From owner-software@net.bio.net Mon Mar 01 22:00:00 1993 Path: biosci!CLVAX1.CL.MSU.EDU!preissj From: preissj@CLVAX1.CL.MSU.EDU ("J Preiss--Seq Anal") Newsgroups: bionet.software Subject: quick title search of PDB Message-ID: <9303020601.AA17760@net.bio.net> Date: 2 Mar 93 05:58:00 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 16 Hi There has been some talk lately about accessing the PDB via gopher. Right now, just want to find out if a given sequence has a known crystal structure. I have run FASTA of selected domains of my protein using GCG on my local VAX. I now want to know which proteins to look up in the library first. I figure that those with known crystal structures will probably have the most information about the likely structure and function of the domains that I have selected. What is the quickest way to find out this info? Thanks Lenny Bloksberg PreissJ@clvax1.cl.msu.edu From owner-software@net.bio.net Mon Mar 01 22:00:00 1993 Path: biosci!daresbury!bioftp.unibas.ch!comp.bioz.unibas.ch!doelz From: doelz@comp.bioz.unibas.ch (Reinhard Doelz) Newsgroups: bionet.software Subject: Re: GCG sequence file editing Message-ID: <1993Mar2.080726.8355@comp.bioz.unibas.ch> Date: 2 Mar 93 08:07:26 GMT References: <9303020430.AA03274@insect.Berkeley.EDU> Sender: usenet@comp.bioz.unibas.ch (NEWS transaction account) Reply-To: doelz@urz.unibas.ch Distribution: bionet Organization: EMBnet Switzerland [BASEL] Lines: 17 Nntp-Posting-Host: biox.embnet.unibas.ch To make a file homogenous in characters, use ONECASE. OneCase puts all of the alphabetic characters in a file into lower case or UPPER case letters. It can also capitalize the initial letter of every word in a file. -- +----------------------------------+-------------------------------------+ | Dr. Reinhard Doelz | RFC doelz@urz.unibas.ch | | Biocomputing | DECNET 20579::48130::doelz | |Biozentrum der Universitaet | X25 022846211142036::doelz | | Klingelbergstrasse 70 | FAX x41 61 261- 6760 or 267- 2078 | CH 4056 Basel | TEL x41 61 267- 2076 or 2247 | +------------- bioftp.unibas.ch is the SWISS EMBnet node ----------------+ ----------------------------------------- From owner-software@net.bio.net Mon Mar 01 22:00:00 1993 Path: biosci!uwm.edu!wupost!howland.reston.ans.net!sol.ctr.columbia.edu!news.columbia.edu!cunixf.cc.columbia.edu!pcj1 From: pcj1@cunixf.cc.columbia.edu (Pierre Jelenc) Newsgroups: bionet.software Subject: Mac database? Message-ID: <1993Mar2.030521.11612@news.columbia.edu> Date: 2 Mar 93 03:05:21 GMT References: <9303020004.AA14577@umailsrv0.UMD.EDU> Sender: usenet@news.columbia.edu (The Network News) Reply-To: pcj1@cunixf.cc.columbia.edu (Pierre Jelenc) Distribution: bionet Organization: Columbia University Lines: 10 Nntp-Posting-Host: cunixf.cc.columbia.edu Is there a simple (flat file) Macintosh database program that uses files in the dBase format? Barring that, is there a database that can freely import from and export to the dBase III or IV format? Thanks, Pierre Pierre Jelenc pcj1@columbia.edu Columbia University, New York From owner-software@net.bio.net Mon Mar 01 22:00:00 1993 Path: biosci!INSECT.BERKELEY.EDU!bosborne From: bosborne@INSECT.BERKELEY.EDU Newsgroups: bionet.software Subject: Re: GCG sequence file editing Message-ID: <9303020430.AA03274@insect.Berkeley.EDU> Date: 2 Mar 93 04:30:07 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 20 >Is there a simple way to edit a sequence file written by SEQED so that all >residues can be converted to CAPS if the current file is a mixture of lower >and upper case? >Thanks >Laurie Betts >betts@uncvx1.bitnet I don't know what SEQED is, or what computer is running here. If you're on a Unix machine, but not in a program, use the shell (or Terminal). From the command line, do : tr '[a-z]' '[A-Z]' < the_old_file > the_new_filename Hope this helps, ------------------------------------------------------------ Brian Osborne Plant Gene Expression Center bosborne@insect.berkeley.edu Albany CA USA ------------------------------------------------------------ From owner-software@net.bio.net Mon Mar 01 22:00:00 1993 Path: biosci!uwm.edu!ux1.cso.uiuc.edu!news.cso.uiuc.edu!uxa.cso.uiuc.edu!jbog9926 From: jbog9926@uxa.cso.uiuc.edu (Jon Oetting) Newsgroups: bionet.software Subject: MacClade info? Summary: need info about MacClade software (price, source etc.) Keywords: MacClade Message-ID: Date: 2 Mar 93 02:45:38 GMT Sender: usenet@news.cso.uiuc.edu (Net Noise owner) Organization: University of Illinois at Urbana Lines: 15 Greetings. I need information about the MacClade phylogenetic analysis software for the Macintosh. Specifically, I need the price, and the name and address (phone # would be nice too) of the company that produces MacClade. Please reply to me directly via e-mail as I don't often get a chance to read this newsgroup. I would greatly appreciate a reply before this Friday (March 5) as I need this info for a grant proposal! :-) Jonathan Oetting jbog@uiuc.edu -- - Jon Oetting (jbog@uiuc.edu) From owner-software@net.bio.net Mon Mar 01 22:00:00 1993 Path: biosci!UMAILSRV0.UMD.EDU!MAILER-DAEMON From: MAILER-DAEMON@UMAILSRV0.UMD.EDU (Mail Delivery Subsystem) Newsgroups: bionet.software Subject: Software to graph sequence alignments Message-ID: <9303020004.AA14577@umailsrv0.UMD.EDU> Date: 2 Mar 93 00:04:20 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 28 G'day all, I guess that there are very few molecular biologists who have never had the need to produce an optimal seqeunce aligment or at least needed to look carefully at one. There are indeed many different programs available that optimise these seqeunce alignments, the output of which is usually a series of aligned character strings with gaps in appropriate places and special characters to denote identity or similarity. What I'm lookng for is a program that will take a pair of aligned sequences, and plot graphically, either the similarity or identity, and using a specifible window size, along the entire length of an alignment. By doing this it would me far easier to see the regions of high or low similarity/identity and see their relative location along the length of the alignment. Does anyone know of a program to do this ??? BILL ^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^ William D. WARREN, PhD Center for Agricultural Biotechnology Email: ww40@umail.umd.edu University of Maryland at College Park Phone: (301) 405-7681 ^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^ From owner-software@net.bio.net Mon Mar 01 22:00:00 1993 Path: biosci!s.u-tokyo!news.u-tokyo.ac.jp!wnoc-tyo-news!sh.wide!sun-barr!cs.utexas.edu!sdd.hp.com!spool.mu.edu!howland.reston.ans.net!zaphod.mps.ohio-state.edu!saimiri.primate.wisc.edu!zazen!psl.wisc.edu!gcg.com!edelman From: edelman@gcg.com (Irv Edelman) Newsgroups: bionet.software Subject: Re: GCG sequence file editing Message-ID: <2MAR199307205820@gcg.com> Date: 2 Mar 93 13:20:00 GMT References: <9303020430.AA03274@insect.Berkeley.EDU> <1993Mar2.080726.8355@comp.bioz.unibas.ch> Sender: news@pslu1.psl.wisc.edu (USENET News System) Distribution: bionet Organization: Genetics Computer Group Lines: 31 News-Software: VAX/VMS VNEWS 1.41 In article <1993Mar2.080726.8355@comp.bioz.unibas.ch>, doelz@urz.unibas.ch writes... >To make a file homogenous in characters, use ONECASE. > > OneCase puts all of the alphabetic characters in a file into lower > case or UPPER case letters. It can also capitalize the initial > letter of every word in a file. > > > >-- >+----------------------------------+-------------------------------------+ >| Dr. Reinhard Doelz | RFC doelz@urz.unibas.ch | >| Biocomputing | DECNET 20579::48130::doelz | >|Biozentrum der Universitaet | X25 022846211142036::doelz | >| Klingelbergstrasse 70 | FAX x41 61 261- 6760 or 267- 2078 >| CH 4056 Basel | TEL x41 61 267- 2076 or 2247 | >+------------- bioftp.unibas.ch is the SWISS EMBnet node ----------------+ > ----------------------------------------- To change a sequence to all upper case, use REFORMAT/UPPER. This will only change the sequence and won't affect any embedded comments. Irv Edelman =============================================================================== Irv Edelman, Genetics Computer Group E-Mail: Edelman@GCG.Com Phone: (608) 231-5200 =============================================================================== From owner-software@net.bio.net Mon Mar 01 22:00:00 1993 Path: biosci!daresbury!daresbury!news From: risler@cgmvax.cgm.cnrs-gif.fr Newsgroups: bionet.software Subject: BLAST Message-ID: <1993Mar2.120540.1382@gserv1.dl.ac.uk> Date: 2 Mar 93 12:06:47 GMT Sender: list-admin@daresbury.ac.uk Distribution: bionet Lines: 30 Content-Identifier: BLAST Original-To: bio-software@uk.ac.daresbury X-Vms-To: smtp%"bio-software@daresbury.ac.uk" Dear fellow netters, Like many of you, I use BLAST at NCBI for searching sequence databanks. Like many of you, I don't like using programs when I don't understand what (and how) they do. Hence I've tried to read the original papers about BLAST and, in particular, I've tried to understand how they compute the probability P(N) associated with a given score. I must confess that I failed to fully understand, either because I'm just stupid and/or because it is not clearly written. In any case, I thought that P(N) was computed from the figures obtained by a very large number of simulations. If this was true, then this probability should be the same for the same hit whatever the databank used. A colleague of mine recently searched a protein sequence with BLAST against the "non-redundant protein databank" and against Swissprot. She got in both cases the same hit with the same score, but with different probabilities. With the non-redundant database P(N) was 0.84 and with Swissprot P(N) was 0.51. The segment pairs were exactly the same in both cases. Could somebody help me understand? Thank you, -------------------------------------------------------------------- | Jean-Loup Risler | | | CNRS | risler@frcgm51.bitnet | | Centre de Genetique Moleculaire | risler@cgmvax.cgm.cnrs-gif.fr | | 91198 Gif sur Yvette Cedex France | | -------------------------------------------------------------------- From owner-software@net.bio.net Mon Mar 01 22:00:00 1993 Path: biosci!agate!howland.reston.ans.net!zaphod.mps.ohio-state.edu!hobbes.physics.uiowa.edu!news.iastate.edu!sanger.bb.iastate.edu!zsha From: zsha@iastate.edu (Zhengyu Sha) Newsgroups: bionet.software Subject: Re: GCG sequence file editing Message-ID: Date: 2 Mar 93 03:47:45 GMT References: <01GVAQ39MSCK000IMQ@uncvx1.oit.unc.edu> Sender: news@news.iastate.edu (USENET News System) Distribution: bionet Organization: Iowa State University, Ames IA Lines: 10 In <01GVAQ39MSCK000IMQ@uncvx1.oit.unc.edu> BETTS@UNCVX1.BITNET writes: >Is there a simple way to edit a sequence file written by SEQED so that all >residues can be converted to CAPS if the current file is a mixture of lower >and upper case? >Thanks >Laurie Betts >betts@uncvx1.bitnet Download the file onto your IBM or Mac, use the Microsoft Word to do the job. From owner-software@net.bio.net Mon Mar 01 22:00:00 1993 Path: biosci!daresbury!daresbury!news From: bionet@cgmvax.cgm.cnrs-gif.fr Newsgroups: bionet.software Subject: Re: Kinemage Message-ID: <1993Mar2.093713.25019@gserv1.dl.ac.uk> Date: 2 Mar 93 09:38:40 GMT Sender: list-admin@daresbury.ac.uk Distribution: bionet Lines: 18 Content-Identifier: Re: Kinemage Original-To: bio-software@uk.ac.daresbury X-Vms-To: smtp%"bio-software@daresbury.ac.uk" > > I have just retrei[D[D[D[Dieved KInemage from UC-Irvine by FTP. Can anyone > tell me how to use Kinemage to displayu [D[D a protein from a GCG file? > I am using this program on a PC. Thanks for your help. > Eric Triplett, University of Wisconsin > triplett@wiscmac3.bitnet > If you could do this, you sure would get the Nobel price !! -------------------------------------------------------------------- | Jean-Loup Risler | | | CNRS | risler@frcgm51.bitnet | | Centre de Genetique Moleculaire | risler@cgmvax.cgm.cnrs-gif.fr | | 91198 Gif sur Yvette Cedex France | | -------------------------------------------------------------------- From owner-software@net.bio.net Mon Mar 01 22:00:00 1993 Path: biosci!daresbury!bioftp.unibas.ch!comp.bioz.unibas.ch!doelz From: doelz@comp.bioz.unibas.ch (Reinhard Doelz) Newsgroups: bionet.software Subject: Re: quick title search of PDB Message-ID: <1993Mar2.084637.9055@comp.bioz.unibas.ch> Date: 2 Mar 93 08:46:37 GMT References: <9303020601.AA17760@net.bio.net> Sender: usenet@comp.bioz.unibas.ch (NEWS transaction account) Reply-To: doelz@urz.unibas.ch Distribution: bionet Organization: EMBnet Switzerland [BASEL] Lines: 41 Nntp-Posting-Host: biox.embnet.unibas.ch In article <9303020601.AA17760@net.bio.net>, preissj@CLVAX1.CL.MSU.EDU ("J Preiss--Seq Anal") writes: |> Hi |> |> There has been some talk lately about accessing the PDB via gopher. |> Right now, just want to find out if a given sequence has a known crystal |> structure. I have run FASTA of selected domains of my protein using GCG |> on my local VAX. I now want to know which proteins to look up in the library |> first. I figure that those with known crystal structures will probably have |> the most information about the likely structure and function of the domains |> that I have selected. What is the quickest way to find out this info? |> |> Thanks |> |> Lenny Bloksberg |> PreissJ@clvax1.cl.msu.edu |> |> You install the Sequence Retrieval System (SRS), copyrighted by Thure Etzold. There, you parse the FASTA file output and link it into PDB. The result shows you immediately which hits in the fasta output had actual counterparts in PDB. The fun is that you could even use a TFASTA and link EMBL to PDB this way. Another tip would be to install the NRL_3D database as provided by PIR International. The entries there are exclusively PDB entries. Running FASTA on there would give you PDB entries entirely. Regards Reinhard -- +----------------------------------+-------------------------------------+ | Dr. Reinhard Doelz | RFC doelz@urz.unibas.ch | | Biocomputing | DECNET 20579::48130::doelz | |Biozentrum der Universitaet | X25 022846211142036::doelz | | Klingelbergstrasse 70 | FAX x41 61 261- 6760 or 267- 2078 | CH 4056 Basel | TEL x41 61 267- 2076 or 2247 | +------------- bioftp.unibas.ch is the SWISS EMBnet node ----------------+ ----------------------------------------- From owner-software@net.bio.net Mon Mar 01 22:00:00 1993 Path: biosci!daresbury!buzz.bmc.uu.se!corax.udac.uu.se!sunic!mcsun!uunet!stanford.edu!ames!agate!howland.reston.ans.net!paladin.american.edu!darwin.sura.net!welchgate.welch.jhu.edu!danj From: danj@welchgate.welch.jhu.edu (Dan Jacobson) Newsgroups: bionet.software Subject: Re: Software to graph sequence alignments Message-ID: <1993Mar2.163522.15209@welchgate.welch.jhu.edu> Date: 2 Mar 93 16:35:22 GMT References: <9303020004.AA14577@umailsrv0.UMD.EDU> Distribution: bionet Organization: Johns Hopkins Univ. Welch Medical Library Lines: 85 In article <9303020004.AA14577@umailsrv0.UMD.EDU> MAILER-DAEMON@UMAILSRV0.UMD.EDU (Mail Delivery Subsystem) writes: >G'day all, > >I guess that there are very few molecular biologists who have never >had the need to produce an optimal seqeunce aligment or at least >needed to look carefully at one. There are indeed many different >programs available that optimise these seqeunce alignments, the >output of which is usually a series of aligned character strings >with gaps in appropriate places and special characters to denote >identity or similarity. > >What I'm lookng for is a program that will take a pair of aligned >sequences, and plot graphically, either the similarity or identity, >and using a specifible window size, along the entire length of an >alignment. By doing this it would me far easier to see the regions >of high or low similarity/identity and see their relative location >along the length of the alignment. > >Does anyone know of a program to do this ??? > >BILL > You might want to take a look at Maligned (written by Steve Clark). Maligned allows you to create alignments manually (or input alignments from some of the other alignment programs) and gives you on-screen shading of the alignment based on identity or similarity. As you shift a sequence you can see the shading change and zero in on better alignments. Maligned will also give you statistics on an alignment - including the percent identity at each position in the alignment - you can easily feed that into an XY plotting package or a spread sheet and get the type of graphical display you thinking of. Maligned is designed for multiple alignments and can handle 200 sequences at a time if you'd like. Maligned runs under VMS and is available from (among other places) ftp.bio.indiana.edu by gopher or anonymous ftp in the molbio/vax directory. Best of luck, Dan Jacobson danj@welchgate.welch.jhu.edu --------------------------------------------------------------------------- A clip from the Readme file is as follows: README.TXT MALIGNED stands for Multiple ALIGNment EDitor. Is is a screen editor designed to demonstrate sequence similiarity between related genes or proteins. The regions of similarity in each sequence are highlighted; the screen is updated to reflect the current similiarity as the alignments are changed by shifting a sequence relative to the others, or by adding gaps. This constant visual feedback of the overall alignment makes it easy to see the effect of changing the alignment. MALFORM is a post-processing program that converts the ".MAL" file produced by Maligned to a file that can be printed on a postscript printer. Maligned and Malform run on a VAX/VMS system and were compiled and linked under VMS v5.3-1. These programs and files are copyrighted by Stephen Clark, 1992 (c), but may be freely distributed so long as all files are distributed and without any changes, and no fee is charged. Once obtained, the configuration, help and document files may be edited to make them conform to the local environment, and may be further distributed for the benefit of others with the same output devices. A paper describing Maligned is in press in CABIOS ("Maligned: a multiple sequence alignment program," by Stephen P. Clark.) Comments, suggestions, bug reports, etc, can be sent to me at the indicated address (Internet is prefered). Stephen Clark May 17, 1992 clark@salk-sc2.sdsc.edu (Internet) clark@salk (Bitnet --------------------------------------------------------------------------- From owner-software@net.bio.net Mon Mar 01 22:00:00 1993 Path: biosci!daresbury!buzz.bmc.uu.se!corax.udac.uu.se!sunic!uunet!stanford.edu!agate!howland.reston.ans.net!zaphod.mps.ohio-state.edu!caen!uvaarpa!murdoch!darwin.clas.Virginia.EDU!rbm8p From: rbm8p@Virginia.EDU (Rick MacDonald) Newsgroups: bionet.software Subject: Equipotential Surface for Proteins? Message-ID: <1993Mar2.155850.19377@murdoch.acc.Virginia.EDU> Date: 2 Mar 93 15:58:50 GMT Sender: usenet@murdoch.acc.Virginia.EDU Followup-To: bionet.software Organization: University of Virginia Lines: 21 Originator: rbm8p@darwin.clas.Virginia.EDU I'd like to plot equipotential surfaces for a small globular protein --- any references, recipes, software, suggestions, caveats or advice would be appreciated. I can probably chase down any of several popular packages that run on Silicon Graphics machines, but would also be amenable to converting a recipe for PDB-->energy surface into code. Can anybody offer comments on the differences between a "simple" approach which uses the partial charge on each atom, and an attempt at a more sophisticated description in which the orbitals are considered explicitly? Thanks much (I'll summarize and share responses), Rick rbm8p@virginia.edu From owner-software@net.bio.net Mon Mar 01 22:00:00 1993 Path: biosci!agate!howland.reston.ans.net!usc!sol.ctr.columbia.edu!destroyer!fmsrl7!lynx.unm.edu!umn.edu!proton.med.umn.edu!milius From: milius@proton.med.umn.edu (Bob Milius (BMEC)) Newsgroups: bionet.software Subject: Re: GCG sequence file editing Message-ID: Date: 2 Mar 93 22:42:30 GMT References: <9303012058.AA17649@salk-sgi.sdsc.edu> Sender: news@news2.cis.umn.edu (Usenet News Administration) Distribution: bionet Organization: University of Minnesota Lines: 11 Nntp-Posting-Host: proton.med.umn.edu In article <9303012058.AA17649@salk-sgi.sdsc.edu> mangalam@SALK-SC2.SDSC.EDU (Harry Mangalam) writes: >>Is there a simple way to edit a sequence file written by SEQED so that all >>residues can be converted to CAPS if the current file is a mixture of lower >>and upper case? >Yes, use Don Gilbert's free and wondrous Readseq - the latest version has >the option to convert case as well as format. also, if you are using GCG, I believe the REFORMAT program will do what you want. -bob From owner-software@net.bio.net Mon Mar 01 22:00:00 1993 Path: biosci!UH.EDU!Davison From: Davison@UH.EDU (Dan Davison) Newsgroups: bionet.software Subject: Re: MacClade info? Message-ID: <199303022113.AA22857@Menudo.UH.EDU> Date: 2 Mar 93 21:13:52 GMT References: <9303021756.AA13306@net.bio.net> Sender: daemon@net.bio.net Distribution: bionet Lines: 36 Dan Jacobson said: > In article jbog9926@uxa.cso.uiuc.edu > (Jon Oetting) writes: > >Greetings. I need information about the MacClade phylogenetic analysis > >software for the Macintosh. Specifically, I need the price, and the > >name and address (phone # would be nice too) of the company that > >produces MacClade. Please reply to me directly via e-mail as I don't > >often get a chance to read this newsgroup. I would greatly appreciate > >a reply before this Friday (March 5) as I need this info for a grant > >proposal! :-) > You can obtain MacClade by anonymous ftp from the following sites: [...[ and as danj said, also from Sinauer Associates. Don't bother with the FTP version; it's old and bears little resemblance to the awesome version 3.0. Contact: Sinauer Associates 108 North Main Street Sunderland, MA 01375 phone 413-665-3722 fax 413-665-7292 The cost is either about $75.00 + shipping or $99.00 + shipping. It's well worth it. dan -- dr. dan davison/dept. of biochemical and biophysical sciences/univ. of Houston/4800 Calhoun/Houston,TX 77204-5934/davison@uh.edu/DAVISON@UHOU -----RIP Isaac Asimov 1920-1992 I'll miss him -------------------- Disclaimer: As always, I speak only for myself, and, usually, only to myself. From owner-software@net.bio.net Mon Mar 01 22:00:00 1993 Path: biosci!daresbury!buzz.bmc.uu.se!bio.embnet.se!sunic!uunet!stanford.edu!rock!concert!uvaarpa!murdoch!cyclops.micr.Virginia.EDU!wrp From: wrp@cyclops.micr.Virginia.EDU (Bill Pearson) Newsgroups: bionet.software Subject: Re: BLAST Message-ID: <1993Mar2.175351.22106@murdoch.acc.Virginia.EDU> Date: 2 Mar 93 17:53:51 GMT References: <1993Mar2.120540.1382@gserv1.dl.ac.uk> Sender: usenet@murdoch.acc.Virginia.EDU Distribution: bionet Organization: University of Virginia Lines: 26 In article <1993Mar2.120540.1382@gserv1.dl.ac.uk> risler@cgmvax.cgm.cnrs-gif.fr writes: > Hence I've tried to read the original papers about BLAST and, in particular, > I've tried to understand how they compute the probability P(N) associated > with a given score. ... In any > case, I thought that P(N) was computed from the figures obtained by a very > large number of simulations. If this was true, then this probability should > be the same for the same hit whatever the databank used. The P value is calculated analytically, it is not based on simulations. Equation [5] of Karlin and Altschul, PNAS (1990) 87:2264 tells us that the probability is a function of the length of the query sequence, the length of the database sequence, and a factor, lambda, which is calculated from the scoring matrix and the probabilities of the residues in the query sequence and in the library. > A colleague of mine recently searched a protein sequence with BLAST against > the "non-redundant protein databank" and against Swissprot. She got in both > cases the same hit with the same score, but with different probabilities. > With the non-redundant database P(N) was 0.84 and with Swissprot P(N) was > 0.51. The segment pairs were exactly the same in both cases. In blast, the P value is corrected for the length of the database as well. Thus, the same alignment from two different database searches may have different P values if the databases are different in length or amino acid composition. From owner-software@net.bio.net Mon Mar 01 22:00:00 1993 Path: biosci!lhc!darwin.sura.net!sgiblab!adagio.panasonic.com!nntp-server.caltech.edu!seqvax.caltech.edu!mathog From: mathog@seqvax.caltech.edu (David Mathog) Newsgroups: bionet.software,bionet.general Subject: Re: Video Conferencing & Collaborative SW...slick stuff! Message-ID: <2MAR199310004131@seqvax.caltech.edu> Date: 2 Mar 93 18:00:00 GMT References: Distribution: usa Organization: Division of Biolgy, CALTECH Lines: 63 Xref: biosci bionet.software:4395 bionet.general:4207 NNTP-Posting-Host: seqvax.bio.caltech.edu News-Software: VAX/VMS VNEWS 1.41 In article , ernest@lenti.med.umn.edu (Ernest Retzel (1535 49118)) writes... >... > >Briefly, what they do is 1. provide you with workstation based video- >conferencing [PictureWindow] and 2. provide a groupware environment for >you to share anything you can display on a screen, a capture environment >and a "whiteboard" environment to write on it [ShowMe]. This is serious >cool, folks. I can throw out a couple of examples--collaborations suddenly >become easier and a whole lot cheaper when you can just open a window onto >someone else's machine and see them and talk to them and show them what the >new things you just added to whatever ...without a fax machine and a phone >in your hand. Distance learning takes on a real meaning. Want to see a >conference being held somewhere else? --a video feed to the box can do it, >and you see it for free, no downlike setups and charges and arrangements. >So far, we have done 4-way conferences, and the Suns aren't even breathing >hard. The main reason that we haven't done more is that the purchase was >a proof of concept, and that is all the licenses we have. > >etc. I've got really mixed feelings about this one. On the one hand, this video-conferencing would clearly be very useful. On the other hand, if one had to actually buy the bandwidth from ATT, MCI, Sprint, etc. it would likely be prohibitively expensive, at least for the video part, although the rest of it doesn't sound too data dense. Dr. Retzl seems to be implying that this data channel is free, and that may be a fair approximation for his local LAN. However, if he's referring to the Internet, the statement isn't correct - we pay for Internet bandwidth indirectly through our government. I believe that the following two statements are true: 1. Market systems are more efficient than command systems. 2. Any significant expense that is part of publicly funded research should be specifically approved as part of the grant review process. I've been thinking about this for a while, and I suppose what I'm about to say is heresy, but if the above statements are true, then probably the government should dump the current "free" Internet and instead distribute to the research/academic community the money that they now spend supporting that structure. In turn, these people would purchase such data communications as they need directly on the commercial market. Internet e-mail is "free", but is it really? For all we know MCI-mail might be cheaper than the real costs of Internet e-mail. The same argument holds for the interactive video-conference that Dr. Retzl describes, Gopher, FTP, telnet, and all the rest. My guess is that the network video-conference is slightly cheaper now than a "live" conference, but that the advantage should grow over time as data transfer costs decrease. Implementing the suggested change should result in a decline in the total data communications costs for the current "free" Internet users. We would have to get used to these costs showing up as an explicit, and possibly large, portion of research grants. This might at first be rather shocking, but if one can't justify the real expense, why should the taxpayer be spending money on it? Direct all flames to: David Mathog mathog@seqvax.bio.caltech.edu Manager, sequence analysis facility, biology division, Caltech From owner-software@net.bio.net Mon Mar 01 22:00:00 1993 Path: biosci!WSUVMS1.CSC.WSU.EDU!THOMPSON From: THOMPSON@WSUVMS1.CSC.WSU.EDU (Steve Thompson: VADMS genetics) Newsgroups: bionet.software Subject: Re: graphing sequence similarity Message-ID: <930302102205.26a009b0@BOBCAT.CSC.WSU.EDU> Date: 2 Mar 93 18:22:05 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 26 William_D_WARREN@umail.umd.edu in Message-Id: <9303020004.AA14577@umailsrv0.UMD.EDU> writes: >...What I'm lookng for is a program that will take a pair of aligned >sequences, and plot graphically, either the similarity or identity, >and using a specifible window size, along the entire length of an >alignment. By doing this it would me far easier to see the regions >of high or low similarity/identity and see their relative location >along the length of the alignment.... If you have access to GCG, their program PlotSimilarity does exactly this. It will also deal with multiple sequence alignments and has many built-in options as well as being able to take advantage of the extensive graphics capabilities of the Figure program. Happy plotting, Steve T Steven M. Thompson Consultant in Molecular Genetics and Sequence Analysis VADMS (Visualization, Analysis & Design in the Molecular Sciences) Laboratory Washington State University, Pullman, WA 99164-1224, USA AT&Tnet: (509) 335-0533 or 335-3179 FAX: (509) 335-0540 BITnet: THOMPSON@WSUVMS1 or STEVET@WSUVM1 INTERnet: THOMPSON@wsuvms1.csc.wsu.edu From owner-software@net.bio.net Mon Mar 01 22:00:00 1993 Path: biosci!SALK-SC2.SDSC.EDU!mangalam From: mangalam@SALK-SC2.SDSC.EDU (Harry Mangalam) Newsgroups: bionet.software Subject: Re: Mac database? Message-ID: <9303021817.AA18932@salk-sgi.sdsc.edu> Date: 2 Mar 93 18:17:39 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 20 Pierre Jelenc writes: >Is there a simple (flat file) Macintosh database program that uses files >in the dBase format? Barring that, is there a database that can freely >import from and export to the dBase III or IV format? Filemaker Pro (for one - probably most others can as well) can import/export files in dBase format. The only reason for mentioning FM Pro is that it is overwhelmingly liked here because of its simplicity for non-gymnastic database requirements. Cheers, Harry Harry Mangalam Vox:(619) 453-4100, x250 Dept of Biocomputing Fax:(619) 552-1546 The Salk Institute 1' mangalam@salk-sc2.sdsc.edu 10010 N Torrey Pines Rd 2' hjm@salk-sgi.sdsc.edu La Jolla CA 92037 3' mangalam@salk.bitnet From owner-software@net.bio.net Mon Mar 01 22:00:00 1993 Path: biosci!daresbury!daresbury!news