From owner-software@net.bio.net Fri Jan 01 22:00:00 1993 Path: biosci!kristoff From: kristoff@net.bio.net (David Kristofferson) Newsgroups: bionet.software Subject: Re: (none) Message-ID: Date: 2 Jan 93 03:24:45 GMT References: <20@toano.win.net> Distribution: bionet Organization: BIOSCI International Newsgroups for Biology Lines: 25 mj@toano.win.net (Mary Jo Warsinsky) writes: >INDEX BIO-SOFT The BIOSCI FAQ sheets describe how to use the archives. We do not run LISTSERV here. New users of BIOSCI/bionet may want to read the "Frequently Asked Questions" or "FAQ" sheets for BIOSCI. There are two FAQ sheets for the newsgroup system. FAQ I describes the general purpose and uses of the BIOSCI/bionet newsgroups. FAQ II provides details on how to participate in these forums. Both of these FAQs are available for anonymous FTP from net.bio.net [134.172.2.69] in pub/BIOSCI/biosci1.FAQ and pub/BIOSCI/biosci2.FAQ. They may also be requested by sending e-mail to biosci@net.bio.net (use plain English for your request). The FAQs are also posted on the first of each month to the newsgroup BIONEWS/bionet.announce immediately following the posting of the BIOSCI information sheet. Sincerely, Dave Kristofferson BIOSCI/bionet Manager kristoff@net.bio.net From owner-software@net.bio.net Fri Jan 01 22:00:00 1993 Path: biosci!CSC.FI!Rob.Harper From: Rob.Harper@CSC.FI (Rob Harper) Newsgroups: bionet.software Subject: Best of MSDOS (Part 2) Message-ID: <199301021032.AA12553@csc.fi> Date: 2 Jan 93 10:32:56 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 826 >Xref: funic comp.archives.msdos.d:274 comp.binaries.ibm.pc.wanted:8872 comp.os.msdos.apps:7771 news.answers:4582 >Path: funic!fuug!mcsun!uknet!bnr.co.uk!pipex!uunet!gatech!destroyer!cs.ubc.ca!newsserver.sfu.ca!kko >From: kko@fraser.sfu.ca (Samuel Ko) >Newsgroups: comp.archives.msdos.d,comp.binaries.ibm.pc.wanted,comp.os.msdos.apps,news.answers >Subject: The Most Useful MSDOS Programs at Simtel20 and Garbo (Part II) >Summary: A list of recommended msdos programs at major ftp sites. >Keywords: Simtel20, Garbo, sharewares, freewares, PD programs, ftp >Message-ID: <1993Jan1.231803.2642@sfu.ca> >Date: 1 Jan 93 23:18:03 GMT >Sender: news@sfu.ca >Followup-To: comp.archives.msdos.d >Organization: Simon Fraser University, Burnaby, B.C., Canada >Lines: 810 >Approved: news-answers-request@MIT.Edu Archive-name: msdos-archives/part2 Last-modified: Jan 1, 1993 Version: 2.0 The Most Useful MSDOS Programs at Simtel20 and Garbo (Part II) ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ **** The Ultimate Guide to MSDOS Archive Files **** Version: 2.0 Jan 1, 1993 Compiled by Samuel Ko (kko@sfu.ca) Contents: Part II ------- * Section C Utilities Area 5: Screen Utilities Area 6: System Utilites Area 7: Other Utilities * Section D: Anti-Virus Programs * Section E: Editors * Section F: Communication Programs * Section G: Miscellaneous Files ---- * Appendix 1: Mirror Sites * Appendix 2: Obtaining files by e-mail * Appendix 3: Getting upload announcements by e-mail * Appendix 4: How to do anonymous ftp? --------------------------------------------------------------------------- Area 5: Screen Utilities --------------------------------------------------------------------------- Program: Explosiv Screen Saver (for DOS and Windows) Version: 2.10 Upload Date: 92/10/08 File: explo210.zip Size: 272,258 bytes Location: oak: /pub/msdos/screen garbo: /pc/screen Status: Shareware Comment: Marvelous ... lots of displays ... Alternatives: Explod Fireworks (explo203.zip in /pc/graphics) (garbo only) Billboard (bilbd110.zip) (oak only) - will display message --------------------------------------------------------------------------- Program: Buffit - tsr screen scrollback utility Version: 3.0 Upload Date: 91/05/21 File: buffit30.zip Size: 10,640 bytes Location: oak: /pub/msdos/screen garbo: /pc/screen Status: Shareware Comment: Good ... --------------------------------------------------------------------------- Program: Snipper Version: 2.6 Upload Date: 92/10/28 File: snippr26.zip Size: 20,881 bytes Location: oak: /pub/msdos/screen garbo: /pc/screen Status: Freeware Comment: Marvelous ... Can capture a text screen to the printer, a file, or internal buffer ... --------------------------------------------------------------------------- Area 6: System Utilities --------------------------------------------------------------------------- Program: InfoPlus - screens of system info Version: 1.56 Upload Date: 92/12/30 File: ifp1p156.zip Size: 127,580 bytes Location: oak: /pub/msdos/info garbo: /pc/sysinfo Status: Freeware Comment: Good ... Alternatives: Comptest (ctest257.zip) ASQ (asq130.zip) PC Mag Lab Benchmarks (pcben60{a,b,c}.zip; bench60.zip (garbo)) Microsoft Diagnostics (msd.zip) ... this one is available from ftp-os2.nmsu.edu (in /pub/os2/2.0/dos/sysutils) ... --------------------------------------------------------------------------- Program: Secure System Login Version: 1.0 Upload Date: 92/08/29 File: login.zip Size: 71,258 bytes Location: oak: /pub/msdos/security garbo: /pub/sysutil Status: Shareware, Free for personal use Comment: Good ... unix-like ... login: ? Password: ? ... Alternative: CCP (ccp11.zip) - a more secure system control program --------------------------------------------------------------------------- Program: HyperDisk Version: 4.51 Upload Date: 92/12/07 File: spkt451s.zip Size: 291,958 bytes Location: oak: /pub/msdos/dskutl garbo: /pc/sysutil (not the latest) Status: Shareware Comment: Disk caching utilities ... better than the RAM Disk ... And other Speedkit's utilities (HyperKey and HyperScreen) included ... BTW ... Cache Test (ct43c.zip) is good for evaluating your disk's cache performance ... --------------------------------------------------------------------------- Program: TSR Utilities Version: 3.4 Upload Date: 92/03/12 File: tsrcom34.zip Size: 75,275 bytes Location: oak: /pub/msdos/sysutl garbo: /pc/memutil Status: Freeware Comment: Good ... Can remove TSRs from memory without rebooting ... --------------------------------------------------------------------------- Program: File Completion Version: 1.5 Upload Date: 92/08/07 File: filec15.zip Size: 19,564 bytes Directory: oak: /pub/msdos/sysutl garbo: /pc/keyboard Status: Freeware Comment: A good TSR program to add filename completion ... --------------------------------------------------------------------------- Program: Shell Room Version: 2.0a Upload Date: 92/08/19 File: shroom20.zip Size: 920819 Directory: oak: /pub/msdos/sysutl garbo: /pc/sysutil Status: Shareware Comment: Can swap programs from memory to disk ... --------------------------------------------------------------------------- Area 7: Other Utilities --------------------------------------------------------------------------- Program: PC ReadMail Version: 4.01 Upload Date: 91/07/07 File: rmail401.zip Size: 68,981 bytes Location: oak: /pub/msdos/txtutl garbo: /pc/mail Status: Freeware Comment: A very good program for reading Unix mails, netnews articles and Timo's FAQs OFFLINE ... --------------------------------------------------------------------------- Program: Cal (unix-like) Version: 2.4 Upload Date: 92/07/11 File: cal24.zip Size: 20,730 bytes Location: oak: /pub/msdos/deskaccess garbo: /pc/unix/calendar or /pc/unix Status: Freeware Comment: This program can have the current date highlighted on the monthly calendar and a list of important dates displayed ... --------------------------------------------------------------------------- Program: Ample Notice Version: 3.0 Upload Date: 92/10/07 File: an300.zip Size: 192,263 bytes Location: oak: /pub/msdos/deskaccess garbo: /pc/calendar Status: Shareware Comment: A good appointments calendar / alarm clock package ... --------------------------------------------------------------------------- Program: Ultimate Calculator Version: 1.2 Upload Date: 92/10/27 File: ucalc12.zip Size: 53,551 bytes Location: oak: /pub/msdos/calculator garbo: /pc/math Status: Shareware Comment: A high precision scientific calculator which you can operate at the command prompt ... Alternative: MEC (mathfc23.zip) --------------------------------------------------------------------------- Program: Thumb Print Software's Electric Typewriter Version: 1.0 Upload Date: 91/02/09 File: tp-et.zip Size: 115,774 bytes Location: oak: /pub/msdos/education garbo: /pc/editor Status: Shareware Comment: This program "emulates" an electronic type-writer ... --------------------------------------------------------------------------- Program: TypeFast Version: - Upload Date: 90/09/12 File: typefast.zip Size: 91,532 bytes Location: oak: /pub/msdos/education garbo: /pc/educgames Status: Public Domain Comment: A game that can improve your typing speed ... -------------------------------------------------------------------------- Program: The Animated Series Version: 1.0 Upload Date: 92/11 Files: aalpha.zip, amath1.zip. amem10.zip, animshap.zip, awcmp{1,2}.zip Size: various Location: oak: /pub/msdos/education garbo: /pc/educgames Status: Shareware Comment: Animated programs to enhance learning for preschoolers ... These are just several examples of educational programs available from Simtel20 and Garbo ... There are many others in the above directories (and /../teaching at oak) ... My latest favorite is MathShop (mathsp11.zip) :) ... --------------------------------------------------------------------------- Program: SkyGlobe Version: 3.52 Upload Date: 92/10/16 File: skygl352.zip Size: 297,105 bytes Location: oak: /pub/msdos/astronomy garbo: /pc/astronomy Status: Shareware Comment: An easily accessible planetarium displaying stars ... Alternative: COSMOS (cosmos16.zip) --------------------------------------------------------------------------- Program: ACCU Music System Version: 3.1 Upload Date: 92/12/10 File: ac31musc.zip Location: oak: /pub/msdos/music garbo: not available Status: Shareware Comment: Create, print, transpose and play music ... --------------------------------------------------------------------------- Section D: Anti-Virus Programs --------------------------------------------------------------------------- Note: New versions for these programs are released pretty frequently ... (usually once a month) ... --------------------------------------------------------------------------- Programs: McAfee anti-virus utilities Version: 99 Upload Date: 92/12/02 Files: scanv99.zip(scanner), clean99.zip(removal), vshld99.zip(prevention) Size: scan(158,423 bytes), clean(172,556 bytes), vshield(121,575bytes) Location: oak: /pub/msdos/trojan-pro garbo: /pc/virus Status: Sharewares Comment: Absolutely and positively the BEST ... BTW ... McAfee's anti-virus utilities can also be obtained from /pub/antivirus at the ftp site mcafee.com ... --------------------------------------------------------------------------- Program: F-Prot anti-virus program Version: 2.06a Upload Date: 92/11/06 File: fp-206a.zip Size: 312,066 bytes Location: oak: /pub/msdos/trojan-pro garbo: /pc/virus Status: Shareware, Free for private use Comment: a MUST ... Alternative: Thunderbyte A-V (tbav502.zip + vsig9214.zip) --------------------------------------------------------------------------- Program: VIRx Version: 2.6 Upload Date: 92/12/07 File: virx26.zip Size: 103,915 bytes Location: oak: /pub/msdos/trojan-pro garbo: /pc/virus Status: Freeware Comment: A fine virus scanner ... --------------------------------------------------------------------------- Program: HyperText VSUM Version: 9212 Upload Date: 92/12/30 File: vsumx212.zip Size: 746,332 bytes Location: oak: /pub/msdos/trojan-pro garbo: /pc/virus (not the latest) Status: Shareware Comment: Organized in hypertext form, this program tells you everything you ever want to know about viruses ... Also availabe at mcafee.com ... (in /pub/vsum) ... --------------------------------------------------------------------------- Section E: Editors --------------------------------------------------------------------------- Program: QEdit Version: 2.15 Upload Date: 91/09/09 File: qedit215.zip Size: 134,778 bytes Location: oak: /pub/msdos/qedit garbo: /pc/editor Status: Shareware Comment: This one is very very good ... I'm using it now :) ... Alternatives: can be found in oak: /pub/msdos/editor Vision-Edit (ved331.zip) - can edit files up to 4 megabytes Video Display Editor (vde164.zip) - an efficient editor/quasi- word-processor Boxer (box400b.zip) - a good, fully functional editor PDE (pde From owner-software@net.bio.net Fri Jan 01 22:00:00 1993 Path: biosci!CSC.FI!Rob.Harper From: Rob.Harper@CSC.FI (Rob Harper) Newsgroups: bionet.software Subject: Best of MSDOS (Part1) Message-ID: <199301021031.AA12529@csc.fi> Date: 2 Jan 93 10:31:26 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 755 >Xref: funic comp.archives.msdos.d:271 comp.binaries.ibm.pc.wanted:8870 comp.os.msdos.apps:7769 news.answers:4580 >Newsgroups: comp.archives.msdos.d,comp.binaries.ibm.pc.wanted,comp.os.msdos.apps,news.answers >Path: funic!fuug!mcsun!uunet!zaphod.mps.ohio-state.edu!swrinde!gatech!destroyer!cs.ubc.ca!newsserver.sfu.ca!kko >From: kko@fraser.sfu.ca (Samuel Ko) >Subject: The Most Useful MSDOS Programs at Simtel20 and Garbo (Part I) >Message-ID: <1993Jan1.231418.2527@sfu.ca> >Followup-To: comp.archives.msdos.d >Summary: A list of recommended msdos programs at major ftp sites. >Keywords: Simtel20, Garbo, sharewares, freewares, PD programs, ftp >Sender: news@sfu.ca >Organization: Simon Fraser University, Burnaby, B.C., Canada >Date: Fri, 1 Jan 1993 23:14:18 GMT >Approved: news-answers-request@MIT.Edu >Lines: 739 Archive-name: msdos-archives/part1 Last-modified: Jan 1, 1993 Version: 2.0 The Most Useful MSDOS Programs at Simtel20 and Garbo (Part I) ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ **** The Ultimate Guide to MSDOS Archive Files **** Version: 2.0 Jan 1, 1993 (so, Happy New Year!!!) Compiled by Samuel Ko (kko@sfu.ca) This is a good selection of the "best" sharewares and freewares that are available from Simtel20 (wsmr-simtel20.army.mil) - the largest depository of MSDOS files - and Garbo (garbo.uwasa.fi) - a good alternative to Simtel20. This list contains many commonly-and-frequently-wanted sharewares/freewares/ public domain programs. So before you post any requests for ftp'able MSDOS files in comp.archives.msdos.d, comp.binaries.ibm.pc.wanted or other msdos/pc newsgroups, please try to read the list first. This will help reduce the traffic in those groups a bit. Besides you might find some other interesting stuff here. As it is more convenient to ftp files from Simtel20's mirror sites than Simtel20 itself, so I use the directories of oak.oakland.edu (the most up-to-date mirror site) instead. If you want to use the parent site (Simtel20) or other mirror sites (e.g. wuarchive.wustl.edu), please change the path name accordingly. Here is how to do it: (`whatever' is the