From owner-software@net.bio.net Wed Sep 01 23:00:00 1993 Path: biosci!daresbury!daresbury!news From: msaul@uk.ac.crc (Dr. M.W. Saul) Newsgroups: bionet.software Subject: C code for srestriction enzyme search Message-ID: <1993Sep2.132341.29841@gserv1.dl.ac.uk> Date: 2 Sep 93 13:21:27 GMT Sender: list-admin@daresbury.ac.uk Distribution: bionet Lines: 11 Precedence: first-class Original-To: bio-soft@uk.ac.daresbury I am looking for some C code to do a simple search of sequences, preferably in GCG format, for resatriction sites. Optimally output should be of the sites present and where the size of fragemets ents , but this is not so important. Can someone help ? I have access via FTP, e-mail, gopher etc. to most of the main sites, but don't know where to stasrt :-( Send info to m.saul@hud.ac.uk, or to the address on this message. Thanks in advance, Mike SAUL Huddersfield University W. Yorks U.K. From owner-software@net.bio.net Wed Sep 01 23:00:00 1993 Path: biosci!daresbury!daresbury!not-for-mail From: mbsau@s-crim1.dl.ac.uk (M.W. Saul) Newsgroups: bionet.software Subject: Re: C code for srestriction enzyme search Message-ID: <264vh1INNqge@s-crim1.dl.ac.uk> Date: 2 Sep 93 14:21:21 GMT References: <1993Sep2.132341.29841@gserv1.dl.ac.uk> Distribution: bionet Organization: Daresbury Lab., Warrington, U.K. Lines: 3 NNTP-Posting-Host: s-crim1.dl.ac.uk Sorry about all the ^H's in my posting I'll learn a bit more before I post again. In the meantime I think my request was still understandable? From owner-software@net.bio.net Wed Sep 01 23:00:00 1993 Path: biosci!daresbury!zeta.bmc.uu.se!corax.udac.uu.se!sunic!uts!biobase!pamaga From: pamaga@biobase.aau.dk (Paulo Magalhaes) Newsgroups: bionet.software Subject: A.L.F. - DNA Sequencer Message-ID: Date: 2 Sep 93 10:20:57 GMT Organization: The Danish BioBase Lines: 52 Hi! This is not really a 'software' question, but I found no other group which would be appropriate... So, bear with me a while. We have recently acquired an 'ALF'. The software controlling the machine, as well as the data analysis program, runs under OS/2. All the PCs in the lab run DOS only or DOS/Windows - all except the one running ALF, of course. All the computers are stand alone machines; i.e., our 'masters' still haven't heard of things called LANs... Anyway, on to the main point. As the workload on poor ALF keeps increasing, we now need another PC which can lend a hand in the ALF-generated data analysis. The idea was to acquire an EISA machine to act as a server, running OS/2, where all the data files could be kept. This way both the present PC running ALF and this new one could be used to control/manage data from the sequencer. Furthemore, the new machine would also become (in the nearby future!) the server for all the other PCs in the lab - of course we still have to convince the brass to spend some money on the installation of the network, but we feel that it's only a question of time... Now for the really important part :) What are the flaws in our reasoning? Has anyone out there done the same - using the ALF/OS2 software, that is? What kind of problems can we expect to face? Keeping in mind the other PCs which will be added at a later date, what do we need to hook up just the 2 running OS2? Yes, we don't know so much about computers... ...but we're willing to learn! Your opinions are most welcome. All the best, Paulo -- ********************************************************************** * Paulo Magalhaes | email: pamaga@biobase.aau.dk * * Section of Clinical Genetics | fax: +45 / 31 39 65 43 * * Rigshospitalet | voice: +45 / 35 45 45 92 * * Copenhagen | * * Denmark | snail-mail: C'mon, this is the 90s! * ********************************************************************** -- ********************************************************************** * Paulo Magalhaes | email: pamaga@biobase.aau.dk * * Section of Clinical Genetics | fax: +45 / 31 39 65 43 * * Rigshospitalet | voice: +45 / 35 45 45 92 * From owner-software@net.bio.net Wed Sep 01 23:00:00 1993 Path: biosci!daresbury!daresbury!news From: PARSONS_A@uk.co.pcr.snd01 Newsgroups: bionet.software Subject: Re: Neural Network programs for sequence analysis? Message-ID: <1993Sep2.125016.28348@gserv1.dl.ac.uk> Date: 2 Sep 93 13:49:22 GMT Sender: list-admin@daresbury.ac.uk Distribution: bionet Lines: 48 Precedence: first-class Original-To: BIO-SOFT In article <9308311856.AA03849@genetics.com> mcolbert@GENETICS.COM writes: >Hello, > >I am looking for information on neural network packages that can be used for >protein and nucleic acid sequence analysis. Specifically, we have novel >sequences and want to see what (if anything) they may be similar to within the >databases. The colleague I am asking this question for has already run >traditional types of homology searches (blast,fasta) with not much success. >The profile analysis offered in the GCG package is more sensitive than a >traditional homology search, but creating a profile requires having multiple >sequences that you align and search with, and we have only one sequence at a >time. I have done some work with neural networks (very limited) so we >thought we would at least ask around. > >Any ideas? > >Thanks. > >-Maureen Colbert >mcolbert@genetics.com I know of two neural net applications ;- Dmitrij Frishmann & Patrick Argos (1992) "Recognition of distantly related protein sequences using conserved Motifs and Neural Nets" Jonathan Hirst & Michael Sternberg (1992) "Evaluation of protein motif recognition by neural networks" Both presented at "Genes, Proteins and Computers - 2nd International Conference on Computing in Molecular Biology" Chester (UK), September 1992 Frishmann at the time was at EMBL and a netfind shows him to be reachable as : frishman@embl-heidelberg.de also Argos can be mailed at: argos@embl-heidelberg.de I couldnt narrow down the icrf search theree are 27 domains at icrf - try posting to postmaster@icrf.ac.uk they may be able to give you Hirst and Sternberg's email addresses. Bon Chance! Tony P. (mbpcr@seqnet.dl.ac.uk AKA parsons_a@snd01.pcr.co.uk) From owner-software@net.bio.net Wed Sep 01 23:00:00 1993 Path: biosci!BRUNB.BITNET!WAGNERF From: WAGNERF@BRUNB.BITNET (Wagner Fontes) Newsgroups: bionet.software Subject: Clustal (Gap penalty) Message-ID: <9309021947.AA01103@net.bio.net> Date: 2 Sep 93 20:40:09 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 22 Hi, I'm trying to align peptides using Clustal V, but found a problem: With a low gap penalty, to allow the peptide to be inserted anywhere in the sequence, the software inserts long gaps IN the peptide. Is there a way to increase the gap penalty only for the internal gaps, allowing long gaps at the beginning and/or end of the sequence? Thanks, Wagner Fontes(WAGNERF@BRUNB.BITNET) Brazilian Center of Protein Sequencing Biochemistry and Protein Chemistry Lab. University of Brasilia Brasilia - Brazil . From owner-software@net.bio.net Wed Sep 01 23:00:00 1993 Path: biosci!max.physics.sunysb.edu!mcbsgi.bio.sunysb.edu!kramer From: kramer@mcbsgi.bio.sunysb.edu (joe kramer) Newsgroups: bionet.software Subject: SGI Protein analysis software Message-ID: <2654jd$8k0@max.physics.sunysb.edu> Date: 2 Sep 93 15:47:57 GMT Organization: Institute For Theoretical Physics Lines: 14 NNTP-Posting-Host: mcbsgi.bio.sunysb.edu I am looking for software that will allow me to do stadard analysis' (multiple alignment, IIdary structure, helical wheel, searches etc.) on an SGI Indigo. A primary concern is finding such a program that is easily implemented, as I am a unix novice. Thanks, Joe Kramer S.U.N.Y. Stony Brook Dept. of Mol and Cell Bio kramer@mcbsgi.bio.sunysb.edu From owner-software@net.bio.net Wed Sep 01 23:00:00 1993 Path: biosci!daresbury!doc.ic.ac.uk!agate!howland.reston.ans.net!gatech!pitt.edu!dsinc!netnews.upenn.edu!a.chem.upenn.edu!williams From: williams@a.chem.upenn.edu (Scott A. Williams) Newsgroups: bionet.software Subject: Re: computer programming/data analysis Message-ID: <144474@netnews.upenn.edu> Date: 2 Sep 93 12:27:46 GMT References: <1993Aug29.213231.5582@c-mols.siu.edu> Sender: news@netnews.upenn.edu Organization: University of Pennsylvania Lines: 28 Nntp-Posting-Host: a.chem.upenn.edu >In article <1993Aug29.213231.5582@c-mols.siu.edu> shriver@qm.c-biochem.siu.edu writes: >>We are in the middle of a discussion here concerning the pros and cons of >>having graduate students in biochemistry and molecular biology take a >>short course in computer programming and data analysis. The molecular >>biologists feel that this is an old fashioned requirement, while the >>biophysicists feel that todays students are becoming less and less >>acquainted with quantitative approaches. I have been asked to determine >>if any biochemistry or molecular biology graduate programs still require >>their students to have been exposed to computer programming (in any >>language) and data analysis. Definitely, and without question, take a computer programming course/numerical analysis course at some point. I have background and degrees in both biochemistry and physical chemistry and both require these skills to various extents. I thought, while achieving my biochemistry degree,that I would not need the math skills. However, while tackling such problems as enzyme kinetics, radiometric analysis and any kind of spectroscopy, I learned otherwise and ended up playing alot of "catchup". Also consider this, the world (like it or not) is all computers and even the molecular biologists will need the computer graphics capabilities to do molecular modeling (requiring both math and computer skills) and sequence analysis/identification. -Scott From owner-software@net.bio.net Wed Sep 01 23:00:00 1993 Path: biosci!CRCVMS.UNL.EDU!VWARWAR From: VWARWAR@CRCVMS.UNL.EDU (VITOR WARWAR) Newsgroups: bionet.software Subject: Postscript files? Message-ID: <01H2GWCDDX8W003S5M@crcvms.unl.edu> Date: 2 Sep 93 16:07:00 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 8 Hi Is there a way to print a postscript file generated by GCG in a dot matrix printer? Thanks you all Vitor Warwar From owner-software@net.bio.net Wed Sep 01 23:00:00 1993 Path: biosci!uwm.edu!spool.mu.edu!umn.edu!molbio.cbs.umn.edu!allen From: allen@molbio.cbs.umn.edu (Allen Bartman) Newsgroups: bionet.software Subject: lab manager Message-ID: Date: 2 Sep 93 21:02:55 GMT Sender: news@news.cis.umn.edu (Usenet News Administration) Organization: University of Minnesota, Twin Cities Lines: 7 Nntp-Posting-Host: molbio.cbs.umn.edu X-Newsreader: Tin 1.1 PL5 Does anyone know of a good lab manager? Something that we can use to keep track of strains, oligo, plasmids, etc. thanks in advance. al allen@molbio.cbs.umn.edu From owner-software@net.bio.net Wed Sep 01 23:00:00 1993 Path: biosci!rutgers!gatech!howland.reston.ans.net!agate!doc.ic.ac.uk!uknet!pipex!zaphod.crihan.fr!univ-lyon1.fr!cri.ens-lyon.fr!ibcp.fr!deleage From: deleage@ibcp.fr (G.Delage) Newsgroups: bionet.software Subject: ANTHEPROT: A package for protein sequence analysis Message-ID: <264ufu$fbm@cri.ens-lyon.fr> Date: 2 Sep 93 14:03:42 GMT Organization: Institut de Biologie et Chimie des Proteines. CNRS-Lyon Lines: 120 NNTP-Posting-Host: ibcp.fr X-Newsreader: TIN [version 1.1 PL8] -- ------------------------------------------------------------------------ # # # ####### # # ####### ###### ###### ####### ####### # # ## # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # ####### ##### ###### ###### # # # ####### # # # # # # # # # # # # # # # # ## # # # # # # # # # # # # # # # # # ####### # # # ####### # ----------------------------------------------------------------------- by G.Deleage & C. Geourjon This is a general annoucement of the availability of ANTHEPROT to all academic researchers. ANTHEPROT (ANalyze THE PROTeins) is a package to make protein sequence analysis such as alignment, secondary structure predictions, sites & function detection, physico-chemical profiles, homology search and 3D display of protein structures. This program is now available either for IBM RISC 6000 workstations or IBM PC compatible microcomputers. The main feature of ANTHEPROT is that it is fully interactive within a graphical interface. No particular knowledge about computers is needed and any mole- cular biologist is able to use it. The main methods are: * Input, addition or modification of sequences (FASTA format). * Edition (graphic display of sequence, molecular weight,...). * Extraction of a sequence from databases (SWISSPROT). * Search for subsequences (with pattern matching approach). * Dot matrix plot (4 substitution matrix). * Secondary