience and skill levels in the field so that I can more productively use the Internet (ie it's not just for e-mail and b-boards) ). I can see how it would be difficult though to have to do additional training to get a network going (much less how in a few years the administrator will have users who know more than he/she does in both fields if people really insist upon hiring computational biologists, and two should be hired so that if one leaves for a much needed vacation, the entire network is not left on hold and less accessible to its users. But even friendships struck up outside your discipline can be fruitful - I still call many of my best friends from college and ask them computer questions, just as they ask me about what is currently possible using genetic engineering or how evolutionary concepts seem to work - these are some of the neatest people to consider hiring to help you run your mbcr because they are often curious about the "neat stuff" biologists do (but may have had a poor/uninteresting biology professor or no desire to do lab work). I think lots of different kinds of people could do the job well, but I wouldn't want to put the job squarely on one person's shoulders. Susan Olson Graduate Student Department of Microbiology and Immunology Baylor College of Medicine Houston, TX From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!agate!ames!elroy.jpl.nasa.gov!usc!sol.ctr.columbia.edu!ira.uka.de!chx400!bernina!neptune!gonnet From: gonnet@inf.ethz.ch (Gaston Gonnet) Newsgroups: bionet.software Subject: Re: Gaps and PAMs (How Dayhoff computed its log-odds matrix) Message-ID: <1992Jul1.093354.6085@neptune.inf.ethz.ch> Date: 1 Jul 92 09:33:54 GMT References: <1992Jun30.024538.3684@gpu.utcs.utoronto.ca> Sender: news@neptune.inf.ethz.ch (Mr News) Organization: Dept. Informatik, Swiss Federal Institute of Technology (ETH) Lines: 39 Nntp-Posting-Host: rutishauser-gw.inf.ethz.ch In article <1992Jun30.024538.3684@gpu.utcs.utoronto.ca> lamoran@gpu.utcs.utoronto.ca (L.A. Moran) writes: > >I said, > > "I assume that when constructing a Dayhoff matrix only identical > amino acids are counted in the initial alignment but that gaps > are permitted. Is this correct?" > >Gaston replied, > > "no, you are mistaken, please read Dayhoff's original paper, the > procedure is much more sophisticated. If you would understand their > ideas, you would be much more confident in using their tools." > >How interesting. When you construct a new "Dayhoff" matrix do you use the >old one to improve the alignments that form the database? If not, then what >"sophisticated" assumptions do you make that justify comparing non-identical >residues in the original alignments? Do you think that these assumptions >might affect the final matrix? ============================================== As a matter of fact, Dayhoff et al. counted only mutated positions, not "identical amino acids" as you say. There is a circularity, as you note. To compute a better estimate you need to have alignments. To have alignments you need a good matrix. Dayhoff et al. broke this circularity by computing the sampled alignments by hand. We do it iteratively. It is possible to prove that when you select pairs of sequences which are not to far apart (in PAM distance), the process of aligning, estimating DM, aligning with new matrix, estimating... converges. The only requirement for convergence is that you start with a diagonally dominant mutation matrix. Because the final matrix that we found was the same (up to roundoff error) for 3 initial matrices (Dayhoff's original one, a very early estimate of our own, and an identity matrix) we have sufficient confidence that the procedure is sound. I hope this answers your questions. Gaston H. Gonnet, Informatik, ETH, Zurich. From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!agate!ames!tulane!darwin.sura.net!mips!sdd.hp.com!usc!sol.ctr.columbia.edu!ira.uka.de!chx400!bernina!neptune!gonnet From: gonnet@inf.ethz.ch (Gaston Gonnet) Newsgroups: bionet.software Subject: Re: Gaps and PAMs (estimating deletion penalty parameters) Message-ID: <1992Jul1.092333.5967@neptune.inf.ethz.ch> Date: 1 Jul 92 09:23:33 GMT References: <1992Jun30.024538.3684@gpu.utcs.utoronto.ca> Sender: news@neptune.inf.ethz.ch (Mr News) Organization: Dept. Informatik, Swiss Federal Institute of Technology (ETH) Lines: 23 Nntp-Posting-Host: rutishauser-gw.inf.ethz.ch In article <1992Jun30.024538.3684@gpu.utcs.utoronto.ca> lamoran@gpu.utcs.utoronto.ca (L.A. Moran) writes: > > "subjective decisions about the values of gaps is what has been > done until recently. We have now given a model under which parameters > can be computed from the available samples. I am afraid that you > tend to imply that alignment is "black magic" or "art". I disagree > strongly with this view. We should establish models, compute the > parameters for these models, verify/reject the models against reality > and move into better models when the old ones become unsuitable to > describe reality. This is the way that science makes progress, not > with "subjective measures". There are hundreds of examples of this > methodology in science." > >With all due respect, I do not consider your "model" to be entirely objective. >I still believe that estimating the value of gaps is a difficult problem >that ultimately boils down to a "guesstimate". ============================================ Have you read our paper on insertion/deletions? Or is this your "guess" on its contents? Yes, I agree it is a difficult problem, we have taken the first crack at it, progress is to be expected. Would you like to have a copy? Gaston H. Gonnet, Informatik, ETH, Zurich. From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!agate!spool.mu.edu!mips!darwin.sura.net!Sirius.dfn.de!chx400!bernina!neptune!gonnet From: gonnet@inf.ethz.ch (Gaston Gonnet) Newsgroups: bionet.software Subject: Re: Gaps and PAMs (PAM distance vs time) Message-ID: <1992Jul1.091611.5751@neptune.inf.ethz.ch> Date: 1 Jul 92 09:16:11 GMT References: <1992Jun30.024538.3684@gpu.utcs.utoronto.ca> Sender: news@neptune.inf.ethz.ch (Mr News) Organization: Dept. Informatik, Swiss Federal Institute of Technology (ETH) Lines: 15 Nntp-Posting-Host: rutishauser-gw.inf.ethz.ch In article <1992Jun30.024538.3684@gpu.utcs.utoronto.ca> lamoran@gpu.utcs.utoronto.ca (L.A. Moran) writes: > > c) Changes in environment cannot "force" mutations. What does this > mean? =============================================== An organism lives in an environment for which some of the substances it produces are nearly optimal. Then little or no change is expected for these substances. The envorinment now changes (e.g. CO2 concentration goes down, or the temperature goes up, etc.) and the old substances are no longer adequate, so the organism either evolves or disappears. In the aftermath we can say that the change in the environement "forced" mutations in the survivors. (It is all through natural selection, of course). Gaston H. Gonnet, Informatik, ETH, Zurich. From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!agate!spool.mu.edu!mips!darwin.sura.net!Sirius.dfn.de!chx400!bernina!neptune!gonnet From: gonnet@inf.ethz.ch (Gaston Gonnet) Newsgroups: bionet.software Subject: Re: Gonnet et al. (Needleman & Wunsch or dynamic programming) Message-ID: <1992Jul1.080922.4733@neptune.inf.ethz.ch> Date: 1 Jul 92 08:09:22 GMT References: <920629220811.21a51350@sds.sdsc.edu> Sender: news@neptune.inf.ethz.ch (Mr News) Distribution: bionet Organization: Dept. Informatik, Swiss Federal Institute of Technology (ETH) Lines: 73 Nntp-Posting-Host: rutishauser-gw.inf.ethz.ch In article <920629220811.21a51350@sds.sdsc.edu> gribskov@SDSC.EDU (Michael Gribskov) writes: > > It seems unlikely that such a matrix has been used with the > Needleman-Wunsch algorithm. As you may recall, the NW algorithm (Needleman > and Wunsch, J. Mol. Biol. 48, 443-453, 1970) does not use an affine gap > cost, although they do suggest that the "penalty factor could be a function > of the size and/or direction of the gap". NW requires a scoring table with > all positive values since only the last row and column of the alignment > matrix are examined for the maximum score. A scoring table with negative > values is not guaranteed to give an optimum alignment with the NW > algorithm. Note that needleman and Wuncsh refer to the position containing > the maximum score as being in the first row or column since they build the > alignment from N to C terminus, however they mean the last row or column > calculated during the alignment. Since many sequences in the database have > locally similar segments embedded in unrelated sequences (i.e. cases of > partial homology or gene fusion), one wonders what kind of alignments would > result. =========================================== I think you should all know that what is called "Needleman & Wunsch" is an application of dynamic programming. Wagner et al. (JACM 1974) also found the same algorithm and named it "string correction problem". In parallel the engineers discover it too and called it "Viterbi's algorithm" (I think?). This is a case of an algorithm which is likely to be rediscovered again and again and be renamed each time. I do not blame the authors, other than for not being familiar with combinatorial algorithms. But all these algorithms are "dynamic programming" algorithms (known maybe since WWII). Dynamic programming used to match two strings with a given "cost" matrix and a deletion penalty