name of subdirectory to be substituted) oak: /pub/msdos/whatever = Simtel20: PD1: = wuarchive: /mirrors/msdos/whatever Please note that garbo is mirrored in N. America at wuarchive. Therefore garbo: /pc/whatever = wuarchive: /mirrors/garbo.uwasa.fi/whatever For info on other Simtel20 and Garbo mirror sites, please see Appendix 1. If you do not have ftp access, please read Appendix 2 for instructions on how to obtain most of the files listed below by e-mail. Thanks to all who have helped in improving the list. However, to save some bandwidth, I do not want to include a long list (over 150 names) of acknowledgment. I do sincerely thank each and every one of you who has contributed to this compilation in one way or the other. Any further comments and suggestions will be very much appreciated. I am particularly interested in any programs that you think are better than those listed below. I will usually update this list once a month. So, the next issue will be out in early February. General format of an entry: --------------------------------------------------------------------------- Program: Name and/or Description Version: The latest release Upload Date: The date the program was uploaded to Simtel or Oak File: The name of the file that corresponds to the program Size: The size of the archive file Location: The directory from which the file can be found Status: Shareware / Freeware Info Shareware - copyrighted (or patented) programs distributed and sold on a "try before you buy" basis. Freeware - copyrighted programs which do not require compensation for use in most cases. Public Domain - free from copyrights; open to use by anyone without compensation. Comment: My comment and supplementary info Alternative: Other similar program --------------------------------------------------------------------------------- Contents: Part I ------ * Section A: Application Programs * Section B: Compression / Decompression Programs * Section C: Utilities Area 1: 4DOS Area 2: Disk Utilites Area 3: Directory Utilities Area 4: File / Text Utilities [ Part II ------- Area 5: Screen Utilites Area 6: System Utilites Area 7: Other Utilities * Section D: Anti-Virus Programs * Section E: Editors * Section F: Communication Programs * Section G: Miscellaneous Files -- * Appendix 1: Mirror Sites * Appendix 2: Obtaining files by e-mail * Appendix 3: Getting upload announcements by e-mail * Appendix 4: How to do anonymous ftp? ] --------------------------------------------------------------------------- Section A: Application Programs --------------------------------------------------------------------------- Program: PC-Write Advanced Level Word-Processor Version: 4.0 Upload Date: 92/07/24 Files: pcwal401.zip (Program), pcwal402.zip (Help/Spell) pcwal1403.zip (Conversion), pcwal404.zip (Printer) Size: 946,024 bytes (total) Location: oak: /pub/msdos/editor garbo: /pc/txtutil Status: Shareware Comment: PC-Write is undoubtedly one of the most sophisticated word-processor There is a simpler version - pcws201*.zip (oak only) ... --------------------------------------------------------------------------- Program: AsEasyAs Spreadsheet Version: 5.01c Upload Date: 92/07/08 File: aea501c.zip Size: 338,568 bytes Location: oak: /pub/msdos/spreadsheet garbo: /pc/spreadsheet Status: Shareware Comment: A powerful Lotus 123 clone ... There is a "lighter" version - alite1f.zip (oak only) ... --------------------------------------------------------------------------- Program: Buttonware's PC-File Database Version: 6.5 Upload Date: 92/08/11 Files: pcf65{a,b,c}.zip Size: 895,990 bytes (total) Location: oak: /pub/msdos/dbase garbo: /pc/database Status: Shareware Comment: This database program is fine as long as you've got disk-space for it ... Alternative: RExL (rexl211{a,b,c}.zip in /pub/msdos/database) (oak only) File expresss (fe51-{a,b,c}.zip) (ditto) --------------------------------------------------------------------------- Program: EnVision Publisher Version: 1.0 Upload Date: 92/12/02 Files: evp10{a,b}.zip Size: 669,413 bytes (total) Location: oak: /pub/msdos/deskpub garbo: not available Status: Shareware Comment: Great! ... A WYSIWYG full-feature desktop publishing program ... --------------------------------------------------------------------------- Program: Draft Choice CAD Version: 2.0 Upload Date: 92/07/15 File: dc20.zip Size: 314,791 bytes Location: oak: /pub/msdos/cad garbo: /pc/cad Status: Shareware Comment: A good computer-assisted-design program ... Get dcfonts.zip ... BTW ... Data flow diagrams ... - Analyst's Toolkit (atk15ibm.zip in /pub/msdos/flowchart) - good - EasyCase (ezcase17.zip in /pub/msdos/case) - limited CASE Flow-Charts ... - FLODRAW (fdrw225{a,b}.zip - /pub/msdos/flowchart) (CGA only?) --------------------------------------------------------------------------- Program: X(Plore) Mathematical Toolchest Version: 4 Upload Date: 92/06/08 File: cc4-9206.zip Size: 417,716 bytes Location: oak: /pub/msdos/calculator garbo: /pc/math Status: Shareware Comment: A sophisticated calculus calculator ... doing numeric math ... Alternatives: Symbolic Calculator (sm211a.zip) - doing symbolic math Mercury (mrcry209.zip) - solving equations (in /.../math for oak) --------------------------------------------------------------------------- Section B: Compression / Decompression Programs --------------------------------------------------------------------------- Synopsis - DOS and UNIX ~~~~~~~~ DOS UNIX --- ---- *.zip pkz110eu.exe (pkz193a.exe) zip10ex.tar-z (or .tar.Z) zip10exx.zip (zip19p1x.zip) zip19p1.tar-z (or .tar.Z) unzip50.exe unzip50.tar-z (or .tar.Z) *.arj arj230ng.exe (arj239a.exe) -- unarj230.zip unarj230.tar-z (or *.tar.Z) *.lzh lha213.exe lha-101u.tar-z (oak) lha-1.00.tar.Z (garbo) *.arc pk361.exe arc521e.tar-z (oak) arc602.exe arc.tar.Z (garbo) *.zoo zoo210.exe zoo210.tar-z (or .tar.Z) booz20.zip booz20.tar-z (or .Z) *.hpk hpack78.zip hpack78src.tar.Z (garbo only) *.sqz sqz1082e.exe From owner-software@net.bio.net Fri Jan 01 22:00:00 1993 Path: biosci!agate!ames!purdue!yuma!neptune.rrb.colostate.edu!elpeters From: elpeters@lamar.colostate.edu (Eric L. Peters) Newsgroups: bionet.software Subject: The Vertebrate World Message-ID: Date: 2 Jan 93 21:51:30 GMT Sender: news@yuma.ACNS.ColoState.EDU (News Account) Organization: Colorado State University Lines: 100 X-Useragent: Nuntius v1.1.1d16 X-Xxdate: Sat, 2 Jan 93 14:54:32 GMT X-Xxmessage-Id: Nntp-Posting-Host: neptune.rrb.colostate.edu ANNOUNCING THE VERTEBRATE WORLD PROJECT The Vertebrate World is a HyperCard stack that is designed to be a database shell for the vertebrate animals. The database as planned will eventually provide taxonomic, ecological, behavioral and distribution information for thousands of species of vertebrates. Digitized pictures of each species will be available, as well as phylogenetic trees, sounds, QuickTime movies, and range maps for many species. This will (obviously) require storage and distribution on large capacity medium such as CD-ROM discs. Because of the size of the database, and the relative scarcity of CD-ROM drives, my plan is to allow this database to be customizable by individual instructors by creating a 'master control' stack. The instructor can use this front end to choose particular species for inclusion into self-running subsets of the entire database. These can then be run from a hard disk drive. For example, an instructor might select individual species, or make inclusion criteria for species that correspond to specified search terms, such as 'Birds of North Carolina' or 'Endangered Vertebrates of North America'. The master control would then automatically generate a new HyperCard stack containing those species' entries, and this user-generated stack could then be distributed to students or copied onto hard drives in a microcomputer lab. Various template stacks that automatically include only information appropriate for use at particular education levels will be provided, and these will be modifiable by the instructor. THE VERTEBRATE WORLD PROJECT As there are so many species of vertebrates, I would like to 'job out' different segments of the project to different people. The Vertebrate World Project will have several areas of potential contributions: writing and editing the species accounts, constructing phylogenetic data files, and locating and digitizing pictures, videos and sounds. For example, one person might be in charge of writing the accounts of the pinnepeds, another might collect and/or scan pictures of Australian snakes, etc. In return for these efforts, each person contributing a certain amount of effort would obtain a copy of the finished product of their choice (i.e., one disk from the series), as well as acknowledgement in the documentation. Persons contributing a large amount of digitized or (especially) original written material would be listed as co-authors of the overall project. I believe this is the best approach for us to take because it places the responsibility for the stacks' contents in the hands of experts in each taxon, and it prevents duplication of effort. I also think it would be most worthwhile to be able to offer a complete set (perhaps on several disks according to Class, with the possibilty of doing it by subscription as new species are added). I think that this series would be an excellent marketing tool for a publisher to convince instructors to buy textbooks on ecology or vertebrate biol From owner-software@net.bio.net Fri Jan 01 22:00:00 1993 Path: biosci!CSC.FI!Rob.Harper From: Rob.Harper@CSC.FI (Rob Harper) Newsgroups: bionet.software Subject: Best of MSDOS (Changes and updates) Message-ID: <199301021038.AA12616@csc.fi> Date: 2 Jan 93 10:38:22 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 510 >Xref: funic comp.archives.msdos.d:273 comp.binaries.ibm.pc.wanted:8871 comp.os.msdos.apps:7770 news.answers:4581 >Newsgroups: comp.archives.msdos.d,comp.binaries.ibm.pc.wanted,comp.os.msdos.apps,news.answers >Path: funic!fuug!mcsun!uunet!cs.utexas.edu!swrinde!gatech!destroyer!cs.ubc.ca!newsserver.sfu.ca!kko >From: kko@fraser.sfu.ca (Samuel Ko) >Subject: The Most Useful MSDOS Programs at Simtel20 and Garbo (Changes) >Message-ID: <1993Jan1.232159.2724@sfu.ca> >Followup-To: comp.archives.msdos.d >Summary: A list of major changes since version 1.9. >Keywords: changes, additions, updates >Sender: news@sfu.ca >Organization: Simon Fraser University, Burnaby, B.C., Canada >Date: Fri, 1 Jan 1993 23:21:59 GMT >Approved: news-answers-request@MIT.Edu >Lines: 494 Archive-name: msdos-archives/diff Last-modified: Jan 1, 1993 The Most Useful MSDOS Programs at Simtel20 and Garbo (Changes) ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ **** The Ultimate Guide to MSDOS Archive Files **** Version: 2.0 Jan 1, 1993 Compiled by Samuel Ko (kko@sfu.ca) As this most-useful-program list is quite long, I'm posting this article listing major changes (additions and updates) for those of you who have read the previous issue (version 1.9 Oct 24, 1992). The information in different msdos-archives postings should be more or less accurate as of Dec 31, 1992. As the world of MSDOS archives is rapidly changing, there will be lots of changes before the next version is released. To keep yourself informed of the latest and greatest of MSDOS archive files, do read the upload announcements on comp.archives.msdos.announce newsgroup (or subscribe to the MSDOSANN mailing list if you do not have netnews access). ---- The Most Useful MSDOS Programs at Simtel20 and Garbo (Part I) ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ [ a modified title ] [ the compilation is now in 2 parts ] General format of an entry: --------------------------------------------------------------------------- ... Status: Shareware / Freeware Info Shareware - copyrighted (or patented) programs distributed and sold on a "try before you buy" basis. Freeware - copyrighted programs which do not require compensation for use in most cases. Public Domain - free from copyrights; open to use by anyone without compensation. -------------------------------------------------------------------------- Section A: Application Programs -------------------------------------------------------------------------- Program: Buttonware's PC-File Database ... Alternative: ... File expresss (fe51-{a,b,c}.zip) (ditto) [ new ] --------------------------------------------------------------------------- Program: EnVision Publisher [ new ] Version: 1.0 Upload Date: 92/12/02 Files: evp10{a,b}.zip Size: 669,413 bytes (total) Location: oak: /pub/msdos/deskpub garbo: not available Status: Shareware Comment: Great! ... A WYSIWYG full-feature desktop publishing program ... --------------------------------------------------------------------------- Program: Draft Choice CAD ... BTW ... Data flow diagrams ... - Analyst's Toolkit (atk15ibm.zip in /pub/msdos/flowchart) - good - EasyCase (ezcase17.zip in /pub/msdos/case) - limited CASE Flow-Charts ... - FLODRAW (fdrw225{a,b}.zip - /pub/msdos/flowchart) (CGA only?) [ new ] --------------------------------------------------------------------------- Program: X(Plore) Mathematical Toolchest ... Alternatives: ... Mercury (mrcry209.zip) - solving equations (in /.../math for oak) [ new ] --------------------------------------------------------------------------- Section B: Compression / Decompression Programs --------------------------------------------------------------------------- Synopsis - DOS and UNIX ~~~~~~~~ *.hpk hpack78.zip hpack78src.tar.Z (garbo only) *.F -- freeze * *.z -- pack (on your system) -- gzip-0.5.tar.Z ** *.exe/ pklte115.zip -- *.com lzexe91e.zip diet144.zip * freeze is a new Unix compression program ... Get it from /usenet/comp.sources.misc/volume25/freeze at wuarchive ... ** gzip (GNU zip) is designed to replace Unix's compress (?) ... Get gzip from prep.ai.mit.edu (in /pub/gnu) ... [ new ] --------------------------------------------------------------------------- Program: Hpack multisystem archiver [ new ] Version: 0.78 Upload Date: (to garbo) 92/11/20 File: hpack078.zip Size: 114,243 Location: oak: /pub/msdos/arc-lbr (not the latest) garbo: /pc/arcers Status: Freeware Comment: yet another fine archiver ... but slow compression :( ... --------------------------------------------------------------------------- Program: Buerg's archive files viewer Version: 1.41 [ update ] Upload Date: 92/11/08 File: fv141.zip -------------------------------------------------------------------------- Program: ArcMaster Version: 8.3 [ update ] Upload Date: 92/11/08 File: am83.zip ... Alternative: Shez (shez83.zip) [ update ] --------------------------------------------------------------------------- Section C: Utilities --------------------------------------------------------------------------- Area 1: 4DOS --------------------------------------------------------------------------- Program: 