From owner-software@net.bio.net Sat May 01 23:00:00 1993 Path: biosci!agate!howland.reston.ans.net!ira.uka.de!math.fu-berlin.de!mailgzrz.TU-Berlin.DE!news.netmbx.de!Germany.EU.net!mcsun!news.funet.fi!funic!nic.funet.fi!csc.fi!harper From: Rob.Harper@csc.fi (Rob Harper) Newsgroups: bionet.software Subject: Msdos uploads to Simtel 20 during april 1993 Message-ID: <199305021545.AA27202@csc.fi> Date: 2 May 93 15:45:36 GMT Sender: root@nic.funet.fi (The FUnny NET guru) Organization: Finnish University & Research Network Lines: 482 >Path: funic!news.funet.fi!news.tele.fi!uunet!wupost!tacom-emh1.army.mil!msdos-ann-request >From: w8sdz@TACOM-EMH1.Army.Mil (Keith Petersen) >Newsgroups: comp.archives.msdos.announce >Subject: msdos uploads to SIMTEL20 during the month of April, 1993 >Summary: 268 new files were added >Keywords: simtel20,msdos,uploads,monthly,april >Message-ID: <9305020338.kp23751@tacom-emh1.army.mil> >Date: Sun, 2 May 1993 03:38:09 GMT >Followup-To: comp.archives.msdos.d >Sender: msdos-ann-request@tacom-emh1.army.mil >Organization: The SIMTEL20 Archives >Approved: w8sdz@tacom-emh1.army.mil >Lines: 467 File PD1:UPLOADS.APR Created: May 1, 1993 NOTE: This file is also available in comma-delimited format as SIM9304.IDX MSDOS FILES UPLOADED TO WSMR-SIMTEL20.ARMY.MIL during the month of April 1993 NOTE: Type B is Binary; Type A is ASCII Filename Type Length Date Description ============================================== Directory PD1: 4FILE2U9.ZIP B 75070 930430 4DOS file management tool & description editor EZ-BTM06.ZIP B 51200 930427 4DOS BTM files: loaders/regular/libraries/help Directory PD1: AC300.ZIP B 103250 930430 Converts between compressed archive formats ACZAR100.ZIP B 332101 930412 Archive shell for ZIP,LZH,ARJ,PAK,ARC,ZOO,SCAN AM92.ZIP B 198718 930419 ArcMaster front-end/convrt for ARC/ARJ/LZH/ZIP AT780E.ZIP B 103706 930430 Archive shell for ARC/LZH/PAK/PKA/LBR/ZOO/ZIP Directory PD1: AXO_10.ZIP B 18487 930429 Oblique axonometry of DXF files ver. 10,11,12 HPGLPRL.ZIP B 5168 930429 Perl scripts convert HPGL to AutoCAD DXF/SCR VOLARE10.ZIP B 18979 930429 Volume & area of DTM from DXF file w/3DFACES Directory PD1: BLTQ13.ZIP B 212707 930423 BULLET database toolkit v1.03 for BASIC Directory PD1: RETURNTO.ZIP B 2311 930407 .BAT files for auto-return to starting drv/dir XSET300.ZIP B 106570 930407 Put ANYTHING in a variable of current envir. Directory PD1: FLSORT11.ZIP B 12050 930407 Very fast BBS file list sorting utility JVAS109.ZIP B 60610 930410 JVArcServ v1.09: 'Archie' server for FidoNet KM295E.ZIP B 115294 930405 Kmail: QWK-compatible mail door for PCBoard LSTGEN15.ZIP B 13550 930407 Generates ALLFILES.LST from BBS file lists Directory PD1: CHERI251.ZIP B 126943 930420 Chat simulation door v2.51 for PCBoard BBSs NBROW150.ZIP B 49379 930407 BBS door that allows users to search nodelists PRFL108.ZIP B 37348 930407 BBS door which allows users to enter profiles Directory PD1: USBBS107.ZIP B 90163 930405 Darwin's nationwide IBM BBS listing, Apr. 1993 Directory PD1: BEAV140.ZIP B 94313 930416 Binary file editor, many features and options BEAV140S.ZIP B 152633 930416 Binary file editor, C source, PC, UNIX, Amiga Directory PD1: ACTIVATE.ZIP B 14715 930416 Select hard disk partition while booting Directory PD1: ACTLIB12.ZIP B 151759 930402 General purpose libraries C/C++ programmers BLTC13.ZIP B 150186 930423 BULLET database toolkit v1.03 for DOS C CRNCHR22.ZIP B 72704 930414 C Libs - FFT,Wavelet,Coherence,Filter,Regr.etc JULCAL10.ZIP B 20443 930429 C language sources for Julian date programs Directory PD1: LASI412A.ZIP B 308682 930401 LASI v4.12 IC layout CAD prgm; unzip in \lasi4 LASI412B.ZIP B 332472 930401 LASI v4.12 IC layout CAD prgm; unzip in \lasi4 LASI412C.ZIP B 279824 930401 LASI v4.12 IC layout CAD prgm; unzip in \lasi4 Directory PD1: EASTER11.ZIP B 4461 930430 Calculates the date of Easter in any year SM22A.ZIP B 321321 930423 Math/Chemistry symbolic calculator w/learning TSJOG14.ZIP B 23846 930418 Simple calculator/pacer for jogging enthusiast Directory PD1: CHKCDR11.ZIP B 28073 930430 Checks and displays CD-ROM information Directory PD1: CCL100JE.ZIP B 25080 930423 DOS coroutine class library for Borland C++ STRPP300.ZIP B 78918 930412 String++ 3.0: string class for Borland C++ Z31P1_6.ZIP B 94376 930405 Zortech C++ v3.1 compiler patches 01 thru 06 Directory PD1: FORMGET1.ZIP B 22368 930430 Versatile form data entry tool in batch files SCHOP11.ZIP B 32431 930410 Optimizes schedules based on your preferences Directory PD1: CAL26.ZIP B 14730 930405 Enhanced Unix-like 'cal' monthly calendar MYADRSBK.ZIP B 42631 930407 AddressBook/Write Letters/MailMerge/PrintLists REM10.ZIP B 49899 930414 Reminds users of important dates and events WUK21.ZIP B 266348 930426 Organizes and prints names, phones, and dates Directory PD1: DDEL200.ZIP B 9606 930407 DIRDEL v2.00 - deletes non-empty directories DIRCM304.ZIP B 95286 930402 Like DOS REPLACE command with delete option DIRTO304.ZIP B 158296 930402 Directory listing and totaller FFF43.ZIP B 147293 930423 Derr's FileFinder 4.3, performs fuzzy search FILEMV06.ZIP B 6747 930406 Fast and safe file move tool FILUP304.ZIP B 50786 930402 Copy updated files based on a control list FIND221.ZIP B 31496 930407 Gavin's fast file finder for DOS 3 and higher LF34.ZIP B 23756 930402 Find files on any drive/optionally execute cmd STRUZFDA.ZIP B 15223 930416 Struz's file and directory attribute utility VADOL_CD.ZIP B 11602 930405 Vadol Change Directory: Easy CD, quick access Directory PD1: 486DIS_C.ZIP B 11896 930420 TC source for 486 code stream disassembler OBJ2ASM.ZIP B 76823 930420 TC Source for intelligent .OBJ disassembler Directory PD1: COPYQ305.ZIP B 91574 930430 Fast multiple disk format/copy/verify. SYDEX DIM14A.ZIP B 76357 930419 Disk image archiver, copyer w/password prot. FILL304.ZIP B 101547 930402 Stuffs as many files as possible on disk HICOPY25.ZIP B 73742 930420 High density disk copier, mapping on hard disk MFA10.ZIP B 23224 930427 Allocates files on diskettes space-efficiently QKOPY321.ZIP B 49972 930423 Quikcopy v3.21: Quick file/diskette copier SPKT460S.ZIP B 291524 930412 HyperDisk disk cache w/HyperKey & HyperScreen ST2DOS10.ZIP B 16127 930418 Make Atari ST written floppies DOS-readable Directory PD1: ADAMI93.ZIP B 172148 930413 Tamil word processer / VGA video titler BREEZE50.ZIP B 318962 930426 BREEZE v5.0 word processor/text editor EVOLV104.ZIP B 97142 930426 Source code structure editor in outline form MR250.ZIP B 174509 930405 MindReader intelligent text editor w/spell chk TDE221.ZIP B 342042 930414 PD multi-window/file bin & text ed w/ C & asm VIM127X.ZIP B 162394 930427 VI editor clone with undo, help, macros & more VISED35.ZIP B 408830 930407 Text Editor, multiple windows, mouse support XNOT.ZIP B 365786 930429 Fast EMACS-type editor for MS-Windows,NT,Unix Directory PD1: MATHPR01.ZIP B 55151 930405 Math practice (+-*/) for 1st thru 4th graders Directory PD1: DISLT115.ZIP B 27913 930403 DISLITE, expands all PKLITEd files to original UNP301.ZIP B 19606 930416 Unpacks all kinds of compressed executables Directory PD1: CDROM.INF A 813 930421 Where to obtain SIMTEL20 files on CD-ROM DOWNLOAD.INF A 2836 930421 How to get SIMTEL20 files via telephone modem MAILSERV.INF A 3119 930421 List of e-mail servers offering SIMTEL20 files OAKFTP02.ZIP B 2585 930403 From owner-software@net.bio.net Sat May 01 23:00:00 1993 Path: biosci!agate!howland.reston.ans.net!ira.uka.de!math.fu-berlin.de!mailgzrz.TU-Berlin.DE!news.netmbx.de!Germany.EU.net!mcsun!news.funet.fi!funic!nic.funet.fi!csc.fi!harper From: Rob.Harper@csc.fi (Rob Harper) Newsgroups: bionet.software Subject: tkWWW for editing HTML Message-ID: <199305021551.AA27289@csc.fi> Date: 2 May 93 15:51:13 GMT Sender: root@nic.funet.fi (The FUnny NET guru) Organization: Finnish University & Research Network Lines: 67 >Xref: funic alt.hypertext:1790 comp.lang.tcl:3880 comp.infosystems:1136 comp.infosystems.gopher:3830 comp.text.sgml:2172 >Path: funic!news.funet.fi!news.tele.fi!uunet!think.com!enterpoop.mit.edu!senator-bedfellow.mit.edu!athena.mit.edu!joe >From: joe@athena.mit.edu (Joseph C Wang) >Newsgroups: alt.hypertext,comp.lang.tcl,comp.infosystems,comp.infosystems.gopher,comp.text.sgml >Subject: Announcing tkWWW-0.7, the first WYSIWYG X11 HTML editor >Date: 2 May 1993 03:13:56 GMT >Organization: Massachusetts Institute of Technology >Lines: 58 >Message-ID: <1rve9kINNd3a@senator-bedfellow.MIT.EDU> >NNTP-Posting-Host: theodore-sturgeon.mit.edu tkWWW Version 0.7 alpha (joe@athena.mit.edu) -------------------------------------------- WHAT IS THIS? ------------- World Wide Web (WWW) is a hypertext project which seeks to build a world wide network of hypertext links. There are several different browsers for this system including a simple tty interface. For a demo of the terminal browsers for WWW, telnet to the following sites: telnet info.cern.ch or telnet 128.141.201.74 (SWISS) telnet eies2.njit.edu or telnet 128.235.1.43 (USA [NJ]) telnet vms.huji.ac.il or telnet 128.139.4.3 (ISRAEL) telnet info.funet.fi or telnet 128.214.6.100 (FINLAND) and login as "www" Tk is an interpreted toolkit which allows one to build X11 applications quickly and easily. tkWWW is a Tk interface to (WWW). it is very easy to make modifications and extensions to the system. tkWWW is the first X11 browser with the ability to edit HTML!!!!! What has changed since 0.6? --------------------------- Rough WYWSIWYG editor!!!!!!!!!!! (with help from Nathan Torkington ) Bug fixes courtesy of Jon Hurley (jhn@biosym.com) Uses www library version 2.0 Can now grab images over gopher Added ability to start in iconic mode Where is this? -------------- tkWWW 0.7 can be anon ftp'ed from export.lcs.mit.edu:/contrib/tkWWW-0.7.tar.Z harbor.ecn.purdue.edu:/tcl/extensions/tkWWW-0.7.tar.Z info.cern.ch:/pub/WWW/src/tkWWW-0.7.tar.Z Mailing list ------------ There is a mailing list devoted to discussions about tkWWW at tk-www@athena.mit.edu To get on this list, send e-mail to tk-www-request@athena.mit.edu To report bugs, send e-mail to tk-www-bugs@athena.mit.edu From owner-software@net.bio.net Sun May 02 23:00:00 1993 Path: biosci!HERMES.CHPC.UTEXAS.EDU!mwitten From: mwitten@HERMES.CHPC.UTEXAS.EDU Newsgroups: bionet.software Subject: WORLD CONGRESS IN COMPUTATIONAL MEDICINE<-CFPP Message-ID: <9305032202.AA04866@morpheus.chpc.utexas.edu> Date: 3 May 93 22:02:22 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 236 [] ***** CALL FOR PAPERS AND PARTICIPATION ***** [] FIRST WORLD CONGRESS ON COMPUTATIONAL MEDICINE AND PUBLIC HEALTH 24-28 April 1994 Hyatt Regency Hotel Austin, Texas compmed94@chpc.utexas.edu (this notice may be reposted/cross posted/circulated) ------------------------------------------------------------------------ *Conference Chair: Matthew Witten, UT System Center For High Performance Computing, Austin, Texas - m.witten@chpc.utexas.edu *Conference Directorate: Regina Monaco, Mt. Sinai Medical Center * Dan Davison, University of Houston * Chris Johnson, University of Utah * Lisa Fauci, Tulane University * Daniel Zelterman, University of Minnesota Minneapolis * James Hyman, Los Alamos National Laboratory * Richard Hart, Tulane University * Dennis Duke, SCRI-Florida State University * Sharon Meintz, University of Nevada Los Vegas * Dean Sittig, Vanderbilt University * Dick Tsur, World Bank and UT System CHPC * Dan Deerfield, Pittsburgh Supercomputing Center * Istvan Gyori, Szeged University School of Medicine Computing Center *Conference Theme: The appearance of high-performance computing environments has greatly enhanced the capabilities of the biomedical modeler. With increasing frequency, computational sciences are being exploited as a means with which to investigate biomedical processes at all levels of complexity, from molecular to systemic to demographic. The emergence of an increasing number of players in this field has lead to the subsequent emergence of a new transdisciplinary field which we call Computational Medicine and Public Health. The purpose of this congress is to bring together a transdisciplinary group of researchers in medicine, public health, computer science, mathematics, nursing, veterinary medicine, ecology, allied health, as well as numerous other disciplines, for the purposes of examining the grand challenge problems of the next decades. Young scientists are encouraged to attend and to present their work in this increasingly interesting discipline. Funding is being solicited from NSF, NIH, DOE, Darpa, EPA, and private foundations, as well as other sources to assist in travel support and in the offsetting of expenses for those unable to attend otherwise. Papers, poster presentations, tutorials, focussed topic workshops, birds of a feather groups, demonstrations, and other suggestions are solicited in, but are not limited to the following areas: *Visualization/Sonification --- medical imaging --- molecular visualization as a clinical research tool --- simulation visualization --- microscopy --- visualization as applied to problems arising in computational molecular biology and genetics or other non-traditional disciplines *Computational Molecular Biology and Genetics --- computational ramifications of clinical needs in the Human Genome, Plant Genome, and Animal Genome Projects --- computational and grand challenge problems in molecular biology and genetics --- algorithms and methodologies --- issues of multiple datatype databases *Computational Pharmacology, Pharmacodynamics, Drug Design *Computational Chemistry as Applied to Clinical Issues *Computational Cell Biology, Physiology, and Metabolism --- Single cell metabolic models (red blood cell) --- Cancer models --- Transport models --- Single cell interaction with external factors models (laser, ultrasound, electrical stimulus) *Computational Physiology and Metabolism --- Renal System --- Cardiovascular dynamics --- Liver function --- Pulmonary dynamics --- Auditory function, coclear dynamics, hearing --- Reproductive modeling: ovarian dynamics, reproductive ecotoxicology, modeling the hormonal cycle --- Metabolic Databases and metabolic models *Computational Demography, Epidemiology, and Statistics/Biostatistics --- Classical demographic, epidemiologic, and biostatistical modeling --- Modeling of the role of culture, poverty, and other sociological issues as they impact healthcare *Computational Disease Modeling --- AIDS --- TB --- Influenza --- Other *Computational Biofluids --- Blood flow --- Sperm dynamics --- Modeling of arteriosclerosis *Computational Dentistry, Orthodontics, and Prosthetics *Computational Veterinary Medicine --- Computational issues in modeling non-human dynamics such as equine, feline, canine dynamics (physiological/biomechanical) *Computational Allied Health Sciences --- Physical Therapy --- Neuromusic Therapy --- Resiratory Therapy *Computational Radiology --- Dose modeling --- Treatment planning *Computational Surgery --- Simulation of surgical procedures in VR worlds --- Surgical simulation as a precursor to surgical intervention *Computational Cardiology *Computational Neurobiology and Neurophysiology --- Brain modeling --- Single neuron models --- Neural nets and clinical applications --- Neurophysiological dynamics --- Neurotransmitter modeling --- Neurological disorder modeling (Alzheimers Disease, for example) *Computational Biomechanics --- Bone Modeling --- Joint Modeling *The role of alternate reality methodologies and high performance environments in the medical and public health disciplines *Issues in the use of high performance computing environments in the teaching of health science curricula *The role of high performance environments for the handling of large medical datasets (high performance storage environments, high performance networking, high performance medical records manipulation and management, metadata structures and definitions) *Federal and private support for transdisciplinary research in computational medicine and public health *Contact: To contact the congress organizers for any reason use any of the following Electronic Mail - compmed94@chpc.utexas.edu Fax (USA) - (512) 471-2445 Phone (USA) - (512) 471-2472 Compmed 1994 University of Texas System CHPC Balcones Research Center, 1.154CMS 10100 Burnet Road Austin, Texas 78758-4497 *Submission Procedures: Authors must submit 5 copies of a single-page 50-100 word abstract clearly discussing the topic of their presentation. In addition, authors must clearly state their choice of poster, contributed paper, tutorial, exhibit, focussed workshop or birds of a feather group along with a discussion of their presentation. Abstracts will be published as part of the preliminary conference material. To notify the congress organizing committee that you would like to participate and to be put on the congress mailing list, please fill out and return the form that follows this announcement. You may use any of the contact methods above. *Conference Deadlines: The following deadlines should be noted: 1 October 1993 - Notification of interest in participation 1 November 1993 - Abstracts for talks/posters/workshops/birds of a feather sessions/demonstrations 15 January 1994 - Notification of acceptance of abstract 15 February 1994 - Application for financial aid ============================= INTENT TO PARTICIPATE ========================== First Name: Middle Initial (if available): Family Name: Your Professional Title: [ ]Dr. [ ]Professor [ ]Mr. [ ]Mrs. [ ]Ms. [ ]Other:__________________ Office Phone (desk): Office Phone (message): Home/Evening Phone (for emergency contact): Fax: Electronic Mail (Bitnet): Electronic Mail (Internet): Postal Address: Institution or Center: Building Code: Mail Stop: Street Address1: Street Address2: City: State: Country: Zip or Country Code: Please list your three major interest areas: Interest1: Interest2: Interest3: =================================================================== From owner-software@net.bio.net Sun May 02 23:00:00 1993 Path: biosci!agate!howland.reston.ans.net!darwin.sura.net!haven.umd.edu!uunet!pipex!sunic!news.funet.fi!fuug!funic!nic.funet.fi!csc.fi!harper From: Rob.Harper@csc.fi (Rob Harper) Newsgroups: bionet.software Subject: ftp.cray.com Announcement Message-ID: <199305031254.AA03559@csc.fi> Date: 3 May 93 12:54:07 GMT Sender: root@nic.funet.fi (The FUnny NET guru) Organization: Finnish University & Research Network Lines: 53 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit Mime-Version: 1.0 X-Mailer: ELM [version 2.4 PL21] Content-Length: 2108 %%%%%%%%%%%%%%%%%%%%%%%%%%%% CLIP %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% Cray Research is pleased to announce the availability of ftp.cray.com, a public information service provided through anonymous ftp over the Internet. This service is provided free of charge to anyone with Internet access. It is intended to be a means of communicating information about supercomputing and Cray Research to the worldwide community. Please share the news about this new service with your customers and interested users of Cray Research systems. The information on ftp.cray.com includes: + Cray Research product announcements + Cray Research press releases + Directory of Application Software for Cray Research Supercomputers + Information about Cray Research products + Articles of general interest to the supercomputing community + Miscellaneous electronic artwork + Source code for some public domain programs that run on Cray Research systems To access ftp.cray.com from a UNIX system prompt: $ ftp ftp.cray.com (the Internet address is 128.162.15.3) When prompted for your name, enter: anonymous When prompted for a password, enter your email address. Instructions for the use of ftp.cray.com are in the file README.CRAY, found in the top-level directory. There are also several popular interface programs in the public domain that support access to anonymous ftp servers from a PC or a Macintosh. ftp.cray.com is a public information service of Cray Research. Individual users are responsible for abiding by the appropriate use policies of their local network. %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% END %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% P.S. a direct ftp hook into into the CRAY ftp site is available on the gopher at CSC in the Finnish EMBnet BioBox gopher gopher.csc.fi 70 will take you there. RGDS -=ROB=- Rob Harper E-mail: harper@convex.csc.fi Center for Scientific Computing Molbio/software: harper@nic.funet.fi Tietotie 6, P.O. Box 405 Telephone: +358 0 457 2076 SF-02101 Espoo Finland Fax: +358 0 457 2302 From owner-software@net.bio.net Sun May 02 23:00:00 1993 Path: biosci!biovx1.DNET.NASA.GOV!201yeh From: 201yeh@biovx1.DNET.NASA.GOV Newsgroups: bionet.software Subject: signing up Message-ID: <9305032231.AA09584@east.gsfc.nasa.gov> Date: 3 May 93 22:31:10 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 1 Please sign me up for this newsgroup. Thanks. From owner-software@net.bio.net Sun May 02 23:00:00 1993 Path: biosci!agate!howland.reston.ans.net!ira.uka.de!news.dfn.de!immunbio.mpg.de!immunbio.mpg.de!news From: HAESS@IMMUNBIO.MPG.DE (Gunther H) Newsgroups: bionet.software Subject: Re: coloured sequence-editor (Protein !) ? Message-ID: <1993May3.175609.16@immunbio.mpg.de> Date: 3 May 93 16:56:09 GMT References: Organization: Max-Planck-Institut fuer Immunbiologie Lines: 67 Nntp-Posting-Host: mpi1.immunbio.mpg.de X-News-Reader: VMS NEWS 1.24In-Reply-To: francis@monod.Biol.McGill.CA's message of Thu, 29 Apr 1993 21:24:21 GMTLines: 67 In francis@monod.Biol.McGill.CA writes: > beynonrj@liverpool.ac.uk (Dr. R.J. Beynon) writes: > > >Don Gilbert (gilbertd@sunflower.bio.indiana.edu) wrote: > >: If someone will suggest what colors should be associated with > >: what amino acids for an editor display I will put it into > >: a coming release of seqapp. At some point I'll make it > >: user-definable, but give me a starting selection. > > >: -- > >: Don Gilbert gilbert@bio.indiana.edu > >: biocomputing office, biology dept., indiana univ., bloomington, in 47405 > > >Well, here's suggestion 1, to get things rolling... > > >R,K (H?) : red (+ive) > >D,E : blue (-ive) > >N,Q : magenta (cf blue) > >C,M : yellow (sulphur, or sulfur :-) ) > >A,I,L,M,W,F,V : black ('oily') > >S,T,Y,G : white (not 'oily') > > >Opinions, alternatives anyone? > > > What is the proposed background colour for these different "greys" > (oily and not oily)? > > f. > > > -- > | B.F. Francis Ouellette * francis@monod.biol.mcgill.ca * > | > | "Je cherche a` comprendre" Jacques Monod I wrote a little file-viewer for the VAX, that's able to display aa's in different, user-defined colours. Because the VAX doesen't support colours in textmode, I performed a REGIS(Graphics)-output. So its disadvantages are, that it's working very slowly and it's not an editor. But the groups of aa with the same colours by default in this Program are K R H kations black on red E D anions black on blue S T Q N polar black on yellow V L I A W F C M Y not polar black on green P G "special" black on white I think it's better to use a coloured background instead of coloured letters, because if you want to read the letters, it's better they're in one color. And if you want to distinguish different groups of aa's, it's better to have more coloured area than only the letters themselves. Instead of programming a whole editor for the MAC, I think it would be a good idea of using a kind of macro with a present word-processor. Does anybody know about such a macro-tool for "WORD for MAC" ? Gunther Haess, MPI-IB Freiburg/Germany haess@immunbio.mpg.de From owner-software@net.bio.net Sun May 02 23:00:00 1993 Path: biosci!uwm.edu!zaphod.mps.ohio-state.edu!howland.reston.ans.net!darwin.sura.net!welchgate.welch.jhu.edu!danj From: danj@welchgate.welch.jhu.edu (Dan Jacobson) Newsgroups: bionet.general,bionet.software Subject: Search and retrieve Simtel files and descriptions by Gopher Message-ID: <1993May3.224600.22567@welchgate.welch.jhu.edu> Date: 3 May 93 22:46:00 GMT Organization: Johns Hopkins Univ. Welch Medical Library Lines: 54 Xref: biosci bionet.general:4752 bionet.software:4887 You can now search the one-line descriptions of the programs on the Simtel (DOS software) ftp archive and retrieve the program at the same time. It goes like this: Point your gopher client at merlot.welch.jhu.edu and select the following: --> 14. Search and Retrieve Software/ --> 4. Search and Retrieve DOS Software/ --> 1. DOS programs - one line descriptions (Simtel) Now search this for your favorite topic - lets try: postscript And you see quite a few programs that deal with postscript - so let's narrow it down a bit - so lets say that what you really want to do is to generate a postscript maze ... so: postscript and maze gives us the following: --> 1. amaze10.zip postscript file creates random maze on printer If you select this item we will be asked for a file name and the entire program will be retrieved and put on your hard disk. So in short: 1. DOS programs - one line descriptions (Simtel) Will search a database of one-line descriptions of the files in the SIMTEL archives and its mirror sites. Once you have located a program(s) with this search you can simply retrieve the whole program by selecting it from the search results. You may use booleans (and, or, not) to design your search, 'or' is implied if no other operators (and, not) are given. If you've never heard of gopher don't worry it free and on the net, write me a note if you'd like information on how to get started. Happy Searching, Dan Jacobson danj@welchgate.welch.jhu.edu From owner-software@net.bio.net Mon May 03 23:00:00 1993 Path: biosci!daresbury!doc.ic.ac.uk!uknet!pipex!zaphod.crihan.fr!univ-lyon1.fr!scsing.switch.ch!news.unige.ch!usenet From: dlowry@cmu.unige.ch Newsgroups: bionet.software Subject: re: Prosite????? Message-ID: <1993May4.120537.4311@news.unige.ch> Date: 4 May 93 12:05:37 GMT References: <1s4nvl$1s1@gondor.sdsu.edu> Sender: usenet@news.unige.ch Reply-To: dlowry@cmu.unige.ch Organization: University of Geneva Lines: 23 In article <1s4nvl$1s1@gondor.sdsu.edu> hsb@ucssun1.sdsu.edu (Hirdeypal S. Bhathal) writes: > >Hi Netter > What are the hardware requirements to run Prosite. Can I >run it on Quadra 800. Where can I get it. Thanks. > >Hirdeypal >hsb@ucssun1.sdsu.edu > Dear Hirdeypal, PROSITE - A Dictionary of Sites and Patterns in Protein Sequences is a DATABASE! (of sites and patterns in protein sequences) - maintained by Dr. Amos Bairoch. There are quite a few programs that can search a sequence using the Prosite database. I am not sure what a Quadra 800 is! Please send me e-mail and I'll look into what programs run on it for you, if you like. - Dorothy Lowry (NON-DISCLAIMER: I am Dr. Bairoch's grad student.) From owner-software@net.bio.net Mon May 03 23:00:00 1993 Path: biosci!uwm.edu!zaphod.mps.ohio-state.edu!howland.reston.ans.net!sol.ctr.columbia.edu!ucsnews!ucssun1.sdsu.edu.sdsu.edu!hsb From: hsb@ucssun1.sdsu.edu (Hirdeypal S. Bhathal) Newsgroups: bionet.software Subject: Prosite????? Message-ID: <1s4nvl$1s1@gondor.sdsu.edu> Date: 4 May 93 03:29:57 GMT Organization: SDSU Computing Services Lines: 7 NNTP-Posting-Host: ucssun1.sdsu.edu Hi Netter What are the hardware requirements to run Prosite. Can I run it on Quadra 800. Where can I get it. Thanks. Hirdeypal hsb@ucssun1.sdsu.edu From owner-software@net.bio.net Mon May 03 23:00:00 1993 Path: biosci!uwm.edu!ux1.cso.uiuc.edu!news.cso.uiuc.edu!usenet From: domier@ux1.cso.uiuc.edu Newsgroups: bionet.software Subject: Multiple Alignment for Mac Message-ID: Date: 4 May 93 13:28:40 GMT References: <199305021545.AA27202@csc.fi> Sender: domier@ux1.cso.uiuc.edu Organization: University of Illinois at Urbana Lines: 2 Is there a public domain multiple seqeunce alignment program available for a Mac? From owner-software@net.bio.net Mon May 03 23:00:00 1993 Path: biosci!agate!howland.reston.ans.net!torn!utnut!utcsri!newsflash.concordia.ca!sifon!cerberus.ulaval.ca!frankia.for.ulaval.ca!user From: lsimon@alnus.for.ulaval.ca (Luc Simon) Newsgroups: bionet.software Subject: Re: coloured sequence-editor (Protein !) ? Message-ID: Date: 4 May 93 14:31:42 GMT References: <1993May3.175609.16@immunbio.mpg.de> Sender: news@cerberus.ulaval.ca Followup-To: bionet.software Organization: Universite Laval Lines: 47 Nntp-Posting-Host: frankia.for.ulaval.ca In article <1993May3.175609.16@immunbio.mpg.de>, HAESS@IMMUNBIO.MPG.DE (Gunther H) wrote: > >[stuff deleted...] > I wrote a little file-viewer for the VAX, that's able to display > aa's in different, user-defined colours. Because the VAX doesen't support > colours in textmode, I performed a REGIS(Graphics)-output. So its > disadvantages are, that it's working very slowly and it's not an editor. > > But the groups of aa with the same colours by default in this Program are > > K R H kations black on red > E D anions black on blue > S T Q N polar black on yellow > V L I A W F C M Y not polar black on green > P G "special" black on white > > I think it's better to use a coloured background instead of coloured letters, > because if you want to read the letters, it's better they're in one color. > And if you want to distinguish different groups of aa's, it's better to have > more coloured area than only the letters themselves. > > > Instead of programming a whole editor for the MAC, I think it would be a good > idea of using a kind of macro with a present word-processor. Does anybody know > about such a macro-tool for "WORD for MAC" ? > > > Gunther Haess, > MPI-IB Freiburg/Germany > haess@immunbio.mpg.de Why not simply designing a few colored fonts for the mac, where some letters are assigned background color. Each one could have a name informative about the coloring scheme: "AA Hydrophobicity" or "AA size" and the like. Then, using one's favorite editor, you simply select the portion of sequence to be color-coded and apply the desired font....et voila! Such a thing as already been done: the font BKGCuclc is the best example (I don't know where it comes from!!) and is VERY useful to view DNA alignements, for example in the PAUP editor. Luc Simon CRBF, Universite Laval Quebec lsimon@alnus.for.ulaval.ca From owner-software@net.bio.net Mon May 03 23:00:00 1993 Path: biosci!uwm.edu!linac!uchinews!kimbark!ecec From: ecec@kimbark.uchicago.edu (Eric Cabot) Newsgroups: bionet.software Subject: Re: coloured sequence-editor (Protein !) ? Message-ID: <1993May4.153456.15443@midway.uchicago.edu> Date: 4 May 93 15:34:56 GMT References: <1993May3.175609.16@immunbio.mpg.de> Sender: news@uchinews.uchicago.edu (News System) Reply-To: ecec@midway.uchicago.edu Organization: University of Chicago Lines: 34 In article <1993May3.175609.16@immunbio.mpg.de> HAESS@IMMUNBIO.MPG.DE (Gunther Hd_) writes: > > >I think it's better to use a coloured background instead of coloured letters, >because if you want to read the letters, it's better they're in one color. >And if you want to distinguish different groups of aa's, it's better to have >more coloured area than only the letters themselves. > > >Gunther Haess, >MPI-IB Freiburg/Germany >haess@immunbio.mpg.de I agree with Dr. Haess that it is better to use colored backgrounds than colored letters. In playing around with a colorizing ESEE, I've found that I cannot distinguish many of the letters if they are in different colors against either a white or black background. (Other backgrounds invariably lead to loss of the corresponding color types). I have little difficulty with distinguishing different colored backgrounds though. True, I'm color blind and my eyes aren't as sharp as they once were but I'm certain that I'm not the only sequence analyzer that suffers from these problems. Eric Cabot U. of Chicago P.S. Please no requests for the colorized ESEE, it's not finished yet! -- =+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=v=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+= Eric Cabot | "Non Nobis Nati Solum" ecec@midway.uchicago.edu | =+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=v=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+= From owner-software@net.bio.net Mon May 03 23:00:00 1993 Path: biosci!daresbury!daresbury!news From: ROUCHDA@VAX1.COMPUTER-CENTRE.BIRMINGHAM.AC.UK (Duncan Rouch) Newsgroups: bionet.software Subject: Future of Academic Biocomputing Facilities Message-ID: <1993May4.120211.28593@gserv1.dl.ac.uk> Date: 4 May 93 13:02:00 GMT Sender: list-admin@daresbury.ac.uk Distribution: bionet Lines: 508 Original-To: BIO-SOFT@UK.AC.DARESBURY Future of Academic Biocomputing Facilities. Hi Netters, If your work is touched by Biocomputing this discussion is for you. If you are a molecular biologist user, a programmer, or keep a biocomputing service on the road you have a stake in the future of biocomputing facilities. Effective service requires effective communication between a service and its customer molecular biologists, in both directions. Users can provide both necessary feedback and political support for biocomputing services [1]. Software developments must be integrated into the service environment to be effective. Here we discuss the future of academic biocomputing facilities, with emphasis on commercialization. Duncan Rouch, University of Birmingham UK (D.A.Rouch@BHAM.AC.UK) Tim Littlejohn, Universite de Montreal (Little@ere.umontreal.ca) Contents: 1. Introduction: Optimizing Biocomputing With or Without Commercialization. 2. Academic Computing Facilities: Obtaining and Maintaining Success. 2.1 Obtaining a Better Academic Service. 2.2 Factors Against Optimization. 2.2a Suspended Animation. 2.2b Becoming Invisible. 3. Commercialization. 3.1 Which facilities are we talking about? 3.1.1 National Services. 3.1.2 Site-wide Services. 3.1.2a Why Site-wide Services are Important. 3.1.2b Site-wide Services as Targets for Commercialization. 4. Going Commercial. 4.1 Going Commercial, Badly. 4.1.1 Site-wide Services Seen as Expendable. 4.1.2 Lack of Effective Planning. 4.1.3 Inadequate Management Structure. 4.1.4 A Poor Service as the Basis. 4.2 Going Commercial, Improving the Odds. 4.2.1 Commercialization and Public Responsibility. 4.2.2 Starting With a Good Service. 4.2.3 Charging For Services. 4.3 Maintaining a Commercialized Service. 4.4 Competition. 5. Conclusion. 6. Acknowledgements. 7. References. 1. Introduction: Optimizing Biocomputing With or Without Commercialization. Although some academic computing facilities have already been commercialized, for example what is now Minnesota Supercomputer Center Inc., at the University of Minnesota, this is not yet a widespread phenomenon. However, at least in the UK, there are government moves to marketize the academic world, which could well lead to pressure to turn academic computing services into commercial enterprises. It is essential for scientists and computing staff to discuss what arrangement of computing services would create the optimal support for research in the biological sciences, which could include an element of commercialization. This is critical if we are to shape the future of biocomputing facilities and not leave their fate to bureaucrats and legislators who may not fully appreciate their importance. 2. Academic Computing Facilities: Obtaining and Maintaining Success. Our objective here is to look at how a successful computing service can be established and maintained, whether or not it has a commercial component. We define a successful service as one that performs effectively in five areas [1]. It: (1) trains staff to deal with new technology; (2) trains staff in care of user scientists (customer care); (3) trains customers to use the facilities offered; (4) obtains and acts on feedback from its customers; (5) plans for future needs. Users of a particular facility may be research scientists, or science educators, or more usually of both kinds. Successful biocomputing facilities effectively support users in four major classes of computer-aided techniques: (a) functional-sequence analysis; (b) evolutionary-sequence analysis; (c) molecular modelling; (d) analysis of related information databases, such as literature. Such facilities will also benefit from sharing information and expertise with other facilities [1]. Also, users of small department- and lab-specific facilities can be helped where support for these facilities can be offered by a local site-wide service, which is able to do this through economies of scale. 2.1 Obtaining a Better Academic Service. For a facility to provide an optimal service for a given level of resources it must be highly responsive to the needs of user scientists. This can be encouraged, for example, in the case of a site-wide service where the budget for the research and education departments is drawn on to fund the computing service. Then the departments should have some say in what kind of service they should get. This gives each department a financial incentive for pressing for an efficient facility: a more efficient facility would also help improve the research and educational performance of the department. A prerequisite for creating and maintaining an efficient service is effective management [2]. Effective management personnel: (a) identify what facilities are required; (b) decide what level of service can be offered with a given amount of resources; (c) have the authority to argue for sufficient resources to offer an adequate service, if these do not already exist; (d) set up services and keep them running to meet set objectives; (e) advance user-facility and staff-management understanding, by communication, through: (i) elucidation of user needs, (ii) giving users practical expectations of what facilities can be provided, (iii) ensuring that staff perceive that managers have realistic expectations of their performance; (f) keep the service up to date in relation to the changing needs of user scientists. A not uncommon failing is not to give the head manager of a service sufficient status within the institution. A head manager must have a relative status that is reasonably close to that of the senior decision makers, in order to be given due weight when arguing for appropriate resources. To put this another way, managers must have adequate power to fulfil the responsibilities of the job. This is necessary to allow them to make the necessary decisions to make a success of the service. An efficient computing service among other things should have the capability to both upgrade facilities and user-support as new technology evolves, and expand the facilities to meet the increased need for access to electronic information [1]. Now we look at factors that might hinder this capability. 2.2 Factors Against Optimization. 2.2a Suspended Animation. Obviously if a computing service is suffering a restricted budget it is difficult to introduce change, for example, a major hardware upgrade. If this occurs the service may go into a state of suspended animation. However, if the restrictive budget is in place for a reasonably short period, especially following years of an adequate budget, no long term damage is likely to result. On the other hand, if a restrictive budget has been in place for years a computer service may be in danger of failing to provide a level of service required for the research it supports to be internationally competitive. This may eventually result in the future of the host institution being threatened. An unduly restrictive budget over time may be the result of an inefficient management structure. Typically, too many vertical levels of administration can cause an organization to move very slowly. Administrations can be conditioned for a relatively constant environment and cope badly with the need for change. This has also been found to be a problem in some large commercial corporations. The best long-term solution to a badly setup administration is naturally a total reorganization of the administrative structure. This may be a job best performed by outside commercial management consultants. However, a catch with radical restructuring is that unforseen problems can easily arise so it can be some time before optimal performance of the administration is reached. In this case it might be useful to target an under-resourced computing facility for extra aid early on in the restructuring process. 2.2b Becoming Invisible. A factor that may deleteriously affect the quality of even the best computing service is naturally a budget cut. A small cut may be allow an adequate level of service to be maintained, at least in the short term. However, a major budget cut can put a service in danger of becoming totally ineffective. Essential maintenance and hardware/software upgrading may be out of the question. Also, front-line user support might have to be cut entirely. Interaction with customer scientists is essential for maintenance of a successful service [1]. So, without the interaction provided by front-line user support, combined with reduced hardware/software facilities, the local service may become totally ineffective. In this case individual departments or labs may attempt to meet their own computing needs or rely on national services. Then the local service may be seen as totally unecessary and cut completely. In the long-term, the entire loss of a local service will tend to result in inefficient computing support across the site. Financially well endowed departments may be able to cope reasonably well but small, less well off departments may not. Naturally, one solution to this problem is not to have the major budget reduction in the first place. One way to reduce the chances of excessive financial restriction is for user scientists and staff in the computing service to work together to persuade the decision-makers what computing resources are necessary. 3. Commercialization. There are two logical reasons for commercializing an academic computing service, (i) to increase its efficiency in supporting academic research and education functions, and/or (ii) to generate income for the host institution or organization. Given the critical importance of computing facilities in sustaining both biocomputing and the electronic information revolution, the academic arena is only bettered if the efficency of computing support is increased. This then should be the major factor in deciding whether to commercialize or not, and if so, in what form. A result of a compromise between reasons (i) and (ii) could be the forming a computing business From owner-software@net.bio.net Mon May 03 23:00:00 1993 Path: biosci!MONOD.BIOL.MCGILL.CA!francis From: francis@MONOD.BIOL.MCGILL.CA (Francis Ouellette) Newsgroups: bionet.software Subject: Re: Prosite????? Message-ID: <9305041636.AA00653@monod.biol.mcgill.ca> Date: 4 May 93 16:36:51 GMT References: <1s4nvl$1s1@gondor.sdsu.edu> <1993May4.120537.4311@news.unige.ch> Sender: daemon@net.bio.net Distribution: bionet Lines: 43 In bionet.software you write: >I am not sure what a Quadra 800 is! Please send me e-mail and I'll >look into what programs run on it for you, if you like. Bonjour dorothy ... a quaddra is a big Mac! (top of their line) I think (quick gopher look) there is a Mac engine for PROSITE: gopher ftp.bio.indiana.edu --> 5. IUBio-Software+Data/ --> 9. Molecular biology/ --> 10. mac/ --> 73. macpattern.readme [11Nov92, 4kb]. 74. macpattern20 The top of the readme file reads: > The new version v2.0 of MacPattern is now available. > MacPattern is a Macintosh application which was originally designed > for protein pattern searches using the PROSITE pattern database. > > Version 2.0 added the following new features: and as Dan Jacobson would say: "If you have not heard of gopher ... don't worry, it is free" and info on getting it set up at your site is available from Dan (danj@welchgate.welch.jhu.edu) or myself. regards, francis From owner-software@net.bio.net Mon May 03 23:00:00 1993 Path: biosci!uwm.edu!wupost!howland.reston.ans.net!darwin.sura.net!welchgate.welch.jhu.edu!danj From: danj@welchgate.welch.jhu.edu (Dan Jacobson) Newsgroups: bionet.software Subject: Re: Multiple Alignment for Mac Message-ID: <1993May4.145510.22567@welchgate.welch.jhu.edu> Date: 4 May 93 14:55:10 GMT References: <199305021545.AA27202@csc.fi> Organization: Johns Hopkins Univ. Welch Medical Library Lines: 17 In article domier@ux1.cso.uiuc.edu writes: >Is there a public domain multiple seqeunce alignment program >available for a Mac? There are a few around - there is a version of clustalV (Higgins et al.) which will run on a Mac, there is Aligner (a Multiple sequence editor by Doug Eernisse), and there is SeqApp (Don Gilbert). You can retrieve SeqApp by gopher or ftp from ftp.bio.indiana.edu and the others from felix.embl-heidelberg.de. Best of luck, Dan Jacobson danj@welchgate.welch.jhu.edu From owner-software@net.bio.net Tue May 04 23:00:00 1993 Path: biosci!daresbury!buzz.bmc.uu.se!corax.udac.uu.se!sunic!uunet!sangam!vikram!imtech!raghava From: raghava@imtech.ernet.in (G.P.S.RAGHAVA) Newsgroups: bionet.software Subject: Software for quality prediction Message-ID: <3767@imtech.ernet.in> Date: 4 May 93 03:52:05 GMT Organization: Inst. of Microbial Technology, Chandigarh, India Lines: 17 Dear friends, I am working on prediction of protein secondary structure from their amino acid sequences. I am using different software for predicting the secondary structure and I want to assess the quality of prediction from these softwares. Please write me about the software avilable for assessing the percentage of residues predicted correctly in a protein or set of proteins. Thanks in advance (G P S Raghava) -- ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ | G.P.S.Raghava, Scientist ! Phone/FAX: +91 172 44252 | | Institute of Micro. Technology ! Email: raghava@imtech.ernet.in | | P O Box 1304, Sector 39A ! UUCP: | | Chandigarh 160 014 India. ! ...!uunet!sangam!vikram!imtech!raghava | ============================================================================ From owner-software@net.bio.net Tue May 04 23:00:00 1993 Path: biosci!HUSC3.HARVARD.EDU!"robison1@husc10.harvard.edu" From: "robison1@husc10.harvard.edu"@HUSC3.HARVARD.EDU Newsgroups: comp.lang.c++,bionet.software,bionet.announce Subject: Announcement: molbio++, a C++ library for biosequence analysis Message-ID: <01GXTBXUP1QABIJSBD@HUSC3.HARVARD.EDU> Date: 5 May 93 15:21:00 GMT Sender: kristoff@net.bio.net Lines: 119 Approved: bionews-moderator@net.bio.net Xref: biosci comp.lang.c++:13235 bionet.software:4898 bionet.announce:514 molbio++, release 0.01, is now available via anonymous ftp from: golgi.harvard.edu pub/CONTRIBUTIONS/molbio++ molbio++ is a C++ library for molecular biosequence analysis. Major features include: classes and services for reading and writing sequence data in the following formats: Genbank Flatfile EMBL / SwissProt GCG / Wisconsin Fasta / Pearson PIR NCBI Retrieve Server (read-only) limited parsing of fields and features in biosequence files storing amino acid or nucleic acid sequences iterating over a biosequence calculating and storing counts or frequencies of amino acids or nucleotides device-independent graphics, via GCG's FIGURE program translating nucleotide sequences into proteins using the universal genetic code or modifications thereof. parsing BLAST output calculating pI and molecular weight of proteins amino acid hydropathy values of Kyte & Doolittle example programs for reformatting biosequence files extracting open reading frames from nucleotide sequences parsing BLAST output calculating isoelectric point and molecular weight of proteins codon usage plots calculating local %GC for nucleotide sequences finding restriction sites in nucleotide sequences The examples in molbio++ are not meant to replace existing programs (they are almost universally superior in functionality), but rather to demonstrate the classes and provide bases for customization. molbio++ is the result of an ongoing individual research project. I apologize in advance for any trouble it may give you, but cannot be held liable. At this point, molbio++ has only been tested with cfront running on a Sparcstation. In general, there should be very few compatibility problems. UNIX-specific features are confined to a single class, and no templates are used. The mention of any commercial products in molbio++ and its accompanying documentation does not constitute an endorsement, but simply reflects what I have available for use. If you attempt to use the libraries, please send a message to: robison@biosun.harvard.edu (N.B. it's robISon, not robINSon; someone else gets it there) Announcements of general updates to molbio++ will be posted to bionet.software Major announcements (major revisions, change in ftp site, etc) will also be posted to comp.lang.c++ and bionet.announce. An earlier version of the library was distributed under the name "kertools". molbio++ is completely incompatible with kertools, as the result of a major rewrite. If you have software written for kertools, I can lend some advice as to how to convert. Acknowledgements: KR is supported by a National Defense Science Fellowship, and uses computers funded by the Department of Energy, the National Institutes of Health, and the Howard Hughes Medical Institute. Development of the library has been driven by challenges given me by Dr. Walter Gilbert and Dr. George Church. I have benefitted from discussions with Gary Gryan and Peter Jensen. Finally, I would have never gotten around to learning C++ if it were not for the gift of Stroustrup from my brother, Arch Robison. Keith Robison Harvard University Department of Cellular and Developmental Biology Department of Genetics (Harvard Medical School) / HHMI robison@biosun.harvard.edu From owner-software@net.bio.net Tue May 04 23:00:00 1993 Path: biosci!daresbury!buzz.bmc.uu.se!corax.udac.uu.se!sunic!mcsun!Germany.EU.net!news.netmbx.de!mailgzrz.TU-Berlin.DE!math.fu-berlin.de!ira.uka.de!howland.reston.ans.net!ux1.cso.uiuc.edu!news.cso.uiuc.edu!lwalsh From: lwalsh@nemo (Laura L. Walsh) Newsgroups: bionet.software Subject: Conway's Life Message-ID: Date: 5 May 93 18:30:55 GMT Sender: usenet@news.cso.uiuc.edu (Net Noise owner) Organization: University of Illinois at Urbana Lines: 9 I am looking for the Game of Life, specifically one that will run on a Macintosh. I have tried using archie, but I am not sure of the exact title of the game and I couldn't find what I thought was the correct software. I know someone said there was an After Dark module by that name, but I want to use this software in a course, and I don't think the AD module would be usable in that manner. Laura Walsh From owner-software@net.bio.net Wed May 05 23:00:00 1993 Path: biosci!enterpoop.mit.edu!gatech!howland.reston.ans.net!ira.uka.de!news.belwue.de!softserv.zdv.uni-tuebingen.de!studserv!zxmkr08 From: zxmkr08@studserv.zdv.uni-tuebingen.de (Cornelius Krasel) Newsgroups: bionet.software Subject: Re: Conway's Life Message-ID: Date: 6 May 93 13:29:50 GMT References: Organization: InterNetNews at ZDV Uni-Tuebingen Lines: 26 NNTP-Posting-Host: studserv.zdv.uni-tuebingen.de In lwalsh@nemo (Laura L. Walsh) writes: >I am looking for the Game of Life, specifically one >that will run on a Macintosh. I have tried using >archie, but I am not sure of the exact title of the >game and I couldn't find what I thought was the >correct software. I know someone said there was >an After Dark module by that name, but I want to >use this software in a course, and I don't think the >AD module would be usable in that manner. I know of two versions of Life for After Dark. One of these is configurable, i.e. you can setup the patterns. It is called Life II and should be available from sumex-aim.stanford.edu. If not, mail me and I'll send you a binhexed version. Sorry to post this on the net, but the return address of Laura is invalid (domain name missing). --Cornelius. -- /* Cornelius Krasel, Department of Physiological Chemistry, U Tuebingen */ /* email: krasel@studserv.zdv.uni-tuebingen.de */ /* "People are DNA's way of making more DNA." (R. Dawkins / anonymous) */ From owner-software@net.bio.net Wed May 05 23:00:00 1993 Path: biosci!daresbury!buzz.bmc.uu.se!corax.udac.uu.se!sunic!pipex!zaphod.crihan.fr!univ-lyon1.fr!scsing.switch.ch!ira.uka.de!howland.reston.ans.net!zaphod.mps.ohio-state.edu!cs.utexas.edu!not-for-mail From: jckelley@tigr.org (John C. Kelley) Newsgroups: bionet.general,bionet.software Subject: GENOME SEQUENCING AND ANALYSIS CONFERENCE V Message-ID: <9305061317.AA01938@bengal.tigr.org> Date: 6 May 93 13:13:20 GMT Sender: daemon@cs.utexas.edu Organization: UTexas Mail-to-News Gateway Lines: 57 Xref: biosci bionet.general:4770 bionet.software:4901 NNTP-Posting-Host: cs.utexas.edu FIRST ANNOUNCEMENT GENOME SEQUENCING AND ANALYSIS CONFERENCE V October 23-27, 1993 Hyatt Regency, Hilton Head Island, South Carolina ___________________________ ABSTRACT DEADLINE: August 20, 1993 ___________________________ Cochaired by: J. Craig Venter, Ph.D., The Institute for Genomic Research C. Thomas Caskey, M.D., Baylor College of Medicine Sponsored and supported by: National Center for Human Genome Research, NIH Office of Health and Environmental Research, DOE The Human Genome Organisation (HUGO) The Institute for Genomic Research Corporate sponsors (at this time): Applied Biosystems Inc. Human Genome Sciences Inc. New England Biolabs Qiagen Inc. The fifth annual Genome Sequencing and Analysis Conference is an international conference devoted to discussion of current approaches to understanding the human genome. A special emphasis is placed on methods and criteria for analyzing experimental data. New results from major research groups worldwide are presented and discussed. Plenary sessions, workshops, and working groups are scheduled for presentation and discussion of data and methodology. Special events will include a workshop sponsored by HUGO on quality control issues in genome research. The Data Fair, poster sessions and electronic posters provide forums for researchers to present their latest data and to encourage interaction between participants. Exhibitors display the latest in automated sequencers, laboratory robots, and products for molecular biology. Computer hardware and software for sequencing and analysis also is demonstrated. REGISTRATION MATERIALS WILL BE SENT AUTOMATICALLY TO PAST PARTICIPANTS. If you wish to be added to the mailing list, contact: Susan Wallace Genome Sequencing and Analysis Conference The Institute for Genomic Research 932 Clopper Road Gaithersburg, MD 20878 (301) 216-9567 (301) 977-7233 FAX Internet: swallace@tigr.org From owner-software@net.bio.net Wed May 05 23:00:00 1993 Path: biosci!daresbury!daresbury!not-for-mail From: mbpcr@s-crim1.dl.ac.uk (A. Parsons) Newsgroups: bionet.software Subject: Parallel Processors/Algorithms (Summary) Message-ID: <1sar9sINNlml@s-crim1.dl.ac.uk> Date: 6 May 93 11:03:24 GMT Organization: Daresbury Lab., Warrington, U.K. Lines: 1507 NNTP-Posting-Host: s-crim1.dl.ac.uk NetFolk, Well all threads on my original post on parallel architectures in database similarity searching have all but dried up. Here is the summary (LONG = 1500 lines) including some related threads and earlier comms I had with other folk. It also features the controversial Intelligenetics survey on BLAZE. My overall opinion is that generally people feel that using an implementation of the S&W algorithm is: (a) valuable (b) delivers better quality results. (c) the only real practicable way of implemeting S & W in a realistic timeframe is to use massively parallel hardware. (mpsrch and BLAZE). This is only my impression others may come away with different ones. PVM is an interesting idea but given a greenfield site (we dont have lots of Unix workstations networked - much less any with too many spare cycles) I think that massively parallel is the way to go. The speed aspect may be important but I think it is the quality argument that wins the day (see Chris Uptons posts). Hope you find this valuable/useful/helpful and not too much of a waste of network bandwidth. Many thanks to all who replied! Tony Parsons +----------------------------------------------------------------------------+ | Dr.Tony Parsons, VOX : + 44 304 616871 | | Information Technology, FAX : + 44 304 616670 | | Pfizer Central Research, | | Ramsgate Road, +---------------------- e-mail ------------------------+ | Sandwich, |JANET : parsons_a@uk.co.pcr.snd01 | | KENT |Internet : parsons_a@snd01.pcr.co.uk | | CT13 9NJ UK |Compuserve : 100064,765 PSImail:234216700127.parsons_a | +-----------------+----------------------------------------------------------+ begin ;-------------------------------------------------------------------------------- From: S S Sturrock Early Correspondence from Shane Sturrock (author of Mpsrch) Well, MPsrch will arrive on a MasPar at Harrow (HGMP-RC) probably in the next week or so, they will also be evaluating BLAZE. The EMBL installation is waiting on good network connections and an upgrade of the OS on their machine since that MasPar was supplied by DEC. Performance wise, MPsrch is about two and a bit times quicker, performance of BLAZE is about 55 million cell updates a second compared with 130 million on MPsrch. More to the point though, although BLAZE is a Smith Waterman on the MasPar the reconstruction is by FASTDB, a word based method which is supposedly fast but does not guarantee to get the same alignment as the MasPar, certainly the scores would not agree, the score is the one reported by the S/W algorithm, the alignment is FASTDB. On MPsrch, the reconstruction is also by full S/W and still manages to be about 10x quicker than the FASTDB method used on BLAZE, plus the score will agree because the algorithm is the same. Further, I have introduced the concept of gaps where a gap may be one or many indels thus giving the clumping effect of affine gaps by a simple modification to the S/W algorithm for reconstruction, this is because many paths may give the same score but generally it is best to pick the one with least gaps (although the same number of indels). We still have a single penalty though since having affine gaps increases the complexity though we will introduce them if anyone feels they will be an advantage over the route I have chosen. eg: With DNA in particular - Standard algorithm: ****** * * * * ************ acttatattcctctatattggatgatgctggtctgat acttct--------a--t-g-a---tgctggtctgat MPsrch: ******** ************** acttatattcctctatattggatgatgctggtctgat acttctat---------------gatgctggtctgat These two score identically but the second is obviously the best alignment because it only has one gap rather than the five of the standard method. -------------------------------------------------------------------------------- From: S S Sturrock What you may be interested in is that the smallest MasPar machine is now only 55K pounds including the workstation host, this gives you a 1024 processor MasPar box with MP1 processors, upgradable to 4096 processors, either MP1 or MP2 (which would give over 26000 mips + 6 gigaflops) without the need to change anything else, just a simple board swap. MPsrch will run on this set up, we have discussed the possibility of a package deal too so that may be something to interest you. At these prices it seems crazy to go for anything else, and on the minimum configuration you will still get 40 million cell updates a second at the moment, but should be much more after I come back from California, basically you will get better performance than BLAZE on a far cheaper machine. Too good to be true? -------------------------------------------------------------------------------- Bill Pearson (Fasta fame) writes: >Having read some of the literature that compares various algorithms, >the articles tend to sort into two classes: > > 1) Theoretically based papers discussing the various mathematical > merits of one algorithm versus another. The authors are likely to > have an investment in their favorite tool, and it's not always clear > (to me) how the math translates to the real world > > 2) Very general papers which look at two or three sequences and > draw conclusions about algorithm strengths from a limited database. > >It seems to me that all the algorithms have their unique strengths and >weaknesses- and this is going to be strongly sequence dependent. That >is why I made the original post, in an attempt to discern the relative >strengths of the programs for different applications. I (with bias, no doubt) recommend the paper: W. R. Pearson (1991) Genomics "Searching Protein Sequence Libraries: Comparison of the Sensitivity and Selectivity of the Smith-Waterman and FASTA Algorithms" 11:635-650 It examines the performance of FASTA, BLAST, and the Smith Waterman algorithm (which is used by BLAZE) on about 34 different superfamilies of proteins (all superfamilies with 20 or more members). The bottom line is that Smith-Waterman performs better than BLAST or FASTA, but that FASTA will perform as well as Smith-Waterman if one optimizes all the library scores (the -o option) and search about 10X faster than Smith-Waterman (though not, of course, 10X faster than Smith-Waterman on a MasPar). A