From: bionet@cgmvax.cgm.cnrs-gif.fr Newsgroups: bionet.software Subject: Re: quick title search of PDB Message-ID: <1993Mar2.114125.200@gserv1.dl.ac.uk> Date: 2 Mar 93 11:41:48 GMT Sender: list-admin@daresbury.ac.uk Distribution: bionet Lines: 24 Content-Identifier: Re: quick tit... Original-To: bio-software@uk.ac.daresbury X-Vms-To: smtp%"bio-software@daresbury.ac.uk" > > There has been some talk lately about accessing the PDB via gopher. > Right now, just want to find out if a given sequence has a known crystal > structure. I have run FASTA of selected domains of my protein using GCG > on my local VAX. I now want to know which proteins to look up in the library > first. I figure that those with known crystal structures will probably have > the most information about the likely structure and function of the domains > that I have selected. What is the quickest way to find out this info? > The best way is to get the NRL_3D databank from PIR. It contains the sequences of those proteins whose structures are known and deposited within the PDB. Since it is in PIR format, it can easily be transformed into a GCG database. -------------------------------------------------------------------- | Jean-Loup Risler | | | CNRS | risler@frcgm51.bitnet | | Centre de Genetique Moleculaire | risler@cgmvax.cgm.cnrs-gif.fr | | 91198 Gif sur Yvette Cedex France | | -------------------------------------------------------------------- From owner-software@net.bio.net Mon Mar 01 22:00:00 1993 Path: biosci!daresbury!buzz.bmc.uu.se!corax.udac.uu.se!sunic!mcsun!hp4at!news.univie.ac.at!paladin.american.edu!europa.eng.gtefsd.com!darwin.sura.net!welchgate.welch.jhu.edu!danj From: danj@welchgate.welch.jhu.edu (Dan Jacobson) Newsgroups: bionet.software Subject: Re: MacClade info? Keywords: MacClade Message-ID: <1993Mar2.165938.22661@welchgate.welch.jhu.edu> Date: 2 Mar 93 16:59:38 GMT References: Organization: Johns Hopkins Univ. Welch Medical Library Lines: 99 In article jbog9926@uxa.cso.uiuc.edu (Jon Oetting) writes: > >Greetings. I need information about the MacClade phylogenetic analysis >software for the Macintosh. Specifically, I need the price, and the >name and address (phone # would be nice too) of the company that >produces MacClade. Please reply to me directly via e-mail as I don't >often get a chance to read this newsgroup. I would greatly appreciate >a reply before this Friday (March 5) as I need this info for a grant >proposal! :-) > >Jonathan Oetting >jbog@uiuc.edu > >-- > > - Jon Oetting (jbog@uiuc.edu) > Well this is what I could dig up with a few gopher searches. You can obtain MacClade by anonymous ftp from the following sites: Host fly.bio.indiana.edu Location: /molbio/mac FILE -rw-r--r-- 144646 May 14 1991 macclade.hqx Host sunbcd.weizmann.ac.il Location: /pub/software/mac FILE -r--r--r-- 144646 May 14 1991 macclade.hqx Host sunsite.unc.edu Location: /pub/academic/bio/molbio/mac FILE -r--r--r-- 144646 May 14 1991 macclade.hqx For those of you who aren't familiar with MacClade here's a description that Joe Felsenstein (noted phylogeny guru and author of the PHYLIP package) wrote in his Phylip documentation: 3. If you have a Macintosh computer and any interest in discrete-state parsimony methods (including DNA and protein parsimony), you should definitely get MacClade. As of this writing it was distributed by Wayne Maddison, Department of Ecology and Evolutionary Biology, University of Arizona, Tucson, Arizona 85721, U.S.A. David Maddison and he have produced a program enabling you to use the mouse-window interface to specify and rearrange phylogenies by hand, and watch the number of character steps and the distribution of states of a given character on the tree change as you do so. MacClade is positively addictive and will give you a much better feel for the tree and your data. It's the closest thing to a phylogeny video game that I have seen. It has been influential in spurring the inclusion of interaction and graphics into other phylogeny programs. (I have tried to supply this functionality in PHYLIP by incorporating the programs MOVE, DOLMOVE, and DNAMOVE, which act somewhat like MacClade). MacClade does not have a sophisticated search algorithm to find best trees: it largely relies on you to do it by hand (which is surprisingly effective), with only a local rearrangement algorithm available to improve on that tree. Version 2.1 was released in March 1987. Version 3, with a spread-sheet data editor, support for polytomies, charting facilities, PHYLIP, PAUP, and HENNIG86 compatibility, and many other new features, is coming soon. The program is originally written in Lightspeed Pascal but is provided in pre- compiled form, and is available for distribution cost ($6 in North America, $8 overseas, or three or four Macintosh diskettes in barter). It requires a 512K Macintosh, Macintosh Plus, or larger. In the near future the distribution of version 3 will be on a commercial basis by Sinauer Associates of Sunderland, Massachusetts, although versions 1 and 2 will continue to be freely distributable. Version 2 is also available by electronic mail from the EMBL and Houston net servers which distribute free software for molecular data analysis, in their Mac software, as a squeezed and then binhexed file. So you're looking for: Sinauer Associates of Sunderland, Massachusetts if you want the commercial version. And a little more info on Wayne Maddison: alias: w-maddison name: maddison, wayne p office_address: 310 bio sci west office_location: campus type: person phone department: ecology & evolutionary biology title: assistant professor, ecology and evolutionary biology Best of luck, Dan Jacobson danj@welchgate.welch.jhu.edu From owner-software@net.bio.net Mon Mar 01 22:00:00 1993 Path: biosci!daresbury!buzz.bmc.uu.se!corax.udac.uu.se!sunic!uunet!stanford.edu!agate!spool.mu.edu!hri.com!noc.near.net!news.cs.brandeis.edu!news From: ahouse@hydra.rose.brandeis.edu (Jeremy John Ahouse) Newsgroups: bionet.software Subject: ReadSeq on the Mac? Message-ID: <1993Mar2.153526.28360@news.cs.brandeis.edu> Date: 2 Mar 93 15:35:26 GMT Sender: news@news.cs.brandeis.edu (USENET News System) Organization: Center for Complex Systems Lines: 17 X-Xxdate: Tue, 2 Mar 93 15: 40:07 GMT X-Useragent: Nuntius v1.1.1d17 I have been trying to use readseq on the Mac. typing either: readseq test.seq -all -format=genbank -output=my.gb at the ReadseqSIOW prompt or typing: test.seq -all -format=genbank -output=my.gb just gives me the "help" screen. So I must have the syntax wrong, but this is taken directly from the README file. Any suggestions will be helpful, Thanks, Jeremy John Ahouse - Biology Brandeis Univ. From owner-software@net.bio.net Mon Mar 01 22:00:00 1993 Path: biosci!daresbury!daresbury!news From: coissac@cgmvax.cgm.cnrs-gif.fr Newsgroups: bionet.software Subject: Usenet by telnet Message-ID: <1993Mar2.135423.5647@gserv1.dl.ac.uk> Date: 2 Mar 93 13:54:41 GMT Sender: list-admin@daresbury.ac.uk Distribution: bionet Lines: 9 Content-Identifier: Usenet by tel... Original-To: bio-soft@uk.ac.daresbury X-Vms-To: SMTP%"bio-soft@daresbury.ac.uk" I learn last week that is it possible to use some gophers by telnet. Do you know if is it possible to use USENET by telnet Sincerly. Eric Coissac : Email COISSAC@FRCGM51.bitnet From owner-software@net.bio.net Mon Mar 01 22:00:00 1993 Path: biosci!WSUVMS1.CSC.WSU.EDU!THOMPSON From: THOMPSON@WSUVMS1.CSC.WSU.EDU (Steve Thompson: VADMS genetics) Newsgroups: bionet.software Subject: the easiest answer! Re: sequence case format Message-ID: <930302080510.26a009b0@BOBCAT.CSC.WSU.EDU> Date: 2 Mar 93 16:05:10 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 30 Hello world - Laurie asked last Friday: >Is there a simple way to edit a sequence file written by SEQED so that all >residues can be converted to CAPS if the current file is a mixture of lower >and upper case? >Thanks >Laurie Betts >betts@uncvx1.bitnet I already replied directly to her last week. However, so many of you seem to be missing the boat on the EASIEST way to do what she is asking that I thought I should also post the answer to the group. There is no need to transfer the file to any other platform; no need to write a script program; no need to use anything other than the same GCG package that she created the sequence with. Merely run the GCG utility REformat with its /UPPer option; that's all it takes! (VMS conventions listed above, caps are minimum command required.) Good day all, Steve T Steven M. Thompson Consultant in Molecular Genetics and Sequence Analysis VADMS (Visualization, Analysis & Design in the Molecular Sciences) Laboratory Washington State University, Pullman, WA 99164-1224, USA AT&Tnet: (509) 335-0533 or 335-3179 FAX: (509) 335-0540 BITnet: THOMPSON@WSUVMS1 or STEVET@WSUVM1 INTERnet: THOMPSON@wsuvms1.csc.wsu.edu From owner-software@net.bio.net Mon Mar 01 22:00:00 1993 Path: biosci!daresbury!buzz.bmc.uu.se!corax.udac.uu.se!sunic!uunet!stanford.edu!ames!agate!howland.reston.ans.net!paladin.american.edu!darwin.sura.net!welchgate.welch.jhu.edu!danj From: danj@welchgate.welch.jhu.edu (Dan Jacobson) Newsgroups: bionet.software Subject: Re: quick title search of PDB Message-ID: <1993Mar2.161719.7884@welchgate.welch.jhu.edu> Date: 2 Mar 93 16:17:19 GMT Organization: Johns Hopkins Univ. Welch Medical Library Lines: 65 Newsgroups: bionet.software Subject: Re: quick title search of PDB References: <9303020601.AA17760@net.bio.net> Distribution: bionet Organization: Johns Hopkins Univ. Welch Medical Library In article <9303020601.AA17760@net.bio.net> preissj@CLVAX1.CL.MSU.EDU ("J Preiss--Seq Anal") writes: >Hi > > There has been some talk lately about accessing the PDB via gopher. >Right now, just want to find out if a given sequence has a known crystal >structure. I have run FASTA of selected domains of my protein using GCG >on my local VAX. I now want to know which proteins to look up in the library >first. I figure that those with known crystal structures will probably have >the most information about the likely structure and function of the domains >that I have selected. What is the quickest way to find out this info? > > Thanks > > Lenny Bloksberg > PreissJ@clvax1.cl.msu.edu > > Probably the easiest way to do this is to use the mailserver at PIR to do as Fasta search of NRL_3D. Once you see the results of that search you can retrieve the full NRL_3D and PDB entries by gopher at merlot.welch.jhu.edu as discussed earlier. Below is information extracted from a post by John Garavelli on how to do a Fasta search of NRL_3D via the PIR mailserver. ---------- The following is extracted from the Announcements of the Protein Information Resource Network Request Service published last summer. 5. FASTA Searches for NRL_3D Only Some users had suggested that they wanted to do FASTA sequence searches only for the sequences with known 3-dimensional structures, the sequences extracted from the Brookhaven Protein Data Bank in NRL_3D. Normally our FASTA searches are done against all the protein databases, PIR1, PIR2, PIR3, the non-redundant PATCHX (described in the August announcement and in part 2 above) and NRL_3D. Now when the command USE BASES NRL_3D is used before a SEARCH command, only the NRL_3D database will be used for the FASTA search. Otherwise, all the protein databases will be used. To do the search you want, send an electronic mail message containing the following lines (with the appropiate sequence substitution) USE BASES NRL_3D SEARCH protein_sequence_in_single_letter_code to the PIR Network Request Service address FILESERV@NBRF.Georgetown.EDU on Internet or FILESERV@GUNBRF on BITNET. The server will return the result of a FASTA search through only the protein sequences with reported atomic positions in the Brookhaven Protein Data Bank. The first four characters of the entry codes in the NRL_3D database correspond to the PDB entry codes. [ . . . ] Addition information can be obtained by sending a HELP request to the PIR Network Request Service address. -------------------------- Best of luck, Dan Jacobson danj@welchgate.welch.jhu.edu From owner-software@net.bio.net Mon Mar 01 22:00:00 1993 Path: biosci!NBRF.GEORGETOWN.EDU!POSTMASTER From: POSTMASTER@NBRF.GEORGETOWN.EDU Newsgroups: bionet.software Subject: Re: quick title search of PDB Message-ID: <01GVBVDEY0Z69GV6MR@NBRF.Georgetown.Edu> Date: 2 Mar 93 14:59:49 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 80 In message <9303020601.AA17760@net.bio.net> Lenny Bloksberg (PreissJ@clvax1.cl.msu.edu) asks > There has been some talk lately about accessing the PDB via gopher. > Right now, just want to find out if a given sequence has a known crystal > structure. I have run FASTA of selected domains of my protein using GCG > on my local VAX. I now want to know which proteins to look up in the library > first. I figure that those with known crystal structures will probably have > the most information about the likely structure and function of the domains > that I have selected. What is the quickest way to find out this info? Last week I answered a similar question on the proteins and xtalography boards. As several others have already been kind enough to point out, the NRL_3D database produced by the PIR-International contains all the protein sequence information extracted from the Brookhaven Protein Data Bank. The NRL_3D is provided with the standard PIR distribution and it is also available both for FASTA searching and for database queries through the PIR Network Request Server. The following is extracted from the Announcements of the Protein Information Resource Network Request Service published last summer. > 5. FASTA Searches for NRL_3D Only > Some users had suggested that they wanted to do FASTA sequence searches > only for the sequences with known 3-dimensional structures, the sequences > extracted from the Brookhaven Protein Data Bank in NRL_3D. Normally our > FASTA searches are done against all the protein databases, PIR1, PIR2, PIR3, > the non-redundant PATCHX (described in the August announcement and in part 2 > above) and NRL_3D. Now when the command > USE BASES NRL_3D > is used before a SEARCH command, only the NRL_3D database will be used for > the FASTA search. Otherwise, all the protein databases will be used. To perform the FASTA search in NRL_3D send an electronic mail message containing the following lines (with the appropiate sequence substitution) USE BASES NRL_3D SEARCH protein_sequence_in_single_letter_code to the PIR Network Request Service address FILESERV@NBRF.Georgetown.EDU on Internet or FILESERV@GUNBRF on BITNET. The server will return the result of a FASTA search through only the protein sequences with reported atomic positions in the Brookhaven Protein Data Bank. The first four characters of the entry codes in the NRL_3D database correspond to the PDB entry codes. Users who have the PIR database access programs, the NRL_3D database and the Brookhaven Protein Data Bank can use the MATCH command to generate a VMS command procedure that will extract the atomic coordinates of all the matched sequences in the PDB for model building and comparison. It is also possible to do a more general database query for related sequences. The COMPND records in Broookhaven PDB entries are extracted into the title records of NRL_3D. The server TITLE command can be used to find entries by the words in their titles. Likewise, the SPECIES command can be used to find entries