From owner-software@net.bio.net Tue Dec 01 22:00:00 1992 Path: biosci!CU.NIH.GOV!CZJ From: CZJ@CU.NIH.GOV Newsgroups: bionet.software Subject: Re: hebrew characters Message-ID: <9212020117.AA05295@net.bio.net> Date: 2 Dec 92 01:13:42 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 62 > > >From: IN%"blum@aeolus.ethz.ch" 29-NOV-1992 11:52:27.37 > >To: IN%"bio-soft@net.bio.net" > >CC: > >Subj: hebrew characters > > > >Does someone out there know of software which would allow typing > hebrew characters on a Mac or IBM computer?? > > > A company called Davka specializes in Hebrew fonts (some 56 of > them in their catalog). They also sell specialized word processor > software for editing/dictionary/thesaurus functions in > Hebrew/English. > > I'm not aware of free fonts, sorry. Anyone that is aware of them, I'd > be interested, as well. > > The info for the company is as follows: > > Davka Corporation > 7074 N. Western > Chicago, IL 60645 > phone: 800-621-8227 or 312-465-4070 > > > Shalom > > Phil > The Software Labs, a shareware source, lists a program called INTEXT. I will just enter the blurb: INTEXT is the forst trule multilingual word processor available through shareware. Developed over many years by multinational programmers, INTEXT allows you to word process in any one of the following 8 languages: Arabic, European languages, Farsi, Gaelic, Greek, Hebrew, Polish, and Russian. This unique program has powerful features but is easy to use because it allows you to view documents on-screen before printing. Supports Epson FX compatible printers, IBM Proprinter, and compatibles, and Epson LQ printers. Requires 512K and CGA or Hercules Graphics card. Catalog Numbers 865 - Arabic 866 - European Languages 867 - Farsi 868 - Gaelic 869 - Greek 870 - Hebrew 871 - Polish 872 - Russian. The cost is $ 3.69 each plus shipping and handling. Since this is shareware there is also the cost to the author if you like the program. The number for ordering is 800-569-7900 8:00am - 6:00 pm PST. Jim Cassatt From owner-software@net.bio.net Tue Dec 01 22:00:00 1992 Path: biosci!lhc!darwin.sura.net!spool.mu.edu!think.com!enterpoop.mit.edu!eru.mt.luth.se!lunic!sunic!news.funet.fi!funic!convex!harper From: harper@convex.csc.FI (Rob Harper) Newsgroups: bionet.software Subject: Re: hebrew characters Message-ID: <1992Dec2.061825.27599@nic.funet.fi> Date: 2 Dec 92 06:18:25 GMT References: <9212020117.AA05295@net.bio.net> Sender: usenet@nic.funet.fi Distribution: bionet Organization: Finnish Academic and Research Network Project - FUNET Lines: 33 Nntp-Posting-Host: convex.csc.fi In <9212020117.AA05295@net.bio.net> CZJ@CU.NIH.GOV writes: >The Software Labs, a shareware source, lists a program called >INTEXT. I will just enter the blurb: I had a look on nic.funet.fi for intext and found that it was available. sun4 /pub/msdos 11> grep intext 00Index.all intext12.zip Intext v1.2A multi-lingual word processor You can get it from a couple of directories listed below. ftp> quote find intext12.zip 212-Matching case insensitively expr `intext12.zip' 212-Starting to parse /files/ALL_FILES database: - 266030 Feb 06 14:54 1992 pub/msdos/editors/editor/intext12.zip - 266030 Feb 06 14:54 1992 pub/msdos/SIMTEL20-mirror/editor/intext12.zip 212 End of analysis. 2 matches found. So start up your anonymous ftp engine and get it... that is ftp nic.funet.fi login: anonymous password: userid@host RGDS -=ROB=- -- ~ Rob Harper ~ E-mail: harper@convex.csc.fi ~ Finnish State Computer Centre ~ Molbio/software: harper@nic.funet.fi ~ P.O. Box 40 ~ Telephone: +358 0 457 2076 ~ SF-02101 Espoo Finland ~ Fax: +358 0 457 2302 From owner-software@net.bio.net Tue Dec 01 22:00:00 1992 Path: biosci!daresbury!news From: sanglard@aeolus.ethz.ch (Dominique Sanglard) Newsgroups: bionet.software Subject: ABOUT STADEN Message-ID: <1992Dec2.171706.15970@gserv1.dl.ac.uk> Date: 2 Dec 92 17:14:40 GMT Sender: list-admin@daresbury.ac.uk Distribution: bionet Lines: 14 Content-Identifier: 83 Original-To: bio-soft@uk.ac.daresbury (IPM Return Requested) Conversion: Prohibited Who could give me advices about the STADEN DNA Analysis Program (Compatible for the Mac): -Where it can be obtained ? -Some comments on his performance versus other similar package (for ex DNA Strider, MacVector, Geneworks, etc.) Thanks for your answers and sorry for taking some of your precious working time D.Sanglard Dpt Biotechnology ETH-Hoenggerberg CH-8093 Zurich e-mail: sanglard@aeolus.ethz.ch From owner-software@net.bio.net Tue Dec 01 22:00:00 1992 Path: biosci!MEDUSA.UNM.EDU!mplatt From: mplatt@MEDUSA.UNM.EDU Newsgroups: bionet.software Subject: Hebrew Message-ID: <9212021523.AA29030@net.bio.net> Date: 2 Dec 92 15:24:53 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 15 There is a font on most of the shareware mac-servers, Michigan, SUMEX etc., called Shalom script which enables the insertion of Hebrew in the mac, when the international functions of 7.1 come out for the mac then you will also be able to write rt to lft but dont hold your breath. So you can write backwards in Hebrew idf you only need a few words. I also have Hebrew system 7.0.1 for the mac which is great and comes with fonts, which can be FTP'd from apple. The Nissus hebrew/english wp program for the mac is very expensive and has hardware copy protection. Have fun... Mark Platt Mark Platt ...... .......... School of Medicine ...... Dept of Microbiology ..... Albuquerque ...... .............MPLATT@MEDUSA.UNM.EDU.... NM 87131 From owner-software@net.bio.net Tue Dec 01 22:00:00 1992 Path: biosci!bcm!cs.utexas.edu!sdd.hp.com!zaphod.mps.ohio-state.edu!sol.ctr.columbia.edu!usenet.ucs.indiana.edu!sunflower.bio.indiana.edu!delwiche From: delwiche@sunflower.bio.indiana.edu (Charles Delwiche) Newsgroups: bionet.software Subject: Re: hebrew characters Message-ID: Date: 2 Dec 92 21:39:26 GMT References: <1992Nov29.162554.10573@gserv1.dl.ac.uk> Sender: news@usenet.ucs.indiana.edu (USENET News System) Distribution: bionet Organization: Biology, Indiana University - Bloomington Lines: 24 Nntp-Posting-Host: sunflower.bio.indiana.edu In article <1992Nov29.162554.10573@gserv1.dl.ac.uk> blum@aeolus.ethz.ch (Blum) writes: > > >Hi to everybody, > >Does someone out there know of software which would allow typing hebrew >characters on a Mac or IBM computer?? > >Thanks for all information One of the main features of Apple's new system 7.1 for the Macintosh is supposed to be its support for "world" character sets. I have seen Hebrew fonts for the Macintosh, but supposedly system 7.1 will let you more or less completely convert your Macintosh over to whatever language and alphabet you prefer. Apple is primarily advertising its applicability to far eastern character alphabets, but I presume Hebrew would be a straight-forward matter. -- ------- Charles F. Delwiche (812) 855-2549 Dept. of Biology, Indiana University Bloomington, IN 47405 From owner-software@net.bio.net Wed Dec 02 22:00:00 1992 Path: biosci!bcm!cs.utexas.edu!uunet!mnemosyne.cs.du.edu!nyx!thiggins From: thiggins@nyx.cs.du.edu (Trevor Higgins) Newsgroups: bionet.software Subject: Software for protein folding Message-ID: <1992Dec3.044627.23240@mnemosyne.cs.du.edu> Date: 3 Dec 92 04:46:27 GMT Sender: usenet@mnemosyne.cs.du.edu (netnews admin account) Organization: University of Denver, Dept. of Math & Comp. Sci. Lines: 6 Does anyone know of any software for the calculation of polypeptide conformations? I haven't been able to locate any and some people have suggested that it isn'n possible with current computers. Is this true? T.H. From owner-software@net.bio.net Wed Dec 02 22:00:00 1992 Path: biosci!uwm.edu!cs.utexas.edu!wupost!uunet!news.univie.ac.at!vm.univie.ac.at!A8731GBK From: A8731GBK@vm.univie.ac.at (Robert J. Felber) Newsgroups: bionet.software Subject: cloverleaf secondary structure search program Message-ID: <1992Dec3.210220.9414@newssrv.edvz.univie.ac.at> Date: 3 Dec 92 20:48:41 GMT Sender: news@newssrv.edvz.univie.ac.at (News System - Vienna University) Organization: University of Vienna Lines: 10 Nntp-Posting-Host: helios.edvz.univie.ac.at Dear Netters, I am looking for a program, which is able to detect potential cloverleaf secondary structures (potential tRNAs) for a MS-DOS computer. I found one in the literature: 'TRNA', developed by Staden (1980) Nucleic Acid Research 8, 817-825. Does anyone know, from where I can get it or if there is a modern equivalent. For any hints I would be very appreciated. Thanks in advance. Robert J. From owner-software@net.bio.net Wed Dec 02 22:00:00 1992 Path: biosci!CSC.FI!Rob.Harper From: Rob.Harper@CSC.FI (Rob Harper) Newsgroups: bionet.software Subject: Gopher Server at National Institutes of Health Message-ID: <199212030728.AA04223@csc.fi> Date: 3 Dec 92 07:28:54 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 45 %%%%%%%%%%%%%%%%%%%%%%%%%% CLIP %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% We are pleased to announce a gopher server at the National Institutes of Health (NIH). This server is maintained by the Division of Computer Research and Technology (DCRT) and contains information useful to biomedical researchers at the NIH Bethesda Campus. Notable items of potential interest to the community-at-large include: *NIH Phone Book. *Information about postdoctoral research and training opportunities at NIH, from the NIH Office of Education. *Molecular Biology databases (GenBank, PIR, Swiss-Prot, PDB, Prosite, LiMB, TFD). We have hopes that more information of general interest will become available in the not too distant future. For those who wish to link directly to this site: Name=National Institutes of Health (NIH) Gopher Type=1 Port=70 Path= Host=gopher.nih.gov Visitors to the NIH Gopher should read the "About this Gopher" file for information about site specific features. Since we expect our Gopher to be undergoing continual modification and fine-tuning we request that people who make specific links to items within our data tree notify us of what they have linked to. This way we will be in the position to notify those sites if/when we change items what would render their links inoperable. Please direct questions/comments to gopher@gopher.nih.gov Peter FitzGerald Charlene Osborn Steve Fellini Steve Bailey %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% From owner-software@net.bio.net Wed Dec 02 22:00:00 1992 Path: biosci!agate!ames!saimiri.primate.wisc.edu!zaphod.mps.ohio-state.edu!cs.utexas.edu!uunet!pipex!warwick!nott-cs!news From: mbxfd@mips.nott.ac.uk Newsgroups: bionet.software Subject: Software for calculating pI? Message-ID: <1992Dec3.145158.6678@cs.nott.ac.uk> Date: 3 Dec 92 14:51:58 GMT Sender: news@cs.nott.ac.uk Reply-To: mbxfd@uk.ac.nottingham.ccc.vme Organization: Nottingham University, UK. Lines: 15 Hello, Does anybody know of software to calculate the pI of peptides? I have a colleague who runs the departmental peptide synthesis/sequencing unit. Some of his longer peptides (>30residues) are difficult to clean up by RPHPLC, so ion-xchange HPLC might be better. If he knew the expected pI of the full length paptide and the truncated contaminants he could design a separation. I suppose you could do this with a speardsheet but is their a PD program, Mac or PC? Presumably there are difficulties with predicting pI if there is any secondary structure in the longer paptides. Thanks. Fergus Doherty, Dept. Biochemistry, Nottingham University, UK. From owner-software@net.bio.net Wed Dec 02 22:00:00 1992 Path: biosci!uwm.edu!wupost!cs.utexas.edu!uunet!munnari.oz.au!constellation!aardvark.ucs.uoknor.edu!broe From: broe@aardvark.ucs.uoknor.edu (Bruce Roe) Newsgroups: bionet.software Subject: Re: ABOUT STADEN Message-ID: <3DEC199207521319@aardvark.ucs.uoknor.edu> Date: 3 Dec 92 13:52:00 GMT References: <1992Dec2.171706.15970@gserv1.dl.ac.uk> Sender: usenet@constellation.ecn.uoknor.edu (Usenet Administrator) Distribution: bionet Organization: University of Oklahoma - University Computing Services Lines: 31 Originator: usenet@midway.ecn.uoknor.edu News-Software: VAX/VMS VNEWS 1.41 Nntp-Posting-Host: midway.ecn.uoknor.edu In article <1992Dec2.171706.15970@gserv1.dl.ac.uk>, sanglard@aeolus.ethz.ch (Dominique Sanglard) writes... >Who could give me advices about the STADEN DNA Analysis Program >(Compatible for the Mac): >-Where it can be obtained ? >-Some comments on his performance versus other similar package >(for ex DNA Strider, MacVector, Geneworks, etc.) > >Thanks for your answers and sorry for taking some of your >precious working time > >D.Sanglard >Dpt Biotechnology >ETH-Hoenggerberg >CH-8093 Zurich >e-mail: sanglard@aeolus.ethz.ch Hi, You may wish to contact Rodger Staden via e-mail to: rs@mrc-lmba.cam.ac.uk He's at the: Medical Research Council - Lab. Molecular Biology Hills Road Cambridge, England Cheers....bruce - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - \ Bruce A. Roe Professor of Chemistry and Biochemistry / / University of Oklahoma INTERNET: BROE@aardvark.ucs.uoknor.edu \ - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - From owner-software@net.bio.net Wed Dec 02 22:00:00 1992 Path: biosci!agate!stanford.edu!hsdndev!husc-news.harvard.edu!husc10!robison1 From: robison1@husc10.harvard.edu (Keith Robison) Newsgroups: bionet.software Subject: Re: Software for calculating pI? Message-ID: Date: 3 Dec 92 16:42:56 GMT References: <1992Dec3.145158.6678@cs.nott.ac.uk> Lines: 12 Nntp-Posting-Host: husc10.harvard.edu The GCG program PeptideSort will do this, and there is also a way to do this in DNA*STAR (which I don't use, but I know you can do it). I suspect that other major packages have it too. Keith Robison Harvard University Department of Cellular & Developmental Biology Department of Genetics / HHMI robison@biosun.harvard.edu From owner-software@net.bio.net Wed Dec 02 22:00:00 1992 Path: biosci!INSECT.BERKELEY.EDU!bosborne From: bosborne@INSECT.BERKELEY.EDU Newsgroups: bionet.software Subject: Midas for the NeXT? Message-ID: <9212032120.AA12663@insect.berkeley.edu> Date: 3 Dec 92 21:20:38 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 15 To the Group, Has anyone heard of a program Midas (MIDAS?), supposedly a DNA sequence analysis program for the NeXT? Or is it simply an X Windows application that could run on any of the several X servers made for NeXTs? Thank you for your attention to this matter, ------------------------------------------------------------------ Brian Osborne Plant Gene Expression Center bosborne@insect.berkeley.edu Albany CA USA "Computers are useless. They can only give you answers." Picasso ------------------------------------------------------------------ From owner-software@net.bio.net Thu Dec 03 22:00:00 1992 Path: biosci!agate!usenet.ins.cwru.edu!po.CWRU.Edu!ccy From: ccy@po.CWRU.Edu (Cheung C. Yue) Newsgroups: bionet.software Subject: DNA Strider v 1 Message-ID: <1fnpqqINN7kd@usenet.INS.CWRU.Edu> Date: 4 Dec 92 14:26:34 GMT Reply-To: ccy@po.CWRU.Edu (Cheung C. Yue) Organization: Case Western Reserve University, Cleveland, OH (USA) Lines: 11 NNTP-Posting-Host: slc5.ins.cwru.edu I have heard much about DNA Strider. Before I dish out a couple of hundred bucks for v2.0, I would like to try out v1, which I understand is free/shareware. Unfortunately I cannot locate a FTP site, even with Archie. Can anyone help? P.S. I hope my information is correct, so that I am not requesting anything illegal. ccy@po.cwru.edu -- From owner-software@net.bio.net Thu Dec 03 22:00:00 1992 Path: biosci!daresbury!daresbury!doc.ic.ac.uk!agate!usenet.ins.cwru.edu!magnus.acs.ohio-state.edu!zaphod.mps.ohio-state.edu!sol.ctr.columbia.edu!destroyer!cs.ubc.ca!unixg.ubc.ca!kakwa.ucs.ualberta.ca!acs.ucalgary.ca!akctai From: akctai@acs.ucalgary.ca (Alan Kar-cheung Tai) Newsgroups: bionet.software Subject: Banner Printing Programs Message-ID: <92Dec04.003642.38848@acs.ucalgary.ca> Date: 4 Dec 92 00:36:42 GMT Sender: news@acs.ucalgary.ca (USENET News System) Organization: The University of Calgary, Alberta Lines: 16 Nntp-Posting-Host: acs3.acs.ucalgary.ca I am trying to find a good banner printing program that would be suitable for producing the title in a poster at a scientific meeting. My only requirements are that it be a MS-DOS program compatible with a PostScript laserprinter. The ability to use different types and styles is also needed (Times roman vs Helvetic, bold, italic, etc). I am NOT interested in programs that only work with dot matrix printers. So, what is your favorite tool for doing this? Reply by email or followups, it doesn't matter. Thanks, in advance, -- --------- Alan K.