description of the -o option and the reference to the Genomics paper is provided with the FASTA documentation. In the past 6 months I have extended these studies to 75 superfamilies and used more rigorous statistical tests, but the result is the same, if you use the -o option with FASTA, you will do as well as Smith-Waterman. If you don't, you won't. These comments apply only to protein sequence searching. I do not believe that there is any advantage to slower, more rigorous, algorithms for DNA sequence searches. For DNA, if a significant similarity exists in a non-protein-coding sequence, BLAST or FASTA will find it as well as, or better than, Smith-Waterman. With DNA, selectivity is much more of a problem than sensitivity and both FASTA and BLAST are more selective. Since the protein sequence libraries are considerably smaller than the DNA sequence libraries (and will continue to be, even after entire genomes are sequenced), I believe that it is reasonable for most researchers to rely on FASTA with the -o option for protein library searches and on FASTA or BLAST for DNA searches. There is one place where the Smith-Waterman algorithm should be used, however - in the preparation of alignments for publication. For some proteins with large variable-length loops, FASTA will not allow gaps of the appropriate size (and BLAST does not construct alignments with gaps, although it often shows several aligned regions). I am considering modifying FASTA to display rigorous Smith-Waterman alignments rather than the approximate (gaps < 16 residues) it calculates currently. A Smith-Waterman implementation (SSEARCH) is available with the FASTA distribution. Bill Pearson -------------------------------------------------------------------------------- Subject: Genbank BLAZE user survey summary Cc: stamm@COM.MasPar Sender: stamm@COM.MasPar Thank you all for your patience. Here is the survey summary as promised. Regards, Rich Stamm stamm@maspar.com ============================================================ GENBANK BLAZE USER SURVEY SUMMARY OF RESPONSES BLAZE email server was operated by IntelliGenetics from May to September of 1992 funded in part by IntelliGenetics, MasPar and the National Institutes of Health. A summary of the survey questions and responses follows. A total of 63 people sent responses by email. 1) When you first used BLAZE did you have any previous experience searching sequence databases with the Smith-Waterman algorithm? Previous experience reported: SMITH-WATERMAN = 7 FASTA = 27 BLAST = 20 WORDSEARCH = 2 GAP = 1 FASTDB = 1 EMBL/ARGOS = 1 If so, what were your impressions of the algorithm? Impressions reported FAVORABLE = 29 (mentioned are speed, accuracy, sensitivity, ease of use, annotations, exploratory nature) OK = 3 UNFAVORABLE = 3 (unfavorable experiences were due to problems with email, software bugs, missing features) 2) Did you achieve noticably better sensitivity using BLAZE over other search algorithms? Which ones (FASTA, BLAST, FASTDB...)? Reports of increased sensitivity OVER FASTA = 15 OVER BLAST = 13 OVER FASTDB = 1 OVER WORDSEARCH = 1 NON-SPECIFIC INCREASED OBSERVED = 7 NO ASSESSMENT DONE = 11 SENSITIVITY INCREASE NOT OBSERVED = 13* *7 OF THESE 13 RESPONDEES REPORTED THAT THEIR QUERY SEQUENCES EITHER HAD MANY STRONG MATCHES OR (NEARLY) NO MATCHES AT ALL IN THE DATABASE. 3) Did you explore the parameter space to attempt to improve the sensitivity of your BLAZE searches (i.e. vary the PAM matrix, gap penalty and gap extension penalty)? If so was the improvement from your parameter search noticeable? EXPLORED PARAMETER SPACE = 9 FOUND NOTICABLE IMPROVEMENTS = 5 FOUND NO SIGNIFICANT DIFFERENCES = 3* *2 OF THE 3 RESPONDEES WHO REPORTED NO SIGNIFICANT DIFFERENCES FROM VARYING THE SEARCH From owner-software@net.bio.net Wed May 05 23:00:00 1993 Path: biosci!uwm.edu!cs.utexas.edu!usc!howland.reston.ans.net!newsserver.jvnc.net!synapse.bms.com!riversend.bms.com!user From: Roberts_D@BMS.COM (Dan Roberts) Newsgroups: bionet.software Subject: Helical Wheel Prg. wanted Message-ID: Date: 6 May 93 19:39:57 GMT Sender: news@synapse.bms.com Followup-To: bionet.software Organization: Bristol-Myers-Squibb Research Lines: 9 Does anyone know where I could get a program that would perform a helical wheel plot??. I would prefer a MAC based prg, as my access to an IBM is limited..Thanks!!!..Dan Dan Roberts BRISTOL-MYERS-SQUIBB PHARM. RES. CENTER Cardio-Vascular Biochem Dept. PRINCETON, NEW JERSEY U.S.A. PLANET EARTH, MILKY-WAY GALAXY <<<>>>Roberts_D@BMS.COM From owner-software@net.bio.net Wed May 05 23:00:00 1993 Path: biosci!uwm.edu!cs.utexas.edu!usc!howland.reston.ans.net!agate!headwall.Stanford.EDU!nntp.Stanford.EDU!kurtm From: kurtm@leland.Stanford.EDU (kurt mitchener) Newsgroups: bionet.software Subject: continuous performance task software request Message-ID: <1993May6.200829.8338@leland.Stanford.EDU> Date: 6 May 93 20:08:29 GMT Sender: news@leland.Stanford.EDU (Mr News) Distribution: usa Organization: DSG, Stanford University, CA 94305, USA Lines: 16 Hello, I'd like to run a visual continuous performance task (CPT) in order to test a population of subjects with schizophrenia. I'm looking for either a share ware or low-cost, computer-run version that takes about 10 to 15 minutes to run, has been validated in samples of schizophrenic patients and (here's the clincher) can run on both the Mac and IBM platforms. Has anyone heard of such a monster in existence? A million thanks in advance, -Kurt please email responses -- Kurt D. Mitchener email: kurtm@cardinal.stanford.edu Stanford University voice: (415) 493-5000 x5899 Stanford, CA 94305 USA fax: (415) 493-4901 From owner-software@net.bio.net Wed May 05 23:00:00 1993 Path: biosci!NBRF.GEORGETOWN.EDU!POSTMASTER From: POSTMASTER@NBRF.GEORGETOWN.EDU Newsgroups: bionet.software Subject: Availability of PIR ATLAS CD-ROM Message-ID: <01GXUXVDAS0YA3CABM@NBRF.Georgetown.Edu> Date: 6 May 93 19:01:30 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 120 ATLAS of Protein and Genomic Sequences CD-ROM The new release of the ATLAS of Protein and Genomic Sequences CD-ROM is now available for distribution. The ATLAS CD contains the most up-to-date versions of the PIR-International Protein Sequence Database (release 36.00, the most comprehensive and complete protein sequence database available) and the GenBank Sequence Data Bank (release 75.0, supplemented with the weekly GenBank new data entries). Once again the Protein Sequence Database increased by more than 10% since the last release and is nearly double the size of release 25 of the Swiss-Prot database. In conjunction with the MIPS PATCHX data set (assembled from a collection of other public domain protein sequence databases and also included on the CD-ROM), the Protein Sequence Database provides the most complete collection of protein sequence data currently available in the public domain. This release of the PIR-International Protein Sequence Database is comprehensively cross-referenced to the MedLine abstracts by the MedLine Unique Identifier (MUID) and contains cross-references to the Genome Data Base (GDB) of the Welch Medical Library at the Johns Hopkins University. Also provided on the CD-ROM are: release 12.00 of NRL_3D Structure-Function Database, release 4.0 of the PIR Alignment Database, and the March 1993 release of the JIPID ECOLI (Escherichia coli) Nucleic Acid Sequence Database. The NRL_3D Database is a protein sequence database extracted from the Brookhaven Protein Data Bank (PDB) coordinate data files; it provides an interface between the Protein Sequence Database and the PDB and provides access to the PDB data via computerized sequence searching and comparison methods. The ALN database provides a set of multiple sequence alignments of closely related protein sequences from the PIR-International Protein Sequence Database. The ECOLI Nucleic Acid Sequence Database is a comprehensive, nonredundant, fully merged (all recognized contigs are assembled into single sequence segments), and annotated Escherichia coli genomic sequence database. All entries in this dataset are directly linked to the corresponding protein sequence products in the PIR-International Protein Sequence Database. All data on the ATLAS CD are represented in ASCII files that can be read directly by any computer system that supports the ISO 9660 CD-ROM standard. The sequence data files are in the NBRF format that can be accessed by a wide variety of sequence analysis software, including the GenePro software by Riverside Scientific, the Genetics Computer Group (GCG) package, the FASTA series of database searching programs by William Pearson of the University of Viginia, and any software using the READSEQ subroutines by Don G. Gilbert of Indiana University. Included on the ATLAS CD-ROM is the ATLAS Information Retrieval program that provides direct and simultaneous retrieval from all of the databases on the CD-ROM. This program was recently featured on the CD-ROM produced in cooperation with the journal Protein Science and the Protein Society. In this release of the ATLAS CD-ROM, versions of the ATLAS program are provided for PC-DOS, VMS (VAX and alpha), and DEC(RISC) ULTRIX operating systems. Support will be added for SunOS and MacIntosh systems in the near future. The ATLAS program provides an effective alternative to the Entrez program of the National Center for Biotechnology Information (NCBI). The ATLAS program is designed on the principle that the sequence database annotations (protein names, superfamily names, organism names, gene names, keywords, feature descriptions, author's names, etc.) provide meaningful, biological information that can be used to query the database directly. These data provide direct links between the nucleic acid and protein sequence database entries and entries in other specialized data sets. The ATLAS program provides an environment where data entries from various databases can be linked dynamically by simultaneous retrieval on these biological and bibliographic descriptors. The program presents a command interface modeled on the DEC Command Language (DCL) of the VMS operating system. The "command/modifier" interface recognizes truncated versions of the commands and modifiers. The ATLAS command language is similar to that employed in the NBRF PSQ and NAQ programs. Those familiar with these systems will experience very little difficulty in adapting to this new program. A menu interface is provided for PC-DOS systems. A complete and comprehensive Installation and User's Guide is provided on the CD-ROM and the ATLAS program itself contains an integrated help facility. ATLAS allows simultaneous retrieval on any selected subset (or all) of the databases on the CD-ROM. The user may select any combination of fields to query on. For example, a single query command will allow retrieval on the TITLE and KEYWORDS fields of the GenBank and PIR-International databases. Queries can be refined by Boolean combination of sequential database queries. Queries are evaluated by an efficient substring searching algorithm. For example, a search on the term "globin" will retrieve the complete set of hemoglobin, leghemoglobin, alpha-globin, beta-globin, myoglobin, and various other globin and globin-like sequences. This logic alleviates difficulties resulting from usage of varying or nonstandard biological terminology within the different databases. The ATLAS CD-ROM also contains specially configured versions of the FASTA and TFASTA programs that allow the sequence databases on the CD-ROM to be searched (by sequence) directly. These programs will execute on PC-DOS, VAX/VMS, and DEC ULTRIX systems. Orders for the ATLAS CD-ROM are accepted, without prepayment, by FAX or E-mail. For further information in the US and the Americas, please contact: Kathryn Sidman, Technical Services Coordinator Protein Information Resource (PIR) National Biomedical Research Foundation (NBRF) 3900 Reservoir Rd., NW Washington DC 20007 FAX: (202) 687-1662 phone: (202) 687-2121 E-mail: PIRMAIL@nbrf.georgetown.edu PIRMAIL@gunbrf.bitnet In Europe contact: Martinsried Institute for Protein Sequences (MIPS) Max-Planck-Institute for Biochemistry 8033 Martinsried, Germany FAX: 49 89 8578 2655 phone: 49 89 8578 2657 E-mail: mewes@ehpmic.mips.biochem.mpg.de In Asia and Oceania contact: Japan International Protein Information Database (JIPID) Science University of Tokyo 2669 Yamazaki, Noda 278 Japan FAX: 81 47 122 1544 phone: 81 48 124 1501 E-mail: Tsugita@JPNSUT31.BITNET From owner-software@net.bio.net Wed May 05 23:00:00 1993 Path: biosci!daresbury!doc.ic.ac.uk!uknet!bnr.co.uk!demon!visigoth.demon.co.uk!user From: pettsj@visigoth.demon.co.uk (James Petts) Newsgroups: bionet.software Subject: Re: Conway's Life Message-ID: Date: 6 May 93 08:23:34 GMT References: Sender: news@demon.co.uk Followup-To: bionet.software Organization: No Affiliation Lines: 27 Nntp-Posting-Host: visigoth.demon.co.uk In article , lwalsh@nemo (Laura L. Walsh) wrote: > > I am looking for the Game of Life, specifically one > that will run on a Macintosh. I have tried using > archie, but I am not sure of the exact title of the > game and I couldn't find what I thought was the > correct software. I know someone said there was > an After Dark module by that name, but I want to > use this software in a course, and I don't think the > AD module would be usable in that manner. > Laura Walsh I have something called LifeLab, which came along with my copy of OzTeX. If you can't find anything on archie under this name, drop me a line, and I will binhex it and e-mail it to you. It is, BTW, one of the best implementations I have seen, with an amazing collection of predefined patterns. ===> James Petts <=== ========================================================================= pettsj@visigoth.demon.co.uk ..oo000oo.. PGP 2.X key on the servers ========================================================================= I feel that if a person can't communicate, the very least he can do is shut up. -- Tom Lehrer ========================================================================= From owner-software@net.bio.net Wed May 05 23:00:00 1993 Path: biosci!daresbury!doc.ic.ac.uk!warwick!warwick!not-for-mail From: lsren@csv.warwick.ac.uk (Mr D J Plows) Newsgroups: bionet.software Subject: Protein analysis software. Message-ID: <1sbgpjINNt93@violet.csv.warwick.ac.uk> Date: 6 May 93 17:10:11 GMT Organization: Computing Services, University of Warwick, UK Lines: 9 NNTP-Posting-Host: violet.csv.warwick.ac.uk I was just wondering if anyone knows of some shareware (or other) software that allows analysis of protein sequence, such as hydropathy plots etc. Also the program should allow me to export the data (image) to another graphics package such as Freelance Graphics. thanks Dave From owner-software@net.bio.net Wed May 05 23:00:00 1993 Path: biosci!enterpoop.mit.edu!gatech!howland.reston.ans.net!darwin.sura.net!gatekeeper.es.dupont.com!esds01.es.dupont.com!MOLDOVBJ@esvx12.es.dupont.com From: moldovbj@esvx12.es.dupont.com Newsgroups: bionet.software Subject: Plaasmid maps Message-ID: <1993May6.134850.13692@es.dupont.com> Date: 6 May 93 13:48:50 GMT Sender: news@es.dupont.com (USENET News System) Reply-To: moldovbj@esvx12.es.dupont.com Organization: DuPont (Opinions are those of the writer only) Lines: 6 Nntp-Posting-Host: esvx12.es.dupont.com I am looking for software that will produce graphical maps of plasmid constructs for the IBM, similar to that from DNA Strider for the Mac. Is there anything out there, either shareware or commercial, that has the ability to draw maps, do restriction digests, cut-and-paste fragments, etc? Moldovbj@esvax.dnet.dupont.com From owner-software@net.bio.net Wed May 05 23:00:00 1993 Path: biosci!NET.BIO.NET!kristoff From: kristoff@NET.BIO.NET (Dave Kristofferson) Newsgroups: bionet.software Subject: bio-soft mailing list problem Message-ID: Date: 6 May 93 21:10:36 GMT Sender: kristoff@net.bio.net Distribution: bionet Lines: 14 The mailing list file for the BIO-SOFTWARE group at net.bio.net was apparently accidentally corrupted a few days ago. I had a copy retrieved from tape. If you unsubscribed from this group recently and get this message by e-mail, please contact biosci@net.bio.net and request to be removed from the list again. Sorry for the inconvenience. Sincerely, Dave Kristofferson BIOSCI/bionet Manager kristoff@net.bio.net From owner-software@net.bio.net Wed May 05 23:00:00 1993 Path: biosci!parc!decwrl!pa.dec.com!nntpd2.cxo.dec.com!paaiec.enet.dec.com!tung From: tung@paaiec.enet.dec.com Newsgroups: bionet.software Subject: Articles on software applications in biotech Message-ID: <1993May6.223309.2489@nntpd2.cxo.dec.com> Date: 6 May 93 22:33:09 GMT Sender: usenet@nntpd2.cxo.dec.com (USENET News System) Reply-To: tung@paaiec.enet.dec.com () Organization: Digital Equipment Corporation Lines: 10 I am looking for articles which give an introductory overview on how software has been used and will be used in the biotech industry. I am from software background and do not know much about biotech, so anything which can give me a better "feel" about the different aspects and opportunities in this industry will help. Looking forward to your suggestions. Thank you in advance. (PS: if there is a better place to post this request, please let me know) From owner-software@net.bio.net Wed May 05 23:00:00 1993 Path: biosci!uwm.edu!zaphod.mps.ohio-state.edu!howland.reston.ans.net!darwin.sura.net!welchgate.welch.jhu.edu!danj From: danj@welchgate.welch.jhu.edu (Dan Jacobson) Newsgroups: bionet.software Subject: Re: Helical Wheel Prg. wanted Message-ID: <1993May6.215900.8001@welchgate.welch.jhu.edu> Date: 6 May 93 21:59:00 GMT References: Organization: Johns Hopkins Univ. Welch Medical Library Lines: 32 In article Roberts_D@BMS.COM (Dan Roberts) writes: >Does anyone know where I could get a program that would perform a helical >wheel plot??. I would prefer a MAC based prg, as my access to an IBM is >limited..Thanks!!!..Dan If you can wrangle access to a PC you might want to take a look at Prograph which does this and much more. For the Mac there is the PLOTA series of programs: PLOTA_AADATA.HQX Sequence editor PLOTA_DOT.HQX Dot matrix comparison PLOTA_GGR.HQX Secondary structure prediction PLOTA_GOR.HQX Secondary structure prediction PLOTA_HEL.HQX Helical wheel <----------- PLOTA_HYD.HQX Hydropathy analysis PLOTA_HYD5.HQX Hydropathy analysis (averaging) PLOTA_KAS.HQX Chain flexibility and antigenicity PLOTA_KKD.HQX Prediction of membrane spanning regions PLOTA_POW.HQX Power spectrum plot PLOTA_SIG.HQX Signal peptide prediction PLOTA_SIM.HQX Dissimilarity plot PLOTA_TMH.HQX Hydrophobic moment analysis You can get both by anonymous ftp or gopher from felix.embl-heidelberg.de Best of luck, Dan Jacobson danj@welchgate.welch.jhu.edu From owner-software@net.bio.net Wed May 05 23:00:00 1993 Path: biosci!BDT.FTPT.BR!adriano From: adriano@BDT.FTPT.BR (Adriano Cesar da Silva) Newsgroups: bionet.software Subject: Bacterial Identif.Software Message-ID: <9305061751.AA06644@sabia.ftpt.br> Date: 6 May 93 14:51:15 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 27 Dear Everybody, I am a microbiology student working here on information systems and I'd like to get hold of software for bacterial identification for the PC. At FTPT bacteria are identified by traditional methods of simple morphological and biochemical tests (eg. assimilation/fermentation of sugars). I would like software which performs identifications with these data, using a database which is supplied with the software. However, I'm not having much luck in finding appropriate software! I have already looked at systems such as GDE, Montanus and Delta which are more concerned with constructing taxonomic keys. Other software are concerned with numerical analysis of data (eg. PC Taxon). One software which seemed promising was MICRID, but the version I have is rather old and incomplete (ca. 1985). Any suggestions? Thank you for your attention Campinas, 06/05/93 15:00 pm -- Adriano Cesar da Silva adriano@bdt.ftpt.br Fundacao "Andre Tosello" tel: +55 192 42 7022 Base de Dados Tropical - BDT fax: +55 192 42 7827 From owner-software@net.bio.net Thu May 06 23:00:00 1993 Path: biosci!agate!howland.reston.ans.net!darwin.sura.net!welchgate.welch.jhu.edu!danj From: danj@welchgate.welch.jhu.edu (Dan Jacobson) Newsgroups: bionet.software Subject: Re: PROGRAPH Program Description?? Message-ID: <1993May7.232040.29264@welchgate.welch.jhu.edu> Date: 7 May 93 23:20:40 GMT References: Organization: Johns Hopkins Univ. Welch Medical Library Lines: 158 In article Roberts_D@BMS.COM (Dan Roberts) writes: >Does anyone out there have a description of the IBM platform PROGRAPH >program that they could send me??..Thanks...:-)..Dan > This is a clip from the (extensive) documentation that comes with prograph. Note this is a little out of date - there's newer docs that come with the present version. Best of luck, Dan Jacobson danj@welchgate.welch.jhu.edu ---------------------------------------------------------- A graphical protein analysis tool V 1.3 October 1991 A. What is PROFILEGRAPH PROFILEGRAPH is a public-domain program for helping with the analysis of protein sequences. It does so by plotting profiles of the sequence to the screen or to various output devices. These profiles are derived from the sequence by application of amino-acid specific parameters, a well known example for such a profile is the hydrophobicity plot. One of my main concerns in writing PROFILEGRAPH was to include a lot of options for influencing the calculation of the profile and to make PROFILEGRAPH able to do everything that is possible with such profiles. Of course this goal was not achieved in many ways, but I hope the features I did implement are a reasonable subset of all possible ones. Another main concern besides making PROFILEGRAPH as flexible as possible was to make it comfortable and relatively fast. One obvious reason for including a comfortable user-interface is that such a program is more fun to work with. Another reason is that all the nice options I included would almost never be used if they were hidden behind cryptic command line options or the like. I hope that by providing a sufficiently fast and easy interface the usefulness of the program will be improved and that even some less obvious profile analyses will be carried out which are likely to give no show something unexpected (and I believe that the unexpected features are the most interesting ones). For a first introduction and a short guided tour through the menus of PROFILEGRAPH, read chapter E. of this file. For a more detailed description of each menu-choice, please read chapter D. of this documentation. If you like to contact me, feel free to do so, my address is: Kay Oliver Hofmann Institut fuer Biochemie (med. Fak.) Universitaet Koeln Joseph Stelzmann Str. 52 D-5000 Koeln 41 (West Germany) Tel +49 221 478-6980 Fax +49 221 478-6979 INTERNET: khofmann@cipvax.biolan.uni-koeln.de I am extremely interested in bug reports, suggestions for future versions, proposed modifications of PROFILEGRAPH or any other comments. B. Hardware and software requirements Because PROFILEGRAPH works fully in graphics mode, a graphics adapter in combination with an appropriate monitor is required. Almost any available adapter type is supported. The program has been written in TURBO PASCALTM and it uses the BORLAND GRAPHICS INTERFACETM. Therefore the correct .BGI- graphics driver must be present. Driver files for hercules, EGA, VGA and SVGA adapters are supplied together with the executables of PROFILEGRAPH. A complete set of drivers is shipped with newer versions of all TURBO- languages from BORLAND. A high-resolution color graphics adapter is highly desirable but hercules graphics will also do. There is a problem with CGA-graphics where some A most critical feature of PROFILEGRAPH V1.3 is that use of a mouse is highly recommended. (See chapter D.) The executable files run only with a MICROSOFTTM compatible mouse if there is an appropriate mouse-driver installed. If you plan to recompile the sources, it will be easy to replace the unit MOUSE by another one supporting other rodents like MOUSE-SYSTEMSTM mice etc. The memory requirements are not clearly defined because the program makes extensive use of dynamically allocated memory. I only tried running the program on ATs with more than 640kB, it is possible that less memory is also sufficient when using a low-resolution graphics card. Extended or expanded memory is supported only for overlay management at the moment. The program is suited for running under MS-WINDOWS as a non-windows application. I have tested it with WINDOWS 3.0, corresponding PIF and ICO files are provided with the executables of PROFILEGRAPH. Running PROFILEGRAPH under WINDOWS offers the advantage of cutting and pasting to the clipboard and, of course, switching between multiple applications. In the executable version of PROFILEGRAPH V1.3, a numerical coprocessor is not supported. If you recompile the pascal sources, it will be most easy to switch on a compiler option to include 80x87-code. I you like to recompile the program, you need a current version of the TURBO-PASCAL compiler. The executables distributed have been compiled by release 5.5 of the compiler, in contrast to the previous release, TP5.5 specific code is used. C. Installation The release version V1.3 of PROFILEGRAPH consist of the following files: executable section: - PG_READ .ME last minute informations - PROGRAPH.EXE the main program - PROGRAPH.TAB the startup amino-acid parameter table - * .TAB perhaps some additional tables - PROGRAPH.ANA standard analysis file - PROGRAPH.ICO Icon file for use with MS-WINDOWS 3.0 - PG256 .CFG demo configuration file for 256 color SVGA - PG16S .CFG demo configuration file for 16 color SVGA - PG16 .CFG demo configuration file for 16 color EGA/VGA - PG2 .CFG demo configuration file for b/w - * .BGI graphics drivers (copyright BORLAND) - SVGABGI .ZIP SVGA drivers (copyright Jordan Hargrave) - MYPR$HUM.DAT test sequence file in UWGCG-format - TPGLVIEW.EXE TPGL file viewer - TPGLTOPS.EXE TPGL to POSTSCRIPTTM - Converter - TPGLPRT .BAT needed for 'special print' feature documentation section - PG_READ .ME last minute informations - PGDOC .TXT documentation in ASCII-format - PGDOC .DOC documentation in MS-WinWord format - PGDOC .PS documentation in POSTSCRIPTTM format - PG_PAPER.DOC paper decribing PROFILEGRAPH in MS-WinWord format source code section: - PG_READ .ME last minute informations - PROGRAPH.PAS the main program - PG_TYPE .PAS type declaration unit - PG_INIT .PAS variable initialization unit - PG_CALC .PAS calculation unit - PG_WHEEL.PAS helical wheel unit - POPUP .PAS pop-up menu unit - POPAPP .PAS pop-up menu applications unit - GRUTIL .PAS graphics utility unit - FILUTIL .PAS file utility unit - OVR_INIT.PAS overlay initialization unit - SEQ .PAS sequence utility unit - HCOPY .PAS hard copy utility unit - TPGL .PAS TPGL-creation unit - UREADSEQ.PAS Don Gilbert's READSEQ unit (converted for use with TP5) - TPGLVIEW.PAS TPGL file viewer - TPGLTOPS.PAS TPGL to POSTSCRIPTTM converter And much more - this is just the start... From owner-software@net.bio.net Thu May 06 23:00:00 1993 Path: biosci!daresbury!buzz.bmc.uu.se!corax.udac.uu.se!sunic!trane.uninett.no!nntp.uio.no!biomaster.uio.no!rodrigol From: rodrigol@biomaster.uio.no (Rodrigo Lopez) Newsgroups: bionet.software Subject: Re: Secondary Structure Prediction Message-ID: <1sdkch$o1v@hermod.uio.no> Date: 7 May 93 12:23:45 GMT References: <1993May7.104359.11697@gserv1.dl.ac.uk> Distribution: bionet Organization: The Norwegian EMBnet node Lines: 29 NNTP-Posting-Host: biomaster.uio.no In article <1993May7.104359.11697@gserv1.dl.ac.uk>, LYNDON@BMS-UNIT.ICR.AC.UK writes: |> Does anybody know of any shareware programs to predict the secondary |> structure of a proteim given its primary amino acid sequence and where |> to obtain such a program? |> |> Thanks in advance |> |> Lyndon I would suggest you send an e-mail message to : predictprotein@embl-heidelberg.de with the word HELP as subject. You will recieve information on how to submitt your sequence to the predict protein server. -- *************************************************************************** * RODRIGO LOPEZ SERRANO * * * * Administrator for The Norwegian EMBNet node * * * * Tel: XX-47-22-958756 Biotechnology Centre of Oslo * * Fax: XX-47-22-694130 Gaustadalleen 21 * * P.B. 1125 Blindern * * 0316 Oslo 3 Norway * * rodrigol@biomed.uio.no * * rodrigol@ulrik.uio.no * *************************************************************************** From owner-software@net.bio.net Thu May 06 23:00:00 1993 Path: biosci!uwm.edu!cs.utexas.edu!usc!howland.reston.ans.net!darwin.sura.net!lhc!ray!dab From: dab@ray.nlm.nih.gov (Dennis Benson) Newsgroups: bionet.software Subject: Re: VAX/VMS & NCBI's _Entrez_: text interface desired Message-ID: <1993May7.200627.28100@nlm.nih.gov> Date: 7 May 93 20:06:27 GMT References: <930507104042.214062a7@JAGUAR.CSC.WSU.EDU> Sender: news@nlm.nih.gov Distribution: bionet Organization: National Library of Medicine Lines: 46 Cc: epstein@ncbi kans@ncbi dab@ncbi X-Newsreader: Tin 1.1 PL4 THOMPSON@JAGUAR.CSC.WSU.EDU (Steve Thompson: VADMS genetics) writes: : Greetings BioNetLanders - : : From all I can gather (using Gopher and USENET) NCBI's _Entrez_ system can only : run on a VMS system if Motif and some type of windowing environment is : utilized. _Entrez_ is tremendously powerful with its "neighboring" and "hard : link" concepts and could prove invaluable to many users on our campus if they : had access to it. No other system so painlessly merges the information : available in Medline to sequence data. The probability of getting many : separate laboratories to purchase both the _Entrez_ CD's and CD readers for : their own machines is nil. Therefore, we desire to place the system on a : distributed platform that all users could equally access. In our case that : limits our choice to VAX/VMS. Our system already has the necessary CD readers : and network connections. Yet few of our users have X-window server software on : their machines, furthermore, many of our users ONLY have access to text or at : most Tek graphics terminals. Has anybody developed a text only interface to : _Entrez_ ?! The potential application of such an interface in enormous. I : would imagine that if one were developed, the demand would be substantial. : : Call to software developers! Please heed this need to make NCBI's _Entrez_ : system accessible to ALL biologists, not just those chosen few with seemingly : bottomless computing resource budgets! : : : Steven M. Thompson : Consultant in Molecular Genetics and Sequence Analysis : VADMS (Visualization, Analysis & Design in the Molecular Sciences) Laboratory : Washington State University, Pullman, WA 99164-1224, USA : AT&Tnet: (509) 335-0533 or 335-3179 FAX: (509) 335-0540 : BITnet: THOMPSON@WSUVMS1 or STEVET@WSUVM1 : INTERnet: THOMPSON@wsuvms1.csc.wsu.edu : Steven -- NCBI is in the testing stages of a network version of Entrez - there are clients for Macs and PCs (as well as Unix and VMS) in this version, so that may offer an alternative to setting up a local version. If you're interested in testing network Entrez, send a message to: net-info@ncbi.nlm.nih.gov You may also be interested in a text only interface to Entrez that was done by Alex Reisner's group in Australia: reisner@angis.su.oz.au Regards, Dennis Benson NCBI From owner-software@net.bio.net Thu May 06 23:00:00 1993 Path: biosci!uwm.edu!zaphod.mps.ohio-state.edu!howland.reston.ans.net!ira.uka.de!news.dfn.de!rrz.uni-koeln.de!biomed.biolan.uni-koeln.de!KHOFMANN From: khofmann@biomed.biolan.uni-koeln.de Newsgroups: bionet.software Subject: Re: Protein analysis software. Message-ID: <1sdvfnINNd3m@rs1.rrz.Uni-Koeln.DE> Date: 7 May 93 15:33:11 GMT References: <1sbgpjINNt93@violet.csv.warwick.ac.uk> Reply-To: khofmann@biomed.biolan.uni-koeln.de Organization: Biochemical Institute, Cologne University Lines: 16 NNTP-Posting-Host: biomed.biolan.uni-koeln.de In article <1sbgpjINNt93@violet.csv.warwick.ac.uk>, lsren@csv.warwick.ac.uk (Mr D J Plows) writes: > I was just wondering if anyone knows of some shareware >(or other) software that allows analysis of protein sequence, such as >hydropathy plots etc. Also the program should allow me to export the >data (image) to another graphics package such as Freelance Graphics. > thanks > Dave You could try ProfileGraph (aka PROGRAPH) which is available by FTP from biomed.biolan.uni-koeln.de or from ftp.emb-heidelberg.de It is possible to export the data various numerical formats to an ASCII file that can be imported by all spreadsheet-type programs i know of. Best regards, kay From owner-software@net.bio.net Thu May 06 23:00:00 1993 Path: biosci!agate!usenet.ins.cwru.edu!magnus.acs.ohio-state.edu!mdale From: mdale@magnus.acs.ohio-state.edu (Michael L Dale) Newsgroups: bionet.software Subject: >>Wanted: Computerized Plant Key<< Message-ID: <1se6hl$gl0@charm.magnus.acs.ohio-state.edu> Date: 7 May 93 17:33:41 GMT Organization: The Ohio State University Lines: 13 NNTP-Posting-Host: bottom.magnus.acs.ohio-state.edu I have been seaking a plant key (dos-based) for quite a long time. Any help or direction you could give me would be appreciated. Thanx! =-=-=-=-=-=-=-=-=-=- Vivo procerus et adiuvo -=-=-=-=-=-=-=-=-=-= | Michael L. Dale | | The Ohio State University | | 2003 Millikin Road mdale@magnus.acs.ohio-state.edu | | Columbus, Ohio 43210 | =-=-=-=-=-=-=-=-=-=-=-=- Pax et vivo habito-=-=-=-=-=-=-=-=-=-=-= From owner-software@net.bio.net Thu May 06 23:00:00 1993 Path: biosci!agate!howland.reston.ans.net!noc.near.net!uunet!mcsun!sunic!news.lth.se!news.lu.se!macservenius.wblab.lu.se!Bo.Servenius From: Bo.Servenius@wblab.lu.se (Bo Servenius) Newsgroups: bionet.software Subject: Program to calculate Tm for oligo with Inosin??? Message-ID: <1993May7.130251.10779@nomina.lu.se> Date: 7 May 93 13:02:51 GMT Sender: news@nomina.lu.se (USENET News System) Organization: Lund university, Sweden Lines: 10 X-Xxmessage-Id: X-Xxdate: Fri, 7 May 93 21:09:00 GMT Nntp-Posting-Host: macservenius.wblab.lu.se X-Useragent: Nuntius v1.1.1d17 Dear Netters: We are trying to find a program that can calculate Tm values for oligos containing inosin. I have checked out Dataminder but it does not seem to understand other characters than ACGT. We are using macintosh computers. Any tip would be highly appreciated BOSSE From owner-software@net.bio.net Thu May 06 23:00:00 1993 Path: biosci!uwm.edu!cs.utexas.edu!uunet!mcsun!uknet!edcastle!sss From: sss@castle.ed.ac.uk (S S Sturrock) Newsgroups: bionet.software Subject: Re: Parallel Processors/Algorithms (Summary) Message-ID: <35398@castle.ed.ac.uk> Date: 7 May 93 12:56:29 GMT References: <1sar9sINNlml@s-crim1.dl.ac.uk> Organization: Edinburgh University Lines: 141 In article <1sar9sINNlml@s-crim1.dl.ac.uk> mbpcr@s-crim1.dl.ac.uk (A. Parsons) writes: Sheesh Tony! You have been listening! :-) > >begin ;-------------------------------------------------------------------------------- > >From: S S Sturrock >Early Correspondence from Shane Sturrock (author of Mpsrch) Very early so I figure I better correct a few points here and there. > >Well, MPsrch will arrive on a MasPar at Harrow (HGMP-RC) probably in the >next week or so, they will also be evaluating BLAZE. The EMBL installation The Harrow installation is about to be removed, for various reasons neither Blaze or MPsrch seemed to get much use. >is waiting on good network connections and an upgrade of the OS on their >machine since that MasPar was supplied by DEC. Well, as most of you should know the installation has been up and running since Feb and in that time nearly 3000 searches have been run, not bad. Comments about only swiss-prot being offered have been passed on and I have installed the latest code for both proteins *AND* nucleic acid searches but there needs to be some work done at the Heidelberg end now to offer this new code but then the EMBL na database will be available. >Performance wise, MPsrch is about two and a bit times quicker, performance >of BLAZE is about 55 million cell updates a second compared with 130 The gap has widened as expected. MPsrch performs 202 million cell updates per second now (Version 1.5) and MPsrch_na performs just under 400 million per sec, note that these performances are for 4K PEs. They scale linearly with processor numbers. >million on MPsrch. More to the point though, although BLAZE is a Smith >Waterman on the MasPar the reconstruction is by FASTDB, a word based method I think in this case my info was not quite right, I was informed that the alignments were full Smith/Waterman alignments later on, it still struck me as being strange that the alignment scores didn't always agree with the search, this I am assured has been fixed. >which is supposedly fast but does not guarantee to get the same alignment >as the MasPar, certainly the scores would not agree, the score is the one >reported by the S/W algorithm, the alignment is FASTDB. On MPsrch, the >reconstruction is also by full S/W and still manages to be about 10x Reconstruction is faster now, and I have increased the maximum size of alignments to 65000 bp for nucleic acids. >What you may be interested in is that the smallest MasPar machine is now >only 55K pounds including the workstation host, this gives you a 1024 >processor MasPar box with MP1 processors, upgradable to 4096 processors, >either MP1 or MP2 (which would give over 26000 mips + 6 gigaflops) without 6 gigs and is achieved with 16K PE MP2 configuration, the 4K PE set up will get 1.5 gigs, still not bad for a small box. >to go for anything else, and on the minimum configuration you will still >get 40 million cell updates a second at the moment, but should be much more For the smallest machine you now get 50 million for protein and 100 million for NA. >after I come back from California, basically you will get better Had a good time, made some definite improvements particularly losing some of the cost of database loading and other neat tricks. >performance than BLAZE on a far cheaper machine. Too good to be true? True. >ko61fr@genius.embnet.dkfz-heidelberg.de >Newsgroups: bionet.software >Organization: DKFZ Heidelberg >Cc: >Status: R > >I have been using BLAZE as long as it was freely available, and I felt the >big disadvantage with this service was that you could not get an alignment >of your query sequence to the hits. BLITZ (which is Mpsrch) includes alignments >(in fact you can choose what you want, hits and/or alignments) and is >therfore my preferred choice. The only problem I have with the BLITZ alignments >is that sometimes single residues are aligned (i.e. a single residue with gaps >on both sides); structurally this seems nonsense to me, but this is a minor >problem I am assuming it is a problem of this sort: ** . *. .* * *.. * . *.**.. .. * . . . .* * . * *.* * Db 64 RFVASDRLNDDAKAKFLNKLFYATVDITDPTQFGKLAD-LCGPVEK-GI-A--I-YLSTA 117 Qy 64 RF-TDDQ--AQAEA-FIEHFSYRAHDVTDAASYAVLKEAIEEAADKFDIDGNRIFYMSVA 119 Here the Alanine and Isoleucine are floating with gaps on either side, this is an unfortunate effect of the algorithm and the scoring, I am looking into correcting this at the moment. The aligner for proteins and nucleic acids will prevent obvious problems of the kind I described earlier where compound indels (gaps) are kept to a minimum but this requires that the score remains the same (ie best that the algorithm allows) and in the above case, if you want to join the GIAI sequence to get one gap the score gets lower so I don't do it for now. Modified penalties (such as affine gaps) will possibly be added as long as it can be done without too much performance loss, where there's a will etc. >I did not attempt to compare the BLAZE and BLITZ results systematically, >because of the missing alignments. This is a problem (with Blaze, supposed to be fixed). > >I'm also interested in this area. You may have more luck posting to >the comp.parallel newsgroup. I do know that several people are >working in this area. I recall something on the Thinking Machines >CM-5 (and possible an older version on the CM-2). There are also The best performance I have heard of for the CM-5 is 30 million on a 32 node CM-5, you would thus need 400+ nodes to compete with a 4K PE MasPar. Work I did on the CM-200 showed that it was not really suitable for high mip requirement tasks like sequence analysis, never really managed to get over 20 million on 16K PEs. Mind you, I never ventured out of using C* on that machine, with the MasPar assembly is so easy that you can make some really significant gains of compiled C code. (Factor of 3 for MPsrch_na) >------------------------------------------------------------------------------ >From: Michael McKenna writes >identity, but MPsrch identified related molecules >where FASTA, BLAST, Blaze, and BLOCKS failed. Nice :-) -- \. That is biological Captain! | Shane Sturrock, BRU, Darwin Building, (}:-( -- Mr Sturrock | University of Edinburgh, Scotland, /' | Untied Kingdom (Split now!) :-) From owner-software@net.bio.net Thu May 06 23:00:00 1993 Path: biosci!JAGUAR.CSC.WSU.EDU!THOMPSON From: THOMPSON@JAGUAR.CSC.WSU.EDU ("Steve Thompson: VADMS genetics") Newsgroups: bionet.software Subject: VAX/VMS & NCBI's _Entrez_: text interface desired Message-ID: <930507104042.214062a7@JAGUAR.CSC.WSU.EDU> Date: 7 May 93 17:40:42 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 32 Greetings BioNetLanders - From all I can gather (using Gopher and USENET) NCBI's _Entrez_ system can only run on a VMS system if Motif and some type of windowing environment is utilized. _Entrez_ is tremendously powerful with its "neighboring" and "hard link" concepts and could prove invaluable to many users on our campus if they had access to it. No other system so painlessly merges the information available in Medline to sequence data. The probability of getting many separate laboratories to purchase both the _Entrez_ CD's and CD readers for their own machines is nil. Therefore, we desire to place the system on a distributed platform that all users could equally access. In our case that limits our choice to VAX/VMS. Our system already has the necessary CD readers and network connections. Yet few of our users have X-window server software on their machines, furthermore, many of our users ONLY have access to text or at most Tek graphics terminals. Has anybody developed a text only interface to _Entrez_ ?! The potential application of such an interface in enormous. I would imagine that if one were developed, the demand would be substantial. Call to software developers! Please heed this need to make NCBI's _Entrez_ system accessible to ALL biologists, not just those chosen few with seemingly bottomless computing resource budgets! Thank you for the time, Steve T Steven M. Thompson Consultant in Molecular Genetics and Sequence Analysis VADMS (Visualization, Analysis & Design in the Molecular Sciences) Laboratory Washington State University, Pullman, WA 99164-1224, USA AT&Tnet: (509) 335-0533 or 335-3179 FAX: (509) 335-0540 BITnet: THOMPSON@WSUVMS1 or STEVET@WSUVM1 INTERnet: THOMPSON@wsuvms1.csc.wsu.edu From owner-software@net.bio.net Thu May 06 23:00:00 1993 Path: biosci!daresbury!daresbury!news From: LYNDON@BMS-UNIT.ICR.AC.UK Newsgroups: bionet.software Subject: Secondary Structure Prediction Message-ID: <1993May7.104359.11697@gserv1.dl.ac.uk> Date: 7 May 93 11:39:00 GMT Sender: list-admin@daresbury.ac.uk Distribution: bionet Lines: 7 Original-To: BIO-SOFT@UK.AC.DARESBURY Does anybody know of any shareware programs to predict the secondary structure of a proteim given its primary amino acid sequence and where to obtain such a program? Thanks in advance Lyndon From owner-software@net.bio.net Thu May 06 23:00:00 1993 Path: biosci!enterpoop.mit.edu!gatech!howland.reston.ans.net!usc!cs.utexas.edu!uunet!mcsun!uknet!pipex!zaphod.crihan.fr!univ-lyon1.fr!ghost.dsi.unimi.it!batcomputer!munnari.oz.au!uniwa!uniwa!not-for-mail From: andrewh@uniwa.uwa.edu.au (Andrew Hobbs) Newsgroups: bionet.software Subject: Contig assembly program Message-ID: <1sda19$gkd@uniwa.uwa.edu.au> Date: 7 May 93 09:27:05 GMT Organization: The University of Western Australia Lines: 28 NNTP-Posting-Host: uniwa.uwa.edu.au X-Newsreader: Tin 1.1 PL5 Hi, Forgive me if I am asking an FAQ. Does anyone know of a public domain program (set of programs) akin to the Staden set, to assemble sequences hot off the autoradiograph, into a completed sequence, - for MS DOS (or windows even). We have a commercial set from Amersham but it has this thing hanging off the back of the computer without which it won't work. It is incredibly poorly behaved, rewriting the configuration files and then requiring one to reboot the computer. Finally now that we are networked we find that it won't tolerate any extra cards in the extension slots. Finally, finally after trying to get it to work with other cards, it won't work at all.!!!!!!!! :-( I was thinking of the possibility of getting Staden's scource files (in Fortran) and compiling (and possibly rewriting bits if necessary) on my PC. Has anyone tried this? In the meantime does anyone know of a public domain program as above. Thanks in advance. Andrew Hobbs Dept of Biochemistry University of Western Australia andrewh@uniwa.uwa.edu.au From owner-software@net.bio.net Thu May 06 23:00:00 1993 Path: biosci!uwm.edu!zaphod.mps.ohio-state.edu!howland.reston.ans.net!gatech!taco!wed.poulsci.ncsu.edu!nEcho From: nEcho@NCSUmvs (Scott Knowles) Newsgroups: bionet.software Subject: Bacteria Identification databases wanted Message-ID: Date: 7 May 93 17:42:27 GMT Sender: news@ncsu.edu (USENET News System) Organization: North Carolina State University Lines: 14 