by the source of the sequence. In some cases, the titles and species differ between NRL_3D and the corresponding PDB entry either because the information has been updated or corrected. For example, the PDB SOURCE record occasionally lists the host species of a viral sequence rather than the virus itself, and some PDB COMPND records carry older Enzyme Commission numbers. This series of commands could be used to find the cytochrome oxidases in Brookhaven PDB. USE BASES NRL_3D TITLE CYTOCHROME OXIDASE This would find any sequences from white-tailed deer USE BASES NRL_3D SPECIES WHITE TAILED DEER The information in HELIX, SHEET, TURN, SITE and some ATOM and HETATM records of PDB entries is extracted into NRL_3D features records. To find all author reported segments of type I turns, this set of commands could be sent to the server USE BASES NRL_3D FEATURE TURN "TYPE I " Addition information can be obtained by sending a HELP request to the PIR Network Request Service address. ------------------------------------------------------------------------ Dr. John S. Garavelli Database Coordinator Protein Information Resource National Biomedical Research Foundation Washington, DC 20007 POSTMAST@GUNBRF.BITNET POSTMASTER@NBRF.GEORGETOWN.EDU From owner-software@net.bio.net Mon Mar 01 22:00:00 1993 Path: biosci!CINVESMX.BITNET!APONCE From: APONCE@CINVESMX.BITNET Newsgroups: bionet.software Subject: software for unix (silicon graphics) Message-ID: <01GVBRQOQLCM0000NS@CINVESMX.BITNET> Date: 2 Mar 93 14:45:26 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 7 Hello all: I want to find out information on software for use on Silicon Graphics. DNA sequencing, Image processing, Word processing and graphics. Can anyone provi de me with a directory of most used programs????. Regards. Arturo Ponce. Center for Reserach. Mexico From owner-software@net.bio.net Tue Mar 02 22:00:00 1993 Path: biosci!daresbury!buzz.bmc.uu.se!corax.udac.uu.se!sunic!mcsun!sun4nl!sun2.iend.wau.nl!AGROBERSWORD@rcl.wau.nl From: agrobersword@rcl.wau.nl Newsgroups: bionet.software Subject: Re: Mac database? Message-ID: Date: 2 Mar 93 23:01:40 GMT References: <9303020004.AA14577@umailsrv0.UMD.EDU>,<1993Mar2.030521.11612@news.columbia.edu> Sender: news@sun2.iend.wau.nl (Newsmanager WAU) Reply-To: agrobersword@rcl.wau.nl Distribution: bionet Organization: Wageningen Agricultural University Lines: 17 In article <1993Mar2.030521.11612@news.columbia.edu>, pcj1@cunixf.cc.columbia.edu (Pierre Jelenc) writes: >Is there a simple (flat file) Macintosh database program that uses files >in the dBase format? Barring that, is there a database that can freely >import from and export to the dBase III or IV format? > >Thanks, > >Pierre > >Pierre Jelenc pcj1@columbia.edu > Columbia University, New York Look at Filemaker Pro 2.0 from Claris cooperation. It is a flat file database program wich imports DBase and many mor formats. It also has a supreme way of layouting. God luck Thorsten v. Berswordt E-Mail: agrobersword@rcl.wau.nl From owner-software@net.bio.net Tue Mar 02 22:00:00 1993 Path: biosci!VTHVAX.TAMU.EDU!MCAO From: MCAO@VTHVAX.TAMU.EDU Newsgroups: bionet.software Subject: RE: Using PRIMER-- a software selecting primers Message-ID: <930302110524.2051@VTHVAX.TAMU.EDU> Date: 2 Mar 93 17:05:24 GMT Sender: kristoff@net.bio.net Distribution: bionet Lines: 4 Hi, Do you know where to get this kind of software from public domain? I would like to get one for primer design. Ming Cao From owner-software@net.bio.net Tue Mar 02 22:00:00 1993 Path: biosci!agate!spool.mu.edu!torn!utcsri!helios.physics.utoronto.ca!alchemy.chem.utoronto.ca!fbignone From: fbignone@alchemy.chem.utoronto.ca (Franco Bignone) Newsgroups: bionet.software Subject: hypertext software Keywords: Hypertext Message-ID: <1993Mar3.022331.5297@alchemy.chem.utoronto.ca> Date: 3 Mar 93 02:23:31 GMT Sender: F. Bignone Distribution: bionet Organization: University of Toronto Chemistry Department Lines: 20 I have been looking for a good hypertext system both for PC-DOS machines and UNIX machines (Silicon Graphics) but I find the situation very confusing. I would like to be able to find something similar to DYNATEXT (a very expensive package) with the ability to link, index, and browse: files (ASCII), pictures (GIF, TIF, RGB or wathever), and to be able to edit the files, DYNATEXT despite its price in the 10,000-20,000 range cannot. A program named MEDIAVIEW seems good on paper, but that I understand exists only for the NEXT. Anybody interested in the same problem? A pointer to a site full of programs? I will post a summary at the end of my information search. Franco --------------------------------------------------------------------------- Dr. Franco A. Bignone home (416)932-1706 Physical Chemistry Theory Group bus (416)978-5325 Dept. of Chemistry, University of Toronto, fax (416)978-8775 St. George St., Toronto, Canada M5S1A1. --------------------------------------------------------------------------- From owner-software@net.bio.net Tue Mar 02 22:00:00 1993 Path: biosci!agate!howland.reston.ans.net!gatech!pitt.edu!dsinc!ub!galileo.cc.rochester.edu!crocus.medicine.rochester.edu!ajp2o From: ajp2o@crocus.medicine.rochester.edu (Anthony J. Persechini) Newsgroups: bionet.software Subject: Mol Biol packages for Windows Keywords: windows, biology Message-ID: <1993Mar3.230615.7572@galileo.cc.rochester.edu> Date: 3 Mar 93 23:06:15 GMT Sender: news@galileo.cc.rochester.edu Reply-To: ajp2o@crocus.medicine.rochester.edu Organization: University of Rochester Lines: 12 Nntp-Posting-Host: crocus.medicine.rochester.edu I am interested in identifying a good integrated sytem for display and analysis of DNA and protein sequences. Something sort of analagous to the GCG or MBIR, packages but running under MS Windows on a x86 PC. A good graphical interface is a must. I suspect this is a FAQ of sorts and would be happy to summarize the results here. -- Anthony Persechini Assistant Professor University of Rochester School of Medicine ajp2o@crocus.medicine.rochester.edu From owner-software@net.bio.net Wed Mar 03 22:00:00 1993 Path: biosci!uwm.edu!zaphod.mps.ohio-state.edu!cs.utexas.edu!uunet!mcsun!uknet!comlab.ox.ac.uk!cporter From: cporter@bioch.ox.ac.uk (Chris Porter) Newsgroups: bionet.software Subject: PC framegrabber for documenting ethidium gels Message-ID: <1993Mar4.150921.556@newton.bioch.ox.ac.uk> Date: 4 Mar 93 15:09:21 GMT Organization: Department of Biochemistry, University of Oxford Lines: 21 Originator: cporter@newton.bioch Does anybody have experience of using a cheap PC video frame-grabbing board for the documentation of ethidium bromide-stained gels? We're trying to find a cheap alternative to the commercial solutions. The sort of thing we're looking at is the Media-Pro Plus board connected to a video camera, image processing software and a good quality laser printer (HP 4M or Apple Pro 630). Please let me know of any experience you have with this sort of solution, suggestions for good (cheap) frame grabbers, video cameras and software. Is the quality of the media-pro plus suitable for this sort of application? This is mainly for documentation. We still expect to use Polaroids for publication etc. [If anybody can suggest a Mac based alternative, I'd love to hear about it, but I think that in this case, the PC wins by having cheap frame grabbing boards available.] Thanks, Chris Porter Genetics Laboratory Department of Biochemistry University of Oxford From owner-software@net.bio.net Wed Mar 03 22:00:00 1993 Path: biosci!agate!howland.reston.ans.net!wupost!news.miami.edu!newssun.med.miami.edu!miasun.med.miami.edu!sdorazio From: sdorazio@miasun.med.miami.edu (Sarah Dorazio) Newsgroups: bionet.software Subject: Dayhoff matrix for protein comparisons?? Message-ID: <1993Mar3.225233.19116@newssun.med.miami.edu> Date: 3 Mar 93 22:52:33 GMT Sender: news@newssun.med.miami.edu Distribution: na Organization: University Of Miami, School Of Medicine Lines: 13 Nntp-Posting-Host: miasun.med.miami.edu I have been using the GCG Gap and Bestfit programs to make amino acid sequence comparisons between related proteins. I recently learned that implementing something called the"Dayhoff matrix" would be better for this purpose. Does anyone know how to use this matrix and where I can find it? I would appreciate e-mail responses since I do not read this newsgroup often. Thank You! Sarah D'Orazio (sdorazio@miasun.med.miami.edu) From owner-software@net.bio.net Wed Mar 03 22:00:00 1993 Path: biosci!agate!howland.reston.ans.net!bogus.sura.net!darwin.sura.net!welchgate.welch.jhu.edu!danj From: danj@welchgate.welch.jhu.edu (Dan Jacobson) Newsgroups: bionet.software Subject: Re: Using PRIMER-- a software selecting primers Message-ID: <1993Mar4.142341.25660@welchgate.welch.jhu.edu> Date: 4 Mar 93 14:23:41 GMT References: <930302110524.2051@VTHVAX.TAMU.EDU> Distribution: bionet Organization: Johns Hopkins Univ. Welch Medical Library Lines: 900 In article <930302110524.2051@VTHVAX.TAMU.EDU> MCAO@VTHVAX.TAMU.EDU writes: >Hi, Do you know where to get this kind of software from public domain? I would like to get one for primer design. > > Ming Cao > There are, to my knowledge 4 programs which deal with pcr primer construction which one can obtain by anonymous ftp and one which will be mailed to you by the author. The programs are listed below in no particular order. Pgen - for Dos only Primer - Stanford - Sun Sparcstations only Primer - Whitehead -Unix, Vms, DOS (and Mac if you can compile it) Amplify - Mac only OSP - Unix, X-windows, Vms, DOS, Mac - by snail-mail only. Below is all the info I have on said programs. Hope this helps, Dan Jacobson Kudos go to the authors and the ftp site maintainers. ------------------------------------------------------------------------- Pgen An excerpt from the PrimerGen's documentation: PrimerGen searches strings of amino acid residues in order to reverse-translate oligonucletide primers of a desired range of lengths and maximum number of degeneracies. PrimerGen only works on IBM-PC(TM), XT, AT, PS/2 and compatibles with EGA or VGA graphics adaptors. It will not work on computers with CGA or Hercules(TM) graphics cards. This is because the program alters the screen fonts which cannot be done on the latter types of graphics adaptors. I have no access to XGA card-driven computers, so I don't know what happens there! A hard drive is NOT required and PrimerGen will fit on a 360K 5.25" floppy disk. You need to input: - the appropriate amino acid sequence, - the minimum size of desired primers, - the maximum size of primers (important for codon preference - generated primers), - the maximum acceptable number of mismatches, - desired codon preference table (if required). The program will also supply the melting temperature of the primer. You may input the Na or K cation concentration used in the melting temperature calculations. PrimerGen contains a sequence editor, where amino acid residues are entered. The amino acid sequence must be ONE fragment and cannot be longer than 70 residues. The sequence must be in the ONE LETTER CODE and cannot contain any UNKNOWNS. After the desired amino acid sequence has been entered have the option of saving the sequence to a disk. PrimerGen will also accept and re-edit previously saved sequence files, and also contains a codon preference table editor. anonymous ftp from ftp.bio.indiana.edu in the molbio/ibmpc directory. ============================================================================ //////////////////////////////////////////////////////////////////////////// ============================================================================ Priner - Stanford The program 'primer' is written by Don Faulkner. It helps to find potential mispriming sites (primer sequences should be designed before running the program!). The program allows to give higher weights to matches at the 3' end of the primer, linearly decreasing them towards the 5' end (the default is weight=10 for 3' nucleotide decreasing to 1 at nucleotide # 8 from the 3' end). The program can be used when amplifying *long* fragments from a known sequence. The program is written in "C" and runs on Sun workstation (Unix). To get the program running: %ftp 36.45.0.126 or jmullins.stanford.edu logon: anonymous send your ID as a passwd cd pub set binary get primer.tar .... %tar xvf primer.tar %make primer %primer ... and you should get the sample run, presented below. List of files: -rw-rw-rw- 1 gene 532 Apr 8 18:33 Makefile -rw-rw-rw- 1 gene 1527 Apr 8 17:25 backup.c -rw-rw-rw- 1 gene 14226 Apr 8 17:16 clib.c -rw-rw-rw- 1 gene 6174 May 7 1990 dynamic.c -rw-rw-rw- 1 gene 208 May 7 1990 dynamic.h -rw-rw-rw- 1 gene 2999 Apr 8 17:23 faulkn.h -rw-rw-rw- 1 gene 208 May 7 1990 free.c -rw-rw-rw- 1 gene 5328 May 7 1990 get-matrix.c -rw-rw-rw- 1 gene 580 May 8 1990 hello.c -rw-rw-rw- 1 gene 6679 Jun 5 1990 main.c -rw-rw-rw- 1 gene 245 May 7 1990 matrix-test.c -rw-rw-rw- 1 gene 8609 Apr 8 17:27 name-expander.c -rw-rw-rw- 1 gene 1145 Apr 8 17:25 nread.c -rw-rw-rw- 1 gene 4549 Apr 8 17:16 open_file.c -rw-rw-rw- 1 gene 1629 May 11 1990 position-mat.c -rw-rw-rw- 1 gene 8094 May 11 1990 rdseq.c The file -rw-r--r-- 1 gene 229 Apr 8 18:16 matrix has the following: actg ; this is the character set match = 2 close = match / 2 missm = -match ;a c t g match missm missm missm ;a missm match missm missm ;c missm missm match close ;t missm missm close match ;g These are sample files with several primer sequences and long template: -rw-rw-rw- 1 gene 89 May 11 1990 3_primers -rw-rw-rw- 1 gene 26769 May 11 1990 hxb-inv.seq -rw-r--r-- 1 gene 40 Apr 8 17:31 .primer Sample run is below: %primer ********************* * * * DYNAMIC PRIMERS * * * ********************* Parameters for this search will be taken from the previous one you made OR you can specify new parameters. Weighted search using the Dynamic Programming Algorighm Gap Penalty, or for -2.000000 -> LARGE sequence: Enter name of file containing query sequence, or for hxb-inv.seq -> Locus names in the file : HXB2-INV Enter locus name of query sequence, or for HXB2-INV -> 9719 bases found for locus HXB2-INV in file hxb-inv.seq PRIMER sequence: Enter name of file containing query sequence, or for 3_primers -> Locus names in the file <3_primers>: sbc4 sbc5 sbc6 Enter locus name of query sequence, or for sbc4 -> 19 bases found for locus sbc4 in file 3_primers Locus "HXB2-INV" (len = 9719) against "sbc4" (len = 19) Position weighting matrix: Default is Val=1 from 5' end to position (length-8) linearly increasing to Val=10 at the 3' end of the primer. If you want to CHANGE it enter 'y' Output file: File to write to -> test 2391 maxima #1 score 95.875, 1 gap 4840 AATTTG-TTTTTGTAATTC ****. *.******* 1 CATTTTCCAATGGTAATTC #2 score 95.125, 2 gaps 671 CAGCTGCC--TTGTAAGTC **. *.** *.****.** 1 CATTTTCCAATGGTAATTC #3 score 93.625, 4 gaps 5058 GATTGT---A-GGGAATTC ***.* * **.***** 1 CATTTTCCAATGGTAATTC #4 score 93.625, 4 gaps 5008 AATTTT-C---TTTAATTC ***** * ..****** 1 CATTTTCCAATGGTAATTC #5 score 91.000, 3 gaps 8876 TTTTTTCCCATCGATCTAATTC IT CHAR ****** ** * . ****** 1 CATTTTCCAAT-G-G-TAATTC #6 score 90.000, 5 gaps 1156 CCTCGTTACAATCAAGAGTAAGTC * * .** **** * ****.** 1 CAT-TTTCCAAT---G-GTAATTC #7 score 89.875, 3 gaps 1493 C-TTGCCCATTTATCTAATTC * **. *** *. . ****** 1 CATTTTCCAATG-G-TAATTC #8 score 89.250, 4 gaps 6519 C-TGGT---GTGGTAAGTC * *..* ******.** 1 CATTTTCCAATGGTAATTC #9 score 87.500, 3 gaps 1577 C-TTGTGTAATTGTTAATTTC * **.