structure prediction (6 methods). * Profile analysis (Hydrophobicity, flexibility, solvant accessibility, membrane spanning regions, antigenicity,...). * Amphiphilicity of secondary structure. * Prediction of the cleavage site of signal peptide. * Helical wheel projection. * Protein digestion and RP-HPLC simulations. * Circular dichroism spectra analysis. * Search for pattern of biological sites and functions (PROSITE). * Matrix profile analysis of blocks (BLOCKS.DAT). * Multiple alignment methods. * Fasta graphical interface. IBM RISC 6000 version ===================== This version can be considered as a molecular graphic software that is very useful to those who want to play with molecular modelling of proteins. These graphic capabilities are combined with many powerful tools to analyze a protein sequence and structure. The ANTHEPROT package is made of more than 71 submenus which account for about 30 different methods of protein sequence analysis. The complete package represents: 50 000 lines of source code 500 subroutines 1 3000 000 octets of source code 2 6800 000 octets for the antheprot executable file Systems and materials --------------------- ANTHEPROT can run on all IBM Risc 6000 computer equipped with a 3 D graphic adapter (with or without Z buffer, 8 or 24 bits plane) with graPHIGS libraries installed (libgP.a). The perfect configuration : IBM Risc 6000 (any model of CPU from 220 to 580) with at least 32 Mo of RAM), valuators, LPFK, 3 D+ graphic adapter with 24 bits plane + Z buffer or GT4x and GTO graphic cards. About 160 Mo of disk place is needed since the SWISSPROT and the NBRF/PIR protein sequence databases are also included. Distribution support : 150Mo streamer cartridge. References: C. Geourjon, G. Deleage and B. Roux ANTHEPROT : An interactive graphic software for analyzing protein structures from sequences. J. Mol. Graph., 1991, 9, 188-190 Geourjon C., Deleage G. Interactive and graphic coupling between multiple alignments, secondary structure predictions and motif/pattern scanning into proteins. Comput. Appl. Biosci. 9:87-91(1993). G. Deleage and C. Geourjon An interactive graphic program for calculating secondary structures content of proteins from circular dichroism spectrum. CABIOS, 1993, 9, 197-199 IBM PC compatible version ========================= The methods are essentailly the same than in the RISC 6000 except for the 3D display module. ANTHEPROT works onto all 80x86 with x>=2 processors. Math coprocessor is fully supported. The total disk space needed is about 5Mo. It is supplied onto 2 HD (1.44Mo) disks. An automatic installation menu is available by typing A:install The maximal graphic resolution supported is VGA (640x480). The program can be fully mouse driven (Microsoft compatible). Distribution support : 2 MS-DOS fomatted HD disks (1.44Mo) References: G. Deleage, FF Clerc and B Roux ANTHEPROT: IBM PC and Apple Macintosh versions. CABIOS, (1989) 5, 159-160 G. Deleage, FF Clerc, B Roux and DC Gautheron ANTHEPROT: A package for protein sequence analysis using a microcomputer. CABIOS, (1988) 5, 159-160 ===================================================================== # Institut de Biologie et Chimie des Proteines. UPR 412-CNRS # # ***** ***** **** ***** Dr Gilbert Deleage # # # # # # # # # 7, passage du Vercors # # # ***** # # # 69367 Lyon Cedex 07 # # # # # # #**** Tel: (33) 72-72-26-47 # # # # # # # # Fax: (33) 72-72-26-01 # # ***** ****** **** # deleage@ibcp.fr # ===================================================================== From owner-software@net.bio.net Wed Sep 01 23:00:00 1993 Path: biosci!daresbury!doc.ic.ac.uk!uknet!mcsun!sun4nl!eur.nl!hp750.fgg.eur.nl!pa1-164-199.pc.fgg.eur.nl!belzen From: belzen@pa1.fgg.eur.nl (VAN BELZEN @ PA1) Newsgroups: bionet.software Subject: Re: computer programming/data analysis Message-ID: Date: 2 Sep 93 08:59:54 GMT References: <1993Aug29.213231.5582@c-mols.siu.edu> Organization: Erasmus University Rotterdam Lines: 20 NNTP-Posting-Host: pa1-164-199.pc.fgg.eur.nl In article <1993Aug29.213231.5582@c-mols.siu.edu> shriver@qm.c-biochem.siu.edu writes: >We are in the middle of a discussion here concerning the pros and cons of >having graduate students in biochemistry and molecular biology take a >short course in computer programming and data analysis. The molecular >biologists feel that this is an old fashioned requirement, while the >biophysicists feel that todays students are becoming less and less >acquainted with quantitative approaches. I have been asked to determine >if any biochemistry or molecular biology graduate programs still require >their students to have been exposed to computer programming (in any >language) and data analysis. I would strongly recommend a course in computer programming, preferably in a language that is easy to learn and remember like BASIC. The two weeks pre- grad computer programming course I had on the ancient Apple II have been of great value to me. Even if students would never write a single line of code after the course, it would help them to get a feeling for the possibilities and limitations of computer software. Nico van Belzen From owner-software@net.bio.net Wed Sep 01 23:00:00 1993 Path: biosci!daresbury!zeta.bmc.uu.se!corax.udac.uu.se!sunic!pipex!uunet!spool.mu.edu!agate!ames!decwrl!raven.alaska.edu!acad2.alaska.edu!asdyp From: asdyp@acad2.alaska.edu Newsgroups: bionet.software Subject: Re: MEGA: Mol. Evol. Analysis Program Message-ID: <1993Sep1.225246.1@acad2.alaska.edu> Date: 2 Sep 93 02:52:46 GMT References: <9308272052.AA23967@mailgate.roche.com> Sender: news@raven.alaska.edu (USENET News System) Distribution: bionet Organization: University of Alaska Lines: 47 Nntp-Posting-Host: acad2.alaska.edu In article <9308272052.AA23967@mailgate.roche.com>, delisior@rnisd0.DNET.roche.com (Bob DeLisio) writes: > "joe@evolution.u.washington.edu" "Joe Felsenstein" 27-AUG-1993 05: > writes: > . > . > . > > If anyone knows a way to send encoded binaries by e-mail and have people be > able to make them self-extract without requiring tutorials from me on > how to get and use decoding programs, I'd love to hear it (it sounds > impossible to me). > > > Archives can be made (and have been for at least ten years!) to be self > extracting (read: executable or .EXE). All one has to do is type the filename > at the command line and VIOLA! all files are extracted automatically. Therefore > anyone who can use DOS can extract an archive! > > Bob > Bob, this is clearly not what Joe was asking about. Will you please wake up before you spout off with what appears to you to be the most obvious reply? Clearly, Joe was asking about a way to make UUENCODED archives self-extracting on the recipient's end. You are way off on a tangent talking about how PKzip and other fine compression utilities will make self-extracting archives, but none of these have any relevance to encoded binaries. I don't know of any way to automate the decoding of encoded binaries that will be completely cross-platform compatable. If all you are ever working with is Unix boxes with the same shell as yourself you could provide a script for the recipient to use, providing that they have access to a copy of uudecode on their end. Perhaps a more compatable Unix method would be to write something in awk or perl, and hope that any PC users had gone out and FTPed awk and perl for DOS already. This is unacceptable. What else is left? Taking a hint from the alt.binaries groups, as well as comp.sys.hp48 you could write a little startup guide including short BASIC and C source for uudecode, and then provide in the file a more complete version of uudecode as well as instructions on how to FTPmail the most recent version. With this plan you could then just send anyone who is having problems a copy of this file and ask them to read it before they ask any more questions. Me, I'm strongly in favor of dumping large text files full of useful information onto folks who need help. *chuckle* Dave From owner-software@net.bio.net Wed Sep 01 23:00:00 1993 Path: biosci!daresbury!zeta.bmc.uu.se!corax.udac.uu.se!sunic!mcsun!sun4nl!eur.nl!hp750.fgg.eur.nl!pa1-164-199.pc.fgg.eur.nl!belzen From: belzen@pa1.fgg.eur.nl (VAN BELZEN @ PA1) Newsgroups: bionet.software Subject: Re: Radioligand Binding Analysis Software WANTED Message-ID: Date: 2 Sep 93 09:19:19 GMT References: <5695@eagle.ukc.ac.uk> Organization: Erasmus University Rotterdam Lines: 36 NNTP-Posting-Host: pa1-164-199.pc.fgg.eur.nl In article <5695@eagle.ukc.ac.uk> pjg1@ukc.ac.uk (P.J.Gane) writes: > >I'm looking for PC-DOS based software for radioligand binding analysis. > >I know of a few commercial packages such as LIGAND, LOWRY and EBDA but really >I would like to have this software as quickly as possible, and so I'm trying >to find if anything like this exists on the (bio)NET. > >Anything which I can anon. ftp would be great. > There exists a public domain program for Scatchard analysis called RBINDING (if I remember correctly :-) written by Prof. Joop van Zoelen and myself. I don't know whether its on the net, being out of this field for several years now. I tried to contact Joop but he's on holiday. I'll ask if he still supports the program, and put it on the net if he agrees. For my own use, I ported the original LIGAND program from Munson and Rodbard to MS-DOS, a long time ago. It is terrible user-unfriendly, just as the Apple II version I ported it from, and would only be of use if you have the documentation, and some perseverance to master it. I wonder, however, where I stand legally with regard to distributing this program... could anybody enlighten me on this? By the way, in addition to the MS-DOS versions, I wrote Atari ST ports of these programs. If there's any interest, please email me because I don't read this newsgroup regularly. Best regards, Nico ------------------------------------------------ Nico van Belzen, PhD belzen@pa1.fgg.eur.nl Dept. of Pathology, Erasmus University Rotterdam P.O. box 1738 3000DR Rotterdam The Netherlands phone +10-4087932/7935 fax +10-4366660 ------------------------------------------------ From owner-software@net.bio.net Wed Sep 01 23:00:00 1993 Path: biosci!rutgers!uwm.edu!spool.mu.edu!howland.reston.ans.net!europa.eng.gtefsd.com!uunet!pipex!zaphod.crihan.fr!univ-lyon1.fr!cri.ens-lyon.fr!ibcp.fr!deleage From: deleage@ibcp.fr (G.Delage) Newsgroups: bionet.software Subject: Searching a program to fit PDB molecules Message-ID: <264vrt$fin@cri.ens-lyon.fr> Date: 2 Sep 93 14:27:09 GMT Organization: Institut de Biologie et Chimie des Proteines. CNRS-Lyon Lines: 21 NNTP-Posting-Host: ibcp.fr X-Newsreader: TIN [version 1.1 PL8] -- Hi net I am searching for a program (Fortran or C) source code that allows two molecules in PDB format to be fitted together. Is somebody able to help me? Thank you Sincerely Please answer directly to deleage@ibcp.fr ===================================================================== # Institut de Biologie et Chimie des Proteines. UPR 412-CNRS # # ***** ***** **** ***** Dr Gilbert Deleage # # # # # # # # # 7, passage du Vercors # # # ***** # # # 69367 Lyon Cedex 07 # # # # # # #**** Tel: (33) 72-72-26-47 # # # # # # # # Fax: (33) 72-72-26-01 # # ***** ****** **** # deleage@ibcp.fr # ===================================================================== From owner-software@net.bio.net Thu Sep 02 23:00:00 1993 Path: biosci!daresbury!doc.ic.ac.uk!agate!ames!saimiri.primate.wisc.edu!caen!lsa.umich.edu!usenet From: Doug_Ee@um.cc.umich.edu (Doug Eernisse) Newsgroups: bionet.software Subject: Re: Clustal (Gap penalty) Message-ID: <266lhk$231@controversy.math.lsa.umich.edu> Date: 3 Sep 93 05:43:16 GMT References: <9309021947.AA01103@net.bio.net> Organization: University of Michigan - College of Literature, Science, and TheArts Lines: 18 NNTP-Posting-Host: 141.211.110.79 X-UserAgent: Nuntius v1.1.1d24 X-XXDate: Fri, 3 Sep 93 06:49:11 GMT In article <9309021947.AA01103@net.bio.net> Wagner Fontes, WAGNERF@BRUNB.BITNET writes: >I'm trying to align peptides using Clustal V, but found a problem: >With a low gap penalty, to allow the peptide to be inserted anywhere >in the sequence, the software inserts long gaps IN the peptide. > >Is there a way to increase the gap penalty only for the internal gaps, >allowing long gaps at the beginning and/or end of the sequence? I think this is a general problem for multiple sequence alignments in which the sequences are poorly conserved or contain missing data near some of their ends. We need algorithms that allow anchoring of portions of the alignment. Is there a way you can artificially make the