-C. Tai ---------|\^/|--------- akctai@acs.ucalgary.ca --- Dept Biological Sciences _|\| |/|_ 70022.740@compuserve.com University of Calgary > < Voice: (403) 220-3552 ------ AB CANADA T2N 1N4 ------->_./|\._<------- Fax: (403) 289-9311 ------ From owner-software@net.bio.net Thu Dec 03 22:00:00 1992 Path: biosci!agate!stanford.edu!hsdndev!nmr-z!opal.mgh.harvard.edu!burglin From: burglin@opal.mgh.harvard.edu (Thomas Burglin) Newsgroups: bionet.software Subject: Gelreader problems Message-ID: <3DEC199216365334@opal.mgh.harvard.edu> Date: 3 Dec 92 21:36:00 GMT Sender: usenet@nmr-z.mgh.harvard.edu (User for USENET news postings) Organization: Molecular Biology, Massachusetts General Hospital, Boston Lines: 22 News-Software: VAX/VMS VNEWS 1.41 Nntp-Posting-Host: opal.mgh.harvard.edu Hi, I just downloaded Gelreader 2.03 (we also had 2.0) I carefully read the manual, but I am unable to get the program to calculate any Molecular Weights. I have no problem gettting mobilities , but whenever I switch the preferences to Molecular Weight, the "Generate Report" menu stays greyed out, and I am not able to calculate Molecular weights for unknowns. The one example that worked was the example file with 12 lanes and a template, but I have no idea why and how it worked. Any info appreciated. Is this a bug. I am using this on a si with system 7.0.1, and I tried the fpu version on a cx with system 7.0.1 with no succes either. Any help appreciated. Are there any other programs out there for the Macintosh to determine easily the molecular weights of DNA fragments on agarose gels from pictures ? Thanks Thomas Burglin burglin@frodo.mgh.harvard.edu From owner-software@net.bio.net Thu Dec 03 22:00:00 1992 Path: biosci!uwm.edu!cs.utexas.edu!wupost!zaphod.mps.ohio-state.edu!malgudi.oar.net!caen!kuhub.cc.ukans.edu!husc-news.harvard.edu!husc10!robison1 From: robison1@husc10.harvard.edu (Keith Robison) Newsgroups: bionet.software Subject: 7 transmembrane helices plot Keywords: proteins, receptors Message-ID: Date: 3 Dec 92 23:16:05 GMT Lines: 13 Nntp-Posting-Host: husc10.harvard.edu Does anyone out there have a program for generating schematics of membrane-spanning proteins (of the sort you see in review articles and textbooks?) or such a graphic already made up in computer useable format? Keith Robison Harvard University Department of Cellular & Developmental Biology Department of Genetics / HHMI robison@biosun.harvard.edu From owner-software@net.bio.net Thu Dec 03 22:00:00 1992 Path: biosci!CSC.FI!Rob.Harper From: Rob.Harper@CSC.FI (Rob Harper) Newsgroups: bionet.software Subject: Pictures in Gopher Message-ID: <199212041338.AA14617@csc.fi> Date: 4 Dec 92 13:38:35 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 81 >Newsgroups: bionet.users.addresses >Path: funic!convex!harper >From: harper@convex.csc.FI (Rob Harper) >Subject: Pictures in Gopher >Message-ID: <1992Dec4.132458.5209@nic.funet.fi> >Summary: Viewing images over the net. >Keywords: xloadimage vs xv >Sender: usenet@nic.funet.fi >Nntp-Posting-Host: convex.csc.fi >Organization: Finnish Academic and Research Network Project - FUNET >Date: Fri, 4 Dec 92 13:24:58 GMT >Lines: 67 The mother of all gophers just put out a gif of their recent conference. 11. big Ann Arbor gopher conference picture.gif On the Unix gopher if you press O (capital O) for options you get the following: Internet Gopher Options 1. Pager Command : less 2. Print Command : lpr 3. Telnet Command : telnet 4. Sound Command : /bin/false 5. Mail Command : mail 6. 3270 Emulator Command : tn3270 7. MIME pager : metamail -p 8. Image Viewer : xloadimage -fork Press 1-8 to change a field, Return to accept fields and continue For me at least the "xloadimage -fork" did not work so I pressed 8 to change the option to "xv" and lo and behold I got a nice colour picture of the folks who attended the conference. So what is the significance of being able to view pictures over the net? Would it be useful? Is it desirable? What sort of scientific cooperation would benifit from the possibility to share images over the net? Tomography, Molecular modeling? Well at least one example springs to mind... in the latest AATDB distribution xv was included so you could view some pictures of different varieties of Arabidopis... so now it would be possible to do the same thing over the network. Oh yes, and by the way I did some experimentation on our gopher to see just how stable the xv image viewing is. You can try it out if you have xwindows capabilities by giving the command: gopher finsun.csc.fi and going into the option 5 5. Finnish EMBnet BioBox/ In there you will find items 15 and 16. I have decided that it is time that all my fans should finally see what I really look like... well here is your chance:-) 15. uncle Rob's Lonely Heart's Club Band (b/w) 16. uncle Rob's Lonely Heart's Club band (c) P.S. Rememember to setenv DISPLAY your.machine.name:0.0 so xv can open up a window to view the file. RGDS -=ROB=- P.P.S. Frank this is the silly season isn't it? I won't get shot for this? Will I? -- ~ Rob Harper ~ E-mail: harper@convex.csc.fi ~ Finnish State Computer Centre ~ Molbio/software: harper@nic.funet.fi ~ P.O. Box 40 ~ Telephone: +358 0 457 2076 ~ SF-02101 Espoo Finland ~ Fax: +358 0 457 2302 From owner-software@net.bio.net Thu Dec 03 22:00:00 1992 Path: biosci!uwm.edu!zaphod.mps.ohio-state.edu!cs.utexas.edu!uunet!utcsri!newsflash.concordia.ca!sifon!CC.UMontreal.CA!little From: little@ERE.UMontreal.CA (Littlejohn Tim) Newsgroups: bionet.software Subject: Re: Mac_to_PC Message-ID: <1992Dec4.164342.4854@cc.umontreal.ca> Date: 4 Dec 92 16:43:42 GMT References: <1992Dec4.150623.2449@gserv1.dl.ac.uk> Sender: news@cc.umontreal.ca (Administration de Cnews) Distribution: bionet Organization: Universite de Montreal Lines: 67 In article <1992Dec4.150623.2449@gserv1.dl.ac.uk> BIONET@FRCGM51.EARN writes: > > Dear fellow netters, > > As everybody knows, there is no problem in reading a PC diskette on >a Mac through Apple File Exchange. > > What I'm looking for is a means for reading a Mac-formatted >diskette on my PC. Does somebody knows of a peace of software, commercial >or not, for this purpose? This is fast becoming a FAQ! The advice given last time was: --------------------------------------------------------------------------- I posted this: Try looking in the simtel archive: PD1: The file MAC2IBM.ARC has a description that suggests it may be useful for file exchange from a Mac disk to the PC. --------------------------------------------------------------------------- And Jasper Rees, Oxford University (jasper@vax.path.ox.ac.uk wrote): ...Apple's PC Exchange. Originally billed as part of System 7 it didn't make it in time and we got our first copies this week with some new Macs. It is fully system 7 integrated, read/writes/initializes DOS disks (high density anyway, I haven't tested a low density one, though I have a drive somewhere if anyone feels they really want to know :) and you can configure it to display icons of data files for software where there is a PC-Mac pair of versions. It cost us 38 pounds sterling, probably costs US$38 therefore, and I imagine it will become part of system 7 at some time in the future, though at present that is a one copy - one machine license. Now this has *got* to better than Apple file exchange ! So, check out your local Apple dealer! I guess it goes without saying - I liked it! regards, jasper --------------------------------------------------------------------------- By the way, this information was retrieved by searching "Bionet News via WAIS" at Genbank.Bio.Net via the IUBio-Gopher. Thanks again to Don Gilbert. I hope this is of some help, Tim ============================================================================== E-mail: little@ere.umontreal.ca Tim Littlejohn Snail Mail: Departement de biochimie Phone: (514) 343-7936 Universite de Montreal Fax: (514) 343-2210 C.P. 6128, succursale A, Montreal (Quebec), H3C 3J7 CANADA ============================================================================== From owner-software@net.bio.net Thu Dec 03 22:00:00 1992 Path: biosci!HELIX.MGH.HARVARD.EDU!HAINES From: HAINES@HELIX.MGH.HARVARD.EDU ("Jonathan L. Haines") Newsgroups: bionet.software Subject: banner printing programs Message-ID: <01GRWXRZ0LEA8WWUIP@HELIX.MGH.HARVARD.EDU> Date: 4 Dec 92 15:29:21 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 7 Regarding Banner Mania...we use it a fair amount, but it does have some limitations: the number of characters per line is limited to about 60, and the number of lines per banner is limited to 2 (but up to 6 lines can be printed on a page if you reprint on the same paper). Jonathan Haines From owner-software@net.bio.net Thu Dec 03 22:00:00 1992 Path: biosci!daresbury!news From: BIONET@FRCGM51.EARN Newsgroups: bionet.software Subject: Mac_to_PC Message-ID: <1992Dec4.150623.2449@gserv1.dl.ac.uk> Date: 4 Dec 92 16:02:00 GMT Sender: list-admin@daresbury.ac.uk from FRCGM51.BITNET (BIONET) by UKACRL.BITNET (Mailer R2.07) with BSMTP id 2928; Fri, 04 Dec 92 15: 03:36 GMT Distribution: bionet Lines: 21 X-Envelope-To: bio-software@daresbury.ac.uk Original-To: bio-software@UK.AC.DARESBURY X-Vms-To: IN%"bio-software@daresbury.ac.uk" Dear fellow netters, As everybody knows, there is no problem in reading a PC diskette on a Mac through Apple File Exchange. What I'm looking for is a means for reading a Mac-formatted diskette on my PC. Does somebody knows of a peace of software, commercial or not, for this purpose? Thank you for your help, --------------------------------------------------------------- | Jean-Loup Risler | | | CNRS | | | Centre de Genetique Moleculaire | Risler@frcgm51.bitnet | | 91190 Gif sur Yvette France | | --------------------------------------------------------------- From owner-software@net.bio.net Thu Dec 03 22:00:00 1992 Path: biosci!agate!ames!haven.umd.edu!uunet!newsflash.concordia.ca!sifon!CC.UMontreal.CA!little From: little@ERE.UMontreal.CA (Littlejohn Tim) Newsgroups: bionet.software Subject: Re: cloverleaf secondary structure search program Message-ID: <1992Dec4.143855.2935@cc.umontreal.ca> Date: 4 Dec 92 14:38:55 GMT References: <1992Dec3.210220.9414@newssrv.edvz.univie.ac.at> Sender: news@cc.umontreal.ca (Administration de Cnews) Organization: Universite de Montreal Lines: 35 In article <1992Dec3.210220.9414@newssrv.edvz.univie.ac.at> A8731GBK@vm.univie.ac.at (Robert J. Felber) writes: >Dear Netters, > >I am looking for a program, which is able to detect potential cloverleaf >secondary structures (potential tRNAs) for a MS-DOS computer. I found >one in the literature: 'TRNA', developed by Staden (1980) Nucleic Acid >Research 8, 817-825. >Does anyone know, from where I can get it or if there is a modern equivalent. >For any hints I would be very appreciated. Thanks in advance. There is an excellent tRNA identification program called tRNAscan available by email request to bioserve@genome.lanl.gov The e-mail message should contain the single word "trna-scan". See the paper by Fitchant and Burks in J. Mol. Biol., 220: 659-671 (1991). We use this program on Sun SPARCstations but as the C code is provided, it should be implementable on a PC. I hope this helps, Tim ============================================================================== E-mail: little@ere.umontreal.ca Tim Littlejohn Snail Mail: Departement de biochimie Phone: (514) 343-7936 Universite de Montreal Fax: (514) 343-2210 C.P. 6128, succursale A, Montreal (Quebec), H3C 3J7 CANADA ============================================================================== From owner-software@net.bio.net Thu Dec 03 22:00:00 1992 Path: biosci!WELCHGATE.WELCH.JHU.EDU!danj From: danj@WELCHGATE.WELCH.JHU.EDU (Dan Jacobson) Newsgroups: bionet.software Subject: Re: cloverleaf secondary structure search program Message-ID: <9212042250.AA01301@welchgate.welch.jhu.edu> Date: 4 Dec 92 22:50:29 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 41 In article <1992Dec3.210220.9414@newssrv.edvz.univie.ac.at> A8731GBK@vm.univie.ac.at (Robert J. Felber) writes: >Dear Netters, > >I am looking for a program, which is able to detect potential cloverleaf >secondary structures (potential tRNAs) for a MS-DOS computer. I found >one in the literature: 'TRNA', developed by Staden (1980) Nucleic Acid >Research 8, 817-825. >Does anyone know, from where I can get it or if there is a modern equivalent. >For any hints I would be very appreciated. Thanks in advance. > >Robert J. There is a program at ftp.bio.indiana.edu in the molbio/mac directory called trna.hqx. You can download it via anonymous ftp or by gopher (if you go by gopher it's in the IUBio-Software+Data/molbio/mac directory). Note that there are two other files there - trnasearch-euk.hqx and trnasearch-prok.hqx - they are just the two halves of trna.hqx. I know that you want a DOS program - humor me for a minute :-) The Mac version was actually derived from a PC program which you may be able to get if you contact the author. The author of the DOS version is: Randall Shortridge Division of Biochem. P.O. Box 13048 Science Research Bldg. Denton, Texas 76203 Phone: (817) 565-2397 or 565-3537 Best of luck, Dan Jacobson danj@welchgate.welch.jhu.edu From owner-software@net.bio.net Thu Dec 03 22:00:00 1992 Path: biosci!ICBR.IFAS.UFL.EDU!SJJ From: SJJ@ICBR.IFAS.UFL.EDU ("JONG, SONG-MUH J") Newsgroups: bionet.software Subject: Re. MAC-PC software Message-ID: <9212042024.AA18073@net.bio.net> Date: 4 Dec 92 20:03:00 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 14 Someone posted a request asking for software on PC that can recognize MAC disks. I tried to reply to the original mail address without success. So I post it now to this newsgroup. There is a shareware program called CLINK which functions like a small shell for DOS machine. It can read, format, write MAC disks