4DOS command.com replacement Version: 4.01 revision d [ update ] Upload Date: 92/10/31 File: 4dos401p.zip --------------------------------------------------------------------------- Area 2: Disk Utilites --------------------------------------------------------------------------- Program: OnePass - single-pass floppy-disk copier ... Alternatives: ... , WWScopyd (copyd11.zip) BTW ... A good program to break a large file up into pieces and copies it to floppies is slice (oak: /pub/msdos/pcmag/slice13.arc) ... [ new ] --------------------------------------------------------------------------- Program: MegaBack disk system backup Version: 2.1 [ update ] Upload Date: 92/12/07 File: mback210.zip --------------------------------------------------------------------------- Program: HDTEST [ new ] Version: 5.35a Upload Date: 92/10/26 File: hdts535a.zip Size: 139,775 Location: oak: /pub/msdos/dskutl garbo: /pc/diskutil (not the latest) Status: Shareware Comment: A good program for testing and maintaining disks ... --------------------------------------------------------------------------- Area 3: Directory Utilities --------------------------------------------------------------------------- Program: Vernon Buerg's file viewer and disk utility Version: 7.7a [ update ] Upload Date: 92/10/26 File: list77a.zip --------------------------------------------------------------------------- Area 4: File / Text Utilities --------------------------------------------------------------------------- Program: Derr's FileFinder Version: 4.1 [ update ] Upload Date: 92/11/14 File: fff41.zip --------------------------------------------------------------------------- Program: Pretty Good Privacy [ new ] Version: 2.1 Upload Date: (to garbo) 92/12/07 File: pgp21.zip Size: 187,758 bytes Location: oak: not available garbo: /pc/fileutil Status: Freeware Comment: This is a very popular but controversial (public key) encrytpion program ...also available from ghost.dsi.unimi.it (in /pub/security) Alternatives: Encrypt (encrypt.zip), Tangle (tangle.zip) --------------------------------------------------------------------------- Program: Dosnx - Unix-like utilities ... BTW ... Some other "common" Unix Tools for Dos: ^^^^^^^^^^^^^^^^^^^^ ... ksh - oak: /pub/msdos/sysutl/ms_sh21b.zip (386+ preferred) [ update ] ... rcs - oak: /pub/msdos/pgmutl/rcs56dos.zip [ update ] --------------------------------------------------------------------------- Program: CompuShow *.gif files viewer ... Alternatives: ... GIFV (gifv37.zip) [ new ] BTW ... a bit on jpeg files ... viewers: ... ColorView (dcview20.zip) - oak: /pub/msdos/graphics [ new ] DVPEG (dvpeg21.zip) - sunee.uwaterloo.ca: /pub/jpeg/viewers [ update ] --------------------------------------------------------------------------- The Most Useful MSDOS Programs at Simtel20 and Garbo (Part II) ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ **** The Ultimate Guide to MSDOS Archive Files **** --------------------------------------------------------------------------- Area 5: Screen Utilities --------------------------------------------------------------------------- Program: Snipper [ update ] Version: 2.6 Upload Date: 92/10/28 File: snippr26.zip --------------------------------------------------------------------------- Area 6: System Utilities --------------------------------------------------------------------------- Program: InfoPlus - screens of system info Version: 1.56 [ update ] Upload Date: 92/12/30 File: ifp1p156.zip ... Alternatives: ... ASQ (asq130.zip) PC Mag Lab Benchmarks (pcben60{a,b,c}.zip; bench60.zip (garbo)) [ new ] --------------------------------------------------------------------------- Program: Secure System Login ... Alternative: CCP (ccp11.zip) - a more secure system control program [ new ] --------------------------------------------------------------------------- Program: HyperDisk Version: 4.51 [ update ] Upload Date: 92/12/07 File: spkt451s.zip --------------------------------------------------------------------------- Area 7: Other Utilities --------------------------------------------------------------------------- Program: Ultimate Calc From owner-software@net.bio.net Fri Jan 01 22:00:00 1993 Path: biosci!agate!stanford.edu!enterpoop.mit.edu!eru.mt.luth.se!lunic!sunic!dkuug!uts!engeje From: engeje@uts.uni-c.dk (Jacob Engelbrecht) Newsgroups: bionet.software Subject: Re: intron/exon borders Message-ID: <1993Jan2.212630.683@uts.uni-c.dk> Date: 2 Jan 93 21:26:30 GMT References: <30DEC199214434286@aardvark.ucs.uoknor.edu> Organization: UNI-C, Danish Computing Centre for Research and Education Lines: 257 In <30DEC199214434286@aardvark.ucs.uoknor.edu> bfrank@aardvark.ucs.uoknor.edu (FRANK,BART) writes: >Can anyone recommend a good program to screen human genomic seqeunces >and predict positions of intros/exon borders? >Thanks, >Bart Frank >Internet: BFRANK@AARDVARK.UCS.UOKNOR.EDU I include information of a mail server service for prediction of splice sites as described in our Journal of Molecular Biology article. ******** Announcement of the NetGene Mail-server: ********* DESCRIPTION: The NetGene mail server is a service producing neural network predictions of splice sites in vertebrate genes as described in: Brunak, S., Engelbrecht, J., and Knudsen, S. (1991) Prediction of Human mRNA Donor and Acceptor Sites from the DNA Sequence. Journal of Molecular Biology, 220, 49-65. ABSTRACT OF JMB ARTICLE: Artificial neural networks have been applied to the prediction of splice site location in human pre-mRNA. A joint prediction scheme where prediction of transition regions between introns and exons regulates a cutoff level for splice site assignment was able to predict splice site locations with confidence levels far better than previously reported in the literature. The problem of predicting donor and acceptor sites in human genes is hampered by the presence of numerous amounts of false positives - in the paper the distribution of these false splice sites is examined and linked to a possible scenario for the splicing mechanism in vivo. When the presented method detects 95% of the true donor and acceptor sites it makes less than 0.1% false donor site assignments and less than 0.4% false acceptor site assignments. For the large data set used in this study this means that on the average there are one and a half false donor sites per true donor site and six false acceptor sites per true acceptor site. With the joint assignment method more than a fifth of the true donor sites and around one fourth of the true acceptor sites could be detected without accompaniment of any false positive predictions. Highly confident splice sites could not be isolated with a widely used weight matrix method or by separate splice site networks. A complementary relation between the confidence levels of the coding/non-coding and the separate splice site networks was observed, with many weak splice sites having sharp transitions in the coding/non-coding signal and many stronger splice sites having more ill-defined transitions between coding and non-coding. INSTRUCTIONS: In order to use the NetGene mail-server: 1) Prepare a file with the sequence in a format similar to the fasta format: the first line must start with the symbol '>', the next word on that line is used as the sequence identifier. The following lines should contain the actual sequence, consisting of the symbols A, T, U, G, C and N. U is converted to T, letters not mentioned are converted to N. All letters are converted to upper case. Numbers, blanks and other nonletter symbols are skipped. The lines should not be longer than 80 characters. The minimum length analyzed is 451 nucleotides, and the maximum is 100000 nucleotides (your mail system may have a lower limit for the maximum size of a message). Due to the non-local nature of the algorithm sites closer than 225 nucleotides to the ends of the sequence will not be assigned. 2) Mail the file to netgene@virus.fki.dth.dk. The response time will depend on system load. If nothing else is running on the machine the speed is about 1000 nucleotides/min. It may take several hours before you get the answer, so please do not resubmit a job if you get no answer within a short while. REFERENCING AND FURTHER INFORMATION Publication of output from NetGene must be referenced as follows: Brunak, S., Engelbrecht, J., and Knudsen, S. (1991) Prediction of Human mRNA Donor and Acceptor Sites from the DNA Sequence. Journal of Molecular Biology, 220, 49-65. CONFIDENTIALITY Your submitted sequence will be deleted automatically immediately after processing by NetGene. PROBLEMS AND SUGGESTIONS: Should be addressed to: Jacob Engelbrecht e-mail: engel@virus.fki.dth.dk Department of Physical Chemistry The Technical University of Denmark Building 206 DK-2800 Lyngby Denmark phone: +45 4288 2222 ext. 2478 (operator) phone: +45 4593 1222 ext. 2478 (tone) fax: +45 4593 4808 EXAMPLE: A file test.seq is prepared with an editor with the following contents: >HUMOPS GGATCCTGAGTACCTCTCCTCCCTGACCTCAGGCTTCCTCCTAGTGTCACCTTGGCCCCTCTTAGAAGC CAATTAGGCCCTCAGTTTCTGCAGCGGGGATTAATATGATTATGAACACCCCCAATCTCCCAGATGCTG . Here come more lines with sequence. . . This is sent to the NetGene mail-server, on a Unix system like this: mail netgene@virus.fki.dth.dk < test.seq In return an answer similar to this is produced: From netgene@virus.fki.dth.dk Fri Mar 20 13:30 MET 1992 Received: by virus.fki.dth.dk (16.7/16.2) id AA05624; Fri, 20 Mar 92 13:30:41 +0100 Date: Fri, 20 Mar 92 13:30:41 +0100 From: virus mail server Return-Path: To: engel@virus.fki.dth.dk Subject: HUMOPS: NetGene splice site prediction Status: RO ------------------------------------------------------------------------ NetGene Neural Network Prediction of Splice Sites Reference: Brunak, S., Engelbrecht, J., and Knudsen, S. (1991). Prediction of Human mRNA donor and acceptor sites from the DNA sequence. Journal of Molecular Biology 220:49-65. ------------------------------------------------------------------------ Report ERRORS to Jacob Engelbrecht engel@virus.fki.dth.dk. Potential splice sites are assigned by combining output from a local and a global network. The prediction is made with two cutoffs: 1) Highly confident sites (no or few false positives, on average 50% of the true sites detected); 2) Nearly all true sites (more false positives - on average of all positions 0.1% false positive donor sites and 0.4% false positive acceptor sites, at 95% detection of true sites). The network performance on sequences from distantly related organisms has not been quantified. Due to the non-local nature of the algorithm sites closer than 225 nucleotides to the ends of the sequence cannot be assigned. Column explanations, field identifiers: POSITION in your sequence (either first or last base in intron). Joint CONFIDENCE level for the site (relative to the cutoff). EXON INTRON gives 20 bases of sequence around the predicted site. LOCAL is the site confidence from the local network. GLOBAL is the site confidence from the global network. ------------------------------------------------------------------------ The sequence: HUMOPS contains 6953 bases, and has the following composition: A 1524 C 2022 G 1796 T 1611 1) HIGHLY CONFIDENT SITES: ========================== ACCEPTOR SITES: POSITION CONFIDENCE INTRON EXON LOCAL GLOBAL 4094 0.27 TGTCCTGCAG^GCCGCTGCCC 0.63 0.66 5167 0.20 TGCCTTCCAG^TTCCGGAACT 0.59 0.64 3812 0.17 CTGTCCTCAG^GTACATCCCC 0.68 0.54 3164 0.02 TCCTCCTCAG^TCTTGCTAGG 0.79 0.32 2438 0.01 TGCCTTGCAG^GTGAAATTGC 0.78 0.33 DONOR SITES: POSITION CONFIDENCE EXON INTRON LOCAL GLOBAL 3979 0.38 CGTCAAGGAG^GTACGGGCCG 0.92 0.74 2608 0.17 GCTGGTCCAG^GTAATGGCAC 0.85 0.54 4335 0.06 GAACAAGCAG^GTGCCTACTG 0.83 0.41 2) NEARLY ALL TRUE SITES: ========================= ACCEPTOR SITES: POSITION CONFIDENCE INTRON EXON LOCAL GLOBAL 4094 0.55 TGTCCTGCAG^GCCGCTGCCC 0.63 0.66 3812 From owner-software@net.bio.net Sat Jan 02 22:00:00 1993 Path: biosci!agate!spool.mu.edu!uunet!pipex!bnr.co.uk!uknet!comlab.ox.ac.uk!oxuniv!oxpath!jasper From: jasper@vax.path.ox.ac.uk Newsgroups: bionet.software Subject: Protein Structure Prediction mailserver Message-ID: <1993Jan2.173434.1@vax.path.ox.ac.uk> Date: 2 Jan 93 16:34:34 GMT Organization: Oxford University Molecular Biology Data Centre Lines: 63 Nntp-Posting-Host: heatly Nntp-Posting-User: jasper Hi, I haven't *seen* this posted anywhere yet (apologies if it has been, I have that sneaking suspicion we are losing some articles through the feed) but the information is tucked away in Nature, so I think it needs advertising! **** PHD - a new mail server for protein secondary structure prediction *** First the picture: for those of us who just run sequence through the database and are then faced with one of Russ Doolittle's less attractive options (Like "your protein does not match anything else yet seen in the Universe" :) this is going to help you. But if you find that your protein is a member of a family, and there is no homolgous 3D structure to work to, you are kind of stuck with secondary structure predicitions that you *know* are only going to be a little over half right, and you don't which half it's going to be..... The better the prediction is going to be, the more useful it could be to you. And if you have a measure for which parts are more likely to be correct then that is going to help enormously. So: and this is the end of a string of letters and papers that make interesting reading in themselves; look at Nature, vol 360, page 540 (10th Dec 1992 issue) at the letter from Burkhard Rost and Chris Sander from EMBL describing a new network server (PHD, Profile Neural Network Prediction) for the prediction of secondary structures using information from multiple sequence alignments. To get started send HELP as the body of text to the server at PredictProtein@EMBL-Heidelberg.DE, and go from there. You will be instructed on the correct format to send your sequence, which will then be matched against the database, multiply aligned, the prediction of secondary structure calculated and the whole thing sent back. The return times are reasonably fast, but maybe that's because I'm testing it in the vacation? Overall round trip time for a 200 amino acid domain is about 30 minutes. Of course this could get a lot slower if everyone tries it at once! One final point; the whole process will not work if your sequence has less than 30% idenitity to another member of the database. You may be in the position where your own favorite sequence is a member of a family, but at less than 30%. In which case, you should be able to learn something using one of the other family members; the results will not include 'your' protein, but if you already have alignments that are satisfactory this may be useful. I, for one, would be interested to know what sort of results people get from the