ends more highly matching (temporarily) for the purpose of matching the central portions, then remove the central portion back to the unmodified alignment? This problem is why I have never gotten very far with a nonmanual approach to aligning mixtures of partial and complete 18S rRNA sequences. From owner-software@net.bio.net Thu Sep 02 23:00:00 1993 Path: biosci!SCRIPPS.EDU!yagi2 From: yagi2@SCRIPPS.EDU (Akemi Yagi/BCR7 4-8094) Newsgroups: bionet.software Subject: (none) Message-ID: <9309030123.AA03088@gcrc.scripps.edu> Date: 3 Sep 93 01:23:23 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 18 Hello, I have a question regarding C programming on UNIX. A call to the function system() allows a program to execute a shell command. However, system invokes sh but not csh. As a result it cannot execute a command which is an alias defined in the .cshrc file. So my question is as follows. Suppose you are writing a program that lets the user enter a command and if it is an alias how would you get the program to run it? I would appreciate any suggestion you may have. Thank you. Akemi ============================================================================== Akemi Yagi, Ph.D. The Scripps Research Institute email: yagi2@scripps.edu phone: 619-554-2596 ============================================================================== From owner-software@net.bio.net Thu Sep 02 23:00:00 1993 Path: biosci!daresbury!bioftp.unibas.ch!comp.bioz.unibas.ch!doelz From: doelz@comp.bioz.unibas.ch (Reinhard Doelz) Newsgroups: bionet.software Subject: Re: Message-ID: <1993Sep3.062535.20446@comp.bioz.unibas.ch> Date: 3 Sep 93 06:25:35 GMT References: <9309030123.AA03088@gcrc.scripps.edu> Sender: usenet@comp.bioz.unibas.ch (NEWS transaction account) Reply-To: doelz@urz.unibas.ch Distribution: bionet Organization: EMBnet Switzerland [BASEL] Lines: 47 Nntp-Posting-Host: biox.embnet.unibas.ch In article <9309030123.AA03088@gcrc.scripps.edu>, yagi2@SCRIPPS.EDU (Akemi Yagi/BCR7 4-8094) writes: ... |> I have a question regarding C programming on UNIX. A call to the function |> system() allows a program to execute a shell command. However, system |> invokes sh but not csh. As a result it cannot execute a command which ... ======================test.c #include "stdio.h" main() { char string[90]; sprintf (string,"/bin/csh test.csh\n"); printf (" Executing %s\n", string); system(string); } ======================test.csh #!/bin/csh alias ==================== % test Executing /bin/csh test.csh h history ls ls -C Be aware, in VMS it's a bit more tricky. -- +----------------------------------+-------------------------------------+ | Dr. Reinhard Doelz | RFC doelz@urz.unibas.ch | | Biocomputing | DECNET 20579::48130::doelz | |Biozentrum der Universitaet | X25 022846211142036::doelz | | Klingelbergstrasse 70 | FAX x41 61 261- 6760 or 267- 2078 | CH 4056 Basel | TEL x41 61 267- 2076 or 2247 | +------------- bioftp.unibas.ch is the SWISS EMBnet node ----------------+ ftp mirror at nic.switch.ch ----------------------------------------- From owner-software@net.bio.net Thu Sep 02 23:00:00 1993 Path: biosci!daresbury!daresbury!news From: luwie@be.ac.rug.gengenp (Luc Van Wiemeersch) Newsgroups: bionet.software Subject: A.L.F. - DNA Sequencer Message-ID: <1993Sep3.074635.14170@gserv1.dl.ac.uk> Date: 3 Sep 93 08:44:43 GMT Sender: luwie@gargamel.rug.ac.be Distribution: bionet Lines: 22 Precedence: first-class Original-To: bio-software@uk.ac.daresbury In our Lab. we have an ALF machine connected to a IBM PS/2 model 80 runnig OS/2 1.2 with the ALF software. The IBM is integrated in our VINES (BANYAN) LAN. The LAN includes about 40 PC's (DOS), 6 UNix hosts , 2 MAc's and the OS/2 machine. On the IBM PS/2 80 we run TCP/IP (PC/TCP for OS/2 from FTP) to connect the computer to the Unix hosts. (using NDIS drivers, complex configuration) Unix partitions can be mounted on it and FTP (file transfer) is also possible.` Vines OS/2 client software is also running on the PS/2 and enables the use of printers in the VINES LAN, the use of mail etc. Not everything works without problems, but the connection is satisfactory. I do not know if this will still be possible with OS/2 version 2.x. ========================================= | Luc Van Wiemeersch | | E-mail: luwie@gengenp.rug.ac.be | | Tel : 3291 2645195 | | UNIVERSITY OF GENT | | LABORATORY OF GENETICS | | Ledeganckstraat 35, | | B-9000 Gent | | BELGIUM | ========================================= From owner-software@net.bio.net Thu Sep 02 23:00:00 1993 Path: biosci!UCI.EDU!mangalam From: mangalam@UCI.EDU (Harry Mangalam) Newsgroups: bionet.software Subject: Re: kinamage Message-ID: <199309031552.AA10859@orion.oac.uci.edu> Date: 3 Sep 93 15:52:18 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 18 > Hello: > > I am interested in displaying a pdb coordinate file on IBM-pc > using KINAMAGE. Where can I get this program? I appreciate if > a command file is also posted of how to use the program. > > thanks > sathya(sathya@ncifcrf.gov) FTP to orion.uci.edu, cd to /protein/Kinemage/pcMAGE, get the READMEs and based on the result, you'll probably want the exe's as well as some of the test data. Check out archie (via telnet) and veronica (via gopher) for future reference. They save an awful lot of time for questions such as these. Cheers Harry From owner-software@net.bio.net Thu Sep 02 23:00:00 1993 Path: biosci!agate!howland.reston.ans.net!math.ohio-state.edu!cs.utexas.edu!TAMUTS.TAMU.EDU!bloom-beacon.mit.edu!mcrcim.mcgill.edu!sifon!CC.UMontreal.CA!coady From: coady@ERE.UMontreal.CA (Michael Coady) Newsgroups: bionet.software Subject: Re: kinamage Message-ID: <1993Sep3.161247.3179@cc.umontreal.ca> Date: 3 Sep 93 16:12:47 GMT References: <199309031552.AA10859@orion.oac.uci.edu> Sender: news@cc.umontreal.ca (Administration de Cnews) Distribution: bionet Organization: Universite de Montreal Lines: 23 In article <199309031552.AA10859@orion.oac.uci.edu> mangalam@UCI.EDU (Harry Mangalam) writes: >> I am interested in displaying a pdb coordinate file on IBM-pc >> using KINAMAGE. Where can I get this program? I appreciate if >> a command file is also posted of how to use the program. >FTP to orion.uci.edu, cd to /protein/Kinemage/pcMAGE, get the READMEs and >based on the result, you'll probably want the exe's as well as some of the >test data. > Check out archie (via telnet) and veronica (via gopher) for future >reference. They save an awful lot of time for questions such as these. I agree with Harry that people should check out archie and veronica but, at the risk of being pedantic, people ought to check out their spelling of desired programs before trying archie. In this case, the original poster would have concluded that Kinamage [sic] simply wasn't available. Mike -- Michael J. Coady COADY@ERE.UMONTREAL.CA "I don't got to show you no stinking .signature..." From owner-software@net.bio.net Thu Sep 02 23:00:00 1993 Path: biosci!uwm.edu!math.ohio-state.edu!howland.reston.ans.net!europa.eng.gtefsd.com!uunet!pipex!warwick!not-for-mail From: lsrgn@csv.warwick.ac.uk (Peter Willingmann) Newsgroups: bionet.software Subject: re Antheprot Message-ID: <267khj$m2@violet.csv.warwick.ac.uk> Date: 3 Sep 93 14:32:19 GMT Distribution: eunet Organization: Computing Services, University of Warwick, UK Lines: 15 NNTP-Posting-Host: violet.csv.warwick.ac.uk Mime-Version: 1.0 Content-Type: text/plain; charset=US-ASCII Content-Transfer-Encoding: 7bit Dear Dr. Deleage, i tried to email you, but the mail bounced. I would like to know is there a Macintosh version from the Antheprot prgm coming out/planed? Thank you peter peter willingmann Department of Biological Sciences University of Warwick Coventry CV4 7AL lsrgn@csv.warwick.ac.uk From owner-software@net.bio.net Thu Sep 02 23:00:00 1993 Path: biosci!FCRFV2.NCIFCRF.GOV!SATHYA From: SATHYA@FCRFV2.NCIFCRF.GOV Newsgroups: bionet.software Subject: kinamage Message-ID: <930903095113.20209a6a@FCRFV2.NCIFCRF.GOV> Date: 3 Sep 93 13:51:13 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 10 Hello: I am interested in displaying a pdb coordinate file on IBM-pc using KINAMAGE. Where can I get this program? I appreciate if a command file is also posted of how to use the program. thanks sathya(sathya@ncifcrf.gov) From owner-software@net.bio.net Thu Sep 02 23:00:00 1993 Path: biosci!PBR322.CEINGEBI.UNAM.MX!edgar From: edgar@PBR322.CEINGEBI.UNAM.MX (Edgar Garduno) Newsgroups: bionet.software Subject: doubt of gopher Message-ID: <9309031642.AA10758@pbr322.ceingebi.unam.mx> Date: 3 Sep 93 16:42:22 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 12 Hello, I have a question to make, I am new in this area and want to know what exactly Gopher is?, how to use it? and how can I use it? Edgar Gardu&o Angeles Instituto de Biotecnologia, Universidad Nacional Autonoma de Mexico FAX 544-68-53 in Mexico City Internet edgar@pbr322.ceingebi.unam.mx From owner-software@net.bio.net Thu Sep 02 23:00:00 1993 Path: biosci!agate!spool.mu.edu!sol.ctr.columbia.edu!news.mtu.edu!string!huang From: huang@stringmtu.edu (Xiaoqiu Huang) Newsgroups: bionet.software Subject: Re: Clustal (Gap penalty) Message-ID: <2680og$jkk@mtu.edu> Date: 3 Sep 93 18:00:48 GMT References: <9309021947.AA01103@net.bio.net> Sender: huang@string (Xiaoqiu Huang) Distribution: bionet Organization: Michigan Technological University Lines: 7 NNTP-Posting-Host: string.cs.mtu.edu I have a multiple alignment program (MAP) that does not penalizes end gaps. The MAP program is available from me via an anonymous ftp to string.cs.mtu.edu under directory /pub/huang. Xiaoqiu Huang Michigan Tech From owner-software@net.bio.net Thu Sep 02 23:00:00 1993 Path: biosci!agate!doc.ic.ac.uk!pipex!sunic!corax.udac.uu.se!zeta.bmc.uu.se!daresbury!daresbury!ajt From: ajt@uk.ac.sari.rri (Tony Travis) Newsgroups: bionet.software Subject: Visilog Message-ID: <1993Sep3.230140.15667@gserv1.dl.ac.uk> Date: 3 Sep 93 23:02:35 GMT Sender: list-admin@daresbury.ac.uk Reply-To: ajt@uk.ac.sari.rri Distribution: bionet Organization: Rowett Research Institute Lines: 16 Apparently-To: bio-soft@daresbury Precedence: first-class X-Newsreader: TIN [version 1.2 PL0] I'm using Noesis Visilog 4.1.3 on the PC and Sun workstations to process biological images. I'd be interested to hear from anyone else using Visilog esspecially for the analysis of microscope images. I posted a message to the (UK) CHEST mailbase list for Visilog but have not seen any responses there yet. For those who might not have seen Visilog, it is an object oriented image analysis development system that can be used to generate platform-independant GUI image analysis applications on PC, Sun, HP and SGI (not Mac though). Tony. -- Dr. A.J.Travis, | JANET: Rowett Research Institute, | other: Greenburn Road, Bucksburn, | phone: +44 (0)224 712751 Aberdeen, AB2 9SB. UK. | fax: +44 (0)224 715349 From owner-software@net.bio.net Thu Sep 02 23:00:00 1993 Path: biosci!uwm.edu!spool.mu.edu!nigel.msen.com!caen!lsa.umich.edu!usenet From: Doug_Ee@um.cc.umich.edu (Doug Eernisse) Newsgroups: bionet.software Subject: Re: concerning end gaps and anchoring Message-ID: <267v94$4k6@controversy.math.lsa.umich.edu> Date: 3 Sep 93 17:35:32 GMT References: <930903084111.20202612@BOBCAT.CSC.WSU.EDU> Organization: University of Michigan - College of Literature, Science, and TheArts Lines: 74 NNTP-Posting-Host: 141.211.110.79 X-UserAgent: Nuntius v1.1.1d24 X-XXDate: Fri, 3 Sep 93 18:41:26 GMT In article <930903084111.20202612@BOBCAT.CSC.WSU.EDU> Steve Thompson: VADMS genetics, THOMPSON@WSUVMS1.CSC.WSU.EDU writes: >software. If you know, by eye or otherwise, where the motifs are that you want >to force the alignment around, you can add foreign symbols to the sequence at >corresponding sites in all members of the group. This works best if you can >flank your known motif with the foreign symbol but also works if you just >insert it into a common feature (e.g. this works great for absolutely locking >in disulphide bridges with protein alignments). Then you need to modify the >substitution matrix which the program accesses to likewise add the foreign >symbol. Give it a substitution value at least 10X that of identity for your >table. Then when you run the program be sure and specify the alternate table. >This works very well for many situations, both nucleotide and peptide, and has >been successfully used after my suggestion by many of my users to align >previosly "unalignable" sequence sets. Naturally, use an editor to remove the >foreign symbols after the alignment has been completed. Give it a try. > > Steve Thompson Right, this is similar