inserted in PC floppy drives, but only recognizes 1.4MB disks and not 720K disks. I believe it is available from any major FTP sites. Hope this info is useful for the PC/MAC people. Song-Muh Jong sjj@icbr.ifas.ufl.edu From owner-software@net.bio.net Thu Dec 03 22:00:00 1992 Path: biosci!ACS.UCALGARY.CA!akctai From: akctai@ACS.UCALGARY.CA (Alan Kar-cheung Tai) Newsgroups: bionet.software Subject: RE:Banner Printing Programs Message-ID: <9212040828.AA14078@net.bio.net> Date: 4 Dec 92 00:36:42 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 22 ALAN K.C. TAI WRITES: >I am trying to find a good banner printing program that would be >suitable for producing the title in a poster at a scientific meeting. >My only requirements are that it be a MS-DOS program compatible with a >PostScript laserprinter. The ability to use different types and styles >is also needed (Times roman vs Helvetic, bold, italic, etc). > >I am NOT interested in programs that only work with dot matrix printers. >So, what is your favorite tool for doing this? Reply by email or >followups, it doesn't matter. There is a software called Banner Mania that fits all your specs. I think it is distributed by Borderbound Software. GOOD LUCK! Wagner Fontes Brazilian Center of Protein Sequencing Biochemistry / Protein Chemistry Lab. University of Brazilia - Brazil WAGNERF AT BRUNB From owner-software@net.bio.net Fri Dec 04 22:00:00 1992 Path: biosci!bcm!cs.utexas.edu!wupost!darwin.sura.net!paladin.american.edu!news.univie.ac.at!hp4at!mcsun!uknet!comlab.ox.ac.uk!oxuniv!oxpath!rpgrant From: rpgrant@vax.path.ox.ac.uk Newsgroups: bionet.software Subject: Re: Software for calculating pI? Message-ID: <1992Dec4.160238.1@vax.path.ox.ac.uk> Date: 4 Dec 92 15:02:38 GMT References: <1992Dec3.145158.6678@cs.nott.ac.uk> Organization: Oxford University Molecular Biology Data Centre Lines: 15 Nntp-Posting-Host: kasia Nntp-Posting-User: rpgrant In article <1992Dec3.145158.6678@cs.nott.ac.uk>, mbxfd@mips.nott.ac.uk writes: > Hello, > Does anybody know of software to calculate the pI of peptides? In article , robison1@husc10.harvard.edu > The GCG program PeptideSort will do this GCG also has ISOELECTRIC, which draws a rather nice plot of charge against pH, so you can make an intelligent guess at appropiate pH values to do your ion exchange (IEX). As far as I know, it is not possible to correct for secondary structure (although I'd love to be proved wrong). Richard Grant rpgrant@vax.path.ox.ac.uk From owner-software@net.bio.net Fri Dec 04 22:00:00 1992 Path: biosci!bcm!cs.utexas.edu!hellgate.utah.edu!cc.usu.edu!fahole From: fahole@cc.usu.edu Newsgroups: bionet.software Subject: Re: Mac_to_PC Message-ID: <1992Dec4.163633.61652@cc.usu.edu> Date: 4 Dec 92 22:36:32 GMT References: <1992Dec4.150623.2449@gserv1.dl.ac.uk> Distribution: bionet Organization: Utah State University Lines: 14 In article <1992Dec4.150623.2449@gserv1.dl.ac.uk>, BIONET@FRCGM51.EARN writes: > What I'm looking for is a means for reading a Mac-formatted > diskette on my PC. Does somebody knows of a peace of software, commercial > or not, for this purpose? MACtoDOS will do this. It is analogous to the apple file exchange, in that you can't directly access the drive but must read the disks through the program. It will read write and format mac high density disks on a PC high density drive. For more info on it call, PLI at 1-800-477-7542 in the states. I'm sorry, I don't have a regular number for them but if you can't get through, email me and I'll call them for an address or number. -- David Hole DHOLE@MENDEL.USU.EDU Utah State University FAHOLE@CC.USU.EDU Logan, UT Just say snow! From owner-software@net.bio.net Fri Dec 04 22:00:00 1992 Path: biosci!enterpoop.mit.edu!eru.mt.luth.se!lunic!sunic!aun.uninett.no!nuug!nntp.uio.no!news From: olam@radium.uio.no (Ola Myklebost) Newsgroups: bionet.software Subject: Re: Networked printers Message-ID: <1992Dec5.142307.9994@ulrik.uio.no> Date: 5 Dec 92 14:23:07 GMT References: <9211301729.AA15399@darwin.sfbr.org> Sender: news@ulrik.uio.no (Mr News) Reply-To: olam@radium.uio.no (Ola Myklebost) Organization: University of Oslo Lines: 13 Nntp-Posting-Host: pcdnr05.uio.no I am not an expert, but have learned so much that I can say that connecting Macs, PCs and workstations to the same printer is not trivial. It depends on your network system, but we at least can share between macs and PCs a printer which can recognize the appletalk and parallel ports at the same time (NEC has one and others are coming). In this case you connect an etherprint box to the appletalk port and a PC server to the parallel port. We are part of a big network, and other machines (worksatations, VAXes etc) can print through a server system which I don't know too much about, except that the queues are taken care of by our DECstation server. I can give you email addresses to the experts if you wish. From owner-software@net.bio.net Fri Dec 04 22:00:00 1992 Path: biosci!ICBR.IFAS.UFL.EDU!SJJ From: SJJ@ICBR.IFAS.UFL.EDU ("JONG, SONG-MUH J") Newsgroups: bionet.software Subject: Re. MAC-PC program Message-ID: <9212050248.AA00261@net.bio.net> Date: 5 Dec 92 02:27:00 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 12 Thanks to Pierre's information on CLINK. It was available on SIMTEL before, but no longer so. The title screen of the program showed MAC-IN-DOS 1.0G by Pacific Micro, Inc. I do not have any information about hte above company. Any one who knows the company or any updated version of the above program please share your information. I believe this is going to be FAQ for people working with both types of computers. Song-Muh Jong sjj@icbr.ifas.ufl.edu From owner-software@net.bio.net Fri Dec 04 22:00:00 1992 Path: biosci!bcm!cs.utexas.edu!swrinde!zaphod.mps.ohio-state.edu!sol.ctr.columbia.edu!news.columbia.edu!cunixf.cc.columbia.edu!pcj1 From: pcj1@cunixf.cc.columbia.edu (Pierre Jelenc) Newsgroups: bionet.software Subject: Re: Re. MAC-PC software Message-ID: <1992Dec5.004907.13781@news.columbia.edu> Date: 5 Dec 92 00:49:07 GMT References: <9212042024.AA18073@net.bio.net> Sender: usenet@news.columbia.edu (The Network News) Reply-To: pcj1@cunixf.cc.columbia.edu (Pierre Jelenc) Distribution: bionet Organization: Columbia University Lines: 26 Nntp-Posting-Host: cunixf.cc.columbia.edu In article <9212042024.AA18073@net.bio.net> SJJ@ICBR.IFAS.UFL.EDU ("JONG, SONG-MUH J") writes: >Someone posted a request asking for software on PC that can recognize MAC >disks. I tried to reply to the original mail address without success. So >I post it now to this newsgroup. > >There is a shareware program called CLINK which functions like a small >shell for DOS machine. It can read, format, write MAC disks inserted in >PC floppy drives, but only recognizes 1.4MB disks and not 720K disks. I >believe it is available from any major FTP sites. > >Hope this info is useful for the PC/MAC people. > >Song-Muh Jong >sjj@icbr.ifas.ufl.edu CLINK is a hacked version of a commercial program called Mac-in -Dos (I think) and has been removed from all reputable archive sites. It did not work too well either, several featurees were disabled. Try to find the real program instead. Unfortunately, I don't have the info. Pierre Jelenc pcj1@cunixf.cc.columbia.edu Columbia University, New York From owner-software@net.bio.net Sat Dec 05 22:00:00 1992 Path: biosci!agate!spool.mu.edu!darwin.sura.net!paladin.american.edu!news.univie.ac.at!chx400!bernina!neptune!gonnet From: gonnet@inf.ethz.ch (Gaston Gonnet) Newsgroups: bionet.software Subject: RE: Automatic server at ETH Zurich Message-ID: <1992Dec6.163114.15399@neptune.inf.ethz.ch> Date: 6 Dec 92 16:31:14 GMT Sender: news@neptune.inf.ethz.ch (Mr News) Organization: Dept. Informatik, Swiss Federal Institute of Technology (ETH), Zurich, CH Lines: 37 Nntp-Posting-Host: rutishauser-gw.inf.ethz.ch >> From: BLC >> >> Many people may not know what Darwin is. Can you please describe it >> and/or give a reference? >> B.L.Cohen >> Genetics >> Glasgow Darwin (Data Analysis and Retrieval With Indexed Nucleotide/ peptide sequences) is an interactive system for doing sequence matching and sequence analysis. It is being presently developed at the E.T.H. in Zurich by the Computational Biochemistry Research Group. We are currently using Darwin to solve all our problems related to computational biochemistry. In doing so, the system develops according to our needs. Darwin can be used as an interactive system or more complicated programs can be written and executed. Darwin uses the same syntax as Maple and the semantics are also very similar. Maple is a symbolic algebra system. Users familiar with Maple will find Darwin very similar. The main reference for Darwin is: "A Tutorial on Computational Biochemistry using Darwin". A copy of the tutorial can be requested to wertli@inf.ethz.ch. The tutorial is sent by regular mail (about 180 pages). Darwin programs can be submitted to the ETH automatic server. The programs will be run and the results will be e-mailed back to the user. To find information about the automatic server, e-mail to cbrg@inf.ethz.ch (e.g. help darwin) Darwin is also distributed in object form at no cost. Presently versions for Sun/Sparc, Sun3, DEC/Risc, MIPS and Sequent machines are available. If you are planning on regular use of Darwin it may be best to obtain your own copy. Requests should be e-mailed to knecht@inf.ethz.ch. Gaston H. Gonnet, Informatik ETH, Zurich. From owner-software@net.bio.net Sun Dec 06 22:00:00 1992 Path: biosci!uwm.edu!zaphod.mps.ohio-state.edu!darwin.sura.net!welchgate.welch.jhu.edu!danj From: danj@welchgate.welch.jhu.edu (Dan Jacobson) Newsgroups: bionet.general,bionet.molbio.proteins,bionet.software Subject: NRL_3D Available for searching via Gopher Message-ID: <1992Dec7.202401.7417@welchgate.welch.jhu.edu> Date: 7 Dec 92 20:24:01 GMT Organization: Johns Hopkins Univ. Welch Medical Library Lines: 241 Xref: biosci bionet.general:3718 bionet.molbio.proteins:453 bionet.software:3730 The NRL_3D database is now available for searching by gopher. ================================================================ Description of NRL_3D From the NRL_3D documentation: NRL_3D is a protein sequence--structure database derived from the high resolution X-ray structures of proteins deposited in the Brookhaven National Laboratory's Protein Data Bank (PDB) (1) as of October 1988. NRL_3D has been conceived, developed, and tested by K. Namboodiri, N. Pattabiraman, A. Lowrey, and B. Gaber (2, 4) at the Naval Research Laboratory, Washington, D.C., and incorporated into the Protein Identification Resource (PIR) (3) by D. George and W. C. Barker at the National Biomedical Research Foundation, Washington, D.C. When citing this work please refer to references 2, 3, and 4. The PDB contains the atomic coordinates for the three-dimensional structure of a number of proteins obtained using single crystal X-ray diffraction data or other methods. One often would like to select sets or subsets of coordinate data according to sequence properties. However, the primary sequence information in the PDB is not represented in a form that is compatible with the sequence manipulation programs of the PIR or other sequence analysis software packages. The NRL_3D database provides a link between this software and the PDB and allows the sequence portion of the PDB to be searched and analyzed. Sequence data from selected coordinate sets in the PDB were extracted and reformatted in an NBRF-like format (see the PIR Document Database File Structure and Format Specification for details). These data have been set up as a database and are fully accessible to all of the PIR programs. Coordinate sets were selected on the criteria that 1) they corresponded to well-defined protein sequences, 2) they were determined with resolutions of 3.0 Angstroms or less, and 3) they were not determined by molecular mechanics or other theoretical techniques. When a selected PDB entry contained more than one polypeptide chain, each chain was represented as a separate entry in NRL_3D. In addition, if more than 3.8 Angstroms separated the alpha-carbons of adjacent amino acids, the sequence was divided into separate fragments and each fragment was represented in a separate entry. Large separations between adjacent amino acids result when an intervening sequence fragment cannot be resolved in the electron density map; the existence of large separations indicates that the sequence is not complete or that the chains are not covalently connected. (....) References ---------- 1. Abola, E.E., Bernstein, F.C., Bryant, S.H., Koetzle, T.F., and Weng, J. (1987) in Crystallographic Databases - Information Content, Software Systems, Scientific Applications, eds., Allen, F.H., Bergerhoff, G., and Sievers, R., Data Commission of the Int'l Union of Crystallography, Bonn, Cambridge, Chester, pp. 107-132. 2. Namboodiri, K., Pattabiraman, N., Lowrey, A., and Gaber, B.P. (1988) Automated Protein Structure Data Bank Similarity Searches and Their Use in Molecular Modeling with MIDAS, J. Mol. Graphics 6, 211-212. 3. George, D.G., Barker, W.C., and Hunt, L.T. (1986) The Protein Identification Resource (PIR), Nucl. Acids Res. 14, 11-15. 