* ** **.*** *** 1 CATTTTCCAA-TGGTAA-TTC #10 score 87.375, 4 gaps 6575 CTATGCTGCCCTATTTCTAAGTC * **. *. ** **.. ***.** 1 C-ATT-TT-CCAATGG-TAATTC #11 score 87.000, 5 gaps 2724 GAGTTGATACTACTGGCCTAATTC * **. * * * *** ****** 1 CA-TTT-T-CCAATGG--TAATTC If you want to continue press 'y' 10 scores above threshold, 11 unique paths printed Another PRIMER with sequence 'HXB2-INV' - press 'y' If you want to INVERT the LARGE sequence - press 'i' i Sequence 'HXB2-INV' has been inverted PRIMER sequence: Enter name of file containing query sequence, or for 3_primers -> Locus names in the file <3_primers>: sbc4 sbc5 sbc6 Enter locus name of query sequence, or for sbc4 -> 19 bases found for locus sbc4 in file 3_primers Locus "HXB2-INV_INVERTED" (len = 9719) against "sbc4" (len = 19) Position weighting matrix: Default is Val=1 from 5' end to position (length-8) linearly increasing to Val=10 at the 3' end of the primer. If you want to CHANGE it enter 'y' Output file: test File exists: Overwrite, Append, Reenter, or Backup, or for Append -> 2372 maxima #1 score 100.875, 0 gaps 7365 AATTTTTCTACTGTAATTC ***** * * .******* 1 CATTTTCCAATGGTAATTC #2 score 93.500, 3 gaps 9082 GACTGG--AAGGGCTAATTC * *.. **.** ****** 1 CATTTTCCAATGG-TAATTC #3 score 92.500, 5 gaps 4637 CA--GG--AATTTGGAATTC ** .. ** *.*.***** 1 CATTTTCCAA-TGGTAATTC #4 score 89.625, 3 gaps 8043 C-TGTGCC--TTGGAATGC * *.*.** *.*.***.* 1 CATTTTCCAATGGTAATTC #5 score 89.500, 3 gaps 1 ---TGG--AAGGGCTAATTC *.. **.** ****** 1 CATTTTCCAATGG-TAATTC #6 score 83.625, 4 g From owner-software@net.bio.net Wed Mar 03 22:00:00 1993 Path: biosci!agate!howland.reston.ans.net!gatech!europa.eng.gtefsd.com!emory!athena!aisun1.ai.uga.edu!mjuric From: mjuric@aisun1.ai.uga.edu (Mark Juric [MSAI]) Newsgroups: bionet.software Subject: Software for classifying teratogens Keywords: teratogens, classify, software Message-ID: Date: 4 Mar 93 15:36:18 GMT References: <1993Mar3.230615.7572@galileo.cc.rochester.edu> Sender: mjuric@ai.uga.edu Organization: AI Programs, University of Georgia, Athens Lines: 21 Nntp-Posting-Host: aisun1.ai.uga.edu I need some help classifying some compounds, and I was wondering if there is anyone who could point me in the direction of software or texts for this task. I could also use some firm definitions for the following terms: a) Aromatic heterocycles b) Carboaromatic c) Aliphatic (with rings) d) Alicyclic e) Acyclic I am trying to classify a list of compounds according to these catagories. If anyone has any suggestions for classifying and differentiating teratogenic and non-teratogenic compounds according to this or any other scheme, all help would be appreciated. I am not a chemist or a biologist, so if this is a simple problem, please excuse my ignorance... === === @ Mark Juric A.I. Programs @ @ mjuric@ai.uga.edu University of Georgia @ @ Athens, Georgia 30602 @ From owner-software@net.bio.net Wed Mar 03 22:00:00 1993 Path: biosci!agate!howland.reston.ans.net!usc!sol.ctr.columbia.edu!The-Star.honeywell.com!umn.edu!proton.med.umn.edu!milius From: milius@proton.med.umn.edu (Bob Milius (BMEC)) Newsgroups: bionet.software Subject: Re: Software to graph sequence alignments Message-ID: Date: 4 Mar 93 16:20:47 GMT References: <9303020004.AA14577@umailsrv0.UMD.EDU> Sender: news@news.cis.umn.edu (Usenet News Administration) Distribution: bionet Organization: University of Minnesota Lines: 41 Nntp-Posting-Host: proton.med.umn.edu In article <9303020004.AA14577@umailsrv0.UMD.EDU> MAILER-DAEMON@UMAILSRV0.UMD.EDU (Mail Delivery Subsystem) writes: >G'day all, > >I guess that there are very few molecular biologists who have never >had the need to produce an optimal seqeunce aligment or at least >needed to look carefully at one. There are indeed many different >programs available that optimise these seqeunce alignments, the >output of which is usually a series of aligned character strings >with gaps in appropriate places and special characters to denote >identity or similarity. > >What I'm lookng for is a program that will take a pair of aligned >sequences, and plot graphically, either the similarity or identity, >and using a specifible window size, along the entire length of an >alignment. By doing this it would me far easier to see the regions >of high or low similarity/identity and see their relative location >along the length of the alignment. > >Does anyone know of a program to do this ??? > The GCG package contains a program called PLOTSIMILARITY that does what you want. Also I've written a program that I'm calling ZGOR that uses the algorithm of Zvelebil, M.J., et al. J. Mol. Biol 195:957-961 (1987). It takes a family of aligned protein sequences, calculates the conservation index for each position based on Taylor's Venn Diagram of amino acid structural relatedness, then calculates the average GOR secondary structure prediction weighed at each position based on the conservation index. It's still pretty crude, but it seems to work. It's written in ansi C and has been compiled on my Mac using Think C and on the SGI. The output is a tab deliminated text file which can be read by most spreadsheets such as Excel for plotting. It uses Don Gilbert's ReadSeq library routines to read in the sequences. I've only tested it on MSF format files. If you're interested, drop me a note. Bob Milius Biomedical Engineering Center University of Minnesota milius@lenti.med.umn.edu (612) 626-2614 From owner-software@net.bio.net Wed Mar 03 22:00:00 1993 Path: biosci!uwm.edu!wupost!uunet!nih-csl!pico.nimh.nih.gov!user From: wayne@helix.nih.gov (Wayne Rasband) Newsgroups: bionet.software Subject: Re: PC framegrabber for documenting ethidium gels Message-ID: Date: 4 Mar 93 17:45:07 GMT References: <1993Mar4.150921.556@newton.bioch.ox.ac.uk> Sender: postman@alw.nih.gov (AMDS Postmaster) Followup-To: bionet.software Organization: NIH Lines: 15 In article <1993Mar4.150921.556@newton.bioch.ox.ac.uk>, cporter@bioch.ox.ac.uk (Chris Porter) wrote: > > Does anybody have experience of using a cheap PC video frame-grabbing board > for the documentation of ethidium bromide-stained gels? > > [If anybody can suggest a Mac based alternative, I'd love to hear about it, but > I think that in this case, the PC wins by having cheap frame grabbing boards > available.] A Mac based alternative would be to use NIH Image(public domain) and the Scion LG-3 frame grabber($895 list). NIH Image is available by anonymous ftp from zippy.nimh.nih.gov, in the directory .pub/image. --wayne From owner-software@net.bio.net Wed Mar 03 22:00:00 1993 Path: biosci!uwm.edu!wupost!howland.reston.ans.net!gatech!destroyer!cs.ubc.ca!utcsri!torn!nott!cunews!szikopou From: szikopou@superior.carleton.ca (Steven Zikopoulos) Newsgroups: bionet.software Subject: Re: Software for classifying teratogens Keywords: teratogens, classify, software Message-ID: Date: 4 Mar 93 21:50:00 GMT References: <1993Mar3.230615.7572@galileo.cc.rochester.edu> Sender: news@cunews.carleton.ca (News Administrator) Organization: Carleton University Lines: 28 In mjuric@aisun1.ai.uga.edu (Mark Juric [MSAI]) writes: > I need some help classifying some compounds, and I was wondering if there >is anyone who could point me in the direction of software or texts for >this task. I could also use some firm definitions for the following terms: > a) Aromatic heterocycles > b) Carboaromatic > c) Aliphatic (with rings) > d) Alicyclic > e) Acyclic >I am trying to classify a list of compounds according to these catagories. >If anyone has any suggestions for classifying and differentiating teratogenic >and non-teratogenic compounds according to this or any other scheme, all help >would be appreciated. > I am not a chemist or a biologist, so if this is a simple problem, please >excuse my ignorance... >=== === >@ Mark Juric A.I. Programs @ >@ mjuric@ai.uga.edu University of Georgia @ >@ Athens, Georgia 30602 @ A good place to start is an introductory Organic Chemistry and Bio-Chem. text book. Steve Zikopoulos From owner-software@net.bio.net Wed Mar 03 22:00:00 1993 Path: biosci!NBRF.GEORGETOWN.EDU!POSTMASTER From: POSTMASTER@NBRF.GEORGETOWN.EDU Newsgroups: bionet.software Subject: Re: Dayhoff matrix for protein comparisons?? Message-ID: <01GVERL3OL2W9I43UL@NBRF.Georgetown.Edu> Date: 4 Mar 93 16:25:45 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 42 In message <9303041212.AA07559@net.bio.net> Sarah Dorazio (sdorazio@miasun.med.miami.edu) inquires > I have been using the GCG Gap and Bestfit programs to make > amino acid sequence comparisons between related proteins. I > recently learned that implementing something called > the"Dayhoff matrix" would be better for this purpose. > > Does anyone know how to use this matrix and where I can find > it? I would appreciate e-mail responses since I do not read > this newsgroup often. The derivation and uses of the accepted point mutation probability matrices are described in Chapters 22 and 23 of The Atlas of Protein Sequence and Structure, vol. 5, supplement 3 (1978), pp. 345-358. The following data files are available with the standard PIR distribution or from the PIR Network Request Server. filename description -------- ----------- AAAM.MAT McLachlan Alternative Amino Acid Matrix (1971) GCM.MAT Genetic Code Matrix MD.MAT 250 PAM Mutation Data Matrix (1978), Unknowns Ignored MDM150.MAT 150 PAM Mutation Data Matrix (1978), Unknowns Ignored MDM250.MAT 250 PAM Mutation Data Matrix (1978), Unknowns Counted SWF250.MAT 250 PAM Swiss Mutation Data Matrix (1992), x10 SWR250.MAT 250 PAM Swiss Mutation Data Matrix (1992), Rounded To obtain one of these data files from the Network Request Server, send an electronic mail message containing a line like SEND MDM250.MAT to either FILESERV@GUNBRF on BITNET or to FILESERV@NBRF.Georgetown.EDU on Internet. A list of the currently available files can be obtained by sending the command INDEX ------------------------------------------------------------------------ Dr. John S. Garavelli Database Coordinator Protein Information Resource National Biomedical Research Foundation Washington, DC 20007 POSTMAST@GUNBRF.BITNET POSTMASTER@NBRF.GEORGETOWN.EDU From owner-software@net.bio.net Thu Mar 04 22:00:00 1993 Path: biosci!CSC.FI!Rob.Harper From: Rob.Harper@CSC.FI (Rob Harper) Newsgroups: bionet.software Subject: Xmosaic Message-ID: <199303050637.AA16313@csc.fi> Date: 5 Mar 93 06:37:30 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 104 Xmosaic is a nice user friendly interface for the X11/Motif-environment. Xmosaic is based on World Wide Web but has excellent support for other services such as gopher, ftp, WAIS, etc. Xmosaic is one of the best gopher interfaces under Xwindows. The latest Xmosaic can be found on nic.funet.fi:/pub/networking/services/www/xmosaic %%%%%%%%%%%%%%%%%%%%%%%%%% CLIP %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% Beta version 0.9 of NCSA Mosaic for the X Window System, a networked information systems and World Wide Web browser, is hereby released: file://ftp.ncsa.uiuc.edu/Web/xmosaic/xmosaic-0.9.tar.Z This release of NCSA Mosaic is known to compile on the following platforms: SGI (IRIX 4.0.2) IBM (AIX 3.2) Sun 4 (SunOS 4.1.2 with stock X11R4 and Motif 1.1). DEC Ultrix. Binaries for these platforms are available: file://ftp.ncsa.uiuc.edu/Web/xmosaic/binaries-0.9 More binaries will be supplied as I am able to find other Motif-configured platforms to use. (Contributions of working binaries are welcome.) Documentation is available online, but is temporarily out of date (I'll probably bring it up to date this weekend). (Does that look familiar yet???) Changes since 0.8 include: o Some multimedia support. You asked for it... o GIF, JPEG, TIFF, audio, AIFF, DVI, MPEG, MIME, XWD, PostScript automatically recognized. o Pipe to external viewers (with viewers set via X resource mechanism). o Also retrieve images, audio over Gopher. o But not over HTTP (unless you're running a modified HTTP server). o Inlined MIME/multimedia support will be coming down the road, so this is all just a temporary hack. o Transparent handling of compressed (.Z) files. o Hotlist now *always* saved after modification. o Fixed occasional infinite loop/crash for some 8-bit documents. o Fixed various parsing bugs associated with using instead of <plaintext> internally. o Links to specific anchors now work properly. o Fixed bug with failure in repeated accesses via FTP. o Fixed bug with spurious ^M's in Gopher anchors. o Fixed bug opening local file while visiting remote file. o Fixed display bug with punctuation falling off end of line. o Fixed problem with BadAlloc crashes on some servers. o Annotation text features. o Choice of annotation links in header or footer. o Automatic (& fast) updating of annotations on every document view. o New defaultAuthorName resource to override use of normal fullname. o Annotations now always use machine's full name. o Menubar item 'Delete This Annotation'. o Audio annotations (SGI only, so far). o Fixed BadWindow bug for annotation window on DECstations. o All plaintext files can now be annotated. o Fixed occasional problem with size of hotlist/history windows. o Added sample app-defaults files to distribution. o New resources for multimedia stuff: o gifViewerCommand (default 'xv') o jpegViewerCommand (default 'xv') o tiffViewerCommand (default 'xv') o audioPlayerCommand (default 'showaudio' from Metamail distribution) o aiffPlayerCommand (default 'sfplay' -- SGI specific) o dviViewerCommand (default 'xdvi') o mpegViewerCommand (default 'mpeg_play') o mimeViewerCommand (default 'xterm -e metamail') o xwdViewerCommand (default 'xwud -in') o rgbViewerCommand (default 'ipaste' -- SGI specific) o postscriptViewerCommand o Deleted annotations now have all corresponding disk files removed. o Mosaic is smarter about the <plaintext> HTML token at the head of plaintext files. o Lots of little cleanups and bug fixes. We're targeting a 1.0 release around the middle of March, so quick feedback and bug reports will be GREATLY appreciated. Finally, thanks *again* to everyone who's been contributing comments and bug reports -- keep 'em coming! Cheers, Marc & Eric -- Marc Andreessen & Eric Bina Software Development Group National Center for Supercomputing Applications marca@ncsa.uiuc.edu, ebina@ncsa.uiuc.edu From owner-software@net.bio.net Thu Mar 04 22:00:00 1993 Path: biosci!daresbury!buzz.bmc.uu.se!corax.udac.uu.se!sunic!mcsun!Germany.EU.net!ira.uka.de!news.belwue.de!news.uni-tuebingen.de!mailserv!cbkfr01 From: cbkfr01@mailserv.zdv.uni-tuebingen.de (Kai-Uwe Froehlich) Newsgroups: bionet.software Subject: Re: Software to graph sequence alignments Message-ID: <cbkfr01.731319271@mailserv> Date: 5 Mar 93 08:14:31 GMT References: <9303020004.AA14577@umailsrv0.UMD.EDU> Sender: news@softserv.zdv.uni-tuebingen.de (News Operator) Distribution: bionet Organization: Comp. Center (ZDV) U of Tuebingen, FRG Lines: 92 In <9303020004.AA14577@umailsrv0.UMD.EDU> MAILER-DAEMON@UMAILSRV0.UMD.EDU (Mail Delivery Subsystem) writes: >G'day all, >I guess that there are very few molecular biologists who have never >had the need to produce an optimal seqeunce aligment or at least >needed to look carefully at one. There are indeed many different >programs available that optimise these seqeunce alignments, the >output of which is usually a series of aligned character strings >with gaps in appropriate places and special characters to denote >identity or similarity. >What I'm lookng for is a program that will take