system, and how well the outupt compares with a range of known or new 3D structures. Maybe as people get data they could feed this back to the group? Unless there is preference from EMBL as to where to send feedback? I hope I'm not stealing anyone's thunder by posting this, but it looks too good to go unnoticed. Well, many thanks to Burkhard and Chris, and New Years greetings to everyone else! regards, jasper Jasper Rees Oxford University Molecular Biology Data Centre (nights and weekends) Sir William Dunn School of Pathology (always) Oxford University jasper@vax.path.ox.ac.uk From owner-software@net.bio.net Sat Jan 02 22:00:00 1993 Path: biosci!CSC.FI!Rob.Harper From: Rob.Harper@CSC.FI (Rob Harper) Newsgroups: bionet.software Subject: MSDOS uploads to SIMTEL20 DEC 1992 Message-ID: <199301031054.AA02546@csc.fi> Date: 3 Jan 93 10:54:51 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 497 >Path: funic!fuug!mcsun!uunet!tacom-emh1.army.mil!w8sdz >From: w8sdz@tacom-emh1.army.mil (Keith Petersen) >Newsgroups: comp.archives.msdos.announce >Subject: msdos uploads to SIMTEL20 during the month of December, 1992 >Summary: 275 new files were uploaded >Keywords: simtel20,archives,msdos,monthly,uploads >Message-ID: <9301030731.kp16868@tacom-emh1.army.mil> >Date: Sun, 3 Jan 1993 07:31:46 GMT >Followup-To: comp.archives.msdos.d >Organization: The SIMTEL20 Archives >Approved: w8sdz@tacom-emh1.army.mil >Lines: 483 File PD1:UPLOADS.DEC Created: Jan. 3, 1993 NOTE: This file is also available in comma-delimited format as SIM9212.IDX MSDOS FILES UPLOADED TO WSMR-SIMTEL20.ARMY.MIL during the month of December 1992 NOTE: Type B is Binary; Type A is ASCII Filename Type Length Date Description ============================================== Directory PD1: 4FILE2U6.ZIP B 75433 921203 4DOS file management tool & description editor 4UTILS7.ZIP B 96374 921219 4DOS description editor & file finder (free) EZ-BTM05.ZIP B 50180 921231 4DOS BTM files: loaders/regular/libraries/help Directory PD1: ARCE41A.ZIP B 9224 921207 Vernon Buerg's fast ARC extraction program HPACK78.ZIP B 113973 921231 High performance archiver from New Zealand SHEZ83.ZIP B 211003 921227 Shell for archive manipulation, w/virus check Directory PD1: COSMOS16.ZIP B 178908 921229 SVGA to Herc, professional Astronomy simulator Directory PD1: ACADPCB.ZIP B 71268 921223 Tools and blocks for PC board design w/AutoCAD STREKDXF.ZIP B 297704 921223 DXF format of Enterprise drawing for Autocad Directory PD1: STRINGS2.ZIP B 82478 921207 Adds 70 string handling functions to BAT files TSBAT40.ZIP B 96390 921219 Collection of useful batch files by Timo Salmi Directory PD1: PBINSBAT.ZIP B 1807 921207 Batch file to install Powerboard BBS v1.20 PCBURM13.ZIP B 130308 921217 PCBoard BBS user file/byte ratio monitor v1.3 SBBS_116.ZIP B 777831 921202 SuperBBS: QBBS-compatible multi-node BBS,v1.16 TOPFILES.ZIP B 134095 921227 PC Board top files d'loaded during last x days Directory PD1: GWW11A01.ZIP B 333509 921208 Complete Bible search prog. for Windows, 1/12 GWW11A02.ZIP B 360810 921208 Complete Bible search prog. for Windows, 2/12 GWW11A03.ZIP B 360810 921208 Complete Bible search prog. for Windows, 3/12 GWW11A04.ZIP B 360810 921208 Complete Bible search prog. for Windows, 4/12 GWW11A05.ZIP B 330096 921208 Complete Bible search prog. for Windows, 5/12 GWW11A06.ZIP B 360810 921208 Complete Bible search prog. for Windows, 6/12 GWW11A07.ZIP B 360810 921208 Complete Bible search prog. for Windows, 7/12 GWW11A08.ZIP B 360810 921208 Complete Bible search prog. for Windows, 8/12 GWW11A09.ZIP B 360810 921208 Complete Bible search prog. for Windows, 9/12 GWW11A10.ZIP B 360810 921208 Complete Bible search prog. for Windows, 10/12 GWW11A11.ZIP B 295595 921208 Complete Bible search prog. for Windows, 12/12 GWW11A12.ZIP B 106869 921208 Complete Bible search prog. for Windows, 12/12 Directory PD1: BED100.ZIP B 60715 921215 Molecular Biology input feedback echo w/speakr Directory PD1: ANNE10.ZIP B 244863 921202 Nov 1992 Anne of Green Gables Directory PD1: PRBGI097.ZIP B 357003 921215 BGI driver for dot matrix & laserjet printers Directory PD1: SPWNO413.ZIP B 107266 921212 Disk/EMS/EXT/INT15-swapping spawn() replacemnt Directory PD1: KNWRS120.ZIP B 139541 921227 KnitWare: Sweater knitting design/pattern prnt Directory PD1: JCOOL01.ZIP B 441547 921202 Extensive C++ class library (uses templates) NEWMAT06.ZIP B 108322 921203 C++ classes and functions for Matrices Directory PD1: ASSEMBLR.ZIP B 54456 921210 Generic 6502/6803/8085 assembler Directory PD1: CCHEF20.ZIP B 186624 921219 CompuChef v2.0: Full-featured recipe database CDS24D.ZIP B 52587 921207 CD Catalog with browse & search. Mouse Support MM-703.ZIP B 207319 921207 MealMaster database program for recipes, v7.03 POS410.ZIP B 310413 921202 ESD Point of Sale with Accounts Receivable SCHED203.ZIP B 365313 921204 Automatic employee scheduling system. DEMO SSDINF11.ZIP B 16133 921227 Displays information on selected SAS Datasets TAPEM16B.ZIP B 67967 921229 Music database & audio cassette label maker TS20.ZIP B 947840 921227 Travel Search: Hotels, resorts, inns in U.S.A. Directory PD1: LIB19.ZIP B 211130 921223 dBASE IV procedure/UDF library Directory PD1: DDJ9210.ZIP B 1603338 921231 Dr. Dobbs Journal mag listings, Oct. 1992 DDJ9211.ZIP B 276723 921216 Dr. Dobbs Journal mag listings, Nov. 1992 DDJ9212.ZIP B 1445216 921216 Dr. Dobbs Journal mag listings, Dec. 1992 DDJ9301.ZIP B 403092 921216 Dr. Dobbs Journal mag listings, Jan. 1993 Directory PD1: FAC171.ZIP B 120787 921207 Fast fuzzy find US/foreign telephone area code Directory PD1: EVP10A.ZIP B 354479 921202 EnVision Publisher: DTP GUI,WYSIWYG,mouse,1of2 EVP10B.ZIP B 314934 921202 EnVision Publisher: DTP GUI,WYSIWYG,mouse,2of2 Directory PD1: DVFAQ10.ZIP B 72696 921207 DESQview/QEMM Frequently Asked Questions Directory PD1: OBSLT10.ZIP B 7661 921227 Recursive delete files older than selected age QDEL032.ZIP B 22708 921221 Del dir tree FAST. Options, fun, statistics RMYG13.ZIP B 5419 921227 Joseph Gil's tiny Unix-like file removal util. WALKDIR.ZIP B 10998 921218 Walk through directory structure & print info Directory PD1: DASM85.ZIP B 11084 921210 Disassembler for 8085 binaries DMPPRG20.ZIP B 46604 921202 Disassembles MS-DOS & Windows 3 .EXE files Directory PD1: COMBI110.ZIP B 41443 921201 RAM disk & disk cache sharing XMS memory COPYD11.ZIP B 40075 921207 Wsscopyd, copy/format disks, 1-pass, w/source FFIT162.ZIP B 42303 921209 Copies files to disks optimally (knapsack) HSUTIL60.ZIP B 141554 921202 Hughes-Schoolfield collection of DOS utilities JUMBO303.ZIP B 322305 921228 CMS 120MB and 250MB tape drive software v3.03 MBACK210.ZIP B 225252 921207 Patri-Soft's comprehensive disk system backup QCOPY40.ZIP B 80267 921207 QCOPY v4.0: Disk copying and format utility SPKT451S.ZIP B 291958 921207 HyperDisk disk cache w/HyperKey & HyperScreen Directory PD1: DCLOCK.ZIP B 159082 921208 Simple digital alarm clock for DESQview/X DVIX.ZIP B 105798 921208 DVI previewer for DESQview/X FNVW100.ZIP B 155632 921202 DESQview/X font viewer, v1.00 GS252DVX.ZIP B 1331344 921208 Postscript interpreter that runs under DV/X TGIF212.ZIP B 950862 921208 Xlib-based draw program that runs under DVX XCALC.ZIP B 179536 921208 Scientific calculator (TI-30 / HP-10C) for DVX XCOLORED.ZIP B 199169 921208 Graphical tool for mixing colors under DVX XCOLORMA.ZIP B 124690 921208 Displays current default colormap under DVX Directory PD1: ANSIPC10.ZIP B 74989 921218 ANSI graphics editor w/extensive mouse support BE300.ZIP B 236741 921219 Bingo: Multi-window programmer's text editor DNGDNG11.ZIP B 323790 921204 Chinese Word Processor (previously CEDIT) KANTKS10.ZIP B 107481 921207 Kannada Script editor/Transliterator, req. EGA ME600.ZIP B 554035 921215 Multi-Edit v6.0: Programmer's text editor ME_CD25.ZIP B 357600 921202 ME2 v2.5: Extendable emacs-like text editor TRIVED08.ZIP B 12532 921207 FOSSIL/console vi-like editor for BBS use Directory PD1: GSH220.ZIP B 391784 921201 Gradebook program for college/university MATHSP11.ZIP B 37188 921218 Mathshop: A game-like math drill for age 6-12 PHYSCSXA.ZIP B 293817 921203 Physics tutorial, graphic oriented hypertext SUDBURY.ZIP B 718539 921208 Learn mining vocabulary and French grammar Directory PD1: ADC8_10.ZIP B 62706 921207 How: 8 bit analog->digital cvtr w/printr port SPCTR3E2.ZIP B 364462 921227 386/486 vers. of SPICE 3e2 ckt simu From owner-software@net.bio.net Sat Jan 02 22:00:00 1993 Path: biosci!ICBR.IFAS.UFL.EDU!SJJ From: SJJ@ICBR.IFAS.UFL.EDU ("JONG, SONG-MUH J") Newsgroups: bionet.software Subject: AsEasyAs spreadsheet Message-ID: <9301031726.AA14971@net.bio.net> Date: 3 Jan 93 17:17:00 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 12 Dear netters, I am writing regarding the graphic functions of the spreadsheet AsEasyAs. This program has been selected as one of the best in MSDOS sharewares. However, I found it difficult to create simple graphs with numbers ranging from positive to negative numbers, or numbers with decimals. Can anyone enlighten me as to the ways of doing graphics in AsEasyAs? Or perhaps the graphics functions are only available from the high-end products? Song-Muh Jong sjj@icbr.ifas.ufl.edu From owner-software@net.bio.net Sat Jan 02 22:00:00 1993 Path: biosci!foxmail.gfc.edu!dpowers From: dpowers@foxmail.gfc.edu (Donald R. Powers) Newsgroups: bionet.software Subject: LabView hardware Message-ID: <1993Jan02.165323.24056@foxmail.gfc.edu> Date: 3 Jan 93 00:53:23 GMT Sender: daemon@net.bio.net Distribution: bionet Organization: George Fox College, Newberg, Oregon USA Lines: 11 I have LabView II and would like to set it up to monitor several instruments on my Mac IIci. Can anyone suggest a reasonably priced A/D device I can use for an interface? Most of what I have involves a simple voltage inpute. However, it is possible I might need a differential input at some point. Thanks! Don Powers ********************************************************************* This message was created on the George Fox College Fox Mail system. The views expressed are those of the individual author only. ********************************************************************* From owner-software@net.bio.net Sun Jan 03 22:00:00 1993 Path: biosci!agate!doc.ic.ac.uk!daresbury!buzz.bmc.uu.se!embl-heidelberg.de!omond From: omond@embl-heidelberg.de Newsgroups: bionet.software Subject: Re: Protein Structure Prediction mailserver Message-ID: <1993Jan4.152545.62019@embl-heidelberg.de> Date: 4 Jan 93 14:25:45 GMT References: <1993Jan2.173434.1@vax.path.ox.ac.uk> Organization: EMBL, European Molecular Biology Laboratory Lines: 27 In article <1993Jan2.173434.1@vax.path.ox.ac.uk>, jasper@vax.path.ox.ac.uk writes: > I haven't *seen* this posted anywhere yet (apologies if it has been, > I have that sneaking suspicion we are losing some articles through the feed) > but the information is tucked away in Nature, so I think it needs advertising! > > **** PHD - a new mail server for protein secondary structure prediction *** > > The return times are reasonably fast, but maybe that's because I'm testing it > in the vacation? Overall round trip time for a 200 amino acid domain is about > 30 minutes. Of course this could get a lot slower if everyone tries it at > once! Jasper, sorry to revert to posting to the net, but ... you might be pleasantly surprised to get a faster turnround if you configure your machine vax.path.ox.ac.uk to actually ACCEPT e-mail connections. We've got lots of stuff in our mail queue for you guys, and your machine constantly rejects SMTP connection request from us. Actually this seems to be a common "feature" of sites in Oxford, since it happens pretty regularly. What mailer software are you running ? Regards, Roy Omond System Manager/PostMaster etc. etc. European Molecular Biology Laboratory Heidelberg, Germany. From owner-software@net.bio.net Sun Jan 03 22:00:00 1993 Path: biosci!uwm.edu!cs.utexas.edu!sdd.hp.com!think.com!yale.edu!ira.uka.de!chx400!bernina!neptune!gonnet From: gonnet@inf.ethz.ch (Gaston Gonnet) Newsgroups: bionet.software Subject: Re: Program to compare all members of a group of sequences Message-ID: <1993Jan4.102845.16334@neptune.inf.ethz.ch> Date: 4 Jan 93 10:28:45 GMT References: <1992Dec30.051200.21456@tigger.jvnc.net> Sender: news@neptune.inf.ethz.ch (Mr News) Organization: Dept. Informatik, Swiss Federal Institute of Technology (ETH), Zurich, CH Lines: 21 Nntp-Posting-Host: rutishauser-gw.inf.ethz.ch In article <1992Dec30.051200.21456@tigger.jvnc.net> mrl775@tigger.jvnc.net writes: > Hello > >Does anyone know of a program that will take a set of sequences, and find >common local alignments (sort of like what blast and blast3 do, but with each >member of the set). I am looking to define cofactor binding sites, and have a >list of sequences that all bind the cofactor, but have no good method of >comparing them all together (a multiple alignment doesnt work). Any hints, >pointers, source, executables would be appreciated. ====================================================== We compute multiple alignments based on local (all-against-all) alignments. This may solve your problem. You can try this by submitting a request to our automatic server. Send a mail message to cbrg@inf.ethz.ch with the body help AllAll and you will receive a description on how to submit requests. Gaston H. Gonnet, Informatik, Zurich From owner-software@net.bio.net Mon Jan 04 22:00:00 1993 Path: biosci!daresbury!daresbury!news From: PARSONS_A@snd01.pcr.co.uk Newsgroups: bionet.software Subject: GCG synchronisation problem Message-ID: <1993Jan5.093228.21154@gserv1.dl.ac.uk> Date: 5 Jan 93 09:33:09 GMT Sender: list-admin@daresbury.ac.uk Distribution: bionet Lines: 166 Original-To: BIO-SOFT Happy New Year Neteers, I have had no joy out of GCG on this one - anyone had anyexperience of this particular error whilst using GCG and (a) what it might mean and (b) how it affects the quality of the results that I get? Thanks in Advance, Tony Parsons <> Details..... I was trying to search PIR using FASTA and got the following error :- *** ERROR in SQNext. Sequence reading is out of synchronization. Any ideas what is going on? Log file follows... Tony Parsons - Pfizer central Research (parsons_a@snd01.pcr.co.uk) ------------------------- log of session ----------------------------------- WELCOME TO GCG Sequence Analysis Software Package Version 7.1, March, 1992 (c)1982, 1983, 1984, 1985, 1986, 1987, 1989, 1991, 1992 Genetics Computer Group, Inc. All rights reserved. Published research assisted by this software should cite: Devereux, Haeberli and Smithies (1984). A Comprehensive Set of Sequence Analysis Programs for the VAX. Nucleic Acids Research 12(1); 387-395 Databases available: GenBank Release 73.0 (9/92) PIR-Protein Release 34.0 (10/92) EMBL (Modified) Release 32.0 (9/92) SwissProt Release 23.0 ( 8/92) PIR-Nucleic Release 36.0 (3/90) Vecbase Release 3.0 ( 8/87) PROSITE Release 9.2 (9/92) REBASE restriction enzymes 9210 (10/92) MIPSX 34.0 (9/92) Help is available with the command $ GenHelp PROBLEMS WITH NEW SOFTWARE or DATABASES email: PARSONS_A tel - 6871 Running Fasta using : ... /INfile=ul08.gcg /BEGin=1 /END=750 /INfile2=p:* /WORd=2 /LIStsize=40 /OUTfile=Ul08.Fasta /Default *** ERROR in SQNext. Sequence reading is out of synchronization. (Peptide) FASTA of: Ul08.Gcg from: 1 to: 750 December 8, 1992 15:09 TO: p:* Sequences: 223 Symbols: 30,658 Word Size: 2 Score Init1 Initn < 2 0 0: 4 0 0: 6 0 0: 8 0 0: 10 0 0: 12 0 0: 14 0 0: 16 1 1:= 18 4 4:== 20 12 12:====== 22 26 26:============= 24 21 21:=========== 26 35 35:================== 28 30 30:=============== 30 10 10:===== 32 44 43:====================== 34 7 6:===- 36 4 2:=- 38 10 6:===-- 40 7 3:==-- 42 4 5:==+ 44 2 2:= 46 1 1:= 48 5 6:=== 50 0 2:+ 52 0 1:+ 54 0 1:+ 56 0 1:+ 58 0 0: 60 0 1:+ 62 0 1:+ 64 0 0: 66 0 1:+ 68 0 1:+ 70 0 0: 72 0 1:+ 74 0 0: 76 0 0: 78 0 0: 80 0 0: > 80 0 0: mean initn score: 23.8 (2.83) mean init1 score: 23.8 (2.83) The best scores are: init1 initn opt Pir1:Cbms Cytochrome b - Mouse mitochondrion (SGC1) 39 72 40 Pir1:Cbrt Cytochrome b - Rat mitochondrion (SGC1) 39 68 40 Pir1:Cbqfr Cytochrome b - Rhodospirillum rubrum 39 66 41 Pir1:Cbhu Cytochrome b - Human mitochondrion (SGC1) 37 62 39 Pir1:Wmrz17 Cytochrome b6-f complex 17K protein - Rice c... 44 59 66 Pir1:O4hud1 Debrisoquine 4-hydroxylase (EC 1.14.14.