4. Pattabiraman, N., Namboodiri, K., Lowrey, A., and Gaber, B.P. (1989) Protein Sequences & Data Analysis (communicated). ============================ A typical entry is as follows: ENTRY 1ACE1 #Type Protein (fragment) TITLE Acetylcholinesterase, fragment 1 - Torpedo californica (electric ray) #EC-number 3.1.1.7 COMMENT PDB code: 1ACE SOURCE Torpedo californica #Common-name electric ray REFERENCE #Authors Sussman J.L., Harel M., Silman I. #Citation coordinates deposited in Brookhaven National Laboratory's Protein Data Bank REFERENCE #Authors Sussman J.L., Harel M., Frolow F., Oefner C., Goldman A., Toker L., Silman I. #Journal Science (1991) 253:872 #Title Atomic structure of acetylcholinesterase from torpedo californica: a prototypic acetylcholine-Binding protein. REFERENCE #Authors Sussman J., Harel M., Frolow F., Oefner C., Toker L., Silman I. #Book Cholinesterases: Structure, Function, Mechanism, Genetics, and Cell Biology, Massoulie, J., Bacou, F., Barnard, E., Chatonnet, A., Doctor, B., and Quinn, D.M., eds., pp.7, American Chemical Society, Columbus, Oh, 1991 #Title Structural studies on acetylcholinesterases from torpedo californica. REFERENCE #Authors Sussman J.L., Harel M., Frolow F., Goldman A., Oefner C., Toker L., Silman I. #Journal Proceedings Of The 1991 Medical Defense Bioscience Review (1991) 0:441 #Title 3-D structure of acetylcholinesterase from torpedo californica. REFERENCE #Authors Sussman J.L., Harel M., Frolow F., Silman I. #Journal Proceedings Of The 1989 Medical Defense Bioscience Review (1989) 0:309 #Title X-ray crystallographic studies of acetylcholinesterase. REFERENCE #Authors Sussman J.L., Harel M., Frolow F., Varon L., Toker L., Futerman A.H., Silman I. #Journal J. Mol. Biol. (1988) 203:821 #Title Purification and crystallization of a dimeric form of acetylcholinesterase from torpedo californica subsequent to solubilization with phosphatidylinositol-specific phospholipase c. COMMENT Resolution: 2.8 angstroms COMMENT R-value: 0.186 COMMENT Determination: X-ray diffraction KEYWORDS Hydrolase(carboxylic esterase) FEATURE 76-80 #Region helix (right hand alpha)\ 130-137 #Region helix (right hand alpha)\ 165-181 #Region helix (right hand alpha)\ 198-208 #Region helix (right hand alpha)\ 235-248 #Region helix (right hand alpha)\ 256-265 #Region helix (right hand alpha)\ 268-275 #Region helix (right hand alpha)\ 301-308 #Region helix (right hand alpha)\ 325-332 #Region helix (right hand alpha)\ 346-356 #Region helix (right hand alpha)\ 362-372 #Region helix (right hand alpha)\ 381-408 #Region helix (right hand alpha)\ 457-476 #Region helix (right hand alpha)\ 3-7,10-17,24-28,93-99, 138-144,107-113, 190-196,218-223, 314-321,413-420 #Region beta sheet\ 64-91 #Disulfide-bonds\ 251-262 #Disulfide-bonds\ 399 #Disulfide-bonds interchain (to 1ACE2:32)\ 197,324,437 #Site SUMMARY #Length 481 #Checksum 6848 SEQUENCE 5 10 15 20 25 30 1 S E L L V N T K S G K V M G T R V P V L S S H I S A F L G I 31 P F A E P P V G N M R F R R P E P K K P W S G V W N A S T Y 61 P N N C Q Q Y V D E Q F P G F S G S E M W N P N R E M S E D 91 C L Y L N I W V P S P R P K S T T V M V W I Y G G G F Y S G 121 S S T L D V Y N G K Y L A Y T E E V V L V S L S Y R V G A F 151 G F L A L H G S Q E A P G N V G L L D Q R M A L Q W V H D N From owner-software@net.bio.net Sun Dec 06 22:00:00 1992 Path: biosci!THEORY.BCHS.UH.EDU!dbd From: dbd@THEORY.BCHS.UH.EDU (Dan Davison) Newsgroups: bionet.software Subject: gene-server feeling much better, thanks Message-ID: <9212071905.AA06603@theory.BCHS.UH.EDU> Date: 7 Dec 92 19:05:35 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 8 The UH Gene-Server software developed a glitch on November 30th in the late afternoon and it was fixed this morning, December 7. If you sent a request to the Gene-Server e-mail facility during that time and did not get a response, our apologies and please re-send your requests. dan davison gene-server wrangler From owner-software@net.bio.net Sun Dec 06 22:00:00 1992 Path: biosci!agate!spool.mu.edu!sol.ctr.columbia.edu!ira.uka.de!math.fu-berlin.de!news.belwue.de!news.uni-tuebingen.de!studserv!zxmkr08 From: zxmkr08@studserv.zdv.uni-tuebingen.de (Cornelius Krasel) Newsgroups: bionet.software Subject: E.coli genetic map ftp-able? Message-ID: Date: 7 Dec 92 08:48:39 GMT Sender: news@softserv.zdv.uni-tuebingen.de (News Operator) Organization: Comp. Center (ZDV) U of Tuebingen, FRG Lines: 15 Hello netters, a recent paper (Mol. Microbiol. 5 (1991), 2629-2640) assembles sequencing data from E.coli to a genetic map and proposes to offer these data on a ftp server. I tried to contact the authors (the adress given in the article was reg@frpst01.bitnet) about three weeks ago but haven't received any answer yet... so I wanted to ask here if anybody is aware of these data and could tell me an internet adress... Thanx in advance, Cornelius. -- /* Cornelius Krasel, Department of Physiological Chemistry, U Tuebingen */ /* email: krasel@studserv.zdv.uni-tuebingen.de (Internet) HAS CHANGED!! */ /* NO WIN/X400 MAIL POSSIBLE AT THE MOMENT! */ /* "People are DNA's way of making more DNA." (anonymous) */ From owner-software@net.bio.net Sun Dec 06 22:00:00 1992 Path: biosci!agate!ames!saimiri.primate.wisc.edu!zaphod.mps.ohio-state.edu!darwin.sura.net!welchgate.welch.jhu.edu!danj From: danj@welchgate.welch.jhu.edu (Dan Jacobson) Newsgroups: bionet.general,bionet.software Subject: EPD is now available for searching via Gopher Message-ID: <1992Dec7.201926.7022@welchgate.welch.jhu.edu> Date: 7 Dec 92 20:19:26 GMT Organization: Johns Hopkins Univ. Welch Medical Library Lines: 142 Xref: biosci bionet.general:3717 bionet.software:3729 The Eukaryotic Promoter Database (EPD) is now available for searching via Gopher. I have taken the version of EPD that contains a codified header and the sequence of the promoter and translated the header into english so that it can be searched for keywords. For example: >EPD16010 (-) Gm RuBPCss SRS4; range -499 to 100. Now becomes - EPD16010 (-) Glycine max (soybean) Ribulose-1,5-biphosphate carboxylase small subunit SRS4; range -499 to 100. So a typical entry looks like the following: >EPD07005 (-) Glycine max (soybean) Ribulose-1,5-biphosphate carboxylase small subunit; range -499 to 100. NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNCTCCGAGAGGAATGAATAATGGAACCTCCATGTGTCACCTC CTCATATGGTATCCAACAATAAGGCTACCATTCGAAAATTTTCCTCGACTCGTGTGGCCT ATATGCTGTAATGTCATCACTTATTCGAATCCAACGGTTGTAACTTTTCGGCAACCAATC CTCTCCATTTCACACCATTGGATTAGTACTACACAAATCGACACTATTATATATAGCAAG TTTGAGCAGAAGCTTGGATATCTGGCAGCAGAAAAACAAGTAGTTGAGAACTAAGAAGAA GAAAATGGCTTCCTCAATGATCTCCTCCCCAGCTGTTACCACCGTCAACCGTGCCGGTGC // =============================================================================== From the EPD documentation: The Eukaryotic Promoter Database EPD was designed and developed at the Weizmann Institute of Science in Rehovot (Israel) and is currently maintained at ISREC in Epalinges s/Lausanne (Switzerland). EPD is a specialized annotation database of the EMBL Data Library. It provides information about eukaryotic promoters avail- able in the EMBL Data Library and is intended to assist experimental research- ers, as well as computer analysts, in the investigation of eukaryotic transcrip- tion signals. EPD is a rigorously selected database. In order to be included in EPD, a pro- moter must be: 1. recognized by eukaryotic RNA POL II, 2. active in a higher eukaryote, 3. experimentally defined or sufficiently homologous to a experimentally defined promoter, 4. biologically functional, 5. available in the current EMBL release, 6. distinct from other promoters in the database. Explanations: 1. Transcription by RNA POL II is bona fide assumed for protein coding genes but must be supported by alpha-amanitin data if the end product is an RNA. 2. All eukaryotes except phycophyta, fungi, myxomycetes, and protozoa are considered higher eukaryotes. Note that the expression "active in" does not always refer to the source organism of the promoter (e.g. in viruses). 3. A promoter is experimentally determined if a corresponding tran- scription initiation site is mapped with a precision of +/- 5 bp or higher. Any technique that characterizes the 5'terminus of an in vivo or in vitro generated RNA is acceptable. Single nuclease- protection or primer-extension data must be accompanied by additional evidence unless the gene's intron-exon organization is well established. Homology is considered "sufficient" if similarity (see section 6) is >=60% between -79 and +20 or >=75% between -49 and +10. 4. A promoter is biologically functional if it contributes to the source organism's survival and/or reproduction. This is bona fide assumed except for promoters of pseudogenes, minor transcription initiation sites (<20% of total gene transcripts), promoters giving rise to an unstable RNA product, and mutant promoter. 5. The minimum sequence requirement is 45 bp between -49 and +10. 6. Promoters are considered distinct if they originate from different gene loci or different species. Identity is assumed if two promoters from the same species exhibit >95% similarity between -79 and +20 while their genetic relationship is unknown. Multiple isolates of viruses or transposable elements are considered distinct if at least one promoter region fails to fulfill the above similarity criterion. The gopher site is: Name=Computational Biology (Welchlab - Johns Hopkins University) Type=1 Port=70 Path= Host=merlot.welch.jhu.edu You will find this database search in the following directory: --> 10. Search Databases at Welchlab (.....) Please read the "About these searches" file in the above directory as this service is still experimental and there are a few client-specific bugs. Note to Gopher administrators: If you want to make a link to this search I would suggest that you link to the directory rather than the search itself as the waisindex may change to another machine in the not-too-distant future. Sincerely, Dan Jacobson danj@welchgate.welch.jhu.edu ====================================================================== Standard disclaimer: This gopher site is experimental in nature and developement is ongoing. We cannot be responsible for the consequences to users of any errors in the data or the searches. ====================================================================== From owner-software@net.bio.net Mon Dec 07 22:00:00 1992 Path: biosci!enterpoop.mit.edu!mojo.eng.umd.edu!dynaflow From: dynaflow@eng.umd.edu (Georges Chahine @ Dynaflow Inc.) Newsgroups: sci.bio,bionet.software Subject: CONNOLLY (sp?) program for plotting molecular surfaces Message-ID: <1992Dec08.231335.2936@eng.umd.edu> Date: 8 Dec 92 23:13:35 GMT Organization: Project GLUE, University of Maryland, College Park Lines: 8 Xref: biosci sci.bio:1214 bionet.software:3734 I would like to obtain code and/or details regarding the CONNOLLY program to plot the surface of a macromolecule. The program appears to have applications in fluid mechanics (my area). Thanks in advance Ramani Duraiswami From owner-software@net.bio.net Mon Dec 07 22:00:00 1992 Path: biosci!HARVARD.EDU!greenes From: greenes@HARVARD.EDU (Bob Greenes) Newsgroups: bionet.software Subject: Medical Informatics Training at Harvard-MIT-Tufts/NEMC Message-ID: <9212080006.AA28255@net.bio.net> Date: 8 Dec 92 00:03:13 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 84 *** Fellowships Available for AY 1993 *** HARVARD, MIT, and TUFTS/NEW ENGLAND MEDICAL CENTER COMBINED RESEARCH TRAINING PROGRAM IN MEDICAL INFORMATICS We are seeking qualified applicants for the Harvard Medical School, MIT, Tufts/New England Medical Center combined training program in medical informatics, for July, 1993 or later. A number of different training options are offered, including: Formal doctoral degree training (for both predoctoral and postdoctoral trainees) in: o Medical Computer Science at MIT (under the direction of Prof. Peter Szolovits), emphasizing medical knowledge representation, model building, and clinical decision making o Health Decision Science at Harvard School of Public Health (under the direction of Prof. Milton Weinstein), emphasizing decision analysis, cost-effectiveness analysis, and outcome modeling Research fellowship training (postdoctoral only): o Decision Systems Group, Brigham and Women's Hospital (under the direction of Robert A. Greenes, M.D., Ph.D.), emphasizing clinical decision making, medical educational strategies, clinical guidelines, clinical record keeping, medical knowledge representation and query (UMLS), radiologic image management, and object-oriented software architectures for network-based application development o Laboratory of Computer Science, Massachusetts General Hospital (under the direction of G. Octo Barnett, M.D.), emphasizing clinical decision making, medical student education, student/physician workstation design, problem-based knowledge access, ambulatory computer-based medical record systems, and implementation/evaluation of guidelines o Division of Clinical Decision Making, NEMC (under the direction of Stephan G. Pauker, M.D.), emphasizing clinical decision making, knowledge representation, and guidelines and outcome evaluation o Other special opportunities are also available to qualified candidates in radiology informatics. Predoctoral fellowship applicants must concurrently apply for admission to the MIT or Harvard degree program. Postdoctoral applicants will usually have at least one year and preferably three years of residency training prior to beginning of fellowship. The combined training program offers a wide range of opportunities for education, research, and collegial interaction among the training sites. A large variety of course offerings at Harvard, MIT, and Tufts, many seminars, journal clubs, and other opportuities for exchange of information provide all trainees with opportunities to learn about the variety of work occurring at the various laboratories and in the affiliated institutions, as well as in the larger field of medical informatics. A number of associated faculty participate in the program through the research activities of each of the training sites. In addition to the research programs of the participating laboratories, we encourage the fellows to develop projects that may involve unique collaborative relationships. NLM-supported fellowships are available to U.S. permanent residents only. For more information, contact the training program office: Medical Informatics Training Program ATTN: Robert A. Greenes, MD, PhD Decision Systems Group, Brigham and Women's Hospital 75 Francis Street, Boston, MA 02115 (617) 732-6281 FAX: (617) 732-6317 email: greenes@harvard.edu or the individual training program component directors via email at: Barnett: obarnett@hstbme.mit.edu Greenes: greenes@harvard.edu Pauker: sgp@cor.cdm.nemc.org Szolovits: psz@mit.edu Weinstein: mcw@biostat.harvard.edu From owner-software@net.bio.net Mon Dec 07 22:00:00 1992 Path: biosci!uwm.edu!zaphod.mps.ohio-state.edu!darwin.sura.net!wupost!uunet!think.com!yale.edu!not-for-mail From: bell-peter@yale.edu (Peter Bell) Newsgroups: bionet.software Subject: is there a template for the NRSA application available? Message-ID: <1g146pINNfh7@MINERVA.CIS.YALE.EDU> Date: 8 Dec 92 03:18:49 GMT Distribution: usa Organization: Yale University Science & Engineering UNIX(tm), New Haven, CT 06520-2158 Lines: 9 NNTP-Posting-Host: minerva.cis.yale.edu Hello, all-- Just wondering if there is a pc or mac (preferably mac) template for the NRSA application from the NIH available by ftp or email server.... Thanks! Peter bell@minerva.cis.yale.edu From owner-software@net.bio.net Mon Dec 07 22:00:00 1992 Path: biosci!bcm!cs.utexas.edu!swrinde!zaphod.mps.ohio-state.edu!darwin.sura.net!spool.mu.edu!yale.edu!ira.uka.de!news.belwue.de!news.uni-tuebingen.de!studserv!zxmkr08 From: zxmkr08@studserv.zdv.uni-tuebingen.de (Cornelius Krasel) Newsgroups: bionet.software Subject: Re: E.coli genetic map ftp-able? Message-ID: Date: 8 Dec 92 08:26:06 GMT References: Sender: news@softserv.zdv.uni-tuebingen.de (News Operator) Organization: Comp. Center (ZDV) U of Tuebingen, FRG Lines: 19 In zxmkr08@studserv.zdv.uni-tuebingen.de (Cornelius Krasel) writes: >Hello netters, >a recent paper (Mol. Microbiol. 