to what I have done, although your manipulation of the substitution matrix for amino acids is a very nice touch. If you just want to try adding columns of a special symbol in your alignment and, like me, you are using a Mac to edit your alignments, you might find the following tip useful. I have found the freeware version (2.22) of the text editor BBEdit, which is one "Child Apps" which comes with Don Gilbert's SeqApp program, to be useful in this particular case. Actually, you need to download one of the many available pd BBEdit extensions written by other authors. I got this one at "mac.archive.umich.edu" (anonymous ftp _after_ business hours) but it should also be at Sumex and the various mirrors to these sites. On the Michigan archives, look in /util/text/ for something like "BBE_InsertColumns.hqx" which simply allows you to insert columns of tabs in your data (you can also get the full version of BBEdit 2.22 while you are there). I have made trivial changes to the Think C code included, changed the name, and recompiled to make other versions for specific characters (e.g., my gap symbol, space, "$", or whatever), but it is also easy enough to globally change all the tabs you inserted in your alignment to be "$$$$$$" or whatever. These may be stripped in a similar global manner using the built-in "Replace" facility. As a general comment, one should be wary of such a method because it is exceedingly difficult to limit alignment ambiguities to particular columns. The same applies to those who put bars over "ambiguous" alignment sites which are then excluded from a phylogenetic analysis. The problem is, alternative gap placements may extend into or out of the sites one would like to treat in a special manner. At least keep those ambiguous sites in your alignment, perhaps excluding them from some analyses by defining a "charset" of those sites (PAUP). If you don't you risk losing track of your decisions on alignment. Steve's case of lacking disulphide bridges might be an appropriate a priori justification for deciding where the gaps should go. Doug From owner-software@net.bio.net Thu Sep 02 23:00:00 1993 Path: biosci!WSUVMS1.CSC.WSU.EDU!THOMPSON From: THOMPSON@WSUVMS1.CSC.WSU.EDU ("Steve Thompson: VADMS genetics") Newsgroups: bionet.software Subject: concerning end gaps and anchoring Message-ID: <930903084111.20202612@BOBCAT.CSC.WSU.EDU> Date: 3 Sep 93 15:41:11 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 60 Hello Bio-Soft - In Message-Id <9309031002.AA21206@net.bio.net> Doug Eernisse, (Hi Doug!) Doug_Ee@um.cc.umich.edu, quotes Wagner Fontes and proposes a solution: >In article <9309021947.AA01103@net.bio.net> Wagner Fontes, >WAGNERF@BRUNB.BITNET writes: >>I'm trying to align peptides using Clustal V, but found a problem: >>With a low gap penalty, to allow the peptide to be inserted anywhere >>in the sequence, the software inserts long gaps IN the peptide. >>Is there a way to increase the gap penalty only for the internal gaps, >>allowing long gaps at the beginning and/or end of the sequence? >I think this is a general problem for multiple sequence alignments >in which the sequences are poorly conserved or contain missing >data near some of their ends. We need algorithms that allow anchoring >of portions of the alignment. Is there a way you can artificially >make the ends more highly matching (temporarily) for the purpose >of matching the central portions, then remove the central portion >back to the unmodified alignment? This problem is why I have >never gotten very far with a nonmanual approach to aligning >mixtures of partial and complete 18S rRNA sequences. This is a crucial problem in all alignments, especially multiple ones. Wagner's dismay is about my only complaint with Clustal V --- it has no feature that I am aware of to allow the program to ignore end gap weighting. GCG's PileUp, which pretty much is the same type of algorithm, by default ignores end gap weights and, therefore, is much more appropriate in instances where all sequences do not begin at a common site. PileUp also allows one to specify end gap weighting if desired. Doug's point, however, raises an entirely different issue. How can a program find and align strong "motifs" within sequences if the overall similarity is very low? Supposedly PIMA works well at this but I have not had a chance to play with it since I do not have a UNIX station at my disposal. However, I have used a TRICK in forcing this type of alignment to work with other software. If you know, by eye or otherwise, where the motifs are that you want to force the alignment around, you can add foreign symbols to the sequence at corresponding sites in all members of the group. This works best if you can flank your known motif with the foreign symbol but also works if you just insert it into a common feature (e.g. this works great for absolutely locking in disulphide bridges with protein alignments). Then you need to modify the substitution matrix which the program accesses to likewise add the foreign symbol. Give it a substitution value at least 10X that of identity for your table. Then when you run the program be sure and specify the alternate table. This works very well for many situations, both nucleotide and peptide, and has been successfully used after my suggestion by many of my users to align previosly "unalignable" sequence sets. Naturally, use an editor to remove the foreign symbols after the alignment has been completed. Give it a try. Steve Thompson Steven M. Thompson Consultant in Molecular Genetics and Sequence Analysis VADMS (Visualization, Analysis & Design in the Molecular Sciences) Laboratory Washington State University, Pullman, WA 99164-1224, USA AT&Tnet: (509) 335-0533 or 335-3179 FAX: (509) 335-0540 BITnet: THOMPSON@WSUVMS1 or STEVET@WSUVM1 INTERnet: THOMPSON@wsuvms1.csc.wsu.edu From owner-software@net.bio.net Fri Sep 03 23:00:00 1993 Path: biosci!FDACFSAN.BITNET!FOF From: FOF@FDACFSAN.BITNET Newsgroups: bionet.software Subject: Statistical significance of short consensus sequences. Message-ID: <9309040506.AA22382@net.bio.net> Date: 4 Sep 93 00:56:21 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 25 Greetings bio-soft netters. I have cloned a yeast gene encoding a protein invo lved in transcriptional control which lacks any significant homology to previou sly identified proteins when the entire coding sequence is searched against Gen Bank. However, the predicted protein has two short basic stretches at its N-terminus that, whe n searched against GenBank, individually are distantly related to helix-loop-he lix (fos, jun, and some plant HLH proteins) DNA-binding domains and to helix 1 of paired family homeobox transcription factors. In order to gain some perspective on how homol ogous these sequences were I have aligned both regions with a wide variety of H LH and homeo box proteins. Although both segments seem to conform to a pseudo consensus for HLH and homeo domains, respectively, I am bothered by the fact that I cannot valida te statistically the significance of the homologies because the sequences are s o short. What I am looking for is a program for Mac of IBM PCs (preferably Mac ) that allows multiple short sequences to be input and a consensus and some statistical measu re of the significance of the homology of the query sequence with the other ali gned sequences to be output. In simple terms, I have a query sequence and 10-1 2 known examples of a known protein structural motif and I need to know what the significance of the homology is. Is there such a program in existence for the Mac (preferably ) or the IBM PC that is available for very minimal or no cost? Any information is greatly appreciated. From owner-software@net.bio.net Sat Sep 04 23:00:00 1993 Path: biosci!agate!howland.reston.ans.net!europa.eng.gtefsd.com!uunet!nwnexus!m3047 From: m3047@halcyon.com (Fred Morris) Newsgroups: bionet.software Subject: Mac GCC or something similar? Keywords: GCC Macintosh genetic sequencing Message-ID: <26bh5n$lq1@nwfocus.wa.com> Date: 5 Sep 93 01:59:19 GMT Sender: news@nwfocus.wa.com Organization: Northwest Nexus Inc. Lines: 9 NNTP-Posting-Host: nwfocus.wa.com I few weeks ago I saw a thread that briefly touched on GCC or a GCC-like package for the Macintosh. Was that for real? Is it ready? Is there an ftp site? Is it commercially available? Need help? Presently running GCC on a VAX and exploring alternatives (we've got lotsa new Macs). Related question: is this newsgroup archived somewhere? Fred Morris I'm a VAX/VMS and Macintosh guru m3047@halcyon.com ..but I don't know everything! From owner-software@net.bio.net Sat Sep 04 23:00:00 1993 Path: biosci!agate!spool.mu.edu!umn.edu!lynx.unm.edu!carina.unm.edu!news-user From: bhjelle@unm.edu Newsgroups: bionet.software Subject: Biomed Clip Art Message-ID: <26d81n$2ku@carina.unm.edu> Date: 5 Sep 93 17:35:51 GMT Distribution: na Organization: University of New Mexico, Albuquerque Lines: 23 NNTP-Posting-Host: carina.unm.edu I often have to give presentations on topics related to molecular biology, genetics, and more "organismal" level subjects concerning human and animal virology. I have several presentation packages (software) ranging from Wordperfect Presentations to Harvard Graphics to DrawPerfect, so can deal with various bitmapped and vector mapped formats. I have been looking unsuccessfully for large "clip art" libraries that would allow me to import high-quality pictures of, say, DNA structure, virus particles (eg, illustration or bitmapped EM picture), human organs, phylogenic tree templates, a library of mouse pictures, etc. Is it too soon to ask for such a library, eg, on CD-ROM? Does anyone know of something that would help with this? I understand there are some "medical" packages on CD-ROM, which are not clipart libraries but multimedia medical reference libraries. Is anyone familiar with these? Windows compatibility is important... Thanks for any and all ideas. Brian From owner-software@net.bio.net Sat Sep 04 23:00:00 1993 Path: biosci!lhc!azalea!francis From: francis@azalea.nlm.nih.gov (Francis Ouellette) Newsgroups: bionet.software Subject: Re: Mac GCC or something similar? Message-ID: <1993Sep5.125728.26402@nlm.nih.gov> Date: 5 Sep 93 12:57:28 GMT References: <26bh5n$lq1@nwfocus.wa.com> Sender: news@nlm.nih.gov Organization: National Library of Medicine Lines: 16 X-Newsreader: Tin 1.1 PL4 m3047@halcyon.com (Fred Morris) writes: : Related question: is this newsgroup archived somewhere? al BIOSCI newsgroups are archived at net.bio.net in th eBIOSCI directory. They are also reachable by gopher ... there and also at ftp.bio.indiana.edu regards, francis -- | B.F. Francis Ouellette | | francis@ncbi.nlm.nih.gov From owner-software@net.bio.net Sat Sep 04 23:00:00 1993 Path: biosci!agate!howland.reston.ans.net!europa.eng.gtefsd.com!uunet!pipex!uknet!mcsun!sun4nl!news.sara.nl!HASARA11.SARA.NL!A428ENDE From: A428ENDE@HASARA11.SARA.NL Newsgroups: bionet.software Subject: Re: Neural Network programs for sequence analysis? Message-ID: <16C4012840.A428ENDE@HASARA11.SARA.NL> Date: 5 Sep 93 19:30:59 GMT References: <9308311856.AA03849@genetics.com> Organization: S.A.R.A. Academic Computing Services Amsterdam Lines: 21 Nntp-Posting-Host: vm1.sara.nl X-Newsreader: NNR/VM S_1.3.2 In article <9308311856.AA03849@genetics.com> mcolbert@GENETICS.COM writes: >I am looking for information on neural network packages that can be used for >protein and nucleic acid sequence analysis. Specifically, we have novel >sequences and want to see what (if anything) they may be similar to within the >databases. The colleague I am asking this question for has already run >traditional types of homology searches (blast,fasta) with not much success. >The profile analysis offered in the GCG package is more sensitive than a >traditional homology search, but creating a profile requires having multiple >sequences that you align and search with, and we have only one sequence at a >time. I have done some work with neural networks (very limited) so we >thought we would at least ask around. A while ago I read an article in which they used neural networks to predict cod ing and noncoding sequences in a piece of genomic DNA (I don't have the article at hand but I can look it up if you want). This is the only use of a neural ne twork in sequence analysis I am aware off. Please if someone else has more info rmation share it with this group. It is a very interesting subject! Henk van de Kamer CHLAMY@SARA.NL From owner-software@net.bio.net Sun Sep 05 23:00:00 1993 Path: biosci!parc!decwrl!ames!elroy.jpl.nasa.gov!swrinde!cs.utexas.edu!uunet!pipex!sunic!trane.uninett.no!news.eunet.no!nuug!news.eunet.fi!funic!nic.funet.fi!csc.fi!harper From: Rob.Harper@csc.fi (Rob Harper) Newsgroups: bionet.software Subject: Simtel-20 August 93 Uploads. Message-ID: <199309060846.AA03618@csc.fi> Date: 6 Sep 93 08:46:32 GMT Sender: root@nic.funet.fi (The FUnny NET guru) Organization: Finnish Academic and Research Network Project - FUNET Lines: 439 >Path: funic!news.funet.fi!sunic!mcsun!uunet!wupost!tacom-emh1.army.mil!msdos-ann-request >From: w8sdz@TACOM-EMH1.Army.Mil (Keith Petersen) >Newsgroups: comp.archives.msdos.announce >Subject: MS-DOS uploads to SIMTEL20 & OAK during the month of August, 1993 >Summary: 238 new files were added >Message-ID: <9309021009.kp8555@tacom-emh1.army.mil> >Date: Thu, 2 Sep 1993 10:09:00 GMT >Followup-To: comp.archives.msdos.d >Sender: msdos-ann-request@tacom-emh1.army.mil >Organization: The SIMTEL20 Archives and The OAK Software Repository >Approved: w8sdz@tacom-emh1.army.mil >Lines: 425 File PD1:UPLOADS.AUG Created: Sept. 2, 1993 NOTE: This file is also available in comma-delimited format as SIM9308.IDX MS-DOS files uploaded to WSMR-SIMTEL20.Army.Mil and OAK.Oakland.Edu during the month of August 1993 NOTE: Type B is Binary; Type A is ASCII Filename Type Length Date Description ============================================== Directory PD1: AV308.ZIP B 104134 930820 Archive view: Free ZIP etc directory viewer SHEZ92.ZIP B 244632 930813 Shell interface to ZIP/ARJ/LZH/ZOO/ARC/SQZ/PAK SHEZ92P.ZIP B 67978 930819 Bug fix patch to update SHEZ92 to SHEZ92A Directory PD1: GALSAT50.ZIP B 37270 930814 Displays relative positions of Jupiter's Moons Directory PD1: WRLDMAPS.ZIP B 64300 930826 Create maps in AutoCAD using WORLDMAP data Directory PD1: GAWK215A.ZIP B 218197 930821 GNU Awk: text scanning and processing language GAWK215S.ZIP B 491248 930821 Sources for GAWK215A.ZIP (GNU Awk) Directory PD1: NEWS9210.ZIP B 542613 930804 Baker's PC press releases - Oct 1992 NEWS9307.ZIP B 360638 930804 Baker's PC press releases - Jul 1993 WNWS9307.ZIP B 292049 930803 WIN3 hlp: Baker's PC press releases - Jul 1993 Directory PD1: SW-42A.ZIP B 54126 930811 SW v4.2: BATCH file enhancement utility Directory PD1: 125ADEV.ZIP B 31282 930811 Powerboard BBS 1.25A Developer's Kit AUU100.ZIP B 30682 930815 Auto user upgrader for RemoteAccess 2.00 FIDOQ118.ZIP B 186520 930831 Toss BBS mail between Fido- and QWK-networks GAPDEMO1.ZIP B 340883 930817 GAP BBS Version 6.2 DEMO (1 of 3) GAPDEMO2.ZIP B 330895 930817 GAP BBS Version 6.2 DEMO (2 of 3) GAPDEMO3.ZIP B 199727 930817 GAP BBS Version 6.2 DEMO (3 of 3) PB125A_1.ZIP B 138700 930809 Powerboard DV-aware BBS, easy config, 1 of 4 PB125A_2.ZIP B 331376 930809 Powerboard DV-aware BBS, easy config, 2 of 4 PB125A_3.ZIP B 234938 930809 Powerboard DV-aware BBS, easy config, 3 of 4 PB125A_4.ZIP B 98547 930809 Powerboard DV-aware BBS, easy config, 4 of 4 RABIR210.ZIP B 42177 930815 Birthday utility for RA 1.11/2.00/PB 1.30 VAREA610.ZIP B 104397 930830 VBBS subscriber/unsubscriber for VNET Directory PD1: DAWN100.ZIP B 144380 930811 Dawn: BBS Door with artificial intelligence Directory PD1: BBS_9308.ZIP B 19799 930822 PC Industry Support BBS list - Aug 1993 USBBS112.ZIP B 101206 930831 Darwin's nationwide IBM BBS listing, Sep 1993 Directory PD1: EXEOUT.ZIP B 719447 930803 Executable outlines: Bible study guides KBIB_30.DOC A 1442 930831 Information on files needed to run KBIBLE 3.0 KBIB_30.ZIP B 94318 930831 KBIBLE v3.0: KJV Bible read/search by topics KBIB_KJ1.ZIP B 321538 930821 King James Version of the Bible, file 1 of 5 KBIB_KJ2.ZIP B 327996 930821 King James Version of the Bible, file 2 of 5 KBIB_KJ3.ZIP B 346476 930821 King James Version of the Bible, file 3 of 5 KBIB_KJ4.ZIP B 342293 930821 King James Version of the Bible, file 4 of 5 KBIB_KJ5.ZIP B 104922 930821 King James Version of the Bible, file 5 of 5 Directory PD1: BLACKOUT.ZIP B 2255 930810 Suppress CONFIG.SYS/AUTOEXEC.BAT screen output ECHOBLK2.ZIP B 13858 930824 Displays Operative lines in DOS 6 CONFIG.SYS Directory PD1: SVGABG50.ZIP B 108840 930802 SuperVGA/Tweaked VGA BGI drivers, release 5.0 Directory PD1: BLTC17.ZIP B 146968 930831 Bullet btree/DBF database mgr, DOS C compilers CENVID1.ZIP B 167695 930810 ShareWare C interpreter and batch enhancer DFLAT15.ZIP B 141014 930816 Dflat: SAA-compatible windowing LIB w/C source EMSIF24A.ZIP B 68041 930823 EMS interface for Borland/Turbo/MS C[++] JULIN105.ZIP B 33835 930821 Source in C for calendar date calculations KBDHANDL.ZIP B 9026 930812 Multiple keypress INT 9 keyboard handler w/src Directory PD1: PRFECT45.ZIP B 198333 930803 Perfect Box: Speaker enclosure design program Directory PD1: SM221A.ZIP B 302732 930809 Math/Chemistry symbolic calculator w/learning Directory PD1: SHSUCD05.ZIP B 55448 930810 CDROM Client/Server + unloadable MSCDEX Directory PD1: RPCXLB10.ZIP B 195493 930812 RPCXLib: EGA/VGA/SVGA graphic Clipper library Directory PD1: USTIME11.ZIP B 51909 930826 Synchronize clock to US Naval Observatory time Directory PD1: ISC365.ZIP B 138405 930810 Interrupts in C++, create TSRs + serial, w/src MONEY.ZIP B 10982 930809 C++ class to fake Decimals/BCD's using floats Directory PD1: CDS42B.ZIP B 70384 930830 Powerful music cataloguing system for CDs CJPOS133.ZIP B 252425 930813 Point-of-Sale inventory track'g/sales analysis WIN_EDGE.ZIP B 933117 930812 The Winning Edge Fantasy Football Manager DEMO Directory PD1: REM2-893.ZIP B 55163 930823 Reminds users of important dates/events(AUG93) Directory PD1: DVINT36.ZIP B 92363 930802 Listing of DESQview/QEMM interrupt calls Directory PD1: DIRCO308.ZIP B 97533 930820 Updates files based on source directory DIRTO308.ZIP B 164603 930820 Directory lister and totaller HOTDIR73.ZIP B 74009 930809 HotDIR Plus 7.3-Color sorted directory utility ICD220.ZIP B 4009 930816 Instant Change Directory (auto-updating) INCDOS10.ZIP B 21569 930830 Long's set of added DOS-type commands RLBDIR11.ZIP B 8114 930830 Long's BDIR ('Branch DIRectory') v1.1 RLGD11.ZIP B 5672 930830 Long's GD ('Go to Directory') v1.1 RLKD12.ZIP B 7889 930830 Long's KD ('Kill Directory') v1.2 Directory PD1: 1SEAGATE.ZIP B 330472 930811 Specs for ALL Seagate drives from Seagate BBS DCF42A.ZIP B 90973 930819 Very fast 1-pass diskette copy utility FILL308.ZIP B 108785 930820 Stuffs as many files as possible on disk FLEXP300.ZIP B 221100 930805 Flexibak Plus: Hard disk backup w/compression HDTRAK12.ZIP B 73348 930813 HardTrack v1.2: Tracks hard drive/LAN changes MACSE31D.ZIP B 82394 930827 Read/write Mac disks on PC. DOS & WIN3.x. DEMO Directory PD1: IMAKEDVX.ZIP B 144851 930805 Imake for DJGPP porting X applications to DV/X Directory PD1: ADAMI94.ZIP B 180051 930802 Tamil word processer / VGA video titler ADAMIEN1.ZIP B 117430 930802 Environment for ADAMI Tamil word processor SHSUEDT3.ZIP B 35300 930810 Small DOS text editor TDE31.ZIP B 363280 930831 PD multi-window/file bin & text ed w/ C & asm XNOT12G.ZIP B 368569 930810 Fast Emacs-type editor for MS-Windows,NT,Unix Directory PD1: TYPEMT42.ZIP B 77527 930819 A course for touch typing with 10 fingers Directory PD1: UNP312.ZIP B 26074 930826 Unpacks all kinds of compressed executables Directory PD1: DOWNLOAD.INF A 1402 930826 How to get SIMTEL20 files via telephone modem SIM9307.IDX A 27419 930801 Comma-delimited list of July 1993 uploads SIMIBM.ZIP B 300250 930902 Comma-delim list of all MSDOS files w/descrip. SIMLIST.ZIP B 292527 930902 Text format list of all MSDOS files w/descrip. SIMSCH10.ZIP B 117760 930824 Scan/print SIMTEL20 SIMIBM.IDX from Windows3.x SIM_VW1B.ZIP B 543260 930827 WIN3: Util to browse/search SIMIBM.IDX. Beta UPLOADS.JUL A 26521 930801 List of uploads to SIMTEL20 for July 1993 Directory PD1: BIGTEXT.ZIP B 123277 930810 Converts ASCII text files to .EXE files FILED39A.ZIP B 76931 930809 Darwin's File: Guesses file-type FILEX13.ZIP B 48398 930805 Identify files by filename extension (1500) QDIR122.ZIP B 121530 930813 QuickDir v1.22: Archive/file/directory manager TEXTLIFE.ZIP B 61792 930810 Turns text into self displaying .EXE file Directory PD1: BK51FP1.ZIP B 696014 930810 My Brother's Keeper Genealogy SW 7-93, 1 of 3 BK51FP2.ZIP B 639154 930810 My Brother's Keeper Genealogy SW 7-93, 2 of 3 BK51FP3.ZIP B 508613 930810 My Brother's Keeper Genealogy SW 7-93, 3 of 3 Directory PD1: ALAD171.ZIP B 271537 930817 Aladdin v1.71: The GEnie AutoComm Navigator ILMP9308.ZIP B 81095 930805 GEnieLamp IBM Online Magazine (Aug 1993) LVWR9309.ZIP B 33771 930827 GEnie LiveWire Online Magazine, Sep 1993 Directory PD1: HPGL2GEO.ZIP B 42475 930810 Convert HPGL to GEOS 1.X format Directory PD1: GB_93_08.ZIP B 176960 930810 GeoBytes Newsletter, August 1993 P1_93_08.ZIP B 83901 930810 PaGEOne Newsletter (formerly SAGE), Aug. 1993 Directory PD1: ALCH17.ZIP B 478208 930827 Image Alchemy v1.7 image format conversion FRAIN182.ZIP B 484307 930827 Fractint fractal generator version 18.2 FRASR182.ZIP B 869246 930827 Source for Fractint 18.2 fractal generator NVIEW10.ZIP B 117574 930804 SVGA BMP/GIF/PCX/TIFF/TGA Viewer (+ger. help) SPLT251.ZIP B 190894 930803 Advanced HP-GL & DXY-GL pen plotter simulator WILLDRAW.ZIP B 107120 930804 Drawing program with Animated Icons WMORPH10.ZIP B 332681 930830 2D-Morphing program for 320x200 GIF & 386 Directory PD1: HAMCOM22.ZIP B 386911 930802 HamComm 2.2: Send/Receive RTTY,CW w/o modem Directory PD1: HEB_TRNS.ZIP B 12294 930823 Mac to PC text-file translator, w/Hebrew supp. Directory PD1: HDK90A.ZIP B 188472 930827 DOS/Win3/DV-X/Text & OS/2 Help Dev Kit, 1of2 HDK90B.ZIP B 210217 930827 DOS/Win3/DV-X/Text & OS/2 Help Dev Kit, 2of2 IL2HDK20.ZIP B 90607 930803 Cvt Interrupt List to Help Develop. Kit format NG2HDK10.ZIP B 9715 930817 Converts Norton Guides format to HLPDK format Directory PD1: 1SGATHTX.ZIP B 243240 930815 Seagate tech support's disk ref (needs HHV20) ASP6802.ZIP B 480561 930809 Association of Shareware Professionals catalog AUTHWN02.ZIP B 6405 93081 From owner-software@net.bio.net Sun Sep 05 23:00:00 1993 Path: biosci!swmed.edu!WEIX From: WEIX@swmed.edu Newsgroups: bionet.software Subject: Re: GCC or something similar? Message-ID: <01H2LSAI6GJ69X67HB@swmed.edu> Date: 6 Sep 93 03:05:36 GMT Sender: news@net.bio.net Distribution: bionet Lines: 25 Dear Fred Morris There are a number of molecular biology programs for the Mac available as academic freeware. They do not always have the power or speed of GCG, but for graphics ease and alignment they are better/easier. Much easier. I have used GCG on a VAX system for a few years (on and off as I needed to), and it is *not* user friendly! Since my first degree was in Mechanical Engineering, I consider myself somewhat computer literate. My advice, if you have access to VAX-GCG, would be to do sequence searching (FASTA, etc.) on the GCG, and to do alignments and analysis on the Mac. The place to look is ftp to molbio.indiana.edu. Download everything and take it for a spin. :-) Have fun! @@@@ (o o) |----------------------ooO---(__)---Ooo----------------------| | | | Patrick Weix weix@swmed.edu | | UT Southwestern Medical Center tel: (214) 648-5050 | | 5323 Harry Hines Blvd fax: (214) 648-5453 | | Dallas, TX 75235 | |------------------------------------------------------------| || || (__) (__) P.S. We use: DNAaid, SeqApp, and Strider. If you find a good plasmid drawing program, please let me know! From owner-software@net.bio.net Sun Sep 05 23:00:00 1993 Path: biosci!agate!doc.ic.ac.uk!pipex!sunic!corax.udac.uu.se!zeta.bmc.uu.se!embl-heidelberg.de!higgins From: higgins@embl-heidelberg.de Newsgroups: bionet.software Subject: Re: Clustal (Gap penalty) Message-ID: <1993Sep6.173009.115413@embl-heidelberg.de> Date: 6 Sep 93 16:30:09 GMT References: <9309021947.AA01103@net.bio.net> Distribution: bionet Organization: EMBL, European Molecular Biology Laboratory Lines: 23 In article <9309021947.AA01103@net.bio.net>, WAGNERF@BRUNB.BITNET (Wagner Fontes) writes: > Hi, > > I'm trying to align peptides using Clustal V, but found a problem: > With a low gap penalty, to allow the peptide to be inserted anywhere > in the sequence, the software inserts long gaps IN the peptide. > > Is there a way to increase the gap penalty only for the internal gaps, > allowing long gaps at the beginning and/or end of the sequence? > All gaps in clustal v are penalised identically which does look bad when aligning sequences of greatly different lengths. This is due to the dynamic programming algorithm I used (Myers and Miller, CABIOS, 1988) which is very memory efficient but which is VERY complicated to modify (e.g. to penalise end gaps differently or not at