-) cy... 37 55 37 Pir1:Cbbo Cytochrome b - Bovine mitochondrion (SGC1) 39 54 40 Pir1:Wmlv17 Cytochrome b6-f complex 17K protein - Liverw... 37 52 57 Pir1:Cbxl Cytochrome b - African clawed frog mitochondri... 38 49 42 Pir1:Ccqfct Cytochrome c' - Rhodocyclus tenuis 35 49 35 Pir1:Cbboc6 Cytochrome b-c1 complex, 6.4K protein - Bovine 36 48 41 Pir1:Cblv55 Cytochrome b559 component E - Liverwort (Mar... 47 47 50 Pir1:Cbobe Cytochrome b - Evening primrose mitochondrion 47 47 61 Pir1:Cbnt55 Cytochrome b559 component E - Common tobacco... 47 47 50 Pir1:Cbrz55 Cytochrome b559 component E - Rice chloroplast 47 47 50 Pir1:Cbvf Cytochrome b - Fava bean mitochondrion 47 47 61 Pir1:Wmnt17 Cytochrome b6-f complex 17K protein - Common... 45 45 67 Pir1:Ccrfpp Cytochrome c' - Rhodobacter capsulatus 33 43 33 Pir1:Cclm Cytochrome c - Pacific lamprey 43 43 46 Pir1:Cbutb Cytochrome b - Trypanosoma brucei mitochondri... 32 42 42 Pir1:Rdbyun Ubiquinol--cytochrome-c reductase (EC 1.10.2... 42 42 42 Pir1:Wmsp17 Cytochrome b6-f complex 17K protein - Spinac... 41 41 67 Pir1:Cbyb55 Cytochrome b559 component psbE - Synechocyst... 41 41 48 Pir1:O4psz Denitrification system component nirT - Pseud... 41 41 51 Pir1:Ccps5a Cytochrome c551 - Pseudomonas aeruginosa 40 40 41 Pir1:Cbrz Cytochrome b - Rice mitochondrion 39 39 41 Pir1:Cbzm Cytochrome b - Maize mitochondrion 39 39 41 Pir1:Ccps5f Cytochrome c551 - Pseudomonas fluorescens bi... 38 38 49 Pir1:Cbbo5 Cytochrome b5 - Bovine 38 38 52 Pir1:Ccps5d Cytochrome c551 - Pseudomonas sp. 38 38 49 Pir1:Ccbf6 Cytochrome c6 - Yellow-green alga (Bumillerio... 37 37 39 Pir1:Ccps5s Cytochrome c551 - Pseudomonas stutzeri (stra... 37 37 52 Pir1:Ccps5b Cytochrome c551 precursor - Pseudomonas stut... 37 37 47 Pir1:Wmkl17 Cytochrome b6-f complex 17K protein - Chlore... 36 36 38 Pir1:Cctw5t Cytochrome c552 - Thermus aquaticus 36 36 36 Pir1:Cblv6 Cytochrome b6 - Liverwort (Marchantia polymor... 34 34 36 Pir1:Ccck Cytochrome c - Yeast (Issatchenkia orientalis) 33 33 36 Pir1:Ccus Cytochrome c - Smut fungus (Ustilago sphaerogena) 33 33 34 Pir1:Cceg Cytochrome c - Euglena gracilis 33 33 41 Pir1:Cchq Cytochrome c - Yeast (Hansenula anomala) 33 33 37 Aligning... CPU time: 0:00:19 Output File: Ul08.Fasta PARSONS_A job terminated at 8-DEC-1992 15:13:16.77 Accounting information: Buffered I/O count: 457 Peak working set size: 12603 Direct I/O count: 1919 Peak page file size: 21702 Page faults: 15293 Mounted volumes: 0 Charged CPU time: 0 00:00:29.73 Elapsed time: 0 00:05:30.12 From owner-software@net.bio.net Mon Jan 04 22:00:00 1993 Path: biosci!bcm!cs.utexas.edu!sdd.hp.com!usc!wupost!spool.mu.edu!agate!usenet.ins.cwru.edu!po.CWRU.Edu!ccy From: ccy@po.CWRU.Edu (Cheung C. Yue) Newsgroups: bionet.software Subject: Ethernet card recommendations for MacII Message-ID: <1iaoi4INN3vf@usenet.INS.CWRU.Edu> Date: 5 Jan 93 01:33:56 GMT Reply-To: ccy@po.CWRU.Edu (Cheung C. Yue) Organization: Case Western Reserve University, Cleveland, OH (USA) Lines: 12 NNTP-Posting-Host: hela.ins.cwru.edu I am daydreaming again, hoping to put the Mac IIsi in my laboratory on the net. Not being particularly familiar with Mac's, I would like to solicit recommendations for brands of ethernet cards. Also I would welcome suggestions of appropriate software (I suppose NCSA Telnet is probably the best). Finally I wonder if it is possible to allow remote control of the Mac over ethernet. Thanks in advance for all your input. C Cho Yue ccy@po.cwru.edu -- From owner-software@net.bio.net Mon Jan 04 22:00:00 1993 Path: biosci!bcm!cs.utexas.edu!uwm.edu!spool.mu.edu!uunet!pipex!demon!manor.demon.co.uk!paulf From: paulf@manor.demon.co.uk (Paul Fawcett) Newsgroups: comp.ai,comp.ai.neural-nets,sci.cognitive,comp.theory.cell-automata,bionet.neuroscience,bionet.molbio.evolution,bionet.software Subject: Biologically Plausible Dynamic Artificial Neural Networks Message-ID: <726213237snz@manor.demon.co.uk> Date: 5 Jan 93 05:53:57 GMT Sender: usenet@demon.co.uk Reply-To: paulf@manor.demon.co.uk Organization: UDI Lines: 59 Xref: biosci comp.ai:1368 comp.ai.neural-nets:1257 sci.cognitive:692 comp.theory.cell-automata:204 bionet.neuroscience:872 bionet.molbio.evolution:716 bionet.software:3875 X-Mailer: Simple NEWS 1.90 (ka9q DIS 1.19) Biologically Plausible Dynamic Artificial Neural Networks. ----------------------------------------------------------- A *Dynamic Artificial Neural Network* (DANN) [1] possesses processing elements that are created and/or annihilated, either in real time or as some part of a development phase [2]. Of particular interest is the possibility of constructing *biologically plausible* DANN's that models developmental neurobiological strategies for establishing and modifying processing elements and their connections. Work with cellular automata in modeling cell genesis and cell pattern formation could be applicable to the design of DANN topologies. Likewise, biological features that are determined by genetic or evolutionary factors [3] would also have a role to play. Putting all this together with a view to constructing a working DANN, possessing cognitive/behavioral attributes of a biological system is a tall order; the modeling of nervous systems in simple organisms may be the best approach when dealing with a problem of such complexity [4]. Any comments, opinions or references in respect of the above assertions would be most welcome. Many thanks Paul Fawcett. University of Westminster References. 1. Ross, M. D., et al (1990); Toward Modeling a Dynamic Biological Neural Network, Mathl Comput. Modeling, Vol 13 No.7, pp97-105. 2. Lee, Tsu-Chang,(1991); Structure Level Adaptation for Artificial Neural Networks, Kluwer Academic Publishers. 3. Edleman, Gerald,(1987); Neural Darwinism the Theory of Neural Group Selection, Basic Books. 4. Beer, Randal, D,(1990); Intelligence as Adaptive Behavior : An Experiment in Computational Neuroethology. Academic Press. -- -------------------------------------------------------------------------- Paul Fawcett | Internet: paulf@manor.demon.co.uk London, UK. | tenec@westminster.ac.uk -------------------------------------------------------------------------- From owner-software@net.bio.net Mon Jan 04 22:00:00 1993 Path: biosci!daresbury!buzz.bmc.uu.se!corax.udac.uu.se!sunic!mcsun!uunet!spool.mu.edu!caen!batcomputer!ghost.dsi.unimi.it!univ-lyon1.fr!chx400!news.unige.ch!pun From: pun@cui.unige.ch (PUN Thierry) Newsgroups: bionet.software Subject: Re: Analysis of 1-D Gels Keywords: PAGE, AGAROSE GEL ANALYSIS Message-ID: <1993Jan5.081627.24635@news.unige.ch> Date: 5 Jan 93 08:16:27 GMT References: <1993Jan5.065024.15769@hippo.ru.ac.za> Sender: usenet@news.unige.ch Organization: University of Geneva, Switzerland Lines: 193 In article <1993Jan5.065024.15769@hippo.ru.ac.za> mimq@hippo.ru.ac.za (Molapo Qhobela) writes: > >Can anyone out there help me out. I am looking for a DOS based software >package that can be used to analyse 1-D gels, with the ultimate aim of >perantage determination of samples. I currently use a package called >GelManager by Peter Jackman, but it only calculates similarities between >samples. I saw a similar posting on this subject a few months back, but >I never saw the responses. > Hello, Our software LaboImage (public domain, general purpose image analysis, see doc below) includes a comprehensive 1D gel analysis program. This program is based on work I performed at the NIH in 1982-1985, but has been rewritten for Sun, then for Motif/X11. We have not had the resources to run LaboImage on PC/DOS, but since it is now based on Motif/X11, it is feasible. Best regards, Prof. Thierry Pun, Computer Vision Group Computing Science Center, University of Geneva 24, r. General Dufour, CH-1211 Geneva 4, SWITZERLAND Phone : +41(22) 705 7627; secr: x7660; fax: x7780 E-mail: pun@cui.unige.ch [or pun@cgeuge51.bitnet] ******************************************************************************** LaboImage --------- Original notice March 8th, 1989: LaboImage 2.0 (SunView) August 24th, 1990: LaboImage 3.0 (SunView) March 19th, 1991: LaboImage 3.1 (SunView) December 1st, 1992: LaboImage 4.0 (X11 / OSF Motif) Computer Science Center, University of Geneva, Switzerland Thank you for your interest in LaboImage! General description ------------------- Labo Image is a window based software for image processing and analysis. It contains a comprehensive set of operators as well as general utilities. It is designed to be open-ended; new modules can easily be added. The software, written in C, is now based on X11 / OSF Motif. The current version has been developped and tested on a Sun SPARC station, with X11r4 and Motif 1.1. LaboImage has been extensively used by students as well as researchers from various domains: computer science (image analysis), medicine, biology, physics. It is distributed free of charge (source code). Status ------ Version 4.0, 1st December 1992: - hosts: Sun SPARC station; - OS: 4.1.1; - window system: X11r4 / Motif 1.1; - language: C; - approx. code size: source 2.5MB (80'000 lines), executable 2.5MB; - documentation: interactive help (english) Means of distributions ---------------------- LaboImage source code is available by anonymous ftp at: 1) ftp.ads.com, login name anonymous, in pub/VISION-LIST-ARCHIVE/SHAREWARE. 2) peipa.essex.ac.uk, login name anonymous, in ipa/proc-src. If you have no access to ftp, please contact the author. If you wish to be kept current with update, error reports, ..., please send us a mail with your full name, regular and electronic addresses. Distribution policy ------------------- In essence: - this is a non-profit software, but it is our property and the copyright notice must appear; - the reference to cite in case of published results obtained with Labo Image is: "A. Jacot-Descombes, M. Rupp, T. Pun: `LaboImage: A portable window-based environment for research in image processing and analysis', SPIE Symposium on Electronic Imaging Science and Technology, Image Processing: Implementation and Systems, San Jose, California, USA, Feb. 9-14, 1992. - no responsibility is assumed; - not to be used for profit making purposes; - bugs will usually be corrected since we use the software intensively ; - modifications should be communicated to us, with (normally) allowance for redistribution. Payment ------- Athough LaboImage has undergone many upgrades and suffered in the hands of many users, the current version is certainly not bug free. For the time being, we require NO prepayment, return postage or anything. We may however change this policy in the future, and ask for nominal fees to cover material expenditures. HOWEVER, if you are satisfied with the product, why not send us some "souvenir" (post card, drink, etc.)) from your country...??!! Capabilities ------------ Labo Image is an interactive software, whose interface is menu, mouse and window based. Its main features are: - input-output: LaboImage format file, SUN raster file; postscript; - display: mono, RGB, dithering, color table editor; - preprocessing: filters (median, high pass, low pass: hamming, gauss, etc), background subtraction, histogram equalization; - processing: thresholding, Fourier transforms, edge extractions: various operators, ridge-riding, zero-crossing; segmentation into regions, binary and gray tone mathematical morphology; - measures: histograms, image statistics, power, region outlining, object counting; - auxiliary: conversions, arithmetic & logical operations, noise addition, image generation, magnification, convolution/correlation with masks, image; padding; - elementary interactive operations: region outlining, statistics and histogram computation, etc.; - special tools: - modify image at pixel level interactively, - one-dimensional gel analysis, - expert system for image segmentation (not implemented in LaboImage 4.0); - macros definitions, save and replay (not implemented in LaboImage 4.0); - on line documentation. Image formats ------------- Own format: descriptor file + data file (binary, byte, int, float, complex; mono or RGB). Supports also Sun raster format. Conversions to various other formats. Data structures: - iconic (pixel-based), with each image having its own parameter list; - vectors (histograms, look-up tables); Miscellaneous remarks (answers to commonly asked questions) --------------------- - FILE FORMAT: we decided to go for: 1) a machine independant format; 2) a simple, data (ie. signal) oriented format. At the beginning of the development (summer 1987), we were not aware of any image format used by the whole community. There seems now to be some progress on the matter (TIFF, etc.), but they are still not that widely used in the community. Also, due to development priorities we consider conversion routines a more secondary issue as long as our format is simple. In addition, the menu "ACQUISITION=>free byte format" is fairly versatile. Also, the SUN raster images can now be read into LaboImage and likewise images on system may be stored in SUN raster format. However.. we would welcome any software contribution! - 3D IMAGE PROCESSING: nothing special for such images. - ON LINE HELP: available. Acknowledgements ---------------- More than 10 people have so far participated in this project, and their contribution is gratefully acknowledged. Staff: Pierre-Yves Burgi, Claudia Coiteux-Rosu, Ziping Hu, Alain Jacot- Descombes, Rene Lutz, Christian