a pair of aligned >sequences, and plot graphically, either the similarity or identity, >and using a specifible window size, along the entire length of an >alignment. By doing this it would me far easier to see the regions >of high or low similarity/identity and see their relative location >along the length of the alignment. >Does anyone know of a program to do this ??? >BILL Confronted with the problem to produce a graphical output of aligned sequences for an easy visualization of more and of less similar regions, I devised a method which displays the degree of similarity in grades of gray. Each aligned sequence therefore is presented as a bar filled with stripes of different darkness. It provides a very compact graphic result, which is also well suited for sequence presentation in a talk. (This opinion is of course extremely biased, because its just my own. For your own impression have a look at my paper in J. Cell Biol. 144, 443-453 (1991).) The display is not intended for short chunks of sequence (isolated domains, etc.), which reasonably allow for a residue by residue display (as provided, e.g., by Malined), but for the comparision of whole proteins, the stuff which normally provokes a groan of the audience when a slide with thousands of aligned letters is presented. However, I did not produce the graphics with one slick and easy to use program, which could be offered to and used by others, but instead wrote some small Hypercard tools for parts of the process and used Excel and Word (for a lot of search and replace) for the intermediate steps. In short, a tedious procedure. I started to integrate the whole process into a single (Hypercard) program and at the same time to add more flexibility. I put the project on hold ( the total scheme and some modules (Hypercard Xternals for the time-critical steps) are waiting in the drawer) because I realized that there might be already programs around which can perform this task, possibly from a real programmer who hacked them together in a flash. This newsgroup is probably the ideal platform to find out if this is true, or if somebody else would step forward to do it (it would take ME a VERY long time), and if there is really a demand for it. I only hope that the bionet programming gurus are reading my post, too. I have no access to the GCG package, so I wonder if PlotSimilarity, which has been proposed by Steve Thompson, really performs the same task, summing up over a stretch of aa residues, or if its graphic output rather shows single separated residues?? For a short description of my project (which would be a Macintosh Hypercard stack :-): A set of prealigned sequences (ClustalV-output in NBRF/PIR format seems a good standard) is first compared pairwise. The comparision can either check for identity, or using amino acid cross tables, allowing for the consideration of similarities. In the next step, the values of identity/similarity are summed up in a sliding window, the output at this step could also be used to produce a line or area graph with the respective program. The result is converted into a postscript file describing the corresponding bars of grays, including the names of the sequences and optionally a scale. At that stage, a threshold value for minimal degree of identity can be chosen, which emphasizes the regions of homology. This output is in Illustrator format and thus can be further processed or included in a paper. I would really like to produce that program (though it would take me more time than I should reasonably spend on it), but I would hate to find out later-on that the problem either has long been solved or that nobody really has a requirement for the gray-bar stuff. And if somebody would do it faster and on a more platform independent way (but hey, everybody needs a Mac) he shall speak now... I hope for some enlightening response. Kai-Uwe Froehlich, kaifr@mailserv.zdv.uni-tuebingen.de; Physiologisch-chemisches Institut, Hoppe-Seyler-Str. 4, 7400 Tuebingen, Germany From owner-software@net.bio.net Thu Mar 04 22:00:00 1993 Path: biosci!agate!dog.ee.lbl.gov!spindle.ee.lbl.gov!veklerov From: veklerov@spindle.ee.lbl.gov (eugene veklerov) Newsgroups: bionet.software Subject: Re: Software to graph sequence alignments Message-ID: <29406@dog.ee.lbl.gov> Date: 5 Mar 93 21:25:50 GMT References: <9303020004.AA14577@umailsrv0.UMD.EDU> Reply-To: veklerov@spindle.ee.lbl.gov (eugene veklerov) Distribution: bionet Organization: Lawrence Berkeley Laboratory Lines: 13 NNTP-Posting-Host: 128.3.112.82 In article <9303020004.AA14577@umailsrv0.UMD.EDU> MAILER-DAEMON@UMAILSRV0.UMD.EDU (Mail Delivery Subsystem) writes: >What I'm lookng for is a program that will take a pair of aligned >sequences, and plot graphically, either the similarity or identity, >and using a specifible window size, along the entire length of an I have written a program that displays the results of sequence alignment produced by XDAP in a graphical form. Even though the program is pretty straight-forward, our biologists like it, because they do a lot of sequencing and they need to visualize the output. Eugene Veklerov From owner-software@net.bio.net Thu Mar 04 22:00:00 1993 Path: biosci!SMAUG.UCR.EDU!learn From: learn@SMAUG.UCR.EDU (Jerry Learn) Newsgroups: bionet.software Subject: Re: Software to graph sequence alignments Message-ID: <9303051825.AA08920@smaug.ucr.edu> Date: 5 Mar 93 18:25:11 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 40 Kai-Uwe Froehlich responded to Bill Warren's original query: > In <9303020004.AA14577@umailsrv0.UMD.EDU> MAILER-DAEMON@UMAILSRV0.UMD.EDU (Mail Delivery Subsystem) writes: > > >G'day all, > stuff deleted > > >What I'm lookng for is a program that will take a pair of aligned > >sequences, and plot graphically, either the similarity or identity, > >and using a specifible window size, along the entire length of an > >alignment. By doing this it would me far easier to see the regions > >of high or low similarity/identity and see their relative location > >along the length of the alignment. > > >Does anyone know of a program to do this ??? > > >BILL stuff deleted > I have no access to the GCG package, so I wonder if > PlotSimilarity, which has been proposed by Steve Thompson, really > performs the same task, summing up over a stretch of aa residues, > or if its graphic output rather shows single separated residues?? > I can attest that Steve Thompson knows what he's talking about [at least when he is talking about the GCG package 8-) ]. PlotSimilarity does in fact sum over a stretch of residues. The size of this window may be changed by the user. It is a useful program for producing such a graphical output. Jerry Learn learn@smaug.ucr.edu Dept. of Botany & Plant Sciences University of California, Riverside USA From owner-software@net.bio.net Thu Mar 04 22:00:00 1993 Path: biosci!daresbury!buzz.bmc.uu.se!corax.udac.uu.se!sunic!news.lth.se!news.lu.se!pollux.lu.se!q700.plantbio.lu.se!lars.snogerup From: lars.snogerup@plantbio.lu.se (Lars Snogerup) Newsgroups: bionet.software Subject: screen capture program?? Message-ID: <1993Mar5.131717.10854@pollux.lu.se> Date: 5 Mar 93 13:17:17 GMT Sender: news@pollux.lu.se (Owner of news files) Organization: Plant Biochemistry KC. U. of Lund, Sweden Lines: 13 X-Xxmessage-Id: <A7BD11B33901387C@q700.plantbio.lu.se> X-Xxdate: Fri, 5 Mar 93 12:18:27 GMT Nntp-Posting-Host: q700.plantbio.lu.se X-Useragent: Nuntius v1.1.1d12 Hello netters, Does anybody know of a screen capture program that can make screen dumps of open (held down) menues on a Mac under 7.XX ? I need this to make a user guide for the departments Polaroid DIA printer, the manual is not what I would call user friendly so I would like to save some time and not always print everybodys frames. I have tested some programs but they will not take a picture until the menues are released. With best regards Lars S, Plant Biochemistry U of Lund, Sweden.************************************************ Adress: Solvegatan, 35, box 7007, S-220 07 Lund SWEDEN E-mail Lars.Snogerup@plantbio.lu.se Phone# + 46 46 104194, Home# + 46 46 158706 Fax# + 46 46 104116 From owner-software@net.bio.net Fri Mar 05 22:00:00 1993 Path: biosci!daresbury!mrccrc!warwick!pavo.csi.cam.ac.uk!nntp-serv.cam.ac.uk!seb1005 From: seb1005@bio.cam.ac.uk (Steven Brenner) Newsgroups: bionet.software Subject: Re: Xmosaic Message-ID: <SEB1005.93Mar6003115@mbfs.bio.cam.ac.uk> Date: 6 Mar 93 00:29:19 GMT References: <199303050637.AA16313@csc.fi> Sender: news@infodev.cam.ac.uk (USENET news) Distribution: bionet Organization: U of Cambridge, England Lines: 35 In-Reply-To: Rob.Harper@CSC.FI's message of 5 Mar 93 06:37:30 GMT Nntp-Posting-Host: mbfs.bio.cam.ac.uk In article <199303050637.AA16313@csc.fi> Rob.Harper@CSC.FI (Rob Harper) writes: Xmosaic is a nice user friendly interface for the X11/Motif-environment. ... The latest Xmosaic can be found on nic.funet.fi:/pub/networking/services/www/xmosaic ... Binaries for these platforms are available: file://ftp.ncsa.uiuc.edu/Web/xmosaic/binaries-0.9 WOW! I just downloaded the binary this software and am thoroughly amazed. It really comes across as a beautiful package. One gets the impression that "if it's out there, it's in here," here meaning it's in Xmosaic. You can tell, after a little while, that it is still beta software; the main problems I found were "jerky" scrolling and bizarre problems when trying to backspace in an edit field. These are, however, a small price to pay for such a friendly & well-thought-out piece of software. It's simple enough to get and try; I highly recommend it! -- Steven E. Brenner | Internet seb1005@mbfs.bio.cam.ac.uk Department of Biochemistry | JANET seb1005@uk.ac.cam.bio.mbfs University of Cambridge | Laboratory +44 223 333671 Tennis Court Road | Home +44 223 314964 Cambridge CB2 1QW, UK | Lab Fax +44 223 333345 From owner-software@net.bio.net Fri Mar 05 22:00:00 1993 Path: biosci!bcm!cs.utexas.edu!usc!howland.reston.ans.net!agate!stanford.edu!hsdndev!nmr-z!OPAL.MGH.HARVARD.EDU!CHERRY From: cherry@OPAL.MGH.HARVARD.EDU Newsgroups: bionet.software Subject: Re: Dayhoff matrix for protein comparisons?? Message-ID: <1993Mar5.043353.18960@nmr-z.mgh.harvard.edu> Date: 5 Mar 93 04:33:53 GMT References: <1993Mar3.225233.19116@newssun.med.miami.edu> Sender: usenet@nmr-z.mgh.harvard.edu (User for USENET news postings) Reply-To: cherry@OPAL.MGH.HARVARD.EDU Distribution: na Organization: Molecular Biology - Mass Gen Hospital Lines: 25 Nntp-Posting-Host: opal.mgh.harvard.edu In article <1993Mar3.225233.19116@newssun.med.miami.edu>, sdorazio@miasun.med.miami.edu (Sarah Dorazio) writes: >I have been using the GCG Gap and Bestfit programs to make >amino acid sequence comparisons between related proteins. I >recently learned that implementing something called >the"Dayhoff matrix" would be better for this purpose. The GCG Gap and Bestfit programs use the Dayhoff scoring matrix to determine the score of a match. The exact matrix used by GAP and Bestfit are slightly different from the original Dayhoff scoring matrix -- they have been rescaled and normalized. See the comments in the GCG comparison table files called: GENRUNDATA:SWGAPPEP.CMP for GAP GENRUNDATA:NWSGAPPEP.CMP for BESTFIT (The tables and transformation from Dayhoff are the same between these two tables. But GAP uses one and BESTFIT the other.) Another scoring matrix was published last year in Science (1992) 256:1443-1445 by Gonnet et al and is available in GCG format, TEXT file and as a Macintosh Excel table via Anonymous ftp from amber.mgh.harvard.edu in the directory gonnet. Mike From owner-software@net.bio.net Fri Mar 05 22:00:00 1993 Path: biosci!uwm.edu!zaphod.mps.ohio-state.edu!howland.reston.ans.net!hsdndev!nmr-z!OPAL.MGH.HARVARD.EDU!CHERRY From: cherry@OPAL.MGH.HARVARD.EDU Newsgroups: bionet.software Subject: Re: GCG sequence file editing Message-ID: <1993Mar6.151244.24622@nmr-z.mgh.harvard.edu> Date: 6 Mar 93 15:12:44 GMT References: <01GVAQ39MSCK000IMQ@uncvx1.oit.unc.edu>,<zsha.731044065@sanger.bb.iastate.edu> Sender: usenet@nmr-z.mgh.harvard.edu (User for USENET news postings) Reply-To: cherry@OPAL.MGH.HARVARD.EDU Distribution: bionet Organization: Molecular Biology - Mass Gen Hospital Lines: 17 Nntp-Posting-Host: opal.mgh.harvard.edu In article <zsha.731044065@sanger.bb.iastate.edu>, zsha@iastate.edu (Zhengyu Sha) writes: >In <01GVAQ39MSCK000IMQ@uncvx1.oit.unc.edu> BETTS@UNCVX1.BITNET writes: >>Is there a simple way to edit a sequence file written by SEQED so that all >>residues can be converted to CAPS if the current file is a mixture of lower >>and upper case? >>Thanks >>Laurie Betts >>betts@uncvx1.bitnet > >Download the file onto your IBM or Mac, use the Microsoft Word to do the job. Just use the GCG command ONECASE. This will change all the alphabetic characters in a file, it doesn't have to be a sequence file, into lower or upper case. Another option available for ONECASE is for it to capitalize every word. Mike From owner-software@net.bio.net Fri Mar 05 22:00:00 1993 Path: biosci!agate!spool.mu.edu!darwin.sura.net!sgiblab!rpal.rockwell.com!news.cs.indiana.edu!umn.edu!visna.med.umn.edu!ernest From: ernest@visna.med.umn.edu (Ernest Retzel (1535 49118)) Newsgroups: bionet.software Subject: Re: Video Conferencing & Collaborative SW...slick stuff! Message-ID: <C3HFJ2.J1J@news.cis.umn.edu> Date: 6 Mar 93 19:30:15 GMT Sender: news@news.cis.umn.edu (Usenet News Administration) Organization: University of Minnesota Lines: 47 Nntp-Posting-Host: visna.med.umn.edu David Mathog sez... > I've got really mixed feelings about this one. > > On the one hand, this video-conferencing would clearly be very useful. > > On the other hand, if one had to actually buy the bandwidth from ATT, MCI, > Sprint, etc. it would likely be prohibitively expensive, at least for the > video part, although the rest of it doesn't sound too data dense. Dr. > Retzl seems to be implying that this data channel is free, and that may be > a fair approximation for his local LAN. However, if he's referring to the > Internet, the statement isn't correct - we pay for Internet bandwidth > indirectly through our government. Well, I had been hoping for a response a little closer to that which Gopher got ... this one surprised me more than a little ... The only thing that I can really think of to compare David's argument to is that the Interstate Highway System would really be better off if we didn't use it, particularly for trucks, since they wear it out faster than cars do...or if we do keep that system, we should really put it in the hands of the private sector... There are things such as infrastructure which are necessary to the overall good of the country, which can and should be the province of government. They may be one of the few things that government is good at. On the other hand, I was equally surprised, but pleasantly, by the response of our local Telecommunications people, whom I had expected to go through the roof when I told them I would be doing video-conferencing on a routine basis. Their response was that they had been gearing up for this for a long time, and were glad to finally have a prototype to watch to see where they will have to move in order to accommodate it when the scale increases. This was, by the way, acquired mostly for the purposes of collaboration with off-site folks, particularly at Michigan State and at Centers for Disease Control in Atlanta, so, yes, we will be exercising the