all). I do have a fix (have had for a year) but have not yet had time to document or debug it properly. I hope to release a version with this option soon. In the meantime, yes, PILEUP in the GCG package does allow end gaps to be unpenalised. So, sorry about the messy ends! You can always align the sequences manually:-). Des Higgins From owner-software@net.bio.net Sun Sep 05 23:00:00 1993 Path: biosci!agate!library.ucla.edu!psgrain!ee.und.ac.za!ford.ee.up.ac.za!zeno.up.ac.za!bio1 From: bio1@navi.up.ac.za (Fourie Joubert) Newsgroups: bionet.software Subject: ANTHEPROT? Message-ID: Date: 6 Sep 93 17:58:09 GMT Organization: University of Pretoria Lines: 16 NNTP-Posting-Host: zeno.up.ac.za X-Newsreader: Trumpet for Windows [Version 1.0 Rev A] Hi Could anyone please tell me how and where the ANTHEPROT package may be obtained? Please mail, thanks... __________________________________________________________________________ _/_/_/_/ _/_/_/_/_/ Fourie Joubert _/ _/ Department of Biochemistry _/ _/ University of Pretoria _/_/_/_/ _/ South Africa _/ _/ bio1@navi.up.ac.za _/ _/_/_/_/ Disclaimer: "Fourie who?" __________________________________________________________________________ From owner-software@net.bio.net Sun Sep 05 23:00:00 1993 Path: biosci!swmed.edu!WEIX From: WEIX@swmed.edu Newsgroups: bionet.software Subject: Re: molbio@indiana Message-ID: <01H2MIU6FPW29X6PPQ@swmed.edu> Date: 6 Sep 93 15:48:02 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 3 Sorry to all! I recently posted an incorrect address for software molbio archives at indiana. The correct ftp site address is fly.bio.indiana.edu. Then cd to the molbio dir. Sorry again. From owner-software@net.bio.net Sun Sep 05 23:00:00 1993 Path: biosci!MNI.lan.mcgill.ca!IVAN From: IVAN@MNI.lan.mcgill.ca Newsgroups: bionet.software Subject: Re: Biomed Clip Art Message-ID: <9309061549.AA08051@kona.cc.mcgill.ca> Date: 6 Sep 93 18:44:38 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 45 > I often have to give presentations on topics related to molecular > biology, genetics, and more "organismal" level subjects concerning > human and animal virology. [edited...] > I have been looking unsuccessfully for large "clip art" libraries > that would allow me to import high-quality pictures of, say, DNA > structure [edited...] > I understand there are some "medical" packages on CD-ROM, which > are not clipart libraries but multimedia medical reference > libraries. Is anyone familiar with these? Windows compatibility is > important... Boy, do I feel for you! I'm in the same boat with my own lab group since I have the most computer expertise as well as design taste (most of the others haven't progressed past the crayon stage). For anatomy, Micrografx sells an anatomy clipart package which was drawn by a medical illustrator; T/Maker has a similar package. In terms of other images, have you heard of a package called SlideWrite? I personally do not use it though I have seen the brochure describing the clipart add-ons available. As for the medical CD-ROMs, the only non-text version I've seen is a nephrology tutor called Up To Date and its companion product McPee (these are Win3.1 packages); images appear to be TIFF but I haven't been able to extract anything from it - yet. Unfortunately, there are more clipart packages available for the Mac than for the PC; what I've done in the past is to export a Mac clipart image to Adobe Illustrator format or EPS, and then transfer the package over to my PC (via Ethernet and a Netware server). Adobe Illustrator/Win can read them with no problems. - ivan ------------------------------------------ Ivan Shaw "The Angel of Death" Neuroimmunology Unit Montreal Neurological Institute Montreal, Canada H3A 2B4 ------------------------------------------ Internet e-mail: Ivan@MNI.LAN.McGill.CA Telephone: (514) 398-3002 FAX (514) 398-7371 From owner-software@net.bio.net Sun Sep 05 23:00:00 1993 Path: biosci!agate!howland.reston.ans.net!europa.eng.gtefsd.com!uunet!pipex!sunic!corax.udac.uu.se!zeta.bmc.uu.se!daresbury!d.love From: d.love@dl.ac.uk (Dave Love) Newsgroups: bionet.software Subject: Re: Curve Fitting Message-ID: Date: 6 Sep 93 13:21:55 GMT References: <1993Aug29.213608.5674@c-mols.siu.edu> Distribution: bionet Organization: SERC Daresbury Laboratory, Warrington, UK Lines: 7 NNTP-Posting-Host: dlpx1.dl.ac.uk In-reply-to: shriver@qm.c-biochem.siu.edu's message of Sun, 29 Aug 1993 21:36:08 GMT Be careful. Fitting general sums of decaying exponentials is an ill-conditioned problem for which one is usually cautioned against general least-squares routines. There are specialised routines in some non-free Fortran subroutine libraries that I know of (IMSL, Harwell and probably CERNlib and others). Good places to look for a treatment of the problem might be the journals `Nuclear Instruments and Methods' and `Computer Physics Communications'. From owner-software@net.bio.net Mon Sep 06 23:00:00 1993 Path: biosci!parc!decwrl!ames!saimiri.primate.wisc.edu!sdd.hp.com!swrinde!cs.utexas.edu!uunet!pipex!sunic!uts!biobase!engel From: engel@biobase.aau.dk (Jacob Engelbrecht) Newsgroups: bionet.software Subject: Re: Neural Network programs for sequence analysis? Message-ID: Date: 7 Sep 93 08:46:05 GMT References: <9308311856.AA03849@genetics.com> <2624h0INNh0e@s-crim1.dl.ac.uk> Distribution: bionet Organization: The Danish BioBase Lines: 251 some years ago we published the following, and we are continuing to work with neural networks as well as other methods for localizing structure and function in biological sequences. Jacob Engelbrecht Center for Biological Sequence analysis engel@virus.fki.dth.dk DESCRIPTION: The NetGene mail server is a service producing neural network predictions of splice sites in vertebrate genes as described in: Brunak, S., Engelbrecht, J., and Knudsen, S. (1991) Prediction of Human mRNA Donor and Acceptor Sites from the DNA Sequence. Journal of Molecular Biology, 220, 49-65. ABSTRACT OF JMB ARTICLE: Artificial neural networks have been applied to the prediction of splice site location in human pre-mRNA. A joint prediction scheme where prediction of transition regions between introns and exons regulates a cutoff level for splice site assignment was able to predict splice site locations with confidence levels far better than previously reported in the literature. The problem of predicting donor and acceptor sites in human genes is hampered by the presence of numerous amounts of false positives - in the paper the distribution of these false splice sites is examined and linked to a possible scenario for the splicing mechanism in vivo. When the presented method detects 95% of the true donor and acceptor sites it makes less than 0.1% false donor site assignments and less than 0.4% false acceptor site assignments. For the large data set used in this study this means that on the average there are one and a half false donor sites per true donor site and six false acceptor sites per true acceptor site. With the joint assignment method more than a fifth of the true donor sites and around one fourth of the true acceptor sites could be detected without accompaniment of any false positive predictions. Highly confident splice sites could not be isolated with a widely used weight matrix method or by separate splice site networks. A complementary relation between the confidence levels of the coding/non-coding and the separate splice site networks was observed, with many weak splice sites having sharp transitions in the coding/non-coding signal and many stronger splice sites having more ill-defined transitions between coding and non-coding. INSTRUCTIONS: In order to use the NetGene mail-server: 1) Prepare a file with the sequence in a format similar to the fasta format: the first line must start with the symbol '>', the next word on that line is used as the sequence identifier. The following lines should contain the actual sequence, consisting of the symbols A, T, U, G, C and N. U is converted to T, letters not mentioned are converted to N. All letters are converted to upper case. Numbers, blanks and other nonletter symbols are skipped. The lines should not be longer than 80 characters. The minimum length analyzed is 451 nucleotides, and the maximum is 100000 nucleotides (your mail system may have a lower limit for the maximum size of a message). Due to the non-local nature of the algorithm sites closer than 225 nucleotides to the ends of the sequence will not be assigned. 2) Mail the file to netgene@virus.fki.dth.dk. The response time will depend on system load. If nothing else is running on the machine the speed is about 1000 nucleotides/min. It may take several hours before you get the answer, so please do not resubmit a job if you get no answer within a short while. REFERENCING AND FURTHER INFORMATION Publication of output from NetGene must be referenced as follows: Brunak, S., Engelbrecht, J., and Knudsen, S. (1991) Prediction of Human mRNA Donor and Acceptor Sites from the DNA Sequence. Journal of Molecular Biology, 220, 49-65. CONFIDENTIALITY Your submitted sequence will be deleted automatically immediately after processing by NetGene. PROBLEMS AND SUGGESTIONS: Should be addressed to: Jacob Engelbrecht e-mail: engel@virus.fki.dth.dk Department of Physical Chemistry The Technical University of Denmark Building 206 DK-2800 Lyngby Denmark phone: +45 4288 2222 ext. 2478 (operator) phone: +45 4593 1222 ext. 2478 (tone) fax: +45 4593 4808 EXAMPLE: A file test.seq is prepared with an editor with the following contents: >HUMOPS GGATCCTGAGTACCTCTCCTCCCTGACCTCAGGCTTCCTCCTAGTGTCACCTTGGCCCCTCTTAGAAGC CAATTAGGCCCTCAGTTTCTGCAGCGGGGATTAATATGATTATGAACACCCCCAATCTCCCAGATGCTG . Here come more lines with sequence. . . This is sent to the NetGene mail-server, on a Unix system like this: mail netgene@virus.fki.dth.dk < test.seq In return an answer similar to this is produced: From netgene@virus.fki.dth.dk Fri Mar 20 13:30 MET 1992 Received: by virus.fki.dth.dk (16.7/16.2) id AA05624; Fri, 20 Mar 92 13:30:41 +0100 Date: Fri, 20 Mar 92 13:30:41 +0100 From: virus mail server Return-Path: To: engel@virus.fki.dth.dk Subject: HUMOPS: NetGene splice site prediction Status: RO ------------------------------------------------------------------------ NetGene Neural Network Prediction of Splice Sites Reference: Brunak, S., Engelbrecht, J., and Knudsen, S. (1991). Prediction of Human mRNA donor and acceptor sites from the DNA sequence. Journal of Molecular Biology 220:49-65. ------------------------------------------------------------------------ Report ERRORS to Jacob Engelbrecht engel@virus.fki.dth.dk. Potential splice sites are assigned by combining output from a local and a global network. The prediction is made with two cutoffs: 1) Highly confident sites (no or few false positives, on average 50% of the true sites detected); 2) Nearly all true sites (more false positives - on average of all positions 0.1% false positive donor sites and 0.4% false positive acceptor sites, at 95% detection of true sites). The network performance on sequences from distantly related organisms has not been quantified. Due to the non-local nature of the algorithm sites closer than 225 nucleotides to the ends of the sequence cannot be assigned. Column explanations, field identifiers: POSITION in your sequence (either first or last base in intron). Joint CONFIDENCE level for the site (relative to the cutoff). EXON INTRON gives 20 bases of sequence around the predicted site. LOCAL is the site confidence from the local network. GLOBAL is the site confidence from the global network. ------------------------------------------------------------------------ The sequence: HUMOPS contains 6953 bases, and has the following composition: A 1524 C 2022 G 1796 T 1611 1) HIGHLY CONFIDENT SITES: ========================== ACCEPTOR SITES: POSITION CONFIDENCE INTRON EXON LOCAL GLOBAL 4094 0.27 TGTCCTGCAG^GCCGCTGCCC 0.63 0.66 5167 0.20 TGCCTTCCAG^TTCCGGAACT 0.59 0.64 3812 0.17 CTGTCCTCAG^GTACATCCCC 0.68 0.54 3164 0.02 TCCTCCTCAG^TCTTGCTAGG 0.79 0.32 2438 0.01 TGCCTTGCAG^GTGAAATTGC 0.78 0.33 DONOR SITES: POSITION CONFIDENCE EXON INTRON LOCAL GLOBAL 3979 0.38 CGTCAAGGAG^GTACGGGCCG 0.92 0.74 2608 0.17 GCTGGTCCAG^GTAATGGCAC 0.85 0.54 4335 0.06 GAACAAGCAG^GTGCCTACTG 0.83 0.41 2) NEARLY ALL TRUE SITES: ========================= ACCEPTOR SITES: POSITION CONFIDENCE INTRON EXON LOCAL GLOBAL 4094 0.55 TGTCCTGCAG^GCCGCTGCCC 0.63 0.66 3812 0.52 CTGTCCTCAG^GTACATCCCC 0.68 0.54 3164 0.49 TCCTCCTCAG^TCTTGCTAGG 0.79 0.32 5167 0.49 TGCCTTCCAG^TTCCGGAACT 0.59 0.64 2438 0.48 TGCCTTGCAG^GTGAAATTGC 0.78 