Pellegrini, Thierry Pun, Marianne Logean- Rupp, Krassimir Todorov. Students: Anne Bobillier, Alain Brunner, Markus Buchi, Christian Girard, Rene Perrier, Vrinda Shukla. Amongst them, A. Jacot-Descombes is responsible for general design issues, and is the keystone for implementation; R. Lutz is responsible for display manipulations (Color Table Editor,etc.); T. Pun is responsible for the original layout and general design issues; V. Shukla is responsible for the upgrade from LaboImage 2.0 to LaboImage 3.0; Marianne Logean-Rupp is responsible for the portability of LaboImage to X11 (LaboImage 4.0). We are particularly grateful to Drs. D. F. Hochstrasser and O. Ratib, Digital Imaging Unit, Computer Center, University Hospital of Geneva, for their extended support. LaboImage 4.0 could not have been without their help. Contacts -------- Particular problems will be redirected to relevant persons, but we prefer that all communications be made to the same address: e-mail: "pun@uni2a.unige.ch" or pun@cgeuge51.bitnet (if this fails, "pun@cui.unige.ch"). tel.: +(4122) 705 76 27 (T. Pun), 705 76 30 (A. Jacot-Descombes). fax: +(4122) 320 29 27. postal address: Thierry Pun LaboImage Computing Science Center, University of Geneva 24, rue du General-Dufour CH - 1211 Geneva 4 SWITZERLAND ******************************************************************************** From owner-software@net.bio.net Mon Jan 04 22:00:00 1993 Path: biosci!s.u-tokyo!ccut!news.u-tokyo.ac.jp!wnoc-tyo-news!sh.wide!sun-barr!cs.utexas.edu!wupost!spool.mu.edu!uunet!psgrain!hippo!mimq From: mimq@hippo.ru.ac.za (Molapo Qhobela) Newsgroups: bionet.software Subject: Analysis of 1-D Gels Keywords: PAGE, AGAROSE GEL ANALYSIS Message-ID: <1993Jan5.065024.15769@hippo.ru.ac.za> Date: 5 Jan 93 06:50:24 GMT Organization: Rhodes University, Grahamstown, South Africa Lines: 20 Hi, Can anyone out there help me out. I am looking for a DOS based software package that can be used to analyse 1-D gels, with the ultimate aim of perantage determination of samples. I currently use a package called GelManager by Peter Jackman, but it only calculates similarities between samples. I saw a similar posting on this subject a few months back, but I never saw the responses. Thanks in advance for your help. Please reply to this posting or directly to me at mimq@hippo.ru.ac.za Cheers Molapo -- Molapo Qhobela PhD. | Do not ever get caught with Rhodes University - Microbiology | your plants down!! Internet: mimq@hippo.ru.ac.za | Consult a Plant Pathologist Telefax: +27 (0461) 24377 | via APS From owner-software@net.bio.net Mon Jan 04 22:00:00 1993 Path: biosci!TIGGER.STCLOUD.MSUS.EDU!q00023 From: q00023@TIGGER.STCLOUD.MSUS.EDU Newsgroups: bionet.software Subject: want pkunpak program Message-ID: <00966206.44C22B60.14459@TIGGER.STCLOUD.MSUS.EDU> Date: 5 Jan 93 04:15:56 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 7 Dear netters, I am looking for PKUNPAK program for de-arcing a program. Also I amlooking for some useful list of biotechnoloy softwares. Could anyone can send me the program and the list? Thanks in advance, Gabriel Cheung From owner-software@net.bio.net Mon Jan 04 22:00:00 1993 Path: biosci!SALK-SC2.SDSC.EDU!mangalam From: mangalam@SALK-SC2.SDSC.EDU (Harry Mangalam) Newsgroups: bionet.software Subject: Re: Mac plasmid programs? Message-ID: <9301062004.AA02606@salk-sgi.sdsc.edu> Date: 6 Jan 93 20:04:19 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 65 Scott Monsma writes: >Is anyone aware of Mac programs for keeping records of plasmid constructs? >Such program would hopefully also draw graphic maps of the plasmids, >and keep sequence information. Thanks! As a matter of fact, yes.... Check out the program Gene Construction Kit - an excerpt a critically disclaimed review follows (also check Peter Markiewicz's reviews on the same (but older version of the) program. Gene Construction Kit by Textco (vox/fax: 603 643 1471) is also a relatively new entry but it is an extremely interesting cloning tool. All of the previously mentioned programs allow you to 'clone electronically', but GCK is optimized for it (and does nothing else). It is made only for the Mac and while it may run on B+W Macs, it really requires a color monitor to show its stuff. It combines elements of a drawing program and sequence editor to allow you to cut and paste elements of a number of sequences together to form new constructs. It remembers the history (even multiple histories) of the sequences you use to clone, what enzymes you used to clip the sequences, what you did to the ends to allow ligation (and prevents you from performing biologically impossible operations); whatever you create, you have a detailed construction history. It now also allows boolean searches of the associated text boxes in which you store any comments. In this way you could for instance, search all your "electronic freezer" for any constructs that had a luciferase reporter gene AND amp AND tet but NOT kan resistance genes. Besides being a great idea, it is also extraordinarily easy to use. The last program that attempted this trick was a piece of work from Intelligenetics called Stratagene (A great idea, if only they hadn't made it for _only_ a $30,000 Xerox LISP workstation and demanded about $50,000 for the software). Despite my aforementioned rage at demos, there is an excellent demo-tutorial of GCK available at the usual archives (ftp.bio.indiana.bio, in the IUBIO Software+Data/molbio/mac folder by gopher). There is also a new demo available direct from the company. From my experience with the new demo and its very reasonable cost (especially compared to the amount of aggro and wasted time that a questionable contruct can bring to a lab) there is no reason why any cloning lab should be without this bit of software. Surprisingly enough, it is also available as a networked version, one of the few that is - however, Textco has taken a somewhat contrary approach in pricing - they base their pricing not only on the number of copies you buy (the more, the cheaper, as usual), but also on the number of Macs that can be served (the larger the number, the more expensive). There is a logic to it, but it is not the usual logic 8). And, unlike the DNASTAR network license, GCK uses Keyserver, which allows you find out how many keys are checked out, who has them and for how long. For a largish institution, this allows (evil word follows) recharging for use, if anyone cares. Later today, I'll upload the demo mentioned within to the Indiana (if there's still room) and U Houston archives. You can also get it direct from our anonymous FTP server - FTP to salk-sc2.sdsc.edu, login as anonymous, any password, get the 890K(!), binhexed, self extracting archive named GCK_DEMO.SEA_HQX (it's a VAX, he said apologetically) in the directory [anonymous.mac]. Cheers Harry Harry Mangalam Vox:(619) 453-4100, x250 Dept of Biocomputing Fax:(619) 552-1546 The Salk Institute 1' mangalam@salk-sc2.sdsc.edu 10010 N Torrey Pines Rd 2' hjm@salk-sgi.sdsc.edu La Jolla CA 92037 3' mangalam@salk.bitnet From owner-software@net.bio.net Mon Jan 04 22:00:00 1993 Path: biosci!snd01.pcr.co.uk!PARSONS_A From: PARSONS_A@snd01.pcr.co.uk Newsgroups: bionet.software Subject: GCG synchronisation problem Message-ID: <1993Jan5.093129.20898@gserv1.dl.ac.uk> Date: 5 Jan 93 09:32:58 GMT Sender: kristoff@net.bio.net Distribution: bionet Lines: 167 Happy New Year Neteers, I have had no joy out of GCG on this one - anyone had anyexperience of this particular error whilst using GCG and (a) what it might mean and (b) how it affects the quality of the results that I get? Thanks in Advance, Tony Parsons <> Details..... I was trying to search PIR using FASTA and got the following error :- *** ERROR in SQNext. Sequence reading is out of synchronization. Any ideas what is going on? Log file follows... Tony Parsons - Pfizer central Research (parsons_a@snd01.pcr.co.uk) ------------------------- log of session ----------------------------------- WELCOME TO GCG Sequence Analysis Software Package Version 7.1, March, 1992 (c)1982, 1983, 1984, 1985, 1986, 1987, 1989, 1991, 1992 Genetics Computer Group, Inc. All rights reserved. Published research assisted by this software should cite: Devereux, Haeberli and Smithies (1984). A Comprehensive Set of Sequence Analysis Programs for the VAX. Nucleic Acids Research 12(1); 387-395 Databases available: GenBank Release 73.0 (9/92) PIR-Protein Release 34.0 (10/92) EMBL (Modified) Release 32.0 (9/92) SwissProt Release 23.0 ( 8/92) PIR-Nucleic Release 36.0 (3/90) Vecbase Release 3.0 ( 8/87) PROSITE Release 9.2 (9/92) REBASE restriction enzymes 9210 (10/92) MIPSX 34.0 (9/92) Help is available with the command $ GenHelp PROBLEMS WITH NEW SOFTWARE or DATABASES email: PARSONS_A tel - 6871 Running Fasta using : ... /INfile=ul08.gcg /BEGin=1 /END=750 /INfile2=p:* /WORd=2 /LIStsize=40 /OUTfile=Ul08.Fasta /Default *** ERROR in SQNext. Sequence reading is out of synchronization. (Peptide) FASTA of: Ul08.Gcg from: 1 to: 750 December 8, 1992 15:09 TO: p:* Sequences: 223 Symbols: 30,658 Word Size: 2 Score Init1 Initn < 2 0 0: 4 0 0: 6 0 0: 8 0 0: 10 0 0: 12 0 0: 14 0 0: 16 1 1:= 18 4 4:== 20 12 12:====== 22 26 26:============= 24 21 21:=========== 26 35 35:================== 28 30 30:=============== 30 10 10:===== 32 44 43:====================== 34 7 6:===- 36 4 2:=- 38 10 6:===-- 40 7 3:==-- 42 4 5:==+ 44 2 2:= 46 1 1:= 48 5 6:=== 50 0 2:+ 52 0 1:+ 54 0 1:+ 56 0 1:+ 58 0 0: 60 0 1:+ 62 0 1:+ 64 0 0: 66 0 1:+ 68 0 1:+ 70 0 0: 72 0 1:+ 74 0 0: 76 0 0: 78 0 0: 80 0 0: > 80 0 0: mean initn score: 23.8 (2.83) mean init1 score: 23.8 (2.83) The best scores are: init1 initn opt Pir1:Cbms Cytochrome b - Mouse mitochondrion (SGC1) 39 72 40 Pir1:Cbrt Cytochrome b - Rat mitochondrion (SGC1) 39 68 40 Pir1:Cbqfr Cytochrome b - Rhodospirillum rubrum 39 66 41 Pir1:Cbhu Cytochrome b - Human mitochondrion (SGC1) 37 62 39 Pir1:Wmrz17 Cytochrome b6-f complex 17K protein - Rice c... 44 59 66 Pir1:O4hud1 Debrisoquine 4-hydroxylase (EC 1.14.14.-) cy... 37 55 37 Pir1:Cbbo Cytochrome b - Bovine mitochondrion (SGC1) 39 54 40 Pir1:Wmlv17 Cytochrome b6-f complex 17K protein - Liverw... 37 52 57 Pir1:Cbxl Cytochrome b - African clawed frog mitochondri... 38 49 42 Pir1:Ccqfct Cytochrome c' - Rhodocyclus tenuis 35 49 35 Pir1:Cbboc6 Cytochrome b-c1 complex, 6.4K protein - Bovine 36 48 41 Pir1:Cblv55 Cytochrome b559 component E - Liverwort (Mar... 47 47 50 Pir1:Cbobe Cytochrome b - Evening primrose mitochondrion 47 47 61 Pir1:Cbnt55 Cytochrome b559 component E - Common tobacco... 47 47 50 Pir1:Cbrz55 Cytochrome b559 component E - Rice chloroplast 47 47 50 Pir1:Cbvf Cytochrome b - Fava bean mitochondrion 47 47 61 Pir1:Wmnt17 Cytochrome b6-f complex 17K protein - Common... 45 45 67 Pir1:Ccrfpp Cytochrome c' - Rhodobacter capsulatus 33 43 33 Pir1:Cclm Cytochrome c - Pacific lamprey 43 43 46 Pir1:Cbutb Cytochrome b - Trypanosoma brucei mitochondri... 32 42 42 Pir1:Rdbyun Ubiquinol--cytochrome-c reductase (EC 1.10.2... 42 42 42 Pir1:Wmsp17 Cytochrome b6-f complex 17K protein - Spinac... 41 41 67 Pir1:Cbyb55 Cytochrome b559 component psbE - Synechocyst... 41 41 48 Pir1:O4psz Denitrification system component nirT - Pseud... 41 41 51 Pir1:Ccps5a Cytochrome c551 - Pseudomonas aeruginosa 40 40 41 Pir1:Cbrz Cytochrome b - Rice mitochondrion 39 39 41 Pir1:Cbzm Cytochrome b - Maize mitochondrion 39 39 41 Pir1:Ccps5f Cytochrome c551 - Pseudomonas fluorescens bi... 38 38 49 Pir1:Cbbo5 Cytochrome b5 - Bovine 38 38 52 Pir1:Ccps5d Cytochrome c551 - Pseudomonas sp. 38 38 49 Pir1:Ccbf6 Cytochrome c6 - Yellow-green alga (Bumillerio... 37 37 39 Pir1:Ccps5s Cytochrome c551 - Pseudomonas stutzeri (stra... 37 37 52 Pir1:Ccps5b Cytochrome c551 precursor - Pseudomonas stut... 37 37 47 Pir1:Wmkl17 Cytochrome b6-f complex 17K protein - Chlore... 36 36 38 Pir1:Cctw5t Cytochrome c552 - Thermus aquaticus 36 36 36 Pir1:Cblv6 Cytochrome b6 - Liverwort (Marchantia polymor... 34 34 36 Pir1:Ccck Cytochrome c - Yeast (Issatchenkia orientalis) 33 33 36 Pir1:Ccus Cytochrome c - Smut fungus (Ustilago sphaerogena) 33 33 34 Pir1:Cceg Cytochrome c - Euglena gracilis 33 33 41 Pir1:Cchq Cytochrome c - Yeast (Hansenula anomala) 33 33 37 Aligning... CPU time: 0:00:19 Output File: Ul08.Fasta PARSONS_A job terminated at 8-DEC-1992 15:13:16.77 Accounting information: Buffered I/O count: 457 Peak working set size: 12603 Direct I/O count: 1919 Peak page file size: 21702 Page faults: 15293 Mounted volumes: 0 Charged CPU time: 0 00:00:29.73 Elapsed time: 0 00:05:30.12 From owner-software@net.bio.net Mon Jan 04 22:00:00 1993 Path: biosci!bcm!cs.utexas.edu!milano!cactus.org!wixer!pacoid From: pacoid@wixer.cactus.org (Paco Xander Nathan) Newsgroups: bionet.software Subject: Re: LabView hardware Message-ID: <1993Jan5.014505.10138@wixer.cactus.org> Date: 5 Jan 93 01:45:05 GMT References: <1993Jan02.165323.24056@foxmail.gfc.edu> Distribution: bionet Organization: FringeWare Inc., +1 512 477 1366 Lines: 13 In article <1993Jan02.165323.24056@foxmail.gfc.edu> dpowers@foxmail.gfc.edu (Donald R. Powers) writes: >I have LabView II and would like to set it up to monitor several >instruments on my Mac IIci. Can anyone suggest a reasonably priced A/D >device I can use for an interface? Most of what I have involves a >simple voltage inpute. However, it is possible I might need a >differential input at some point. Thanks! Check with Radient in SF - 415 296 8040.. I wrote a review on them for the last issue of Mondo 2000 - they have a CNX box that'll take 8 inputs into a Mac(A or D) and the whole system sells for around $350 which is a lot less than a LabView II .. Tell 'em I sent you :-) Paco Xander Nathan From owner-software@net.bio.net Mon Jan 04 22:00:00 1993 Path: biosci!agate!usenet.ins.cwru.edu!magnus.acs.ohio-state.edu!zaphod.mps.ohio-state.edu!wupost!cs.utexas.edu!uunet!newsstand.cit.cornell.edu!vax5.cit.cornell.edu!samx From: samx@vax5.cit.cornell.edu Newsgroups: bionet.software Subject: Mac plasmid programs? Message-ID: <1993Jan5.114333.16686@vax5.cit.cornell.edu> Date: 5 Jan 93 16:43:33 GMT Distribution: bionet Organization: Cornell University Lines: 6 Is anyone aware of Mac programs for keeping records of plasmid constructs? Such program would hopefully also draw graphic maps of the plasmids, and keep sequence information. Thanks! -Scott Monsma Boyce Thompson Institute 607/254-1369 From owner-software@net.bio.net Mon Jan 04 22:00:00 1993 Path: biosci!daresbury!daresbury!news From: PARSONS_A@snd01.pcr.co.uk Newsgroups: bionet.software Subject: RE: GCG Synchronisation Problem Message-ID: <1993Jan5.145442.6246@gserv1.dl.ac.uk> Date: 5 Jan 93 14:53:24 GMT Sender: list-admin@daresbury.ac.uk Distribution: bionet Lines: 23 Original-To: BIO-SOFT Many thanks to all those who helped me out of a jam with a GCG synchronisation problem in particular those at the foot of this message - makes