net. What we won't be doing is acquiring as many Frequent Flier miles..... Somehow, I get the feeling that I am missing something here, but maybe not. But then, we don't write tty interfaces for our programs, either....8^) Ernie Retzel ernest@lenti.med.umn.edu From owner-software@net.bio.net Sat Mar 06 22:00:00 1993 Path: biosci!agate!howland.reston.ans.net!zaphod.mps.ohio-state.edu!saimiri.primate.wisc.edu!usenet.coe.montana.edu!news.u.washington.edu!ns1.nodak.edu!aardvark.ucs.uoknor.edu!aardvark.ucs.uoknor.edu!broe From: broe@aardvark.ucs.uoknor.edu (Bruce Roe) Newsgroups: bionet.software Subject: RNA fingerprint program question Message-ID: <7MAR199307522119@aardvark.ucs.uoknor.edu> Date: 7 Mar 93 13:52:00 GMT Organization: University of Oklahoma - University Computing Services Lines: 19 Nntp-Posting-Host: loopback.uoknor.edu News-Software: VAX/VMS VNEWS 1.41 Lines: 19 Hi all, I've got someone who is doing time-of-flight Mass Spec. and would like to have a program that takes a know RNA sequence, tRNA and/or rRNA, and produces an output containing: a. a list of the fragments obtained by RNAase T1 or RNAaseA digestion and b. the molecular weights of these fragments. Before she goes off and re-invents the wheel, does anyone know of such a program? I am aware of GCG's FINGERPRINT program but it only lists the T1 fragments and does not give the mol. wts. while the Staden NIP program gives di- and tri-nucleotide frequencies. Thanks..........bruce - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - \ Bruce A. Roe Professor of Chemistry and Biochemistry / / University of Oklahoma INTERNET: BROE@aardvark.ucs.uoknor.edu \ - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - From owner-software@net.bio.net Sat Mar 06 22:00:00 1993 Path: biosci!uwm.edu!spool.mu.edu!howland.reston.ans.net!hsdndev!nmr-z!OPAL.MGH.HARVARD.EDU!CHERRY From: cherry@OPAL.MGH.HARVARD.EDU Newsgroups: bionet.software Subject: Re: Video Conferencing & Collaborative SW...slick stuff! Message-ID: <1993Mar7.044031.25058@nmr-z.mgh.harvard.edu> Date: 7 Mar 93 04:40:31 GMT References: <C3HFJ2.J1J@news.cis.umn.edu> Sender: usenet@nmr-z.mgh.harvard.edu (User for USENET news postings) Reply-To: cherry@OPAL.MGH.HARVARD.EDU Organization: Molecular Biology - Mass Gen Hospital Lines: 28 Nntp-Posting-Host: opal.mgh.harvard.edu Ernest Retzel's original message described an interesting use of the Internet--that is digital video conferencing. I first saw this in use at the San Diego Sun Microsystems office. Cameras on the workstations and scattered around their facility allowed any workstation user to visually search for someone or communicate via video with someone else on there network. To be able to use this technology to hold small conferences would be terrific. I'm sure there are many others besides myself that loath taking all day to flight to a meeting. I hope someone is working on standardizing this for the better of us all so we don't have to exclude folks without a Sun. This tread also prompted a discussion between David Mathog and Ernest about whether the Internet should be commericial or public. Of course we all pay for the public form of the current Internet. We all pay for our local and campus connections through our institutional overhead rates or in some other manner but the national backbone and much of the regional networks are publically funded. Information is wealth and it is in the public good to maintain public networks that promote the interconnection of the country. The government should make sure all the country has equal access to this information. At some point in the future I'm sure we will all be paying out of our pockets for services used on the network and not just for the hardware as we do today. I'll close this message without going further into this discussion except to add that the commercialization of the Internet has already started in many ways. Mike Cherry cherry@frodo.mgh.harvard.edu From owner-software@net.bio.net Sat Mar 06 22:00:00 1993 Path: biosci!uwm.edu!spool.mu.edu!sol.ctr.columbia.edu!The-Star.honeywell.com!umn.edu!lenti.med.umn.edu!ernest From: ernest@lenti.med.umn.edu (Ernest Retzel (1535 49118)) Newsgroups: bionet.software Subject: Re: Video Conferencing & Collaborative SW...slick stuff! Message-ID: <C3J8Io.6o3@news.cis.umn.edu> Date: 7 Mar 93 18:54:02 GMT References: <C3HFJ2.J1J@news.cis.umn.edu> <1993Mar7.044031.25058@nmr-z.mgh.harvard.edu> Sender: news@news.cis.umn.edu (Usenet News Administration) Organization: University of Minnesota Lines: 46 Nntp-Posting-Host: lenti.med.umn.edu Mike Cherry says: > Ernest Retzel's original message described an interesting use of the > Internet--that is digital video conferencing. I first saw this in use > at the San Diego Sun Microsystems office. Cameras on the workstations > and scattered around their facility allowed any workstation user to > visually search for someone or communicate via video with someone else > on there network. To be able to use this technology to hold small > conferences would be terrific. I'm sure there are many others besides > myself that loath taking all day to flight to a meeting. I hope > someone is working on standardizing this for the better of us all so > we don't have to exclude folks without a Sun. It really is quite a remarkable use of the tools! I would also mention that BBN is presently porting to HP workstations [not much use to most of us, but easy for them, and let's see...40+% of the market + 40+% of the market is...]; this will be followed by Mac and PC ports, all compatible with each other. There is a pd program out there as well, but for the time being, it is a Sun-only piece of software as well [at least last time I checked]. There have already been nation-wide teleconferences, the most recent of which I recall was that of Clinton's speech at SGI. I am equally enthused about the other software. The groupware concept is really quite amazing; we all know WYSIWIG, and appreciate that--this can be transformed to WYSIWIS [What You See Is What I See]. So suddenly you can share anything you have on [or can get into] a computer--an image, a dataset, a screen, a new display you are working on, an error that you are getting, a slideset you have scanned in, pages from a paper you just edited, you name it--all by just "drag-and-drop"-ing. And then write on it, and point to things in it, and so on and on. In real time, not after file transfer and opening a program. Combined with the video conferencing, it so transforms what we can do that I am sure it will alter the way we do our science, and hopefully sooner rather than later. A good friend and collaborator is a collaborative sw [groupware] type, and their techno-sociologists estimate that less than half of what we do, we do in isolation. Computing, in the environment of the terminal and the personal computer or workstation, has become a solitary experience. But with tools like these, it becomes the instrument of joint adventures. But I am going philosophical... I could have let it go with it will save us a Lot Of Time and flights we don't want to take, and into the bargain, they are pretty much fun to use 8^). Ernie Retzel ernest@lenti.med.umn.edu From owner-software@net.bio.net Sun Mar 07 22:00:00 1993 Path: biosci!parc!decwrl!decwrl!uunet!pipex!warwick!uknet!gdt!bspahh From: bspahh@gdr.bath.ac.uk (Andrew Henry) Newsgroups: bionet.software Subject: Re: Winrefer whereabouts? Message-ID: <1993Mar7.121211.10973@gdr.bath.ac.uk> Date: 7 Mar 93 12:12:11 GMT References: <bio1.117.0@navi.up.ac.za> Organization: School of Biological Sciences, University of Bath, UK Lines: 16 In the referenced article, bio1@navi.up.ac.za (Fourie Joubert) writes: >Hi > >Anyone know where Winrefer 2.x is available? At ftp.cica.indiana.edu (129.79.20.84), in /pub/pc/win/util/wr21.zip -r--r--r-- 1 -2 0 505140 Feb 12 10:45 wr21.zip Alternatively: src.doc.ic.ac.uk (146.169.2.1) /computing/systems/ibmpc/windows3/util/wr21.zip Andrew Henry Sempre Gilles bspahh@gdr.bath.ac.uk From owner-software@net.bio.net Sun Mar 07 22:00:00 1993 Path: biosci!RCF.MAYO.EDU!EBERHARDT From: EBERHARDT@RCF.MAYO.EDU Newsgroups: bionet.software Subject: Re: PAPYRUS for unix? Message-ID: <930308091727.22203524@rcf.mayo.edu> Date: 8 Mar 93 15:17:27 GMT Sender: kristoff@net.bio.net Distribution: bionet Lines: 52 Netters: The following are abbreviated answers and comments and/or follow-up that I received to my request for unix software for reference management. Thanks for your help. "I use BibTeX, which works with TeX, LaTeX, etc." "The troff "refer" system is used by some people for bibliographies, but many Unix people use BibTeX. I use a flat file and a fast workstation!" "I am using roffbib, refer, psroff for my references, but there is also a commercial suite of programs called bibroff (from some Californian university), which looked pretty expensive (for companies)." -----I attempted to contact some people in California, but I haven't been able find out anything about this commercial suite of programs.------ "I know a little about BibTex. The comments that I have seen from anybody other than the devotees are not too glowing, however. It doesn't offer much in the way of formatting your output for different journals, and importing data from something like BRS can be trying." "I'm not 100% certain but I think that PAPYRUS has a version that runs on UNIX. Check with the author, Dave Goldman, at RSD@Applelink.apple.com." -----This does not exist; here is the reply from Dave Goldman: Date: 04 Mar 93 09:51 GMT From: RSD@AppleLink.Apple.COM (Research SW Design, D Goldman,PRT) Subject: Re: PAPYRUS for unix? To: EBERHARDT@RCF.MAYO.EDU Message-Id: <731240012.9706304@AppleLink.Apple.COM> Norman -- Nope, PAPYRUS is currently for DOS or VAX/VMS, and we're hard at work on the Macintosh edition. There might be a UNIX version someday, but not until the Mac and Windows versions. (Actually, if some cross-platform development promises are kept, there might be a UNIX version very shortly after the Windows version. No promises from me, though!) In the meantime, I know that at least a few people are running the DOS version of PAPYRUS under SunPC or other DOS emulators. I haven't gotten much feedback yet about the resulting performance or convenience. -- Dave Goldman Research Software Design From owner-software@net.bio.net Sun Mar 07 22:00:00 1993 Path: biosci!agate!howland.reston.ans.net!zaphod.mps.ohio-state.edu!cs.utexas.edu!uunet!psgrain!ee.und.ac.za!ford.ee.up.ac.za!zeno.up.ac.za!bio1 From: bio1@navi.up.ac.za (Fourie Joubert) Newsgroups: bionet.software Subject: Epitope search Message-ID: <bio1.128.0@navi.up.ac.za> Date: 8 Mar 93 07:28:18 GMT Organization: University of Pretoria Lines: 15 NNTP-Posting-Host: zeno.up.ac.za Hi Does anybody know of a shareware program that searches sequences for possible immunological epitopes. Please mail me at: bio1@navi.up.ac.za Thanks a lot! __________________________________________________________________________ _/_/_/_/ _/_/_/_/_/ Fourie Joubert _/ _/ Department of Biochemistry _/ _/ University of Pretoria _/_/_/_/ _/ bio1@navi.up.ac.za _/ _/ _/ _/_/_/_/ __________________________________________________________________________ From owner-software@net.bio.net Sun Mar 07 22:00:00 1993 Path: biosci!agate!spool.mu.edu!uunet!pipex!bnr.co.uk!uknet!edcastle!sss From: sss@castle.ed.ac.uk (S S Sturrock) Newsgroups: bionet.software Subject: Re: rate of growth of the sequence databases Message-ID: <32686@castle.ed.ac.uk> Date: 8 Mar 93 13:34:34 GMT References: <73E0FEC5429F007D61@HKUMD1.HKU.HK> Distribution: bionet Organization: Edinburgh University Lines: 76 In article <73E0FEC5429F007D61@HKUMD1.HKU.HK> HRMBDKC@HKUMD1.HKU.HK writes: >I'd like some information about the rate of growth of the sequence >databases both in the past and projections for the future. This is Generally it is accepted that databases are growing exponentially, doubling times around 18 months. Often this information is put in the release notes for a particular database. Also, note many databases are now available for free or on CD-ROM for a small charge (eg EMBL) and so you need not be limited to the databases that a particular software company see fit to supply in their particular format. Add to this updates available on FTP and things can get interesting. >a serious consideration when setting up one's own on -site database >a serious consideration when subscribing to the database services >currently available. This is also a consideration in deciding which >type of main-frame system to go for. Always a difficult choice and the wide range of available software and systems not to mention the vast amount of wild claims made for sensitivity and such like of differing systems/code make this a near impossible question to answer. Database size is really just a matter of disc space unless you are dealing with specific implementations of searching code where memory requirements may obsolete the machine you buy very quickly or certainly put you in line for large memory upgrades, not that manufacturers would complain. Also, as databases increase in size the time taken to search will increase (obviously) and so your hardware may also be obsolete quickly. Depending on how rigorous you want to be in searches or whatever you can go for the variety of heuristic algorithms such as FASTA or BLAST which allow for quick searches on cheap machines but may or may not miss some interesting alignments. For many cases you may not see any difference. Also, there are various implementations of the classic Smith & Waterman exhaustive dynamic algorithm which compares every base/residue in the database with every one in the query thus is time consuming and can be very slow. Again, it depends on who wrote the code, I know of implementations of the same algorithm which can be orders of magnitude different in performance on the same hardware thus claims that heuristic methods may be much faster than the exhaustive algorithm depends on which implementation of that algorithm was compared against it. That's the long answer, the short answer is that you just can't tell, new hardware is coming along at a rate of knots and implementations of code on these platforms takes time with various people claiming speed records and someone always waiting in the wings to go faster on some other machine, especially true with parallel architectures. You must also consider that if you buy software you are going to be paying for support which needs to be budgeted for each year. The popular suites such as GCG offer a huge array of functions/routines for a reasonable price of course performance will suffer since this is normally run on low performance hardware. This isn't really helping much is it? Either way, it's going to cost in time or money. Assess just what your users want and how patient they are willing to be, or in many cases how likely it is that they will use the software to best effect if it takes several hours to see the results of changing one parameter thus making them more likely to take defaults. IMHO this can lead to people not finding all the possible clues to homology that are available given a little time and tinkering. Most of all, don't just assume that since a computer gave these results they are the gospel truth, the code is produced by programmers and may be biased in terms of weighting schemes, significances of results etc etc etc. There are programs out there which can