0.33 4858 0.39 TCATCCATAG^AAAGGTAGAA 0.77 0.20 3712 0.36 CCTTTTCCAG^GGAGGGAATG 0.88 -0.01 4563 0.33 CCCTCCACAG^GTGGCTCAGA 0.81 0.05 5421 0.33 TTTTTTTAAG^AAATAATTAA 0.75 0.13 3783 0.29 TCCCTCACAG^GCAGGGTCTC 0.64 0.26 3173 0.25 GTCTTGCTAG^GGTCCATTTC 0.52 0.36 4058 0.24 CTCCCTGGAG^GAGCCATGGT 0.43 0.51 1784 0.22 TCACTGTTAG^GAATGTCCCA 0.68 0.08 6512 0.21 CCCTTGCCAG^ACAAGCCCAT 0.67 0.08 2376 0.20 CCCTGTCTAG^GGGGGAGTGC 0.61 0.16 1225 0.18 CCCCTCTCAG^CCCCTGTCCT 0.65 0.07 1743 0.13 TTCTCTGCAG^GGTCAGTCCC 0.62 0.03 3834 0.13 GGGCCTGCAG^TGCTCGTGTG 0.26 0.58 4109 0.13 TGCCCAGCAG^CAGGAGTCAG 0.29 0.54 6557 0.13 CATTCTGGAG^AATCTGCTCC 0.56 0.12 1638 0.11 CCATTCTCAG^GGAATCTCTG 0.62 0.00 247 0.10 GCCTTCGCAG^CATTCTTGGG 0.55 0.11 6766 0.09 CTATCCACAG^GATAGATTGA 0.64 -0.06 906 0.08 AATTTCACAG^CAAGAAAACT 0.61 -0.02 6499 0.08 CAGTTTCCAG^TTTCCCTTGC 0.55 0.06 378 0.07 GTACCCACAG^TACTACCTGG 0.24 0.52 3130 0.07 CTGTCTCCAG^AAAATTCCCA 0.51 0.12 4272 0.07 ACCATCCCAG^CGTTCTTTGC 0.58 0.00 4522 0.07 TGAATCTCAG^GGTGGGCCCA 0.51 0.12 5722 0.07 ACCCTCGCAG^CAGCAGCAAC 0.55 0.05 2316 0.06 CTTCCCCAAG^GCCTCCTCAA 0.40 0.27 2357 0.06 GCCTTCCTAG^CTACCCTCTC 0.39 0.28 2908 0.06 TTTGGTCTAG^TACCCCGGGG 0.51 0.10 4112 0.06 CCAGCAGCAG^GAGTCAGCCA 0.25 0.50 1327 0.05 TTTGCTTTAG^AATAATGTCT 0.52 0.06 844 0.04 GTTTGTGCAG^GGCTGGCACT 0.62 -0.11 1045 0.04 TCCCTTGGAG^CAGCTGTGCT 0.54 0.01 1238 0.03 CTGTCCTCAG^GTGCCCCTCC 0.50 0.06 2976 0.03 CCTAGTGCAG^GTGGCCATAT 0.62 -0.12 3825 0.03 CATCCCCGAG^GGCCTGCAGT 0.16 0.60 1508 0.02 TGAGATGCAG^GAGGAGACGC 0.43 0.16 2257 0.02 CTCTCCTCAG^CGTGTGGTCC 0.53 0.00 5712 0.02 ATCCTCTCAG^ACCCTCGCAG 0.51 0.05 2397 0.00 CCCTCCTTAG^GCAGTGGGGT 0.41 0.16 4800 0.00 CATTTTCTAG^CTGTATGGCC 0.47 0.07 5016 0.00 TGCCTAGCAG^GTTCCCACCA 0.59 -0.11 DONOR SITES: POSITION CONFIDENCE EXON INTRON LOCAL GLOBAL 3979 0.75 CGTCAAGGAG^GTACGGGCCG 0.92 0.74 2608 0.51 GCTGGTCCAG^GTAATGGCAC 0.85 0.54 4335 0.38 GAACAAGCAG^GTGCCTACTG 0.83 0.41 656 From owner-software@net.bio.net Mon Sep 06 23:00:00 1993 Path: biosci!HAL.HAHNEMANN.EDU!moreyr From: moreyr@HAL.HAHNEMANN.EDU Newsgroups: bionet.software Subject: Software Packages for MAc for Anatomy and Histology Message-ID: <0097227C.5C8F66E0.27286@hal.hahnemann.edu> Date: 7 Sep 93 01:25:00 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 7 Does anybody out there know of any SW packages for the Machintosh (Performa 600) to study anatomy of Histo (fisrt yr Med student level) please let me know moreyr@hal.hahnemann.edu raj-man From owner-software@net.bio.net Mon Sep 06 23:00:00 1993 Path: biosci!rutgers!gatech!howland.reston.ans.net!agate!doc.ic.ac.uk!uknet!pipex!sunic!trane.uninett.no!news.eunet.no!nuug!news.eunet.fi!funic!convex!harper From: harper@convex.csc.FI (Rob Harper) Newsgroups: bionet.software Subject: Re: Marck, Christian; Telephon a/o Fax-No. Message-ID: <1993Sep7.080956.20863@nic.funet.fi> Date: 7 Sep 93 08:09:56 GMT References: <26has5$cve@basfigw.basf-ag.de> Sender: usenet@nic.funet.fi Organization: Finnish Academic and Research Network Project - FUNET Lines: 23 Nntp-Posting-Host: convex.csc.fi In <26has5$cve@basfigw.basf-ag.de> elard.jacob@zxd.basf-ag.de (Elard Jacob) writes: >Hi netters, >please could anyone advise me about the phone or fax number of Christian >Marck, Gif-Sur-Yvette, France who has written the program DNA-Strider? >Thanx in advance >Elard %%%%%%%%%%%%%%%%%%%%%%%%% GOPHER TO THE RESCUE %%%%%%%%%%%%%%%%%%%%%%%% Dr. Christian Marck Service de Biochimie et de Genetique Moleculaire Bat. 142 Centre d'Etudes de Saclay 91191 GIF-SUR-YVETTE CEDEX FRANCE fax: (33 1) 69 08 47 12 %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% Rob "at your service" Harper -- Rob Harper E-mail: harper@convex.csc.fi Center for Scientific Computing Molbio/software: harper@nic.funet.fi Tietotie 6, P.O. Box 405 Telephone: +358 0 457 2076 SF-02101 Espoo Finland Fax: +358 0 457 2302 From owner-software@net.bio.net Mon Sep 06 23:00:00 1993 Path: biosci!rutgers!mcclb0!cmcl2!yale.edu!newsserver.jvnc.net!nntp.basf-corp.com!nntp.basf-ag.de!news From: elard.jacob@zxd.basf-ag.de (Elard Jacob) Newsgroups: bionet.software Subject: Marck, Christian; Telephon a/o Fax-No. Message-ID: <26has5$cve@basfigw.basf-ag.de> Date: 7 Sep 93 06:48:37 GMT Reply-To: elard.jacob@zxd.basf-ag.de (Elard Jacob) Organization: BASF AG Lines: 5 NNTP-Posting-Host: jacob2.zhv.basf-ag.de Hi netters, please could anyone advise me about the phone or fax number of Christian Marck, Gif-Sur-Yvette, France who has written the program DNA-Strider? Thanx in advance Elard From owner-software@net.bio.net Mon Sep 06 23:00:00 1993 Path: biosci!CRCVMS.UNL.EDU!CSMITH From: CSMITH@CRCVMS.UNL.EDU Newsgroups: bionet.software Subject: Re: Graduate Computer Literacy Requirement Message-ID: <01H2N8K4ESEO004XMX@crcvms.unl.edu> Date: 7 Sep 93 05:01:00 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 72 In article <1993Aug29.213231.5582@c-mols.siu.edu> shriver@qm.c-biochem.siu.edu writes: >We are in the middle of a discussion here concerning the pros and cons of >having graduate students in biochemistry and molecular biology take a >short course in computer programming and data analysis. The molecular >biologists feel that this is an old fashioned requirement, while the >biophysicists feel that todays students are becoming less and less >acquainted with quantitative approaches. I have been asked to determine >if any biochemistry or molecular biology graduate programs still require >their students to have been exposed to computer programming (in any >language) and data analysis. We do not have a requirement in the biochemistry program at UNL at the graduate level and it shows ... but it's not a problem limited to our graduates. I've found many a post-doc (from other well-known institutions and labs) deficient in the most basic computing skills. The lack of these skills in the electronic information age has me questioning their ability to effectively and *efficiently* analyze data from instrumentation and the computer. There are two areas that seem to need addressing; (1) basic computer skills needed to function independently in a lab (e.g., being able to install a program/update *correctly*, or write a simple batch file to simplify ones work), and (2) adequate familiarity and appreciation for the computer (understanding the potentials and LIMITS of a computer, and special recognition for basic computer ails and *bugs*). With regard to point (2), what concerns me the most is that computers (especially those integrated with lab instrumentation) have an uncanny ability to spit out results that look real good (agree with some pre-defined hypothesis), but are in fact nothing more than electronic noise (I've seen this happen more than once, to varying degrees). I attribute the inability to distinguish between the two a direct result of the lack of basic computing skills AND an appreciation of what a computer (or all electronic instrumentation) can DO (whether you want it to or not) and cannot DO (give precisely the same output when the known experimental input has a variance of 10-15%). YES ! I would vote for the introduction of a basic programming/data analysis, architecture course as part of a graduate program. But, I find that given the current condition of science at most universities, the "publish-or-perish" syndrome, I doubt very much that many faculty are willing to spare their research bodies an additional 3-5 hours per week for *another unproductive course*. I dearly hope I am wrong on this score. I wish you the very best success if you are trying to introduce such a "computer" requirement. Hats off to you. Chris Christopher Smith Department of Biochemistry University of Nebraska e-mail: csmith@crcvms.unl.edu csmith@unlinfo.unl.edu From owner-software@net.bio.net Mon Sep 06 23:00:00 1993 Path: biosci!agate!howland.reston.ans.net!sol.ctr.columbia.edu!caen!lsa.umich.edu!usenet From: Doug_Ee@um.cc.umich.edu (Doug Eernisse) Newsgroups: bionet.software Subject: Re: Netiquette (was Re: MEGA: Mol. Evol. Analysis Program) Message-ID: <26iudf$rir@controversy.math.lsa.umich.edu> Date: 7 Sep 93 21:28:15 GMT References: <9309071632.AA16610@mailgate.roche.com> Organization: University of Michigan - College of Literature, Science, and TheArts Lines: 5 NNTP-Posting-Host: 141.211.110.79 X-UserAgent: Nuntius v1.1.1d24 X-XXDate: Tue, 7 Sep 93 22:34:18 GMT In defense of David, I didn't find his comments to be overly critical and they were certainly not slanders. Lighten up a bit and next time please don't post the same (tangential) posting multiple times. Doug From owner-software@net.bio.net Mon Sep 06 23:00:00 1993 Path: biosci!SCRIPPS.EDU!yagi2 From: yagi2@SCRIPPS.EDU (Akemi Yagi/BCR7 4-8094) Newsgroups: bionet.software Subject: MolScript Message-ID: <9309071902.AA10901@gcrc.scripps.edu> Date: 7 Sep 93 19:02:15 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 13 Hello, If you know of a program named MolScript, would you let me know where I can find it? This program presumably produces ribbon-type figures from PDB data files. Thank you. Akemi ============================================================================== Akemi Yagi, Ph.D. The Scripps Research Institute email: yagi2@scripps.edu phone: 619-554-2596 ============================================================================== From owner-software@net.bio.net Mon Sep 06 23:00:00 1993 Path: biosci!rnisd0.DNET.roche.com!delisior From: delisior@rnisd0.DNET.roche.com (Bob DeLisio) Newsgroups: bionet.software Subject: Re: MEGA: Mol. Evol. Analysis Program Message-ID: <9309071632.AA16610@mailgate.roche.com> Date: 7 Sep 93 17:05:55 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 77 INET::"asdyp@acad2.alaska.edu" "Dave" writes: >From: INET::"asdyp@acad2.alaska.edu" "MAIL-11 Daemon" 2-SEP-1993 06:24 >To: bio-soft@net.bio.net >CC: >Subj: Re: MEGA: Mol. Evol. Analysis Program > >In article <9308272052.AA23967@mailgate.roche.com>, >delisior@rnisd0.DNET.roche.com (Bob DeLisio) writes: >> "joe@evolution.u.washington.edu" "Joe Felsenstein" 27-AUG-1993 05: >> writes: >> . >> . >> . >> >> If anyone knows a way to send encoded binaries by e-mail and have people be >> able to make them self-extract without requiring tutorials from me on >> how to get and use decoding programs, I'd love to hear it (it sounds >> impossible to me). >> >> >> Archives can be made (and have been for at least ten years!) to be self >> extracting (read: executable or .EXE). All one has to do is type the filename >> at the command line and VIOLA! all files are extracted automatically. >Therefor >e >> anyone who can use DOS can extract an archive! >> >> Bob >> > >Bob, this is clearly not what Joe was asking about. Will you please wake up >before you spout off with what appears to you to be the most obvious reply? >Clearly, Joe was asking about a way to make UUENCODED archives self-extracting >on the recipient's end. You are way off on a tangent talking about how PKzip >and other fine compression utilities will make self-extracting archives, but >none of these have any relevance to encoded binaries. > >I don't know of any way to automate the decoding of encoded binaries that will >be completely cross-platform compatable. If all you are ever working with is >Unix boxes with the same shell as yourself you could provide a script for the >recipient to use, providing that they have access to a copy of uudecode on >their end. Perhaps a more compatable Unix method would be to write something >in awk or perl, and hope that any PC users had gone out and FTPed awk and perl >for DOS already. This is unacceptable. What else is left? > >Taking a hint from the alt.binaries groups, as well as comp.sys.hp48 you could >write a little startup guide including short BASIC and C source for uudecode, >and then provide in the file a more complete version of uudecode as well as >instructions on how to FTPmail the most recent version. With this plan you >could then just send anyone who is having problems a copy of this file and ask >them to read it before they ask any more questions. > >Me, I'm strongly in favor of dumping large text files full of useful >information onto folks who need help. *chuckle* > >Dave Someone should remind dear David that this is a forum for the free expression and exchange of ideas and information. Apparently he has lost sight of this and has chosen instead to use to engage in abusive and derogatory correspondence for no other reason than self-gratification. I take exception to this kind of behavior, especially when it is at my expense. It is inexcusable to misuse the privilege and violate the trust we all assume when we join a