you wonder what we a re paying GCG maintenance for sometimes. Thanks again! Rick Westerman System Manager of the AIDS Center Laboratory westerm@aclcb.purdue.edu for Computational Biochemistry (ACLCB), BCHM Phone: (317) 494-0505 bldg., Purdue University, W. Lafayette, IN 47907 FAX: (317) 494-7897 Cary O'Donnell ***************************************************************************** AFRC Computing Division JANET : ODONNELL@UK.AC.AFRC.ARCB West Common INTERNET: ODONNELL@ARCB.AFRC.AC.UK Harpenden Long/Lat: 00d 21m 45s West 51d 48m 30s North Herts AL5 2JE Tel: (+44) 582 762271 xt 229 Fax: (+44) 582 761710 U.K. (AFRC = Agricultural & Food Research Council) ----------------------------------------------------------------------------- | Dr. Reinhard Doelz | RFC doelz@urz.unibas.ch | | Biocomputing | DECNET 20579::48130::doelz | |Biozentrum der Universitaet | X25 022846211142036::doelz | From owner-software@net.bio.net Mon Jan 04 22:00:00 1993 Path: biosci!DARWIN.SFBR.ORG!bdyke From: bdyke@DARWIN.SFBR.ORG (Bennett Dyke) Newsgroups: bionet.software Subject: Re: Ethernet card recommendations for MacII Message-ID: Date: 5 Jan 93 14:12:20 GMT References: <9301050311.AA21058@net.bio.net> Sender: daemon@net.bio.net Distribution: bionet Lines: 34 We have made it a practice to use external SCSI Ethernet boxes, which are available from several vendors at about $275, with all Macs without multiple internal slots. Communications are said to be a bit slower than with an internal card, but the single slot of MacIIsi's is saved for other purposes, and we have maximum flexibility to switch and upgrade processors. +----------------------------------------------------------------------------+ | Bennett Dyke | | Department of Genetics Internet: bdyke@darwin.sfbr.org | | Southwest Foundation Phone: (210) 674-1410 Ext 281 | | P.O. Box 28147 Fax: (210) 670-3317 | | San Antonio, TX 78228, USA | +----------------------------------------------------------------------------+ On 5 Jan 1993, Cheung C. Yue wrote: > > I am daydreaming again, hoping to put the Mac IIsi in my laboratory > on the net. Not being particularly familiar with Mac's, I would > like to solicit recommendations for brands of ethernet cards. Also > I would welcome suggestions of appropriate software (I suppose NCSA > Telnet is probably the best). Finally I wonder if it is possible to > allow remote control of the Mac over ethernet. Thanks in advance for > all your input. > > C Cho Yue > ccy@po.cwru.edu > -- > From owner-software@net.bio.net Mon Jan 04 22:00:00 1993 Path: biosci!daresbury!bioftp.unibas.ch!biox!doelz From: doelz@comp.bioz.unibas.ch (Reinhard Doelz) Newsgroups: bionet.software Subject: Re: GCG synchronisation problem Message-ID: Date: 5 Jan 93 10:22:43 GMT References: <1993Jan5.093228.21154@gserv1.dl.ac.uk> Distribution: bionet Organization: EMBnet Switzerland [Basel] Lines: 135 PARSONS_A@snd01.pcr.co.uk writes: >affects the quality of the results that I get? This Problem is Lethal. >I was trying to search PIR using FASTA and got the following error :- > *** ERROR in SQNext. Sequence reading is out of synchronization. >Any ideas what is going on? You need to rerun dbindex and the problem should be fixed. Regards Reinhard > *** ERROR in SQNext. Sequence reading is out of synchronization. > >(Peptide) FASTA of: Ul08.Gcg from: 1 to: 750 December 8, 1992 15:09 > TO: p:* Sequences: 223 Symbols: 30,658 Word Size: 2 >Score Init1 Initn >< 2 0 0: > 4 0 0: > 6 0 0: > 8 0 0: > 10 0 0: > 12 0 0: > 14 0 0: > 16 1 1:= > 18 4 4:== > 20 12 12:====== > 22 26 26:============= > 24 21 21:=========== > 26 35 35:================== > 28 30 30:=============== > 30 10 10:===== > 32 44 43:====================== > 34 7 6:===- > 36 4 2:=- > 38 10 6:===-- > 40 7 3:==-- > 42 4 5:==+ > 44 2 2:= > 46 1 1:= > 48 5 6:=== > 50 0 2:+ > 52 0 1:+ > 54 0 1:+ > 56 0 1:+ > 58 0 0: > 60 0 1:+ > 62 0 1:+ > 64 0 0: > 66 0 1:+ > 68 0 1:+ > 70 0 0: > 72 0 1:+ > 74 0 0: > 76 0 0: > 78 0 0: > 80 0 0: >> 80 0 0: > mean initn score: 23.8 (2.83) > mean init1 score: 23.8 (2.83) >The best scores are: init1 initn opt >Pir1:Cbms Cytochrome b - Mouse mitochondrion (SGC1) 39 72 40 >Pir1:Cbrt Cytochrome b - Rat mitochondrion (SGC1) 39 68 40 >Pir1:Cbqfr Cytochrome b - Rhodospirillum rubrum 39 66 41 >Pir1:Cbhu Cytochrome b - Human mitochondrion (SGC1) 37 62 39 >Pir1:Wmrz17 Cytochrome b6-f complex 17K protein - Rice c... 44 59 66 >Pir1:O4hud1 Debrisoquine 4-hydroxylase (EC 1.14.14.-) cy... 37 55 37 >Pir1:Cbbo Cytochrome b - Bovine mitochondrion (SGC1) 39 54 40 >Pir1:Wmlv17 Cytochrome b6-f complex 17K protein - Liverw... 37 52 57 >Pir1:Cbxl Cytochrome b - African clawed frog mitochondri... 38 49 42 >Pir1:Ccqfct Cytochrome c' - Rhodocyclus tenuis 35 49 35 >Pir1:Cbboc6 Cytochrome b-c1 complex, 6.4K protein - Bovine 36 48 41 >Pir1:Cblv55 Cytochrome b559 component E - Liverwort (Mar... 47 47 50 >Pir1:Cbobe Cytochrome b - Evening primrose mitochondrion 47 47 61 >Pir1:Cbnt55 Cytochrome b559 component E - Common tobacco... 47 47 50 >Pir1:Cbrz55 Cytochrome b559 component E - Rice chloroplast 47 47 50 >Pir1:Cbvf Cytochrome b - Fava bean mitochondrion 47 47 61 >Pir1:Wmnt17 Cytochrome b6-f complex 17K protein - Common... 45 45 67 >Pir1:Ccrfpp Cytochrome c' - Rhodobacter capsulatus 33 43 33 >Pir1:Cclm Cytochrome c - Pacific lamprey 43 43 46 >Pir1:Cbutb Cytochrome b - Trypanosoma brucei mitochondri... 32 42 42 >Pir1:Rdbyun Ubiquinol--cytochrome-c reductase (EC 1.10.2... 42 42 42 >Pir1:Wmsp17 Cytochrome b6-f complex 17K protein - Spinac... 41 41 67 >Pir1:Cbyb55 Cytochrome b559 component psbE - Synechocyst... 41 41 48 >Pir1:O4psz Denitrification system component nirT - Pseud... 41 41 51 >Pir1:Ccps5a Cytochrome c551 - Pseudomonas aeruginosa 40 40 41 >Pir1:Cbrz Cytochrome b - Rice mitochondrion 39 39 41 >Pir1:Cbzm Cytochrome b - Maize mitochondrion 39 39 41 >Pir1:Ccps5f Cytochrome c551 - Pseudomonas fluorescens bi... 38 38 49 >Pir1:Cbbo5 Cytochrome b5 - Bovine 38 38 52 >Pir1:Ccps5d Cytochrome c551 - Pseudomonas sp. 38 38 49 >Pir1:Ccbf6 Cytochrome c6 - Yellow-green alga (Bumillerio... 37 37 39 >Pir1:Ccps5s Cytochrome c551 - Pseudomonas stutzeri (stra... 37 37 52 >Pir1:Ccps5b Cytochrome c551 precursor - Pseudomonas stut... 37 37 47 >Pir1:Wmkl17 Cytochrome b6-f complex 17K protein - Chlore... 36 36 38 >Pir1:Cctw5t Cytochrome c552 - Thermus aquaticus 36 36 36 >Pir1:Cblv6 Cytochrome b6 - Liverwort (Marchantia polymor... 34 34 36 >Pir1:Ccck Cytochrome c - Yeast (Issatchenkia orientalis) 33 33 36 >Pir1:Ccus Cytochrome c - Smut fungus (Ustilago sphaerogena) 33 33 34 >Pir1:Cceg Cytochrome c - Euglena gracilis 33 33 41 >Pir1:Cchq Cytochrome c - Yeast (Hansenula anomala) 33 33 37 >Aligning... > CPU time: 0:00:19 > Output File: Ul08.Fasta > PARSONS_A job terminated at 8-DEC-1992 15:13:16.77 > Accounting information: > Buffered I/O count: 457 Peak working set size: 12603 > Direct I/O count: 1919 Peak page file size: 21702 > Page faults: 15293 Mounted volumes: 0 > Charged CPU time: 0 00:00:29.73 Elapsed time: 0 00:05:30.12 -- +----------------------------------+-------------------------------------+ | Dr. Reinhard Doelz | RFC doelz@urz.unibas.ch | | Biocomputing | DECNET 20579::48130::doelz | |Biozentrum der Universitaet | X25 022846211142036::doelz | From owner-software@net.bio.net Mon Jan 04 22:00:00 1993 Path: biosci!agate!ames!haven.umd.edu!uunet!news.univie.ac.at!chx400!urz.unibas.ch!bioftp.unibas.ch!comp.bioz.unibas.ch!doelz From: doelz@comp.bioz.unibas.ch (Reinhard Doelz) Newsgroups: bionet.software Subject: RE: GCG Synchronisation Problem Message-ID: <1993Jan5.174756.27917@comp.bioz.unibas.ch> Date: 5 Jan 93 17:47:56 GMT References: <1993Jan5.145442.6246@gserv1.dl.ac.uk> Sender: usenet@comp.bioz.unibas.ch (NEWS transaction account) Reply-To: doelz@urz.unibas.ch Distribution: bionet Organization: EMBnet Switzerland [BASEL] Lines: 38 Nntp-Posting-Host: biox.embnet.unibas.ch In article <1993Jan5.145442.6246@gserv1.dl.ac.uk>, PARSONS_A@snd01.pcr.co.uk writes: ... |> message - makes you wonder what we a re paying GCG maintenance for |> sometimes. |> I wouldn't be that harsh. Guess where the knowledge comes from first - I found the GCG guys to be quite responsive, as compared to other software companies. I certainly would appreciate to get all maintenance for nothing :-) but I am afraid that we would wait very long to get the next version this way. You certainly can flame anyone we ought to pay money but the example chosen isn't the prototype suited for blaming. By the way: did you get the databases from GCG or did you get them else- where, and how much did you pay for getting the databases? If you consider the current situation of the database vendors, all people expect that the data are available for free on FTP, and certainly formatted in all available and possible formats. That is apparently true for some databases, but you get what you paid for. I don't want to pay more either (in particular, the database you had problems with is not the cheapest on the block if you purchase its CD-ROM), but the current funding model for databases is that the public state money funds the databases with really big money, and the users get it for negotiable money. If the current growth continues, I am pessimistic enough to predict more of these problems as you had in the future. Regards Reinhard -- +----------------------------------+-------------------------------------+ | Dr. Reinhard Doelz | RFC doelz@urz.unibas.ch | | Biocomputing | DECNET 20579::48130::doelz | |Biozentrum der Universitaet | X25 022846211142036::doelz | | Klingelbergstrasse 70 | FAX x41 61 261- 6760 or 267- 2078 | CH 4056 Basel | TEL x41 61 267- 2076 or 2247 | +------------- bioftp.unibas.ch is the SWISS EMBnet node ----------------+ ----------------------------------------- From owner-software@net.bio.net Mon Jan 04 22:00:00 1993 Path: biosci!MED.PITT.EDU!bsh From: bsh@MED.PITT.EDU (Basavaraju Shankarappa) Newsgroups: bionet.software Subject: Re: software for silent mutagenesis Message-ID: <9301052220.AA09065@miranda.med.pitt.edu> Date: 5 Jan 93 22:20:49 GMT References: <9212302202.AA15166@net.bio.net> Sender: daemon@net.bio.net Distribution: bionet Lines: 34 > In article <1992Dec30.185104.9506@alw.nih.gov> usdin@helix.nih.gov (Ted Usdin) writes: > >Weiner and Scheraga (CABIOS, vol 5 pp191-198, 1989) described a Macintosh > >program (Gene.Design.?) to assist in introducing restriction sites into DNA without changing the amino > >acid sequence. Does anyone know where I can get a copy of this, or a similar > >program that runs on a Macintosh? > > There is a similar program which runs on a PC called OligoMutantMaker. > It is available by anonymous ftp from: > Host fly.bio.indiana.edu > > Location: /molbio/ibmpc > FILE -rw-r--r-- 8540 May 14 1991 oligo.doc > FILE -rw-r--r-- 231882 May 14 1991 oligo.uue > Dan Jacobson > danj@welchgate.welch.jhu.edu I would like to add that we have also developed a PC compatible program called SILMUT for identifying regions for the introduction of restriction enzyme sites by silent mutagenesis. Although we have used the same principle as detailed in the above two programs our approach was highly simplified. This programs just tells you what restriction enzyme/s can be introduced by silent mutagenesis in a specific sequence of amino or nucleic acid. This program is most useful for those who are contemplating introduction of RE sites to generate casette vectors or for swapping specific fragments of a gene in a construct. The program is also available on fly.bio.indiana.edu in the directory molbio/ibmpc as two files: Silmut.xxx. The work has been published in Biotechinques 12: 882-884 (1992). The program sets include source codes for the program which has been internally documented. The programs work in PC and unix machines but if anyone can make it work on a Mac, we would welcome that. Raj Shankarappa bsh@med.pitt.edu From owner-software@net.bio.net Tue Jan 05 22:00:00 1993 Path: biosci!uwm.edu!cs.utexas.edu!usc!wupost!darwin.sura.net!welchgate.welch.jhu.edu!danj From: danj@welchgate.welch.jhu.edu (Dan Jacobson) Newsgroups: bionet.software Subject: Re: Plasmid draw program for IBM Message-ID: <1993Jan6.151812.23835@welchgate.welch.jhu.edu> Date: 6 Jan 93 15:18:12 GMT References: <9301060448.AA14948@net.bio.net> Distribution: bionet Organization: Johns Hopkins Univ. Welch Medical Library Lines: 32 In article <9301060448.AA14948@net.bio.net> preissj@CLVAX1.CL.MSU.EDU ("J Preiss--Seq Anal") writes: >Plasmid.drw > >I have a request to post to the bio software net. I want a >program to draw plasmids for IBM/DOS based computers. I have >compiled a wish list of what I want in such a program. If anyone >knows of any program that comes close to my desires, I would >appreciate hearing about it. >(wish list deleted) There are a few programs which draw plasmids for IBM/DOS. I don't think that they meet all of your specs but you can probably achieve what you'd like by the combination of one of these programs and some utility programs for the PC. 1) Plasmid - can be retrieved by anonymous ftp (or gopher) from ftp.bio.indiana.edu in the molbio/ibmpc directory. 