function finds the maximum sum of costs of any possible alignment of the two strings. All of these variations are possible: (a) to anchor the matching at both ends (b) to leave one end anchored and find the optimal second end (c) to find the overall optimal match of any two subsequences (d) to specify a deletion cost depedent on each amino acid being deleted (e) to allow a linear gap penalty function (a+bk). (This is called Gotoh's algorithm) (f) the entries of the "cost" matrix are arbitrary real numbers (no sign restriction whatsoever) (g) you can minimize instead of maximizing the total cost. (h) recover any one of the alignments which gives the optimal cost (i) you can use an arbitrary concave gap-penalty function at an increase in complexity (a log(n+m) factor, Webb and Myers). All of these variations run in time proportional to m*n where m and n are the lengths of the two sequences, and use space proportional to min(m,n). All these variations find the absolute maximum (ie. no approximations). Notice that when the log-odds matrix is used, we maximize a sum of logarithms of conditional probabilities, hence we maximize the product of these probabilities, hence we find a maximum likelihood alignment. People familiar with estimation theory will recognize that this is an unbiased estimator. In summary, I should have not used the term Needleman & Wunsch if you are going to take such a narrow view of the algorithm. I should have used the term "dynamic programming" (which is what I normally use). Gaston H. Gonnet, Informatik, ETH, Zurich. From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!agate!spool.mu.edu!sol.ctr.columbia.edu!ira.uka.de!chx400!bernina!neptune!gonnet From: gonnet@inf.ethz.ch (Gaston Gonnet) Newsgroups: bionet.software Subject: Re: Gonnet et al. (Nomenclature) Message-ID: <1992Jul1.072420.4249@neptune.inf.ethz.ch> Date: 1 Jul 92 07:24:20 GMT References: <920629220811.21a51350@sds.sdsc.edu> Sender: news@neptune.inf.ethz.ch (Mr News) Distribution: bionet Organization: Dept. Informatik, Swiss Federal Institute of Technology (ETH) Lines: 37 Nntp-Posting-Host: rutishauser-gw.inf.ethz.ch In article <920629220811.21a51350@sds.sdsc.edu> gribskov@SDSC.EDU (Michael Gribskov) writes: > > Personally, I believe this nomenclature to be extremely unfortunate. The > term "Dayhoff matrix" is nearly universally used to mean the MDM78 > (mutation data scoring matrix; log-odds matrix for 250 PAMs). To call the > Gonnet et al. matrix a Dayhoff matrix is to imply that it was derived by > Dayhoffs methodology. A less connotation loaded term would be log-odds > matrix. The term PAM-250 matrix has also been used virtually as a synonym > for the MDM78 matrix. ================================================= There are three type of matrices: (names as in Dayhoff et al.) "Number of accepted point mutations", which is the original collection of data points. (Nobody uses this much further) "Mutation probability matrix", where entry Mij describes the probability of amino acid "j" mutating into aminoacid "i" in 1 PAM-unit of evolution. This is what we (and I believe everybody else) calls mutation matrix, and is really a transposed Markov matrix. When M is powered to some value, say 250, we obtain the mutation matrix (same definition as above) for an evolution of 250 PAM-units. This is statistics 101. "Log-odds matrix", a matrix of logarithms of quotients of probabilities, suitable for running the dynamic programming algorithm (or NW) to align sequences. We (and lots of other people) are naming this type of matrix "Dayhoff matrix" as a generic term, in honor of Margaret Dayhoff, given that she (they) were the first ones to derive such a beast. Nobody who understands what is going on, uses mutation matrices with dynamic programming, mutation matrices are used to compute log-odds matrices or "Dayhoff matrices". I believe we are all agreeing, it is just a problem of using the right names. And I find that the literature has been a bit careless about naming. Gaston H. Gonnet, Informatik, ETH, Zurich. From owner-software@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!CONVEX.HRZ.UNI-MARBURG.DE!otto_mi From: otto_mi@CONVEX.HRZ.UNI-MARBURG.DE (Michael Otto) Newsgroups: bionet.software Subject: (none) Message-ID: <9207010653.AA10145@convex.HRZ.Uni-Marburg.DE> Date: 1 Jul 92 06:53:06 GMT Sender: daemon@genbank.bio.net Distribution: bionet Lines: 14 Dear Netters, - hi - is there anybody working with the Program MacroModel 3.x ? please if there are any users, can someone send me the file MMOD.DOC -or can tell me where I can download it ? Our Institue had got that program, but without specially that file - noone need that document file since I've to change some parameters in the program