5 (1991), 2629-2640) assembles sequencing >data from E.coli to a genetic map and proposes to offer these data on a >ftp server. I tried to contact the authors (the adress given in the >article was reg@frpst01.bitnet) about three weeks ago but haven't reg@frpstr01.bitnet (This was a typo; thanks to Jerry Learn, who pointed this out!) >received any answer yet... so I wanted to ask here if anybody is aware >of these data and could tell me an internet adress... Thanx in advance, Cornelius. -- /* Cornelius Krasel, Department of Physiological Chemistry, U Tuebingen */ /* email: krasel@studserv.zdv.uni-tuebingen.de (Internet) HAS CHANGED!! */ /* NO WIN/X400 MAIL POSSIBLE AT THE MOMENT! */ /* "People are DNA's way of making more DNA." (anonymous) */ From owner-software@net.bio.net Mon Dec 07 22:00:00 1992 Path: biosci!uwm.edu!zaphod.mps.ohio-state.edu!pacific.mps.ohio-state.edu!linac!convex!constellation!aardvark.ucs.uoknor.edu!glazo From: glazo@aardvark.ucs.uoknor.edu (LAZO,GERARD) Newsgroups: bionet.software Subject: System Gold (Beckman) compatibility with PCs Message-ID: <8DEC199217000536@aardvark.ucs.uoknor.edu> Date: 8 Dec 92 23:00:00 GMT Sender: usenet@constellation.ecn.uoknor.edu (Usenet Administrator) Organization: University of Oklahoma - University Computing Services Lines: 24 Originator: usenet@midway.ecn.uoknor.edu News-Software: VAX/VMS VNEWS 1.41 Nntp-Posting-Host: midway.ecn.uoknor.edu We're getting ready to upgrade our Beckman System Gold setup to a new machine. It currently resides on an IBM 55SX (386SX) with it proprietary card in the machine and is connected to our HPLCs and other stuff. We want to put this System Gold on a 486 machine to speed up the graphics manipulations, etc.... We plan to swap our microchannel card for a regular ISA-style card. Apparently, Beckman's program is very particular about what machine it runs on. We were thinking about getting a Gateway 2000 486-33V computer for the System Gold setup. If you have any knowledge about the System Gold running on other PC clones, I would appreciate hearing from you to hear which machines may be compatible with the System Gold Set up. I have seen the System Gold running on some old 286 clones, and our 386SX machine, but if you know of any 486DX success stories, please drop me a line. I hear Dell computers appear to work OK, but I'm not sure about Gateway 2000. Or is there something about the computer, such as the type of BIOS, that I need to look for? Any help on this matter would be appreciated. Thanks. Gerard R. Lazo /\ //====== glazo@aardvark.ucs.uoknor.edu Plant Biology Division // \ // LAB: 405-221-7305 The S.R. Noble Foundation, Inc. \ //====== FAX: 405-221-7380 Ardmore, Oklahoma 73402 // \/ MSG: 405-223-5810 From owner-software@net.bio.net Tue Dec 08 22:00:00 1992 Path: biosci!bcm!cs.utexas.edu!wupost!waikato.ac.nz!canterbury.ac.nz!cantua!stuart From: stuart@cantua.canterbury.ac.nz (Stuart Ralston) Newsgroups: bionet.software Subject: Flower and Seed Database Message-ID: Date: 9 Dec 92 02:48:52 GMT Organization: University of Canterbury, Christchurch, NZ. Lines: 14 Nntp-Posting-Host: cantua.canterbury.ac.nz Hi, I'm looking for a database of flowers and/or seeds, for easier identification, in conjuction with my thesis work in their microbial decomposition. Is there a Dbase/Foxpro database around? Or even some kind of site that I can ftp from? I need it to be PC compatible. Thanks in advance, \||||||/ / o o \ ___ ____ stuart@cosc.canterbury.ac.nz \ / \ / /__ / / / ( ) ___/ / /__/ \__/ From owner-software@net.bio.net Tue Dec 08 22:00:00 1992 Path: biosci!BYRON.U.WASHINGTON.EDU!pkemp From: pkemp@BYRON.U.WASHINGTON.EDU (Paul Kemp) Newsgroups: bionet.software Subject: Re: Ecology Gophers Message-ID: <1992Dec9.003034.26951@u.washington.edu> Date: 9 Dec 92 00:30:34 GMT References: <1fr4f5INNd9b@MINERVA.CIS.YALE.EDU> Sender: kristoff@net.bio.net Distribution: bionet Organization: University of Washington, Seattle Lines: 20 [note from bionet.announce moderator, D.K.: original announcement was on bionet.announce. Am forwarding this question to bionet.software.] In article <1fr4f5INNd9b@MINERVA.CIS.YALE.EDU> smith-una@YALE.EDU (Una Smith) writes: > >There are (at least) two Gopher servers for ecology: > > >The Long Term Ecological Research (LTER) Gopher at lternet.edu (port 70). >This Gopher has a catalog of data set descriptions, and a bibliographic >data base. Other stuff is clearly in the works. This Gopher can be >found on the North America list of Gophers in most Gopher servers. Note: >some GIF images are available. > What good are GIFs at a Gopher site? It was my understanding that Gopher could only deal with ASCII and .hqx (something for MACs) formats. pk [the rest deleted] From owner-software@net.bio.net Tue Dec 08 22:00:00 1992 Path: biosci!bcm!cs.utexas.edu!wupost!sdd.hp.com!network.ucsd.edu!sdcc12!me41 From: me41@sdcc12.ucsd.edu (david j. looney) Newsgroups: bionet.software Subject: Re: Re. MAC-PC program Message-ID: <42222@sdcc12.ucsd.edu> Date: 9 Dec 92 02:32:55 GMT References: <9212050248.AA00261@net.bio.net> Sender: news@sdcc12.ucsd.edu Distribution: bionet Organization: University of California, San Diego Lines: 4 Nntp-Posting-Host: sdcc12.ucsd.edu The Mac-in-Dos v 1.2 program is available through PC Zone in the US for $58. Another commercial program is called Mac-to-Dos Transfer (creative name, huh?) from the same company for $96. They can be reached at 1-800-258-2088. Never tried either program. From owner-software@net.bio.net Tue Dec 08 22:00:00 1992 Path: biosci!CCSUA.CTSTATEU.EDU!LETTIERE_DAJ From: LETTIERE_DAJ@CCSUA.CTSTATEU.EDU (CCSU Biology Club President) Newsgroups: bionet.software Subject: NIH Used Equipment Database Message-ID: <921209123447.2600fec9@CCSUA.CTSTATEU.EDU> Date: 9 Dec 92 17:34:47 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 20 Does anyone out there know if there is internet access to an inventory list for the NIH used equipment holdings, or an address or phone number to reach them at. I am looking to inexpensively purchase or be donated a portable or benchtop pH/mV/ISE meter or pH/ISE meter to be used in a hydroponics experiment run by several undergraduates here at CCSU. Thanks, Dan Lettiere ******************************************************************************** e-mail: lettiere_daj@ccsu.ctstateu.edu snail mail: Central Connecticut State University 1650 Stanley Street, Copernicus Hall New Britain, CT 06050 USA */*/*/*/*/*/*/*/*/*/*/*/*/*/*/*/*/*/*/*/*/*/*/*/*/*/*/*/*/*/*/*/*/*/*/*/*/*/*/*/ From owner-software@net.bio.net Wed Dec 09 22:00:00 1992 Path: biosci!TWNMOE10.BITNET!NCHUS322 From: NCHUS322@TWNMOE10.BITNET Newsgroups: bionet.software Subject: (none) Message-ID: <9212101034.AA14181@net.bio.net> Date: 10 Dec 92 22:00:05 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 2 sub bio-software Alaska From owner-software@net.bio.net Wed Dec 09 22:00:00 1992 Path: biosci!uwm.edu!zaphod.mps.ohio-state.edu!darwin.sura.net!Sirius.dfn.de!mailgzrz.TU-Berlin.DE!mailszrz.zrz.tu-berlin.de!ruekahs1 From: ruekahs1@mailszrz.zrz.tu-berlin.de (Georg Rueckriem) Newsgroups: bionet.software Subject: DIGITAL DOG/wanted Nr.4 Message-ID: <1g7cnfINN3o7@mailgzrz.TU-Berlin.DE> Date: 10 Dec 92 12:21:03 GMT Organization: ZRZ/TU-Berlin Lines: 11 NNTP-Posting-Host: mailszrz.zrz.tu-berlin.de keywords: A new breed of dogs apperared lately in the United States: the precious DIGITAL DOG! It is said to be a loyal friend, brave, fearless and able to swallow several billions of mean viruses a day. If you have any idea where to find (at least) one specimen of these rare animals - please answer us! ++dirk+uwe+dorothee++friends of digital animals++ ruekahs1@mailszrz.zrz.tu-berlin.de From owner-software@net.bio.net Wed Dec 09 22:00:00 1992 Path: biosci!s.u-tokyo!riksun!rknss1!rkna50!smlab.eg.gunma-u!smss2.smlab.eg.gunma-u.ac.jp!smiyazaw From: smiyazaw@smss2.smlab.eg.gunma-u.ac.jp (Sanzo Miyazawa) Newsgroups: bionet.general,bionet.software Subject: DNA/Protein sequence retrieval by "whois" Keywords: DNA, Protein, Sequence, Database, whois Message-ID: <1992Dec10.200020@smss2.smlab.eg.gunma-u.ac.jp> Date: 10 Dec 92 11:00:20 GMT Sender: news@smlab.eg.gunma-u.ac.jp Organization: Gunma University, Faculty of Technology, Japan Lines: 103 Xref: biosci bionet.general:3729 bionet.software:3743 Nntp-Posting-Host: smss2.smlab.eg.gunma-u.ac.jp Flat DNA/Protein Sequence Retrieval Service by "whois" ------------------------------------------------------ DNA and Protein sequences can be obtained by using "whois" command in a local UNIX system on your desk. It is possible to do keyword search in DNA/protein databases but it often generates too much output so that sequence retrieval by specifying entry names or accession numbers can be only allowed. For fasta homology search and keyword search/retrieval, use a "Flat DB E-Mail Network Server" which is also available at smlab.eg.gunma-u.ac.jp. For a brief manual, send an empty mail to flat-netserv@smlab.eg.gunma-u.ac.jp. 12/10/02 Sanzo Miyazawa Gunma Univ., Faculty of Technology FAX: +81 277 40 1026 Phone: +81 277 40 1027 E-mail: sanzo.miyazawa@smlab.eg.gunma-u.ac.jp NAME scandb - scan a database to find entries by entry name or accession number SYNOPSIS % alias scandb "whois -h smlab.eg.gunma-u.ac.jp" % scandb help % scandb "_d_b-_n_a_m_e [ -1 ] [ -o ] [ '_e_n_t_r_y'...] [ | -a '#_a_c_c'... ]" DESCRIPTION Scandb scans the _d_b-_n_a_m_e database to find _e_n_t_r_i_e_s... or #_a_c_c... . '_E_n_t_r_y' and '#_a_c_c' (acession numbers) are expressed in the regular expression but the case of letters is ignored. The following databases are available. _d_b-_n_a_m_e = genbank | embl | genpept | swiss | pir | prf genbank | gb GenBank DNA database including regular release and new entries embl EMBL DNA database including regular release and new entries. genpept | gp GenBank Gene Product Database swiss SwissProt protein database pir PIR protein database prf Peptide Research Foundation peptide database "gb" and "embl" include new entries released by e-mail or obtained by anonymous-FTP in addition to entries in their regular release. OPTIONS -1 All entries with the specified name or accession number in database are retrieved; otherwise only one entries first found is retrieved; the first found entry is usu- ally the most recently released one. To retrieve mul- tiple entries by using wild characters, "-1" must be specified. However, if a secondary accession number is specified, multiple entries with the accession number might be retrieved, even if "-1" is not used. If -o" is specified, -1 will be assumed. -o Entries are not retrieved in the specified order but in the original order. Retrieval becomes faster. -a must be specified if you want to retrieve entries by accession number. EXAMPLES flat% scandb "genbank AGMERLTR1 musbas" # by entry name;case insensitive flat% scandb "genbank -a M11391 d00611" # by accession number ALSO For fasta homology search and keyword search/retrieval, use a "Flat DB E-Mail Network Server" which is also available at smlab.eg.gunma-u.ac.jp. For a brief manual, send an empty mail to flat-netserv@smlab.eg.gunma-u.ac.jp. AUTHORS Sanzo Miyazawa (smiyazaw@smlab.eg.gunma-u.ac.jp) Gunma University, Faculty of Technology 1-5-1 Tenjin Kiryu, Gunma 376 Japan BUGS This command somewhat takes time because of setting up an environment. From owner-software@net.bio.net Wed Dec 09 22:00:00 1992 Path: biosci!s.u-tokyo!ccut!wnoc-tyo-news!sh.wide!wnoc-kyo!icspub!oskgate0.mei!chorus.mei!adagio.panasonic.com!sgiblab!zaphod.mps.ohio-state.edu!sol.ctr.columbia.edu!usenet.ucs.indiana.edu!sunflower.bio.indiana.edu!gilbertd From: gilbertd@sunflower.bio.indiana.edu (Don Gilbert) Newsgroups: bionet.software Subject: Re: Ecology Gophers Message-ID: Date: 10 Dec 92 01:16:49 GMT References: <1fr4f5INNd9b@MINERVA.CIS.YALE.EDU> <1992Dec9.003034.26951@u.washington.edu> Sender: news@usenet.ucs.indiana.edu (USENET News System) Distribution: bionet Organization: Biology, Indiana University - Bloomington Lines: 21 Nntp-Posting-Host: sunflower.bio.indiana.edu In article <1992Dec9.003034.26951@u.washington.edu> pkemp@BYRON.U.WASHINGTON.EDU (Paul Kemp) writes: >What good are GIFs at a Gopher site? It was my understanding that Gopher could >only deal with ASCII and .hqx (something for MACs) formats. Gopher can deal with many/any file type (just give us time to get it in right...). For instance, I have GIF and Postscript and JPEG image files on the IUBio Gopher hole, as well as RTF Rich Text (== word processor full format with images). Some gopher clients can deal with all of these and display them (e.g., GopherApp on Mac), several others can deal with GIF, others will be able to in the future. Most gopher clients can now deal with plain binary data (e.g., compressed files in various formats, or image or other data). Please bear in mind that this Gopher method of network information sharing is fairly new and evolving rapidly. -- Don -- Don Gilbert gilbert@bio.indiana.edu biocomputing office, biology dept., indiana univ., bloomington, in 47405 From owner-software@net.bio.net Wed Dec 09 22:00:00 1992 Path: biosci!uwm.edu!wupost!spool.mu.edu!sol.ctr.columbia.edu!usenet.ucs.indiana.edu!sunflower.bio.indiana.edu!gilbertd From: gilbertd@sunflower.bio.indiana.edu (Don Gilbert) Newsgroups: bionet.software Subject: Re: availability of fast phylogenetic tree codes Message-ID: Date: 10 Dec 92 21:28:53 GMT References: <9212101644.AA15862@t13.lanl.gov> Sender: news@usenet.ucs.indiana.edu (USENET News System) Distribution: bionet Organization: Biology, Indiana University - Bloomington Lines: 39 Nntp-Posting-Host: sunflower.bio.indiana.edu There is an treeing algorithm, originated by Geert De Soete, that seems to be known for its speed (I don't use it myself). It is available as C source in the GDE version 1.0 sequence editor package (you also need a companion program "count" to convert sequences to a distance matrix which the DeSoete "lsadt" program uses). This program is distributed thru the Ribosomal Database Project, where it is also used in treeing the ribosome data. Here is an ftp reference: ftp:info.mcs.anl.gov@/pub/RDP/programs/Editor_GDE/GDE1.0/GDE1.0_src.tar Here are some details of the method: This program uses a least squares fitting method to determine additive trees from a given distance matrix. The tree generated is passed back in Newick format. The prefered method of displaying the phylogenetic results is in TreeTool. LEAST SQUARES ALGORITHM FOR FITTING ADDITIVE TREES TO PROXIMITY DATA GEERT DE SOETE -- VERSION 1.01 - FEB. 1983 VERSION 1.02 - JUNE 1983 VERSION 1.03 - JULY 1983 'C' version by Michael Macuikenas, University of Illinois REFERENCE: DE SOETE, G. A LEAST SQUARES ALGORITHM FOR FITTING ADDITIVE TREES TO PROXIMITY DATA. PSYCHOMETRIKA, 1983, 48, 621-626. DE SOETE, G. ADDITIVE TREE REPRESENTATIONS OF INCOMPLETE DISSIMILARITY DATA. QUALITY AND QUANTITY, 1984, 18, 387-393. -- Don Gilbert gilbert@bio.indiana.edu biocomputing office, biology dept., indiana univ., bloomington, in 47405 From owner-software@net.bio.net Wed Dec 09 22:00:00 1992 Path: biosci!T13.LANL.GOV!asl From: asl@T13.LANL.GOV (Alan Lapedes) Newsgroups: bionet.software Subject: availability of fast phylogenetic tree codes Message-ID: <9212101644.AA15862@t13.lanl.gov> Date: 10 Dec 92 16:44:38 GMT Sender: kristoff@net.bio.net Distribution: bionet Lines: 24 I am interested in obtaining one or more phylogenetic tree codes that implements a conventionally accepted algorithm for producing trees. Apparently, phylogenetic tree algorithms seem to be a somewhat controversial topic -- hence my request for code that, even if not universally accepted, has at least been analysed and debated in the literature. (1) Would prefer C, Fortran is OK. (2) Would like to be able to produce not only trees, but also a parsimonious reconstruction of the sequences at the nodes. (3) Would like to be able to handle either nucleotides, or amino acids as input. (4) Would particularly like to be able to handle a few hundred amino acid sequences, up to a couple of hundred residues long as input. (5) It's critical to us to have reasonable speed: in