BioNetters, I am looking for databases of results of various tests used to identify species/strains of bacteria. In a perfect world, this db would be organized by strain with each test-result assigned a value ranging from strong positive to strong negative. Additionally, the db would be well documented and in the public domain. Does such a database exist? Any tips or leads are appreciated. Scott Knowles < nEcho@NCSUMVS > Toxicology NC State University From owner-software@net.bio.net Thu May 06 23:00:00 1993 Path: biosci!uwm.edu!zaphod.mps.ohio-state.edu!howland.reston.ans.net!newsserver.jvnc.net!synapse.bms.com!riversend.bms.com!user From: Roberts_D@BMS.COM (Dan Roberts) Newsgroups: bionet.software Subject: PROGRAPH Program Description?? Message-ID: Date: 7 May 93 14:57:01 GMT Sender: news@synapse.bms.com Followup-To: bionet.software Organization: Bristol-Myers-Squibb Research Lines: 8 Does anyone out there have a description of the IBM platform PROGRAPH program that they could send me??..Thanks...:-)..Dan Dan Roberts BRISTOL-MYERS-SQUIBB PHARM. RES. CENTER Cardio-Vascular Biochem Dept. PRINCETON, NEW JERSEY U.S.A. PLANET EARTH, MILKY-WAY GALAXY <<<>>>Roberts_D@BMS.COM From owner-software@net.bio.net Thu May 06 23:00:00 1993 Path: biosci!agate!howland.reston.ans.net!noc.near.net!uunet!nih-csl!helix.nih.gov!jip From: jip@helix.nih.gov (John Powell) Newsgroups: bionet.software,bionet.computational Subject: Pedigree drawing software/Genetic DB Message-ID: <1993May7.110756@helix.nih.gov> Date: 7 May 93 15:07:56 GMT Sender: postman@alw.nih.gov (AMDS Postmaster) Reply-To: jip@helix.nih.gov (John Powell) Organization: National Institutes of Health Lines: 29 Xref: biosci bionet.software:4917 We are planning to put medical data about families with genetic neurological diseases into a computerized database in order to facilitate quantitative and statistical studies. The data will include detailed medical histories as well as more general biological data on individuals who are affected, are carriers, or are not affected. At present, we are planning to implement the database structure in Sybase on a Sun, but could change platforms or environment in order to incorporate software that already exists. We are particularly interested in generating graphical images of pedigrees of families with disorders from some type of text output which could be generated by a standard relational database package. We are aware of several commerical programs as well as Pedraw. We are interested in communicating with anyone else who might have software for this type of use or be working in this area. Please respond via E-mail, we'll post a summary of responses to the net. Thanks in advance.... -- John Powell phone: (301) 496-2963 Building 12A, Room 2031 FAX: (301) 402-2867 National Institutes of Health uucp: uunet!jip%alw.nih.gov Bethesda, MD 20892 Internet: jip@alw.nih.gov From owner-software@net.bio.net Fri May 07 23:00:00 1993 Path: biosci!daresbury!doc.ic.ac.uk!uknet!pipex!uunet!zaphod.mps.ohio-state.edu!howland.reston.ans.net!darwin.sura.net!bogus.sura.net!news-feed-1.peachnet.edu!concert!duke!news.duke.edu!chlamy.botany.duke.edu!user From: chlamy@acpub.duke.edu (Elizabeth Harris) Newsgroups: bionet.software Subject: Re: Conway's Life Message-ID: Date: 7 May 93 15:23:29 GMT References: Sender: news@news.duke.edu Followup-To: bionet.software Organization: Duke University Lines: 12 Nntp-Posting-Host: chlamy.botany.duke.edu In article , zxmkr08@studserv.zdv.uni-tuebingen.de (Cornelius Krasel) wrote: > Sorry to post this on the net, but the return > address of Laura is invalid (domain name missing). > Laura, I tried to send you a private reply also, but my message bounced. Please send me a private message and I'll give you some more information. Elizabeth Harris chlamy@acpub.duke.edu From owner-software@net.bio.net Fri May 07 23:00:00 1993 Path: biosci!agate!howland.reston.ans.net!noc.near.net!uunet!psgrain!ee.und.ac.za!hippo!miml From: miml@hippo.ru.ac.za (Malcolme Logie) Newsgroups: bionet.software Subject: PHOTOSYNTHESIS Message-ID: <1993May8.140019.14129@hippo.ru.ac.za> Date: 8 May 93 14:00:19 GMT Organization: Rhodes University, Grahamstown, South Africa Lines: 22 Iam looking for infomation about building a chlorophyll fluorometer as well as writting the software to run it. I have also written some other software for the caluculation of photsynthetic parameters for infrared gas analysis. For more info. see my letter to BIONET.PHOTOSYNTHESIS Thanks Malcolme MALCOLME LOGIE - Department Biochemistry & Microbiology Rhodes Unversity, Grahamstown, 6140, RSA. Internet: miml@hippo.ru.ac.za. Telephone 0461 22023 x 441 -- From owner-software@net.bio.net Fri May 07 23:00:00 1993 Path: biosci!uwm.edu!ux1.cso.uiuc.edu!sdd.hp.com!network.ucsd.edu!munnari.oz.au!metro!angis.su.oz.au!reisner From: reisner@angis.su.oz.au Newsgroups: bionet.software Subject: Re: VAX/VMS & NCBI's _Entrez_: text interface desired Message-ID: <1993May8.115844.25255@ucc.su.OZ.AU> Date: 8 May 93 11:58:44 GMT Sender: news@ucc.su.OZ.AU Reply-To: reisner@angis.su.oz.au () Organization: ANGIS, The University of Sydney, Australia Lines: 24 Nntp-Posting-Host: morgan.angis.su.oz.au Jacq Smelt and Carolyn Bucholtz of ANGIS have developed a cursus based menu system which interfaces with Entrez. Virually all the functionality of the GUI is available using it. We have had it running here for several months under SunOS 4.1.3. Written in ANSI C it appears to run perfectly well with vt100 terminals or emulating softare. We have no experience with trying to run it under VAX/VMS but it oughtn't to be too difficult to port it. Note that the latest version of ENTEZ contains about 820 Mbytes (2 CD-ROMS). I would urge you not to try to run it from the CD-ROMS; we immediately transfer the contents to a hard disc. With a single user CD-ROMS are acceptable but quite slow, on a multiuser system when simultaneously accessed by two or more users they can become frustrating. With Entrez now a multi CD utility I believe you would have very serious problems. A compressed tar file of the source code has been deposited with NCBI and is available via anonymous ftp from ncbi.nlm.nih.gov as /entrez/e2d/entrez-2d.tar.Z Alex Reisner ANGIS (Aust. Nat. Genomic Information Service) From owner-software@net.bio.net Fri May 07 23:00:00 1993 Path: biosci!daresbury!bioftp.unibas.ch!rc1!vnet3.vub.ac.be!waverheu From: waverheu@vub.ac.be (Willy A Verheulpen) Newsgroups: bionet.software Subject: Re: Plaasmid maps Message-ID: Date: 6 May 93 16:00:41 GMT References: <1993May6.134850.13692@es.dupont.com> Sender: news@rc1.vub.ac.be Organization: Institute Molecular Biology, Brussels Free University Lines: 24 In article <1993May6.134850.13692@es.dupont.com> moldovbj@esvx12.es.dupont.com writes: >From: moldovbj@esvx12.es.dupont.com >Subject: Plaasmid maps >Date: 6 May 93 13:48:50 GMT >I am looking for software that will produce graphical maps of plasmid >constructs for the IBM, similar to that from DNA Strider for the Mac. >Is there anything out there, either shareware or commercial, that has >the ability to draw maps, do restriction digests, cut-and-paste fragments, >etc? >Moldovbj@esvax.dnet.dupont.com We use a program that is called "Clone" but it is a rather "old" version. Contact me by e-mail if more info is needed ! I##################################################################I I I I Willy A Verheulpen Systems Coordination I I Brussels Free University Institute Molecular Biology I I e-mail : waverheu@vub.ac.be I I I I##################################################################I From owner-software@net.bio.net Fri May 07 23:00:00 1993 Path: biosci!daresbury!bioftp.unibas.ch!comp.bioz.unibas.ch!doelz From: doelz@comp.bioz.unibas.ch (Reinhard Doelz) Newsgroups: bionet.software Subject: Don't be too high-tech!!! Re: VAX/VMS & NCBI's _Entrez_: text interface desired Message-ID: <1993May8.071326.20248@comp.bioz.unibas.ch> Date: 8 May 93 07:13:26 GMT References: <930507104042.214062a7@JAGUAR.CSC.WSU.EDU> Sender: usenet@comp.bioz.unibas.ch (NEWS transaction account) Reply-To: doelz@urz.unibas.ch Distribution: bionet Organization: EMBnet Switzerland [BASEL] Lines: 42 Nntp-Posting-Host: biox.embnet.unibas.ch In article , wrp@cyclops.micr.Virginia.EDU (Bill Pearson) writes: |> In article <930507104042.214062a7@JAGUAR.CSC.WSU.EDU> THOMPSON@JAGUAR.CSC.WSU.EDU ("Steve Thompson: VADMS genetics") writes: ... |> |> >Yet few of our users have X-window server software on their machines, |> >furthermore, many of our users ONLY have access to text or at most |> >Tek graphics terminals. |> |> It is hard to believe that there are more terminals than Windows compatible |> PC's at many universities today. |> |> >Has anybody developed a text only interface to _Entrez_ ?! |> |> No, nor should they. |> It is reality that the current infrastructure in Universities is that workgroups of 5-15 persons have rarely access to Workstations or ethernetted environments. Some even use modems to access a vt100 type server. My surveys indicate that, in Switzerland, the number of users who currently have vt100 type serial access to molecular biology computing is considerable and will stay considerable in the next years due to low economy -> shrinking budgets -> no money to recable buildings. This is also true in most parts of Germany and other countries where I know the environments. Despite my believe that a GUI is what all biologists should have it is a severe mistake to neglect all non-X or non-ethernetted biologists. A certain fraction doesn't even have access to the central facility but need to walk (or even travel) to get to a place where a access point is on the desktop. So lests behave as generous as possible and stick to also line-oriented interfaces. -- +----------------------------------+-------------------------------------+ | Dr. Reinhard Doelz | RFC doelz@urz.unibas.ch | | Biocomputing | DECNET 20579::48130::doelz | |Biozentrum der Universitaet | X25 022846211142036::doelz | | Klingelbergstrasse 70 | FAX x41 61 261- 6760 or 267- 2078 | CH 4056 Basel | TEL x41 61 267- 2076 or 2247 | +------------- bioftp.unibas.ch is the SWISS EMBnet node ----------------+ ----------------------------------------- From owner-software@net.bio.net Fri May 07 23:00:00 1993 Path: biosci!daresbury!doc.ic.ac.uk!warwick!pipex!uunet!zaphod.mps.ohio-state.edu!darwin.sura.net!news-feed-1.peachnet.edu!concert!uvaarpa!murdoch!cyclops.micr.Virginia.EDU!wrp From: wrp@cyclops.micr.Virginia.EDU (Bill Pearson) Newsgroups: bionet.software Subject: Re: VAX/VMS & NCBI's _Entrez_: text interface desired Message-ID: Date: 8 May 93 00:52:50 GMT References: <930507104042.214062a7@JAGUAR.CSC.WSU.EDU> Sender: usenet@murdoch.acc.Virginia.EDU Distribution: bionet Organization: University of Virginia Lines: 50 In article <930507104042.214062a7@JAGUAR.CSC.WSU.EDU> THOMPSON@JAGUAR.CSC.WSU.EDU ("Steve Thompson: VADMS genetics") writes: >Greetings BioNetLanders - > >From all I can gather (using Gopher and USENET) NCBI's _Entrez_ >system can only run on a VMS system if Motif and some type of >windowing environment is utilized. Entrez will only run on a windowing system on any computer -MSWindows, Mac, or X-windows. >The probability of getting many separate laboratories to purchase >both the _Entrez_ CD's and CD readers for their own machines is nil. >Therefore, we desire to place the system on a distributed platform >that all users could equally access. In our case that limits our >choice to VAX/VMS. Our system already has the necessary CD readers >and network connections. At most universities, a cost-effective system can be built on a Novell Network server. Often you will find that there is a server available, in the library for example, and the only cost is the addition of a 1 GB disk ($1500). Even if you must purchase the server and software, a it can be done for < $5000. And, as Dennis Benson mentions, you can now use Entrez via tcp/ip, without having the database on line at all. >Yet few of our users have X-window server software on their machines, >furthermore, many of our users ONLY have access to text or at most >Tek graphics terminals. It is hard to believe that there are more terminals than Windows compatible PC's at many universities today. >Has anybody developed a text only interface to _Entrez_ ?! No, nor should they. >The potential application of such an interface in enormous. I would >imagine that if one were developed, the demand would be substantial. The beauty of Entrez is not only the database, it is also the user interface. Anyone can start using entrez in a matter of minutes, because of its excellent presentation. With inexpensive network servers and Windows (or Mac) machines available, it is very difficult to justify the investment in a terminal based interface to Entrez, or any other powerful windowed environment. What you save in not purchasing hardware, you easily spend in increased training and decreased access. While I am no believer in the propaganda that Microsoft puts out about Windows productivity, in the case of Entrez, the window system really increases the value. Bill Pearson From owner-software@net.bio.net Fri May 07 23:00:00 1993 Path: biosci!ICBR.IFAS.UFL.EDU!SJJ From: SJJ@ICBR.IFAS.UFL.EDU ("JONG, SONG-MUH J") Newsgroups: bionet.software Subject: Protein structure display programs? Message-ID: <9305082302.AA04615@net.bio.net> Date: 8 May 93 23:53:00 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 10 Hi, Many papers publish protein structures in three-dimensional forms as ribbons shapes. Can anyone inform me which program is capable of doing this structural display? The program preferably works on PC, but MAC progams are fine too. Thanks for any input! Song-Muh jong sjj@icbr.ifas.ufl.edu From owner-software@net.bio.net Fri May 07 23:00:00 1993 Path: biosci!agate!howland.reston.ans.net!noc.near.net!uunet!munnari.oz.au!metro!angis.su.oz.au!reisner From: reisner@angis.su.oz.au Newsgroups: bionet.software Subject: Re: Don't be too high-tech! Message-ID: <1993May8.213442.4567@ucc.su.OZ.AU> Date: 8 May 93 21:34:42 GMT Sender: news@ucc.su.OZ.AU Reply-To: reisner@angis.su.oz.au () Organization: ANGIS, The University of Sydney, Australia Lines: 26 Nntp-Posting-Host: morgan.angis.su.oz.au With regard to the specific matter of access to Entrez via GUI or non-GUI interfaces it needn't be a matter of one precluding the other. ANGIS provides both. Currently of the 1000 or so users of ANGIS in Australia about 20% have access to terminals, workstations, or personal computers that utilize the X Window System, to exclude the remaining 80% from on-line access to Entrez I believe would be inappropriate for a national service. Similarly not to provide the GUI version to those able to make use of it would be derelict. Within the next 18-24 months we expect that the per-centage of users able to utilize the X Window System will rise to 75% or more. An increasing number of databases and applications make use of the X Window System, I believe it is incumbent on ANGIS to provide for that; so for example we make ADeDB and other genomic databases based on ACeDB available on ANGIS and where there are applications utilizing the X Window System they are made available; where there are parallel X and non-X versions av