produce very convincing results which are just plain wrong but how can you tell? It is a well known fact that *ALL* code contains bugs, how dangerous these are depends on how long they go unseen. Well supported software should (I stress *SHOULD*) be mature enough to have a low level of errors and rapid corrections. I hope this helps. PS: Disclaimer. These are my own personal views and are not necessarily shared by my employers. -- Shane Sturrock, Biocomputing Research Unit, Darwin Building, Mayfield Road, University of Edinburgh, Scotland, Commonwealth of Independent Kingdoms. :-) Civilisation is a Haggis Supper with salt and sauce and a bottle of Irn Bru. From owner-software@net.bio.net Sun Mar 07 22:00:00 1993 Path: biosci!uwm.edu!spool.mu.edu!uunet!mcsun!news.funet.fi!funic!convex!harper From: harper@convex.csc.FI (Rob Harper) Newsgroups: bionet.software Subject: Re: Video Conferencing & Collaborative SW...slick stuff! Message-ID: <1993Mar8.124805.24570@nic.funet.fi> Date: 8 Mar 93 12:48:05 GMT References: <C3HFJ2.J1J@news.cis.umn.edu> <1993Mar7.044031.25058@nmr-z.mgh.harvard.edu> Sender: usenet@nic.funet.fi Organization: Finnish Academic and Research Network Project - FUNET Lines: 665 Nntp-Posting-Host: convex.csc.fi For those of you who would like to know more about Multicasting then here is the MBONE faq file. It has got lots of hints on how to get started and where to pick up free software for video conferencing, and tells you how to tune in to broadcasts on the net... experimental stuff, but very interesting. %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% CLIP %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% Frequently Asked Questions (FAQ) on the Multicast Backbone (MBONE) ------------------------------------------------------------------ Steve Casner, casner@isi.edu, 16-Jan-93 *** This file is venera.isi.edu:mbone/faq.txt *** *** Corrections and Additions Requested *** * What is the MBONE? The MBONE is an outgrowth of the first two IETF "audiocast" experiments in which live audio and video were multicast from the IETF meeting site to destinations around the world. The idea is to construct a semi-permanent IP multicast testbed to carry the IETF transmissions and support continued experimentation between meetings. This is a cooperative, volunteer effort. The MBONE is a virtual network. It is layered on top of portions of the physical Internet to support routing of IP multicast packets since that function has not yet been integrated into many production routers. The network is composed of islands that can directly support IP multicast, such as multicast LANs like Ethernet, linked by virtual point-to-point links called "tunnels". The tunnel endpoints are typically workstation-class machines having operating system support for IP multicast and running the "mrouted" multicast routing daemon. * How do IP multicast tunnels work? IP multicast packets are encapsulated for transmission through tunnels, so that they look like normal unicast datagrams to intervening routers and subnets. Currently, the encapsulation takes the form of source routing. The multicast router modifies the packet by appending an IP Loose Source Route option to the packet's IP header. The multicast destination address is moved into the source route, and the unicast address of the router at the far end of the tunnel is placed in the IP Destination Address field. Thus, normal unicast routing carries the packet to the other end of the tunnel where the multicast router restores the original multicast destination address and deletes the source route before forwarding the packet. The presence of the IP LSR option may cause modern router hardware to divert the tunnel packets through a slower software processing path, causing poor performance. Therefore, the tunneling mechanism will soon be changed to use true IP encapsulation in which an additional IP header is prepended with the source and destination addresses of the endpoints of the tunnel, then stripped at the other end. For backward compatibility, both methods of tunnel encapsulation could coexist on separate tunnels. * What is the topology of the MBONE? We anticipate that within a continent, the MBONE topology will be a combination of mesh and star: the backbone and regional (or mid-level) networks will be linked by a mesh of tunnels among mrouted machines located primarily at interconnection points of the backbones and regionals. Some redundant tunnels may be configured with higher metrics for robustness. Then each regional network will have a star hierarchy hanging off its node of the mesh to fan out and connect to all the customer networks that want to participate. Between continents there will probably be only one or two tunnels, preferably terminating at the closest point on the MBONE mesh. In the US, this may be on the Ethernets at the two FIXes (Federal Internet eXchanges) in California and Maryland. But since the FIXes are fairly busy, it will be important to minimize the number of tunnels that cross them. This may be accomplished using IP multicast directly (rather than tunnels) to connect several multicast routers on the FIX Ethernet. * How is the MBONE topology going to be set up and coordinated? The primary reason we set up the MBONE e-mail lists (see below) was to coordinate the top levels of the topology (the mesh of links among the backbones and regionals). This must be a cooperative project combining knowledge distributed among the participants, somewhat like Usenet. The goal is to avoid loading any one individual with the responsibility of designing and managing the whole topology, though perhaps it will be necessary to periodically review the topology to see if corrections are required. The intent is that when a new regional network wants to join in, they will make a request on the appropriate MBONE list, then the participants at "close" nodes will answer and cooperate in setting up the ends of the appropriate tunnels. To keep fanout down, sometimes this will mean breaking an existing tunnel to inserting a new node, so three sites will have to work together to set up the tunnels. To know which nodes are "close" will require knowledge of both the MBONE logical map and the underlying physical network topology, for example, the physical T3 NSFnet backbone topology map combined with the network providers' own knowledge of their local topology. Within a regional network, the network's own staff can independently manage the tunnel fanout hierarchy in conjunction with end-user participants. New end-user networks should contact the network provider directly, rather than the MBONE list, to get connected. * What is the anticipated traffic level? The traffic anticipated during IETF multicasts is 100-300Kb/s, so 500Kb/s seems like a reasonable design bandwidth. Between IETF meetings, most of the time there will probably be no audio or video traffic, though some of the background session/control traffic may be present. A guess at the peak level of experimental use might be 5 simultaneous voice conversations (64Kb/s each). Clearly, with enough simultaneous conversations, we could exceed any bandwidth number, but 500Kb/s seems reasonable for planning. Note that the design bandwidth must be multiplied by the number of tunnels passing over any given link since each tunnel carries a separate copy of each packet. This is why the fanout of each mrouted node should be no more than 5-10 and the topology should be designed so that at most 1 or 2 tunnels flow over any T1 line. While most MBONE nodes should connect with lines of at least T1 speed, it will be possible to carry restricted traffic over slower speed lines. Each tunnel has an associated threshold against which the packet's IP time-to-live (TTL) value is compared. By convention in the IETF multicasts, higher bandwidth sources such as video transmit with a smaller TTL so they can be blocked while lower bandwidth sources such as compressed audio are allowed through. * Why should I (a network provider) participate? To allow your customers to participate in IETF audiocasts and other experiments in packet audio/video, and to gain experience with IP multicasting for a relatively low cost. * What technical facilities and equipment are required for a network provider to join the MBONE? Each network-provider participant in the MBONE provides one or more IP multicast routers to connect with tunnels to other participants and to customers. The multicast routers are typically separate from a network's production routers since most production routers don't yet support IP multicast. Most sites use workstations running the mrouted program, but the experimental MOSPF software for Proteon routers is an alternative (see MOSPF question below). It is best if the workstations can be dedicated to the multicast routing function to avoid interference from other activities and so there will be no qualms about installing kernel patches or new code releases on short notice. Since most MBONE nodes other than endpoints will have at least three tunnels, and each tunnel carries a separate (unicast) copy of each packet, it is also useful, though not required, to have multiple network interfaces on the workstation so it can be installed parallel to the unicast router for those sites with configurations like this: +----------+ | Backbone | | Node | +----------+ | ------------------------------------------ External DMZ Ethernet | | +----------+ +----------+ | Router | | mrouted | +----------+ +----------+ | | ------------------------------------------ Internal DMZ Ethernet (The "DMZ" Ethernets borrow that military term to describe their role as interface points between networks and machines controlled by different entities.) This configuration allows the mrouted machine to connect with tun From owner-software@net.bio.net Sun Mar 07 22:00:00 1993 Path: biosci!IRRI.CGNET.COM!RSCOTT From: RSCOTT@IRRI.CGNET.COM (RPSCOTT) Newsgroups: bionet.software Subject: (none) Message-ID: <01GVKDC4SH6800049V@irri.cgnet.com> Date: 8 Mar 93 04:36:17 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 3 Please cancel my subscription. Thanks. RPScott e-mail: rscott@irri.cgnet.com From owner-software@net.bio.net Sun Mar 07 22:00:00 1993 Path: biosci!uwm.edu!wupost!darwin.sura.net!welchgate.welch.jhu.edu!danj From: danj@welchgate.welch.jhu.edu (Dan Jacobson) Newsgroups: bionet.software Subject: Re: Epitope search Message-ID: <1993Mar8.154212.13957@welchgate.welch.jhu.edu> Date: 8 Mar 93 15:42:12 GMT References: <bio1.128.0@navi.up.ac.za> Organization: Johns Hopkins Univ. Welch Medical Library Lines: 58 In article <bio1.128.0@navi.up.ac.za> bio1@navi.up.ac.za (Fourie Joubert) writes: >Hi > >Does anybody know of a shareware program that searches sequences for >possible immunological epitopes. Please mail me at: bio1@navi.up.ac.za > Three programs which come to mind are Epiplot, Tsites, and Seqaid. Epiplot and Tsites are programs devoted specifically for epitope prediction, Seqaid is a general sequence utlity program with several functions, one of which is epitope prediction. Seqaid and Epiplot are for PCs (DOS), Tsites has a Mac version and probably a DOS version. You can ftp Epiplot from: Host evolution.bchs.uh.edu Location: /pub/gene-server/dos FILE -rwxr--r-- 129317 Sep 16 1991 epiplot.uue You can ftp seqaid from: Host fly.bio.indiana.edu Location: /molbio/ibmpc FILE -rw-r--r-- 324175 May 14 1991 seqaidfd.uue Host genbank.bio.net Location: /pub/dos FILE -rw-rw-r-- 6167 Oct 26 1989 seqaid.doc FILE -rw-rw-r-- 324175 Jul 14 1989 seqaidfd.uue Host nic.funet.fi Location: /pub/sci/molbio/msdos FILE -rw-r--r-- 251259 Feb 3 00:00 seqaid.exe FILE -rw-rw-r-- 305448 Jun 23 1991 seqaid37.shar FILE -rw-r--r-- 73370 Feb 3 00:00 seqaidfd.exe There is no ftp site for Tsites that I know of, you can obtain it for free by writing to: MedImmune, Inc 19 Firstfield Rd. Gaithersburg, MD 20878 (USA) Best of luck, Dan Jacobson danj@welchgate.welch.jhu.edu From owner-software@net.bio.net Mon Mar 08 22:00:00 1993 Path: biosci!uwm.edu!zaphod.mps.ohio-state.edu!sdd.hp.com!think.com!hsdndev!husc-news.harvard.edu!husc-news!evensen From: evensen@husc10.harvard.edu (Erik Evensen) Newsgroups: bionet.software Subject: software for drawing ribbon structures of proteins Message-ID: <EVENSEN.93Mar8183051@husc10.harvard.edu> Date: 8 Mar 93 23:30:51 GMT Distribution: bionet Organization: Harvard Arts and Sciences Computer Services, Cambridge, MA Lines: 6 Nntp-Posting-Host: husc10.harvard.edu Can anyone give me a pointer to software (as cheap as possible) for drawing ribbon or cartoon diagrams of proteins - I'm talking about the things that beta structure as flat arrows and helices as ribbons wound around cylinders. Thanks in advance --Erik From owner-software@net.bio.net Mon Mar 08 22:00:00 1993 Path: biosci!bcm!cs.utexas.edu!natinst.com!news.dell.com!swrinde!zaphod.mps.ohio-state.edu!uwm.edu!spool.mu.edu!uunet!munnari.oz.au!ariel.ucs.unimelb.EDU.AU!ucsvc.ucs.unimelb.edu.au!wehi.edu.au!chai_z From: chai_z@wehi.edu.au Newsgroups: bionet.software Subject: Re: BLAST Message-ID: <1993Mar5.164505.24912@wehi.edu.au> Date: 5 Mar 93 06:45:05 GMT References: <1993Mar2.120540.1382@gserv1.dl.ac.uk> Distribution: bionet Organization: Walter & Eliza Hall Institute Lines: 35 In article <1993Mar2.120540.1382@gserv1.dl.ac.uk>, risler@cgmvax.cgm.cnrs-gif.fr writes: > > Dear fellow netters, > > Like many of you, I use BLAST at NCBI for searching sequence databanks. > Like many of you, I don't like using programs when I don't understand what > (and how) they do. > Hence I've tried to read the original papers about BLAST and, in particular, > I've tried to understand how they compute the probability P(N) associated > with a given score. I must confess that I failed to fully understand, either > because I'm just stupid and/or because it is not clearly written. In any > case, I thought that P(N) was computed from the figures obtained by a very > large number of simulations. If this was true, then this probability should > be the same for the same hit whatever the databank used. > > A colleague of mine recently searched a protein sequence with BLAST against > the "non-redundant protein databank" and against Swissprot. She got in both > cases the same hit with the same score, but with different probabilities. > With the non-redundant database P(N) was 0.84 and with Swissprot P(N) was > 0.51. The segment pairs were exactly the same in both cases. > > Could somebody help me understand? > > Thank you, > > -------------------------------------------------------------------- > | Jean-Loup Risler | | > | CNRS | risler@frcgm51.bitnet | > | Centre de Genetique Moleculaire | risler@cgmvax.cgm.cnrs-gif.fr | > | 91198 Gif sur Yvette Cedex France | | > -------------------------------------------------------------------- 1 From owner-software@net.bio.net Mon Mar 08 22:00:00 1993 Path: biosci!uwm.edu!spool.mu.edu!howland.reston.ans.net!newsserver.jvnc.net!synapse.bms.com!riversend.bms.com!user From: Roberts_D@BMS.COM (DAN ROBERTS) Newsgroups: bionet.software Subject: MacIMDAD MOLECULAR MODELING Message-ID: <Roberts_D-090393150310@riversend.bms.com> Date: 9 Mar 93 20:07:16 GMT Sender: news@synapse.bms.com Followup-To: bionet.software Organization: Bristol-Myers-Squibb Research Lines: 9 Is anybody out there usinf the Molecular Modeling Program called MacIMDAD???...If so, I would like to hear your opinion about the program./..thanks......Dan