our admittedly naive hands the "protpars" code for a problem the size of point (4) above takes too long. (6) If the code is in C or Fortran we could possibly run it on supercomputers for a speed-up. If the code is already ported to vector or parallel machines we would appreciate information on acquiring the code, or accessing the machine (if a service is provided). Thank you, Alan Lapedes From owner-software@net.bio.net Wed Dec 09 22:00:00 1992 Path: biosci!lhc!ray!dab From: dab@ray.nlm.nih.gov (Dennis Benson) Newsgroups: bionet.software Subject: Release 74 of GenBank Available Message-ID: <1992Dec10.190246.22158@nlm.nih.gov> Date: 10 Dec 92 19:02:46 GMT Sender: news@nlm.nih.gov Organization: National Library of Medicine Lines: 167 X-Newsreader: Tin 1.1 PL4 The new release of GenBank, 74.0, is now available through anonymous FTP to: 'ncbi.nlm.nih.gov' in the directory 'ncbi-genbank'. There have been changes in the organization of the taxonomic divisions into which the entries are divided: removal of the 'nlm' and 'organelle' divisions and the creation of an 'est' division. See the README file below for details. Dennis Benson NCBI *********************************************************************** NCBI-GenBank Flat File Release 74.0 Release Date: December 15, 1992 Close-of-Data: November 17, 1992 The files in this directory comprise NCBI-GenBank Release 74.0, in the GenBank flatfile format. These files are also available on the "NCBI-GenBank: Flat File Format" CD-ROM. At the NLM, sequence records are created by specialized indexers in the Division of Library Operations. Over 325,000 articles per year from 3400 journals are scanned for sequence data. They are supplemented by journals in plant and veterinary sciences through a collaboration with the National Agricultural Library. These records join the direct submission data stream from LANL and submissions from the European Molecular Biology Laboratory (EMBL) Data library and the DNA Database of Japan (DDBJ) for incorporation within a relational database, NCBI-GenBank. The data in the LANL direct-submission stream were first parsed into the Abstract Syntax Notation 1 (ASN.1) format, then, along with all the other records in the relational database, converted to the GenBank flat file format. The ASN.1 form of the data is incorporated into the NCBI "Entrez: Sequences" CD-ROM, and is available, as is the flat file data, by anonymous FTP to: 'ncbi.nlm.nih.gov'. For additional information see the file 'gbrel.txt' in this directory. ====================================================================== Important Changes in Release 74.0 As announced in the Release Notes of NCBI-GenBank 73.1, the entries that had appeared in the 'gbnlm.seq' data file have been moved to their appropriate taxonomic division, and a new data file called 'gbest.seq' has been created for Expressed Sequence Tag (EST) sequences. In addition, the entries in the Organelle division now appear in their appropriate taxonomic division; the data file 'gborg.seq' will no longer appear in releases of NCBI-GenBank. ====================================================================== LOCUS name duplicates Because NCBI handles discrete update streams from LANL, DDBJ, and EMBL, it is difficult to guarantee the uniqueness of LOCUS names among all sequence entries. With release 74.0, we were unable to resolve 5 duplicate names before close-of-data: Division PRI: HUMDNAJ: X62421 and D13388 HUMWT1: X51630 and D13624 Division ROD: MUSLAMC: X14170 and D13181 Division VRT: QULTROPOM4: X54379 and X54280 QULTROPOM5: X54479 and X54281 We have decided to allow the LOCUS name redundancy rather than filter out the sequences involved. ====================================================================== Genpept Due to requests for the protein translations appearing in the GenBank flat file feature table, we are making the sequences available in FASTA format. The file 'genpept.fasta.Z' contains a definition line with locus and descriptive information followed by the protein sequence. These are protein sequences which appeared in entries from Release 74.0. CAUTION: The format of the definition line is expected to change within the next few months, so please be aware of the risk of writing software which parses the current format. Changes will include the addition of accession numbers to the definition line. =============================================================================== ncbi-genbank/daily This subdirectory contains the Cumulative Update (CU) for all new or updated entries since close-of-data for Release 74.0. The flatfile CU is generated nightly by: a) Collecting direct submissions from LANL; creating a non-redundant flatfile from the submissions; parsing the result into ASN.1; and then regenerating a new flatfile from the ASN.1 . b) Outputting, in ASN.1 format, all entries in the NCBI Backbone database that have been added or updated since November 17, 1992, and then converting the ASN.1 to flatfile format. c) Combining the results of (a) and (b) into a single file called gbcu.flat.Z . File gpcu.fasta.Z contains the protein translations appearing in gbcu.flat.Z, in FASTA format (see the description about genpept.fasta.Z, above). CAUTION: The format of the definition line is expected to change within the next few months, so please be aware of the risk of writing software which parses the current format. Changes will include the addition of accession numbers to the definition line. NOTE: During the first day or two following the date on which a new release is posted in the ncbi-genbank directory, the CU in this directory could be empty. As soon as an update occurs in a) the NCBI Backbone database or b) the LANL direct-submission stream, gbcu.flat.Z will re-appear, containing all new or updated entries since close of data for the new release. =========================================================================== ncbi-genbank/daily-nc This subdirectory contains individual files for each day's new or updated entries since close-of-data for Release 74.0. File names for these Non-Cumulative Updates (NCU) are of the form ncMMDD.flat.Z, where MMDD represents Month-Day. A flatfile NCU is generated by: a) Parsing the flatfile version of a single day's direct submissions to LANL into ASN.1, and then regenerating a flatfile from the ASN.1 . b) Outputting, in ASN.1 format, all entries in the NCBI Backbone database that have been added or updated on that same day, and then converting the ASN.1 to flatfile format. c) Combining the results of (a) and (b) into a single flatfile. A file called "Last.File" in this directory contains the name of the most recently generated flatfile NCU. Entries undergoing successive updates on different days will be present in more than one NCU file. However, a single NCU will not contain multiple versions of an entry updated more than once on a single day. =========================================================================== If you have any further questions, please contact: National Center for Biotechnology Information National Library of Medicine, 38A, 8N805 8600 Rockville Pike Bethesda, MD 20894 USA Voice: (301) 496-2475 Fax: (301) 480-9241 The electronic mail address is: info@ncbi.nlm.nih.gov From owner-software@net.bio.net Wed Dec 09 22:00:00 1992 Path: biosci!agate!spool.mu.edu!nigel.msen.com!emory!europa.asd.contel.com!darwin.sura.net!fconvx.ncifcrf.gov!fcs260c2!toms From: toms@fcs260c2.ncifcrf.gov (Tom Schneider) Newsgroups: bionet.software Subject: Re: DIGITAL DOG/wanted Nr.4 Message-ID: Date: 10 Dec 92 22:15:08 GMT References: <1g7cnfINN3o7@mailgzrz.TU-Berlin.DE> Sender: usenet@ncifcrf.gov (C News) Organization: Frederick Cancer Research and Development Center Lines: 30 Nntp-Posting-Host: fcs260c2.ncifcrf.gov In article <1g7cnfINN3o7@mailgzrz.TU-Berlin.DE> ruekahs1@mailszrz.zrz.tu-berlin.de (Georg Rueckriem) writes: |A new breed of dogs apperared lately in the United States: |the precious DIGITAL DOG! It is said to be a loyal friend, brave, fearless and |able to swallow several billions of mean viruses a day. |If you have any idea where to find (at least) one specimen of these rare animals |- please answer us! _ / (.__o /_/ __/ .. ! / ! Juha.Hyvonen@hut.fi (juh@sauna.cs.hut.fi) !/ ) ! ------ and I might add _ / (.__o /_/ __/ \ / ! \/ ) ! ------ Tom Schneider National Cancer Institute Laboratory of Mathematical Biology Frederick, Maryland 21702-1201 toms@ncifcrf.gov From owner-software@net.bio.net Thu Dec 10 22:00:00 1992 Path: biosci!uwm.edu!zaphod.mps.ohio-state.edu!caen!destroyer!wsu-cs!vela!pd-dom!duffiem From: duffiem@wl.com (Mark Duffield) Newsgroups: bionet.software Subject: Re: X-Server for PCs? Message-ID: <1992Dec11.183350.9233@wl.com> Date: 11 Dec 92 18:33:50 GMT References: Organization: Warner Lambert / Parke-Davis Lines: 27 In article zxmkr08@studserv.zdv.uni-tuebingen.de (Cornelius Krasel) writes: >Hello netters, >is anybody of you aware of some piece of software which can open a >connection to an X-host and runs under Windows 3.1? Public domain >or shareware is preferred :-) (Specifically we think of >something similar to MacX). >Thanks in advance, Cornelius. The one that I am familiar with is called eXcursion and is sold by Digital. It costs about $180. It works _very_ well. It supports both DECnet and TCP/IP as a transport. I don't know of any public domain software that will do this. There are other alternatives like desqView/X, but they desqView/X does not interoperate with Windows (as far as I know). >-- >/* Cornelius Krasel, Department of Physiological Chemistry, U Tuebingen */ >/* email: krasel@studserv.zdv.uni-tuebingen.de (Internet) HAS CHANGED!! */ >/* NO WIN/X400 MAIL POSSIBLE AT THE MOMENT! */ >/* "People are DNA's way of making more DNA." (anonymous) */ -- ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Mark J. Duffield | Parke Davis Biotechnology | Beer is a beverage, not a projectile. (duffiem@wl.com) | From owner-software@net.bio.net Thu Dec 10 22:00:00 1992 Path: biosci!daresbury!doc.ic.ac.uk!agate!spool.mu.edu!wupost!uunet!munnari.oz.au!comp.vuw.ac.nz!cc-server4.massey.ac.nz!pnv.palm.cri.nz!hrpsdj From: news@massey.ac.nz (USENET News System) Newsgroups: bionet.software Subject: wanted CABIOS program! Keywords: serial communications Message-ID: Date: 11 Dec 92 02:47:14 GMT Organization: DSIR, Palmerston North, New Zealand Lines: 10 I am trying to locate the program TALK o Pretini et. al., CABIOS Vol 6 no 3 1990, Communications between the PC and laboratory instruments. Can anybody offer any pointers to its whereabouts Thanks in advance Sid P.S if replying by email please use SJones@date.palm.cri.nz From owner-software@net.bio.net Thu Dec 10 22:00:00 1992 Path: biosci!uwm.edu!wupost!uunet!pipex!warwick!mrccrc!dcurtis From: dcurtis@crc.ac.uk (Dr. David Curtis) Newsgroups: bionet.software Subject: Re: X-Server for PCs? Message-ID: <1992Dec11.115248.11031@crc.ac.uk> Date: 11 Dec 92 11:52:48 GMT References: Sender: news@crc.ac.uk Organization: MRC Human Genome Resource Centre Lines: 13 Nntp-Posting-Host: tin At St Mary's we are using Exceed/W which seems to work OK. You get multiple "Windows" windows - 1 for each "X" window if you see what I mean. Each user has to pay 35 pounds (?ca. $60) but I don't know what the price deal is overall. Dave Curtis Academic Department of Psychiatry, Janet: dcurtis@UK.AC.CRC St. Mary's Hospital, Elsewhere: dcurtis@CRC.AC.UK Praed Street, London W2. EARN/Bitnet: dcurtis%CRC@UKACRL Tel 071-725 1993 Usenet: ...!mcsun!ukc!mrccrc!D.Curtis From owner-software@net.bio.net Thu Dec 10 22:00:00 1992 Path: biosci!uwm.edu!cs.utexas.edu!sdd.hp.com!caen!batcomputer!ghost.dsi.unimi.it!dei.unipd.it!sabrina.dei.unipd.it!george From: george@sabrina.dei.unipd.it (Giorgio Demenego) Newsgroups: bionet.software Subject: AMIGA PROGRAMS HELP Message-ID: Date: 11 Dec 92 11:02:20 GMT Sender: usenet@dei.unipd.it Organization: D.E.I. Universita' di Padova, Italia Lines: 16 Hello, I hope that this newsgroup will be the right place to post my letter :) I want to know if there is an ftp site with DNA phylogenesis programs for Amiga. (Like Paup, Phylip, Clustalv) If those programs or utilities are not in PD software I only want to know if they exist or no, because here I saw only prgs for PC & Mac !!!! Thank you for reading this software help message, and sorry for my bad english. Your sincerely Giorgio Demenego =============================================================================== // | Giorgio Demenego (E-Mail: george@sabrina.dei.unipd.it) \X/ Amiga | Department of Biology - University of Padova - Italy =============================================================================== From owner-software@net.bio.net Thu Dec 10 22:00:00 1992 Path: biosci!bcm!cs.utexas.edu!wupost!uunet!mcsun!Germany.EU.net!rrz.uni-koeln.de!unidui!math.fu-berlin.de!ira.uka.de!news.belwue.de!news.uni-tuebingen.de!studserv!zxmkr08 From: zxmkr08@studserv.zdv.uni-tuebingen.de (Cornelius Krasel) Newsgroups: bionet.software Subject: X-Server for PCs? Message-ID: Date: 11 Dec 92 09:40:45 GMT Sender: news@softserv.zdv.uni-tuebingen.de (News Operator) Organization: Comp. Center (ZDV) U of Tuebingen, FRG Lines: 11 Hello netters, is anybody of you aware of some piece of software which can open a connection to an X-host and runs under Windows 3.1? Public domain or shareware is preferred :-) (Specifically we think of something similar to MacX). Thanks in advance, Cornelius. -- /* Cornelius Krasel, Department of Physiological Chemistry, U Tuebingen */ /* email: krasel@studserv.zdv.uni-tuebingen.de (Internet) HAS CHANGED!! */ /* NO WIN/X400 MAIL POSSIBLE AT THE MOMENT! */ /* "People are DNA's way of making more DNA." (anonymous) */ From owner-software@net.bio.net Thu Dec 10 22:00:00 1992 Path: biosci!daresbury!daresbury!news From: DKIRSCHT@UVMVM.EARN (David Kirschtel) Newsgroups: bionet.software Subject: ?CABIOS? Message-ID: <1992Dec11.193341.2368@gserv1.dl.ac.uk> Date: 11 Dec 92 19:25:32 GMT Sender: list-admin@daresbury.ac.uk Distribution: bionet Lines: 16 Original-To: bio-software@UK.AC.DARESBURY pardon my ignorance but could somebody please give me the full name of "CABIOS"....I've seen it mentioned several time on this but haven't been able to track it down. thanks in advance ----------------------------------------------------------------------- David Kirschtel || Department of Botany || "You're soaking in it, Madge" Marsh Life Science Building || University of Vermont || - ancient euro-american proverb Burlington, VT 05405-0086 || || Tel.: 802.656.0429 || BITNet: dkirscht@uvmvm || I'Net : dkirscht@uvmvm.uvm.edu From owner-software@net.bio.net Thu Dec 10 22:00:00 1992 Path: biosci!CSC.FI!Rob.Harper From: Rob.Harper@CSC.FI (Rob Harper) Newsgroups: bionet.software Subject: LaboImage Message-ID: <199212111500.AA20657@csc.fi> Date: 11 Dec 92 15:00:58 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 175 >Xref: funic sci.image.processing:1258 ch.si.general:1 >Newsgroups: sci.image.processing,ch.si.general,ug.general >Path: funic!fuug!mcsun!uunet!haven.umd.edu!darwin.sura.net!Sirius.dfn.de!chx400!news.unige.ch!jacot >From: jacot@cui.unige.ch (JACOT-DESCOMBES Alain) >Subject: LaboImage 4.0: new X11 version >Message-ID: <1992Dec9.135704.14622@news.unige.ch> >Sender: JACOT-DESCOMBES Alain >Organization: University of Geneva, Switzerland >Date: Wed, 9 Dec 1992 13:57:04 GMT >Lines: 163 ******************************************************************************** LaboImage --------- Original notice March 8th, 1989: LaboImage 2.0 (SunView) August 24th, 1990: LaboImage 3.0 (SunView) March 19th, 1991: LaboImage 3.1 (SunView) December 1st, 1992: LaboImage 4.0 (X11 / OSF Motif) Computer Science Center, University of Geneva, Switzerland Thank you for your interest in LaboImage! General description ------------------- Labo Image is a window based software for image processing and analysis. It contains a comprehensive set of operators as well as general utilities. It is designed to be open-ended; new modules can easily be added. The software, written in C, is now based on X11 / OSF Motif. The current version has been developped and tested on a Sun SPARC station, with X11r4 and Motif 1.1. LaboImage has been extensively used by students as well as researchers from various domains: computer science (image analysis), medicine, biology, physics. It is distributed free of charge (source code). Status ------ Version 4.0, 1st December 1992: - hosts: Sun SPARC station; - OS: 4.1.1; - window system: X11r4 / Motif 1.1; - language: C; - approx. code size: source 2.5MB (80'000 lines), executable 2.5MB; - documentation: interactive help (english) Means of distributions ---------------------- LaboImage source code is available by anonymous ftp at: 1) ftp.ads.com, login name anonymous, in pub/VISION-LIST-ARCHIVE/SHAREWARE. 