2) Plasmidg - which can be retrieved by anonymous ftp from ftp.bchs.uh.edu in the /pub/gene-server/dos directory 3) Easyclon - which can be retrieved by anonymous ftp from ftp.bchs.uh.edu in the /pub/gene-server/dos directory These can also be retrieved by anonymous ftp or gopher from many of the EMBnet nodes. Best of luck, Dan Jacobson danj@welchgate.welch.jhu.edu From owner-software@net.bio.net Tue Jan 05 22:00:00 1993 Path: biosci!CLVAX1.CL.MSU.EDU!preissj From: preissj@CLVAX1.CL.MSU.EDU ("J Preiss--Seq Anal") Newsgroups: bionet.software Subject: Small scale Auto Sequence entry system Message-ID: <9301060448.AA14938@net.bio.net> Date: 6 Jan 93 04:39:00 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 61 sequence.pgm I am looking for a system for automating entry of sequence data into the computer in our lab. We are a midsized (about 12 of us) biochemistry lab who sequence 2-10 kb per year to verify clones and site directed mutants. We use Sanger di-deoxy sequencing with Sequenase and 35-S-dATP on acrylamide gels and X-ray film. We use an IBM clone (386-25) and GCG on a VAX for sequence analysis. Currently we read sequence films on a light box, record data on scratch paper, and type it into the computer for analysis. This is tedious and error prone. The lab PI recently asked me to recommend a system to enter sequence data into the computer automatically. He wants to spend under $1,000- and wants to stick to the traditional autorad technology that he feels comfortable with. I have a vision of a system in mind, but have no idea if anything like it exists. I envision a small scanner device to enter data into the computer and software which would allow you to see the autorad on screen. I would like to see a visual picture of the computers choices for reading the sequence which could be edited on screen by the user. Data should be in a format which could be easily saved as an ASCII file of sequence or directly shipped down to the vax for GCG to analyze. Ideally, I would like some versatility in the system. If I had a scanner on hand, I would like to be able to use it to enter sequence from old publications or faxed data directly from text on paper. I would like the option to digitize pictures of agarose gels into the computer to use graphics programs to add pointers and text to the gel picture for publication quality figures. This system would require some hardware and some software, of which we have neither. The last system I used was purchased around 1986 and I no longer have access to it or any of it's components. Any suggestions for hardware and/or software for a system like this would be greatly appreciated. In leu of my dream system, I would also appreciate any recommendations from people using small scale automated sequence data entry systems. Any warnings or advice will be greatly appreciated. A summary will be posted back to the net if I get anything interesting and helpful back. If I get nothing I will try posting to autoseqs, but I don't subscribe to that group. Thanks Dr. Leonard N. Bloksberg PreissJ@clvax1.cl.msu.edu Dept. of Biochemistry Michigan State University "Life is weird" From owner-software@net.bio.net Tue Jan 05 22:00:00 1993 Path: biosci!CLVAX1.CL.MSU.EDU!preissj From: preissj@CLVAX1.CL.MSU.EDU ("J Preiss--Seq Anal") Newsgroups: bionet.software Subject: Plasmid draw program for IBM Message-ID: <9301060448.AA14948@net.bio.net> Date: 6 Jan 93 04:41:00 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 105 Plasmid.drw I have a request to post to the bio software net. I want a program to draw plasmids for IBM/DOS based computers. I have compiled a wish list of what I want in such a program. If anyone knows of any program that comes close to my desires, I would appreciate hearing about it. Also, if any programmers monitor this net, I would like to see such a program written. I have heard of several programs for the Mac which are supposed to come close, but none that really does the job. I am also aware of Clone, plus Enhance from Scientific & Educational Software for IBM. It is a very nice program, from what I've heard, but a little out of my price range at $650- last I checked. I would invite others to comment on my wish list, add to it, direct me to their favorite program, or tell me that I am a fool for asking for so much for so little. With any luck, I will either find what I'm looking for, or inspire some enterprising programmer to write it. Things I want in a plasmid drawing program for IBM computers. 1. Low cost, around $250- Based on informal surveys of my colleagues, my estimates for how many copies you could sell, worldwide, of a good program are as follows: $250- 10,000 $500- 1,000 $1000- 100 Ok, very informal. 2. Ability to take in data and output data in formats that are easily compatible with other systems and programs. Most computer users have more than one program loaded on their hard drive, and we each have our favorite for doing certain functions. My favorite programs are those that allow me to do what that program does best and transfer to another program for other functions. An example, I entered my sequence on a digitizer with Microgene, edited it with MS Word, performed sequence analysis on GCG, prepared it for publication on Aldus Pagemaker and prepared slides to present it at meetings with Powerpoint. 3. Ability to take input as either sequence (in ASCII files) or as point info (eg, this site here, that gene there, on a plasmid this big). 4. Ability to produce publication quality plasmid and clone drawings. Printed graphics must be clear and sharp and comparable in print quality with those drawn by graphic artists and published in existing literature. 5. Ability to accommodate new genetic elements and features. Different scientists want to highlight different things in their published plasmid diagrams. Some elements are point sites, some cover a region. Some are directional, some not. Some elements are embedded within other other features. Others are fragments eg, the 5' region of a gene, and may be linked to another fragment, eg the 3' region of another gene. Some features are too detailed to be shown directly in the diagram and need to be blown up, eg, a multiple cloning site. 6. Modifiable or editable final picture. I sometimes want to modify things to highlight features I am discussing in the text or minimize things like mundane vector functions. Can I have the final say in how the figure looks please? 7. Many options for shading and fill patterns in black and white laser prints. Most of the scientific community publishes in black and white. Color options are nice for seminars, but we need black and white to publish. 8. Ability to combine several plasmid and clone drawings on a single page with other graphics. This may really be part of my request to have file formats that can be accessed in many programs. If I could paste several clone diagrams into a file in another program and draw arrows and text between to make flow diagrams showing the history of construction of a plasmid, that would be perfect. 9. Identify all known restriction enzyme sites and names. I would like the program to identify, and include in the final diagram, all sites that I ask it to. An extension of this is to have it include all unique cutting enzymes, or all enzymes that cut less than 3 times or more than 10 times, or what ever I choose that day. A useful, but not necessary, side function here would be the ability to provide a list of restriction fragments resulting from any single or multiple digest and sizes of fragments in order of size. 10. Simple cloning functions to allow creation of new plasmids from pieces of existing figures. Nothing fancy is required here, but it should be able to cut at specified restriction enzyme sites, modify ends with typical enzymes (eg, Klenow, T4-Pol...) and ligate, while maintaining the correct resultant sequence. Thanks Dr. Leonard N. Bloksberg PreissJ@clvax1.cl.msu.edu Dept. of Biochemistry Michigan State University "Life is weird" From owner-software@net.bio.net Tue Jan 05 22:00:00 1993 Path: biosci!uwm.edu!cs.utexas.edu!qt.cs.utexas.edu!yale.edu!ira.uka.de!rz.uni-karlsruhe.de!stepsun.uni-kl.de!sun.rhrk.uni-kl.de!andrick From: andrick@rhrk.uni-kl.de (Ulf Andrick [Biologie]) Newsgroups: comp.ai,comp.ai.neural-nets,sci.cognitive,comp.theory.cell-automata,bionet.neuroscience,bionet.molbio.evolution,bionet.software Subject: Re: Biologically Plausible Dynamic Artificial Neural Networks Message-ID: <1993Jan6.224107.27144@rhrk.uni-kl.de> Date: 6 Jan 93 22:41:07 GMT References: <726213237snz@manor.demon.co.uk> Organization: University of Kaiserslautern, Germany Lines: 97 Xref: biosci comp.ai:1398 comp.ai.neural-nets:1290 sci.cognitive:698 comp.theory.cell-automata:206 bionet.neuroscience:876 bionet.molbio.evolution:720 bionet.software:3889 X-Newsreader: Tin 1.1 PL4 paulf@manor.demon.co.uk (Paul Fawcett) writes: : : Biologically Plausible Dynamic Artificial Neural Networks. : ----------------------------------------------------------- Biologically Plausible Artificial Neural Network sounds to me a bit like an oxymoron. I tend to consider any `Artificial Neural Networks' as not biologically plausible. : : A *Dynamic Artificial Neural Network* (DANN) [1] : possesses processing elements that are created and/or : annihilated, either in real time or as some part of a : development phase [2]. : : Of particular interest is the possibility of : constructing *biologically plausible* DANN's that : models developmental neurobiological strategies for : establishing and modifying processing elements and their : connections. : : Work with cellular automata in modeling cell genesis and : cell pattern formation could be applicable to the design : of DANN topologies. Likewise, biological features that are : determined by genetic or evolutionary factors [3] would : also have a role to play. : Cellular automata? One might feel reminded of the Game of Life, where the cells change their state of being alive or dead according to the states of the neighbouring cells. If something like that is suggested, I feel somewhat skeptical if that is of use. I thought that the main issue of neurogenesis was the formation of synapses. That means, e. g., how do the neuronal processes find their way to their targets through a nascent entanglement of cells (not necessarily neurones, but also glia)? How is synaptic coupling changed in response to some stimulus? So, are your `cells' neurones, processes, synapses, or what? But perhaps you meant a concept of a cellular automaton so general that one might consider the use of the word as nearly meaningless. At least, the point seems to be a little mute to a person with some half-knowledge about cellular automata and neurogenesis. : Putting all this together with a view to constructing a : working DANN, possessing cognitive/behavioral attributes of : a biological system is a tall order; the modeling of nervous : systems in simple organisms may be the best approach when : dealing with a problem of such complexity [4]. There seems to be enough work to be done to simulate `static' Neural Networks in simple organisms. An interesting question is, e. g., what role the complex electrophysiological properties of the single neuron play for the behaviour of the whole network? What are the effects of neuromodulators? And these questions may also be of relevance in neural development. Artificial Neural Networks do hardly play any role in that kind of research, IMVHO, unless they have sophisticated neuronal properties, which most information scientists never dream of, but I wouldn't call such a model Artificial Network in order to distinguish it from much more primitive devices, which might be appropriate to describe spin glasses or whatever. As you can see, my view is that the Artificial Neural Network research is an engineering discipline detached from natural paradigmata, just as the whole AI. (As this is also crossposted to AI groups, I expect to have to put on my flame-proof suit.) : : Any comments, opinions or references in respect of the : above assertions would be most welcome. : : : Many thanks : : Paul Fawcett. : : University of Westminster : : : References. [deleted] -- Ulf R. Andrick andrick@rhrk.uni-kl.de FB Biologie - Tierphysiologie Universitaet Was du nicht selber weiszt, D-W 6750 Kaiserslautern das muszt du dir erklaeren (Tegtmeier) -- Ulf R. Andrick andrick@rhrk.uni-kl.de FB Biologie - Tierphysiologie Universitaet Was du nicht selber weiszt, D-W 6750 Kaiserslautern das muszt du dir erklaeren (Tegtmeier) From owner-software@net.bio.net Wed Jan 06 22:00:00 1993 Path: biosci!uwm.edu!caen!kuhub.cc.ukans.edu!husc-news.harvard.edu!husc.harvard.edu!robison1 From: robison1@husc10.harvard.edu (Keith Robison) Newsgroups: bionet.software Subject: Experiences with Entrez under UNIX? Message-ID: Date: 7 Jan 93 17:11:31 GMT Lines: 16 Nntp-Posting-Host: husc10.harvard.edu Does anyone out there have NCBI's Entrez running under UNIX? What machine are you using, and how much trouble was it to install and how reliable is it? I had heard rumors of it being a difficult beast to install and maintain, but that was 6 months ago so maybe if they had any basis they are now false. Thanks. Keith Robison Harvard University Department of Cellular & Developmental Biology Department of Genetics / HHMI robison@biosun.harvard.edu From owner-software@net.bio.net Wed Jan 06 22:00:00 1993 Path: biosci!agate!spool.mu.edu!yale.edu!ira.uka.de!chx400!urz.unibas.ch!bioftp.unibas.ch!comp.bioz.unibas.ch!doelz From: doelz@comp.bioz.unibas.ch (Reinhard Doelz) Newsgroups: bionet.molbio.genbank,bionet.software Subject: This is a question to bionet.software, commercial issue. Message-ID: <1993Jan7.072233.9124@comp.bioz.unibas.ch> Date: 7 Jan 93 07:22:33 GMT Sender: usenet@comp.bioz.unibas.ch (NEWS transaction account) Reply-To: doelz@urz.unibas.ch Organization: EMBnet Switzerland [BASEL] Lines: 29 Xref: biosci bionet.molbio.genbank:1158 bionet.software:3892 Nntp-Posting-Host: biox.embnet.unibas.ch With respect to the discussion going on about Maspar's posting on the nicety of the BLAZE program, I would like to ask whether companies like GCG woudln't have the same rights? They've been public domain for a bit longer than BLAZE, and still each time I inquired about a bionet.software.gcg newsgroup I was told by Dake K. that this is not an issue (sorry that I don't quote the mail here, the last was already some time back and I deleted them.) Despite the full appreciation of the beauty and beneficious nature of BIONET I start to worry whether there isn't some bias coming in in interpreting the rules. There are hundreds of postings in comp.sys which permanently reflect commercial issues. So why not have the policy adopted for BIONET also? In USENET terminology, BIONET still does behave a little different (just remember voting, email gw etc), but wouldn't it be time to revise this fear of being commercial and afterwards filter (other would call it censor) at the justice of administrators? Regards Reinhard -- +----------------------------------+-------------------------------------+ | Dr. Reinhard Doelz | RFC doelz@urz.unibas.ch | | Biocomputing | DECNET 20579::48130::doelz | |Biozentrum der Universitaet | X25 022846211142036::doelz | | Klingelbergstrasse 70 | FAX x41 61 261- 6760 or 267- 2078 | CH 4056 Basel | TEL x41 61 267- 2076 or 2247 | +------------- bioftp.unibas.ch is the SWISS EMBnet node ----------------+ ----------------------------------------- From owner-software@net.bio.net Wed Jan 06 22:00:00 1993 Path: biosci!agate!spool.mu.edu!uunet!mcsun!uknet!daresbury!news From: PARSONS_A@snd01.pcr.co.uk Newsgroups: bionet.software Subject: Synchronisation Problem in GCG with PIR : Solution & description Message-ID: <1993Jan7.105853.21680@gserv1.dl.ac.uk> Date: 7 Jan 93 10:58:17 GMT Sender: list-admin@daresbury.ac.uk Distribution: bionet Lines: 41 Original-To: BIO-SOFT Hi Netfolk, David Mathog (Caltech) mailed me to post to the net what the solution to my problem was, as had thanked all those who had helped me. Reinhard Doelz (Basel) and Liz Cowe (Oxford) both gave me the answer to fix the problem but Liz also provided an in depth analysis of the cause - with her agreement I am posting her analysis and am also alerting MIPS who provided the copy of PIR in question. Viva la (le?) Net! Tony p. ============================================================================== To: parsons_a@uk.co.pcr.snd01 Message-ID: <009662A5.93B2E8A0.15248@vax.path.ox.ac.uk> Subject: GCG syncoronization problem Tony, I have also seen this problem with the PIR