2) peipa.essex.ac.uk, login name anonymous, in ipa/proc-src. If you have no access to ftp, please contact the author. If you wish to be kept current with update, error reports, ..., please send us a mail with your full name, regular and electronic addresses. Distribution policy ------------------- In essence: - this is a non-profit software, but it is our property and the copyright notice must appear; - the reference to cite in case of published results obtained with Labo Image is: "A. Jacot-Descombes, M. Rupp, T. Pun: `LaboImage: A portable window-based environment for research in image processing and analysis', SPIE Symposium on Electronic Imaging Science and Technology, Image Processing: Implementation and Systems, San Jose, California, USA, Feb. 9-14, 1992. - no responsibility is assumed; - not to be used for profit making purposes; - bugs will usually be corrected since we use the software intensively ; - modifications should be communicated to us, with (normally) allowance for redistribution. Payment ------- Athough LaboImage has undergone many upgrades and suffered in the hands of many users, the current version is certainly not bug free. For the time being, we require NO prepayment, return postage or anything. We may however change this policy in the future, and ask for nominal fees to cover material expenditures. HOWEVER, if you are satisfied with the product, why not send us some "souvenir" (post card, drink, etc.)) from your country...??!! Capabilities ------------ Labo Image is an interactive software, whose interface is menu, mouse and window based. Its main features are: - input-output: LaboImage format file, SUN raster file; postscript; - display: mono, RGB, dithering, color table editor; - preprocessing: filters (median, high pass, low pass: hamming, gauss, etc), background subtraction, histogram equalization; - processing: thresholding, Fourier transforms, edge extractions: various operators, ridge-riding, zero-crossing; segmentation into regions, binary and gray tone mathematical morphology; - measures: histograms, image statistics, power, region outlining, object counting; - auxiliary: conversions, arithmetic & logical operations, noise addition, image generation, magnification, convolution/correlation with masks, image; padding; - elementary interactive operations: region outlining, statistics and histogram computation, etc.; - special tools: - modify image at pixel level interactively, - one-dimensional gel analysis, - expert system for image segmentation (not implemented in LaboImage 4.0); - macros definitions, save and replay (not implemented in LaboImage 4.0); - on line documentation. Image formats ------------- Own format: descriptor file + data file (binary, byte, int, float, complex; mono or RGB). Supports also Sun raster format. Conversions to various other formats. Data structures: - iconic (pixel-based), with each image having its own parameter list; - vectors (histograms, look-up tables); Miscellaneous remarks (answers to commonly asked questions) --------------------- - FILE FORMAT: we decided to go for: 1) a machine independant format; 2) a simple, data (ie. signal) oriented format. At the beginning of the development (summer 1987), we were not aware of any image format used by the whole community. There seems now to be some progress on the matter (TIFF, etc.), but they are still not that widely used in the community. Also, due to development priorities we consider conversion routines a more secondary issue as long as our format is simple. In addition, the menu "ACQUISITION=>free byte format" is fairly versatile. Also, the SUN raster images can now be read into LaboImage and likewise images on system may be stored in SUN raster format. However.. we would welcome any software contribution! - 3D IMAGE PROCESSING: nothing special for such images. - ON LINE HELP: available. Acknowledgements ---------------- More than 10 people have so far participated in this project, and their contribution is gratefully acknowledged. Staff: Pierre-Yves Burgi, Claudia Coiteux-Rosu, Ziping Hu, Alain Jacot- Descombes, Rene Lutz, Christian Pellegrini, Thierry Pun, Marianne Logean- Rupp, Krassimir Todorov. Students: Anne Bobillier, Alain Brunner, Markus Buchi, Christian Girard, Rene Perrier, Vrinda Shukla. Amongst them, A. Jacot-Descombes is responsible for general design issues, and is the keystone for implementation; R. Lutz is responsible for display manipulations (Color Table Editor,etc.); T. Pun is responsible for the original layout and general design issues; V. Shukla is responsible for the upgrade from LaboImage 2.0 to LaboImage 3.0; Marianne Logean-Rupp is responsible for the portability of LaboImage to X11 (LaboImage 4.0). We are particularly grateful to Drs. D. F. Hochstrasser and O. Ratib, Digital Imaging Unit, Computer Center, University Hospital of Geneva, for their extended support. LaboImage 4.0 could not have been without their help. Contacts -------- Particular problems will be redirected to relevant persons, but we prefer that all communications be made to the same address: e-mail: "pun@uni2a.unige.ch" or pun@cgeuge51.bitnet (if this fails, "pun@cui.unige.ch"). tel.: +(4122) 705 76 27 (T. Pun), 705 76 30 (A. Jacot-Descombes). fax: +(4122) 320 29 27. postal address: Thierry Pun LaboImage Computing Science Center, University of Geneva 24, rue du General-Dufour CH - 1211 Geneva 4 SWITZERLAND ******************************************************************************** From owner-software@net.bio.net Thu Dec 10 22:00:00 1992 Path: biosci!bcm!cs.utexas.edu!uunet!noc.near.net!black.clarku.edu!vax.clarku.edu!dkallin From: dkallin@vax.clarku.edu Newsgroups: bionet.software Subject: RE: Ecology Gophers Message-ID: <11DEC92.19445320@vax.clarku.edu> Date: 11 Dec 92 19:44:53 GMT References: <1fr4f5INNd9b@MINERVA.CIS.YALE.EDU> <1992Dec9.003034.26951@u.washington.edu> Sender: news@black.clarku.edu (USENET News System) Organization: Clark University Lines: 21 Date sent: 11-DEC-1992 14:40:40 Somebody mentioned: > >There are (at least) two Gopher servers for ecology: > > >The Long Term Ecological Research (LTER) Gopher at lternet.edu (port 70). >This Gopher has a catalog of data set descriptions, and a bibliographic >data base. Other stuff is clearly in the works. This Gopher can be >found on the North America list of Gophers in most Gopher servers. Note: where can I find this north american list and more importantly, information on accessing these gophers? DannyK DKALLIN@VAX.CLARKU.EDU DKALLIN@CLARKU.BITNET From owner-software@net.bio.net Thu Dec 10 22:00:00 1992 Path: biosci!enterpoop.mit.edu!ira.uka.de!rz.uni-karlsruhe.de!stepsun.uni-kl.de!sun.rhrk.uni-kl.de!nenno From: nenno@rhrk.uni-kl.de (Mario Nenno [Biologie]) Newsgroups: bionet.software Subject: Re: X-Server for PCs? Message-ID: <1992Dec11.194203.29701@rhrk.uni-kl.de> Date: 11 Dec 92 19:42:03 GMT References: Distribution: eunet Organization: University of Kaiserslautern, Germany Lines: 16 zxmkr08@studserv.zdv.uni-tuebingen.de (Cornelius Krasel) writes: >Hello netters, >is anybody of you aware of some piece of software which can open a >connection to an X-host and runs under Windows 3.1? Public domain >or shareware is preferred :-) (Specifically we think of >something similar to MacX). >Thanks in advance, Cornelius. >-- >/* Cornelius Krasel, Department of Physiological Chemistry, U Tuebingen */ Hallo Cornelius and all others, there is a program called _XVision_ which does want you want. It runs under MS Win3.1. But it is commercial. How about using a Un*x-clone linke _linux_. I heard it has an X-server. From owner-software@net.bio.net Thu Dec 10 22:00:00 1992 Path: biosci!uwm.edu!zaphod.mps.ohio-state.edu!darwin.sura.net!welchgate.welch.jhu.edu!danj From: danj@welchgate.welch.jhu.edu (Dan Jacobson) Newsgroups: bionet.software Subject: Re: X-Server for PCs? Message-ID: <1992Dec11.193747.13888@welchgate.welch.jhu.edu> Date: 11 Dec 92 19:37:47 GMT Organization: Johns Hopkins Univ. Welch Medical Library Lines: 1712 Cornelius Krasel writes: >is anybody of you aware of some piece of software which can open a >connection to an X-host and runs under Windows 3.1? Public domain >or shareware is preferred :-) (Specifically we think of >something similar to MacX). This is a FAQ sheet which is posted in comp.windows.x from time to time. It's the most complete answer to the above question that I've ever seen. Happy hunting, Dan Jacobson danj@welchgate.welch.jhu.edu /////////////////////////////////////////////////////////////////////////// \\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\ ================================================================================ X Servers for DOS, Microsoft Windows, OS/2, Macs, and Amigas - NonUNIX ================================================================================ November 1, 1992 - Volume 7.0 ================================================================================ AUTHOR: Daniel J. McCoy Loral Space Information Systems Software Technology Branch Information Systems Directorate NASA/Johnson Space Center POST MAIL: NASA Mail Code PT4 NASA/Johnson Space Center Houston, Texas 77058 E-MAIL: mccoy@gothamcity.jsc.nasa.gov ================================================================================ This is a monthly guide of X servers that can be used on non-UNIX networked machines to display X clients running on UNIX machines. I use the name UNIX loosely here. I know others can run X. The sources for this information come from many places: the FAQ for comp.windows.x, blurbs and info packets from the vendors, user manuals for the products themselves, conversations with sales representatives, personal experience, comp.windows.x articles, etc. Please forward any corrections or updated to the above address. This file is also available by anonymous ftp at: export.lcs.mit.edu[18.24.0.12] in /contrib/XServers-NonUNIX.txt.Z ftp.uwp.edu[131.210.1.4] in /pub/misc/XServers-NonUNIX.txt msdos.archive.umich.edu[141.211.164.153] in msdos/info/XServers-NonUNIX.txt and msdos/info/xnonunix.zip X Servers for DOS: DESQview/X IBM X/Windows Micro X-DOS Micro X-lite PC DECWindows Motif V3.0 PC X-Windows PC Xsight PC-XView SAGE 1280 Adapter and X Windows Display Server TeemTalk-X Vista-eXceed X Appeal Xinet X-Station Xnth XoftWare for DOS XoftWare for TIGA/DOS X Servers Microsoft Windows: DESQview/X HCL-eXceed/W MicroX MultiView/X PC-XView Vista-eXceed X-One X11/AT XVision XoftWare eXodus for MS Windows X Servers OS/2: IBM X-Windows for OS/2 X Servers Macintosh: eXodus MacX X Servers Amiga: UNKNOWN X Window System Version 11 Release for the Amiga Computer ==X-Servers==X-Servers==X-Servers==X-Servers==X-Servers==X-Servers==X-Servers=== ===DOS===DOS===DOS===DOS===DOS===DOS==DOS===DOS===DOS===DOS===DOS===DOS===DOS=== DESQview/X ========== Vendor: Melinda Quarterdeck Office Systems, Inc. 150 Pico Boulevard Santa Monica, CA 90405 TEL: (310)392-9851 FAX: (310)399-3802 Price: $275 Latest Version: 1.0 CPU: 386SX or higher (286 version available) Memory: 4 Mbytes Operating System: DOS 3.0 or higher DR DOS 6 or higher Mouse: optional - MS compatible pointing device Graphics: EGA, VGA, Super VGA, 8514/A, or 256 color DGIS Ethernet Card: Network Software: Disk Space: 40 Mbyte hard drive Features: incorporates X into the DESQview multi-tasking DOS environment adds a graphical 3D look and feel to DESQview gives users a choice of window managers (look and feels) provides a growth path from character mode DOS to industry standard graphical user interfaces runs most regular DOS applications runs DOS Extended applications up to 4Gbytes can display DOS applications within graphical windows multitasks DOS applications and X Clients either locally or remotely provides a simple port of applications from other X systems to DESQview/X and vice versa gives developers a choice of application appearances, based on toolkit chosen supports toolkits that provide features required by developers such as push buttons, scrollbars, pop up dialogue boxes, etc. Adobe Type Manager for scalable fonts and scalable DOS windows ===DOS===DOS===DOS===DOS===DOS===DOS==DOS===DOS===DOS===DOS===DOS===DOS===DOS=== ===DOS===DOS===DOS===DOS===DOS===DOS==DOS===DOS===DOS===DOS===DOS===DOS===DOS=== IBM X/Windows ============= Vendor: IBM part #5765-025 Price: Latest Version: 2.1 CPU: Memory: Operating System: DOS Mouse: Graphics: Ethernet Card: Network Software: Disk Space: Features: ===DOS===DOS===DOS===DOS===DOS===DOS==DOS===DOS===DOS===DOS===DOS===DOS===DOS=== ===DOS===DOS===DOS===DOS===DOS===DOS==DOS===DOS===DOS===DOS===DOS===DOS===DOS=== Micro X-DOS =========== Vendor: StarNet Communications Corporation 3073 Lawrence Expressway Santa Clara, CA 95051 TEL: (408)739-0881 FAX: (408)739-0936 micro-x@starnet.com Prices: $345.00 1 unit $250.00 2-24 units (greater discount for larger quantities) upgrades at 25% of original price educational discount of 10% Latest Version: 1.50 CPU: 386, 486 Memory: 2 Mbytes Operating System: DOS 3.1 or higher Mouse: 2 or 3 button mouse with MS compatible driver Graphics: Ahead(V5000) ATI(18800) Everex(VP VGA) Genoa(6400) Paradise(900C00/11/30) STB(EM-16) Trident(8800CS) Tseng Labs(ET-3000-4000) Video7(HT208 V7VGA) Western Digital(900C00/11/30) ZyMOS(Poach51) and others Ethernet Card: 3Com/3C501/503/505/523 3Com EtherLink/MC Cabletron 1-2-3000 Micom-Interlan NI5010-5210 Western Digital WD80003E Novell NE-1000/2000 National Semiconductor boards that have their own packet driver from manufacturer Network Software Included: StarNet TCP/IP (integrated) Network Software Supported: Beame & Whiteside - BW-TCP FTP Software - PC/TCP Sun - PC-NFS Disk Space: 3 Mbytes (9 Mbytes for all fonts) 5-1/4 1.2 Mbyte or 3-1/2 1.44 Mbyte needed Features: Fast cursor tracking NCSA FTP (File Transfer) NCSA Telnet (Network Virtual Terminal) X-Authorization Intelligent installation program TCP/IP built-in 286 can have 8 mono or 6 color clients 386 can have 15+ mono or 10+ color clients Support Motif, OPEN LOOK, and DEC Clarkson (Crynwr) packet drivers ===DOS===DOS===DOS===DOS===DOS===DOS==DOS===DOS===DOS===DOS===DOS===DOS===DOS=== ===DOS===DOS===DOS===DOS===DOS===DOS==DOS===DOS===DOS===DOS===DOS===DOS===DOS=== Micro X-lite ============ Vendor: StarNet Communications Corporation 3073 Lawrence Expressway Santa Clara, CA 95051 TEL: (408)739-0881 FAX: (408)739-0936 micro-x@starnet.com Prices: $49.00 Latest Version: 1.50 CPU: 286, 386, 486 Memory: 640 Kbytes Operating System: DOS 3.1 or higher Mouse: 2 or 3 button mouse with MS compatible driver Graphics: standard VGA 648x480 Ethernet Card: 3Com/3C501/503/505/523 3Com EtherLink/MC Cabletron 1-2-3000 Micom-Interlan NI5010-5210 Western Digital WD80003E Novell NE-1000/2000 National Semiconductor boards that have their own packet driver from manufacturer Network Software Included: StarNet TCP/IP (integrated) Network Software Supported: Beame & Whiteside - BW-TCP FTP Software - PC/TCP Sun - PC-NFS Disk Space: 2 Mbytes 5-1/4 1.2 Mbyte or 3-1/2 1.44 Mbyte needed Features: Fast cursor tracking NCSA FTP (File Transfer) NCSA Telnet (Network Virtual Terminal) X-Authorization Intelligent installation program TCP/IP built-in 286 can have 8 mono or 6 color clients 386 can have 15+ mono or 10+ color clients Support Motif, OPEN LOOK, and DEC Clarkson (Crynwr) packet drivers ===DOS===DOS===DOS===DOS===DOS===DOS==DOS===DOS===DOS===DOS===DOS===DOS===DOS=== ===DOS===DOS===DOS===DOS===DOS===DOS==DOS===DOS===DOS===DOS===DOS===DOS===DOS=== PC DECWindows Motif V3.0 ======================== Vendor: Dennis Giokas PC DECWindows Development Digital Equipment Corporation 30 Porter Rd. Littleton, MA 01460 Price: Latest Version: V3.0 CPU: 286, 386 Memory: up to 15 Mbytes Operating System: MS-DOS Mouse: any pointing device with MS Mouse V6.0 or later interface Graphics: EGA (16 color and mono) MCGA VGA (16 color and mono) enhanced VGA (800x600 16 color and mono) 8514/A (1024x768 16/256 color) pseudo color visual Ethernet Card: Network Software: TCP/IP and DECnet Disk Space: Features: X11 Release 4 server integrated virtual memory manager standard IBM-compatible keyboards and Digital's LK250 Session manager client integrated into the server suspend session feature to run DOS commands Font Compiler for Adobe Bitmap Distribution files KEYSYM compiler to customize the keyboard for default KEYCODE to KEYSYM mappings; over 70 pre-defined keyboard mapping files Configuration utility to define hardware environment and user preferences supports DECnet and TCP/IP. Available from DEC. ===DOS===DOS===DOS===DOS===DOS===DOS==DOS===DOS===DOS===DOS===DOS===DOS===DOS=== ===DOS===DOS===DOS===DOS===DOS===DOS==DOS===DOS===DOS===DOS===DOS===DOS===DOS=== PC-XView ======== Vendor: Network Computing Devices Inc. PC-Xdivision 9590 SW Gemini Drive Beaverton, OR 97005 TEL: (800)800-9599, (503)641-2200 FAX: (503)643-8642 There are also 15 NCD technical and sales offices around the United States and other international offices Price: PC-Xview for DOS $445.00 for 1 $1780.00 for 5 Annual Maintenance $150.00 for 1 $450.00 for 5 Update From owner-software@net.bio.net Thu Dec 10 22:00:00 1992 Path: biosci!ICBR.IFAS.UFL.EDU!SJJ From: SJJ@ICBR.IFAS.UFL.EDU ("JONG, SONG-MUH J") Newsgroups: bionet.software Subject: Re. ?CABIOS? Message-ID: <9212112259.AA18061@net.bio.net> Date: 11 Dec 92 22:56:00 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 4 Someone asked about the meaning of CABIOS. It is the abbreviation of the journal Computer Applications in BIOmedical Sciences From owner-software@net.bio.net Fri Dec 11 22:00:00 1992 Path: biosci!daresbury!doc.ic.ac.uk!agate!spool.mu.edu!sdd.hp.com!saimiri.primate.wisc.edu!hp9000.csc.cuhk.hk!garfield.csc.cuhk.hk!augustine-lo From: augustine-lo@cuhk.hk (Y. S. Lo) Newsgroups: bionet.software Subject: Need shareware/freeware on molecular graphics software Message-ID: <1992Dec12.053039.7436@hp9000.csc.cuhk.hk> Date: 12 Dec 92 05:30:39 GMT Sender: usenet@hp9000.csc.cuhk.hk Organization: Computer Services Centre, The Chinese University of Hong Kong Lines: 13 X-Xxmessage-Id: X-Xxdate: Sat, 12 Dec 92 05:26:25 GMT Nntp-Posting-Host: garfield.csc.cuhk.hk X-Useragent: Nuntius v1.1.1d11 Hi, I am doing research on molecular biology, and I need some shareware/ freeware to help me in visualize secondary or tertiary DNA structure in 3D. Thanks in advance. regards, Augustine Lo Computer Services Centre The Chinese University of Hong Kong augustine-lo@cuhk.hk From owner-software@net.bio.net Fri Dec 11 22:00:00 1992 Path: biosci!kristoff From: kristoff@net.bio.net (David Kristofferson) Newsgroups: bionet.software Subject: Re: Re. ?CABIOS? Message-ID: Date: 12 Dec 92 03:02:19 GMT References: <9212112259.AA18061@net.bio.net> Distribution: bionet Organization: BIOSCI International Newsgroups for Biology Lines: 6 > Computer Applications in BIOmedical Sciences Close, but not quite. Actually it's Computer Applications in the Biosciences From owner-software@net.bio.net Fri Dec 11 22:00:00 1992 Path: biosci!daresbury!doc.ic.ac.uk!agate!spool.mu.edu!caen!batcomputer!cornell!uw-beaver!news.u.washington.edu!evolution!joe From: joe@evolution.u.washington.edu (Joe Felsenstein) Newsgroups: bionet.software Subject: Re: AMIGA PROGRAMS HELP Summary: Not as executables Message-ID: <1992Dec11.192940.23734@u.washington.edu> Date: 11 Dec 92 19:29:40 GMT References: Sender: news@u.washington.edu (USENET News System) Organization: University of Washington, Seattle Lines: 23 In article george@sabrina.dei.unipd.it (Giorgio Demenego) writes: > >Hello, I hope that this newsgroup will be the right place to post my letter :) >I want to know if there is an ftp site with DNA phylogenesis programs for Amiga. >(Like Paup, Phylip, Clustalv) >If those programs or utilities are not in PD software I only want to know if >they exist or no, because here I saw only prgs for PC & Mac !!!! PAUP is not available by ftp as it costs $50. There is no Amiga version. PHYLIP is available by ftp from my machine: evolution.genetics.washington.edu (IP number 128.95.12.41). There are no Amiga executables available, but you can compile it if you have a Pascal compiler. A C version will be available soon. ClustalV is available by ftp from the major molecular biology software servers (in Europe try ftp.embl-heidelberg.de). There is no Amiga executable version, but it is available as C source which can be compiled if you have a C compiler. ----- Joe Felsenstein, Dept. of Genetics, Univ. of Washington, Seattle, WA 98195 Internet: joe@genetics.washington.edu (IP No. 128.95.12.41) Bitnet/EARN: felsenst@uwavm From owner-software@net.bio.net Fri Dec 11 22:00:00 1992 Path: biosci!daresbury!doc.ic.ac.uk!agate!ames!haven.umd.edu!uunet!mcsun!chsun!bernina!neptune!gonnet From: gonnet@inf.ethz.ch (Gaston Gonnet) Newsgroups: bionet.software Subject: Re: availability of fast phylogenetic tree codes Message-ID: <1992Dec11.203146.7974@neptune.inf.ethz.ch> Date: 11 Dec 92 20:31:46 GMT References: <9212101644.AA15862@t13.lanl.gov> Sender: news@neptune.inf.ethz.ch (Mr News) Distribution: bionet Organization: Dept. Informatik, Swiss Federal Institute of Technology (ETH), Zurich, CH Lines: 44 Nntp-Posting-Host: rutishauser-gw.inf.ethz.ch In article <9212101644.AA15862@t13.lanl.gov> asl@T13.LANL.GOV (Alan Lapedes) writes: >I am interested in obtaining one or more phylogenetic tree codes that implements >a conventionally accepted algorithm for producing trees. Apparently, >phylogenetic tree algorithms seem to be a somewhat controversial topic -- hence >my request for code that, even if not universally accepted, has at least been >analysed and debated in the literature. > >(1) Would prefer C, Fortran is OK. >(2) Would like to be able to produce not only trees, but also a > parsimonious reconstruction of the sequences at the nodes. >(3) Would like to be able to handle either nucleotides, or amino acids as input. >(4) Would particularly like to be able to handle a few hundred amino acid > sequences, up to a couple of hundred residues long as input. >(5) It's critical to us to have reasonable speed: in our admittedly naive hands > the "protpars" code for a problem the size of point (4) above takes too > long. >(6) If the code is in C or Fortran we could possibly run it on supercomputers > for a speed-up. If the code is already ported to vector or parallel > machines we would appreciate information on acquiring the code, or accessing > the machine (if a service is provided). > > >Thank you, >Alan Lapedes > ====================================================== Our automatic server implements a basic tree (Felsenstein's algorithm) with several optimizations. People are generally happy with the trees it produces. (1) - it is written in Darwin, which is written in C. (2) - not for all nodes, only for the root of the tree (3) - only peptides (4) - no problem, we have tried it with more than 500 sequences (5) - Depends on what you consider fast. For a tree with n sequences most of these algorithms are O(n^3) so it depends heavily on the number of sequences. You can make up your own mind on the quality of the trees and on the speed by using the automatic server. Send a message with "help AllAll" as body to cbrg@inf.ethz.ch. If you like it, you can obtain your own copy of Darwin. Gaston H. Gonnet, Informatik, ETH Zurich. From owner-software@net.bio.net Fri Dec 11 22:00:00 1992 Path: biosci!MACC.WISC.EDU!HXIE From: HXIE@MACC.WISC.EDU (HUIWEN XIE) Newsgroups: bionet.software Subject: off Message-ID: <22121123460688@vms2.macc.wisc.edu> Date: 12 Dec 92 04:46:00 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 1 Please sign me off. Thanks. From owner-software@net.bio.net Fri Dec 11 22:00:00 1992 Path: biosci!ICBR.IFAS.UFL.EDU!SJJ From: SJJ@ICBR.IFAS.UFL.EDU ("JONG, SONG-MUH J") Newsgroups: bionet.software Subject: Re. ?CABIOS? Message-ID: <9212121008.AA03457@net.bio.net> Date: 12 Dec 92 09:53:00 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 59 I must confess that I did not check the existence of the journal CABIOS. I only took the reference from the following message: <1>From: bsh@med.pitt.edu (Basavaraju Shankarappa) <1>To: LETTIERE_DAJ@CCSUA.CTSTATEU.EDU, bio-soft@net.bio.net <1>Subject: Re: Biocomputing journals & alternatives to dissection? <1> <1>1. Computer Applications in Biomedical Sciences; a NAR publication <1>also abbreviated as CABIOS <1> <1>2. Computer Methods and Programs in Biomedicine; affiliated to British <1>Medical Informatics Society; Managing Editor: Uppsala University <1>Data Center P.O. Box 2103 S-750 02 Uppsala Sweden <1> <1>3. Computers and Biomedical Research; Dr. Homer R. Warner Dept of <1>Medical Informatics, Univ of Utah School of Medicine <1>Salt Lake City Utah 84132 <1> <1>4. Computers in Biology and Medicine; I think the contact person is <1>Ms. Blaire V. Mossman National Biomedical Research Foundation <1>Georgetown University Medical Center <1>3900 Reservoir Road, NW <1>Washington DC 20007 <1> <1>As to your second question, do you really think you can replace the <1>feel for the dissection with any computer program? <1>Raj Shankarappa <1>bsh@med.pitt.edu <1> <1> But as David pointed out, CABIOS should stand for Computer Applications in the Biosciences. Here is another mail message: <2> <2>From: Des.Higgins@EMBL-Heidelberg.DE (Des Higgins) <2>Subject: RE:ClustalV <2> <2>The paper describing Clustal V came out earlier this year in CABIOS: <2> <2>Higgins, D.G., Bleasby, A.J. and Fuchs, R. (1992) <2>CLUSTAL V: improved software for multiple sequence alignment. <2>Computer Applications in the Biosciences (CABIOS), 8(2):189-191. <2> <2>Des Higgins <2> <2>European Molecular Biology Laboratory <2>Heidelberg <2>Germany Higgins@EMBL-Heidelberg.DE <2> <2> Since Des was the first author of the publication mentioned above, he probably spell the journal name correctly. I still haven't checked the real journal yet. The availability of computers and networks makes one too lazy to go to the library to read real things. What a pity! From owner-software@net.bio.net Fri Dec 11 22:00:00 1992 Path: biosci!news.cs.indiana.edu!ux1.cso.uiuc.edu!uwm.edu!zaphod.mps.ohio-state.edu!news.acns.nwu.edu!uicvm.uic.edu!u53077 From: U53077@uicvm.uic.edu (Dong Li 312-996-0509) Newsgroups: bionet.software,bionet.molbio.proteins Subject: Help wanted: alignment program for proteins Message-ID: <92346.200424U53077@uicvm.uic.edu> Date: 12 Dec 92 02:04:24 GMT Organization: University of Illinois at Chicago Lines: 21 Xref: biosci bionet.software:3761 bionet.molbio.proteins:459 Dear netters, I am looking for a better alignment program for the alignments of 60 different proteins at same time. The program I am using now can line up only 16 proteins at same time, and I have to divide all 60 proteins into 4 groups to line them up separately, then line the 4 groups up by hands. It is laborious and easy to make mistakes. I would be very grateful if you provide any information about it (or just tell me the site and dir. name so that I can FTP it.) Thank you very much for attention. ************************************************************************* With malice toward none, with charity for all.......... Abraham Lincoln ------------------------------------------------------------------------- Dong Li Telephone: (312) 996-0509 Fax: (312) 413-2435 Internet: u53077@uicvm.uic.edu Bitnet: u53077@uicvm.bitnet Dept. Biological Sciences, Univ. Illinois at Chicago, Chicago, IL 60680 ************************************************************************* From owner-software@net.bio.net Fri Dec 11 22:00:00 1992 Path: biosci!enterpoop.mit.edu!usc!zaphod.mps.ohio-state.edu!uwm.edu!spool.mu.edu!uunet!gatech!udel!princeton!phoenix.Princeton.EDU!lpcasson From: lpcasson@phoenix.Princeton.EDU (Lawrence P. Casson) Newsgroups: comp.sys.mac.apps,comp.sys.mac.comm,comp.sys.mac.misc,comp.sys.mac.system,bionet.software Subject: Apps hang with 32-bit addressing turned off? Message-ID: <1992Dec12.062100.19105@Princeton.EDU> Date: 12 Dec 92 06:21:00 GMT Sender: news@Princeton.EDU (USENET News System) Distribution: usa Organization: Princeton University Lines: 29 Xref: biosci comp.sys.mac.apps:3638 comp.sys.mac.comm:2635 comp.sys.mac.misc:3984 comp.sys.mac.system:3003 bionet.software:3766 Originator: news@nimaster Nntp-Posting-Host: phoenix.princeton.edu Our Mac LCII has been running with 32-bit addressing turned on with no problems. I just got Authorin3.0 for submitting sequences to GenBank, EMBL, etc. and it requires that 32-bit addressing be turned off. Trouble is, within a few minutes of being restarted, the computer hangs, even when no program is running. The only unusual error message I have seen is from NCSA/Telnet2.5 which said something like bad F-line, though this may be unrelated. Being that it's a lab computer, I'm not positive that it has e