newsgroup such as this one. Academics need not resort to slander and insult, as David has done, to get a point across. It is unprofessional and characteristic of an immature mind. If we are to have a truly free flow of ideas and information then we must be more tolerant of points of view contrary to our own. David has started a process which we must not allow to continue. I urge everyone concerned to police the behavior of the other members of this group lest we loose even more than what we already have. Malicious personal attacks and ridicule should not be tolerated under any circumstances. Bob From owner-software@net.bio.net Mon Sep 06 23:00:00 1993 Path: biosci!CUCCFA.CCC.COLUMBIA.EDU!MARK From: MARK@CUCCFA.CCC.COLUMBIA.EDU (T. Mark Reboul) Newsgroups: bionet.software Subject: Curve-fitting sums of exponentials: variation on the theme Message-ID: <930907111802.fa4@CUCCFA.CCC.COLUMBIA.EDU> Date: 7 Sep 93 15:18:02 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 40 Following up this comment recently posted to Bio-Soft, on the matter of curve-fitting sums of exponentials.... > Be careful. Fitting general sums of decaying exponentials is an > ill-conditioned problem for which one is usually cautioned against > general least-squares routines. Hmm, is it possible that some of the ill-conditioning arises from the application of straightforward least-squares itself? Or is the ill-conditioning completely intrinsic to the sum-of-exponentials model itself? In any event, a variant approach to this curve-fitting problem has received attention in recent years, and it is claimed to have certain advantages over the usual approach: Herbert R. Halvorson (1992) Pade'-Laplace algorithm for sums of exponentials: Selecting appropriate exponential model and initial estimates for exponential fitting in, "Numerical Computer Methods" Ludwig Brand & Michael L. Johnson, eds. Methods in Enzymology 210: 54-67 E. Yeramian & P. Claverie (1987) Analysis of multiexponential functions without a hypothesis as to the number of components Nature (12 March 1987) 326: 169-174 P. Claverie & A. Denis (1989) [I don't know the title] Computer Physics Reports 9(5): 247-299 [contains details of Claverie et al's Pade'-Laplace approach to fitting sums of exponentials] I cannot assure anybody of this alternate approach's merit, as my awareness of it is only superficial. Still, it seems to be relevant and may be worthy of investigation. Mark Reboul Columbia-Presbyterian Cancer Center Computing Facility mark@cuccfa.ccc.columbia.edu From owner-software@net.bio.net Mon Sep 06 23:00:00 1993 Path: biosci!agate!spool.mu.edu!bloom-beacon.mit.edu!mcrcim.mcgill.edu!sifon!CC.UMontreal.CA!little From: little@ERE.UMontreal.CA (Littlejohn Tim) Newsgroups: bionet.software Subject: Phylogenetic analysis software via gopher Message-ID: Date: 7 Sep 93 14:03:20 GMT References: <9309021947.AA01103@net.bio.net> <2680og$jkk@mtu.edu> Sender: news@cc.umontreal.ca (Administration de Cnews) Distribution: bionet Organization: Universite de Montreal Lines: 45 There has been some recent discussion about phylogenetic software and multiple sequence alignment packages. There is a growing collection of documents, packages and compiled versions of various programs (including Xiaoqiu Huang's MAP program) on the MegaGopher. There is also a nice summary of various phylogenetic analysis packages, written by Joe Felsenstein, too (with a few additions made by myself e.g. the MEGA package), for those who would like an overview of what there is available. To access this collection, point your gopher Client at: Name=MegaGopher Type=1 Port=70 Path= Host=megasun.bch.umontreal.ca and select --> 4. Computational Molecular Biology- programs, documents, help/ --> 3. Phylogenetic analysis- programs, help, etc./ for the summary document, then select: --> 1. Documents/ --> 2. Summary of Programs for Phylogenetic analysis. If you want more information about gopher, just send me an email and I'll try to point you in the right direction. Tim Littlejohn ============================================================================== E-mail: little@ere.umontreal.ca Tim Littlejohn tim@bch.umontreal.ca Snail Mail: Departement de biochimie Phone: (514) 343-5149 Universite de Montreal Fax: (514) 343-2210 C.P. 6128, succursale A, Montreal (Quebec), H3C 3J7 CANADA ============================================================================== From owner-software@net.bio.net Mon Sep 06 23:00:00 1993 Path: biosci!uwm.edu!cs.utexas.edu!uunet!pipex!uknet!mcsun!sun4nl!star.cs.vu.nl!balaena!mac134.bio.vu.nl!user From: quido@bio.vu.nl (quido) Newsgroups: bionet.software Subject: HELP: Beta-strand (sheet) prediction!! Message-ID: Date: 7 Sep 93 10:57:21 GMT Sender: news@bio.vu.nl Followup-To: bionet.software Organization: vu Lines: 15 Hello, I'm looking for a program which can predict beta-strands and/or beta-sheets from primary structures. Preferentially a program that has been used by auteurs before (reference would be nice) If you know how I can get such a program, please contact me as soon as possible. Thanks for the effort! -- Q. Valent, Free University of Amsterdam, Boelelaan 1087, 1081 HV, Amsterdam, The Netherlands. Fax: +3120-6429202, E-mail: quido@bio.vu.nl or valent@bio.vu.nl From owner-software@net.bio.net Mon Sep 06 23:00:00 1993 Path: biosci!agate!howland.reston.ans.net!math.ohio-state.edu!news.acns.nwu.edu!raven.alaska.edu!acad2.alaska.edu!asdyp From: asdyp@acad2.alaska.edu Newsgroups: bionet.software Subject: Re: Postscript files? Message-ID: <1993Sep7.015011.1@acad2.alaska.edu> Date: 7 Sep 93 05:50:11 GMT References: <01H2GWCDDX8W003S5M@crcvms.unl.edu> Sender: news@raven.alaska.edu (USENET News System) Distribution: bionet Organization: University of Alaska Lines: 30 Nntp-Posting-Host: acad2.alaska.edu In article <01H2GWCDDX8W003S5M@crcvms.unl.edu>, VWARWAR@CRCVMS.UNL.EDU (VITOR WARWAR) writes: > > Hi > > Is there a way to print a postscript file generated by GCG in > a dot matrix printer? > > Thanks you all > Vitor Warwar Sure thing, Vitor! What you want is called Ghostscript. It is a gnu software package that allows you to print postscript documents to a wide variety of normal and laser printers, as well as to the console. You can even have it convert your document to a form usable by your favorite printer and save the results to a file so that you can sneaker-net it over. With a little tweaking for some purposes it can be used with network printers just as easily. Ghostscript is available primarily for various flavours of Unix, including linux, and is also available for DOS computers. There is a front-end to use with Windows called ghostview which is pretty darn decent. GS works just great under X, but I think that you can use it without X. Might not be able to display to the console though. I know that you can find the DOS version on wuarchive. Sunsite and tsx both have the Unix source for ghostscript, as well as everything you need to get linux up and running on your 386(+)-based PC. Dave From owner-software@net.bio.net Mon Sep 06 23:00:00 1993 Path: biosci!rutgers!mcclb0!cmcl2!yale.edu!spool.mu.edu!umn.edu!gaia.ucs.orst.edu!news.uoregon.edu!netnews.nwnet.net!serval!owl.csrv.uidaho.edu!crow.csrv.uidaho.edu!kellogg From: kellogg@crow.csrv.uidaho.edu (Scott Kellogg) Newsgroups: bionet.software Subject: 2D & 1D Gel Software Message-ID: <26h1t8INNb35@owl.csrv.uidaho.edu> Date: 7 Sep 93 04:15:36 GMT Organization: University of Idaho, Moscow, Idaho Lines: 6 NNTP-Posting-Host: crow.csrv.uidaho.edu X-Newsreader: TIN [version 1.1 PL8] Can someone please recommend a good PC program for analyzing 1D and especially 2D gels. I have an image analysis system (Image Pro Plus) with CCD camera and capture board but require something that will handle 2D protein gel analyses. Hopefully the program will not be too costly. There is no access to Macs. Thanks. From owner-software@net.bio.net Tue Sep 07 23:00:00 1993 Path: biosci!daresbury!doc.ic.ac.uk!uknet!pipex!uunet!europa.eng.gtefsd.com!howland.reston.ans.net!agate!headwall.Stanford.EDU!bcm!kiwi.imgen.bcm.tmc.edu!jpower From: jpower@kiwi.imgen.bcm.tmc.edu (Joanna L. Power) Newsgroups: bionet.software,bionet.molbio.gdb Subject: GDB-Lite Keywords: gdb software application macintosh Message-ID: <26l1dt$1uf@gazette.bcm.tmc.edu> Date: 8 Sep 93 16:31:57 GMT Organization: Molecular Biology Information Resource, Baylor College of Medicine, Houston, Tx Lines: 55 Xref: biosci bionet.software:5832 bionet.molbio.gdb:91 NNTP-Posting-Host: kiwi.imgen.bcm.tmc.edu -=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=- ANNOUNCING GDB-Lite: a user-friendly browsing and data entry tool for the Genome Data Base -=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=- The Informatics Core of the Human Genome Center at Baylor College of Medicine announces the release of GDB-Lite, a user-friendly GDB browsing and data-entry tool for the Macintosh. GDB-Lite provides investigators in the Human Genome Project an easy method to access and search GDB (the Genome Data Base at The Johns Hopkins University School of Medicine). Reports incorporating data from several GDB tables can be generated easily. GDB-Lite creates submission forms for GDB, automatically formatting the information entered into the database by the user. GDB-Lite was developed using 4th Dimension (4D), a powerful yet easy-to-use relational database system for the Macintosh. Use of GDB-Lite requires 4D Runtime v3.0, available from ACIUS, Inc. (An educational discount is available when ordering directly from ACIUS.) GDB-Lite requires a Macintosh with a hard disk and a 12" (or larger) monochrome or high-resolution color moniter. GDB-Lite is compatible with GDB release 5.1. The data is periodically extracted from GDB at Baylor College of Medicine and made available by anonymous ftp. The data for chromosomes 6, 17 and X is currently available. Other data sets can be provided if a need is present. GDB-Lite is available by anonymous ftp from gc.bcm.tmc.edu. All comments should be sent to gdb-lite@bcm.tmc.edu. -=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=- Randall F. Smith Joanna L. Power Institute for Molecular Genetics Human Genome Center Baylor College of Medicine Baylor College of Medicine Houston, TX 77030 Houston, TX 77030 -=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=- Contact: Joanna L. Power Human Genome Center Baylor College of Medicine Houston, TX 77030 jpower@bcm.tmc.edu 713-198-4689 713-798-5385 (fax) -=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=- From owner-software@net.bio.net Tue Sep 07 23:00:00 1993 Path: biosci!daresbury!doc.ic.ac.uk!uknet!pipex!sunic!trane.uninett.no!nntp.uio.no!biomaster.uio.no!rodrigol From: rodrigol@biomaster.uio.no (Rodrigo Lopez) Newsgroups: bionet.general,bionet.software,embnet.general Subject: Use of SRS 3.1 through gopher or telnet Message-ID: <26l7os$gmn@hermod.uio.no> Date: 8 Sep 93 18:20:12 GMT Organization: The Norwegian EMBnet node Lines: 74 Xref: biosci bionet.general:5993 bionet.software:5833 NNTP-Posting-Host: biomaster.uio.no ANNOUNCEMENT The Sequence Retrieval System (SRS) of Dr. Thure Etzold is available to users inside the Internet community as an interactive service via telnet or as a gopher hole. Two sites carry this service: 1. EMBL telnet embl-heidelberg.de username: SRS (no password) This will allow you to log into EMBL VAX cluster and use SRS on any of the VAX machines. Gopher server managers can add the following to their local menus: # Name=SRS (Sequence Retrieval System) EMBL-Heidelberg Type=8 Port=23 Path=SRS Host=embl-heidelberg.de # 2. EMBnet in Norway telnet biomed.uio.no username: SRS (no password) This will allow you to log into the Norwegian EMBnet node's VAX. Gopher server managers can add the following to their local menus: # Name=EMBnet: Norway / Seq. Retrival System (BIOMED) Type=8 Port=23 Path=srs Host=biomed.uio.no # NOTES The sets of molecular biology databanks installed on the above sites overlap largely but are not equivalent. The system will ask you to provide an Internet e-mail address to which the results of your searches will be send. For this reason please be carefull about providing e-mail addresses correctly. ACKNOWLEDGMENTS The software that make these telnet holes possible was written by Christoph Gartmann from the Max Plank Institute of Immunobiology in Freiburg. Some hubble addition were made by me. R:-) -- *************************************************************************** * RODRIGO LOPEZ SERRANO rodrigol@biomed.uio.no -rodrigol@biotek.uio.no * * Norwegian EMBnet node Tel:xx-47-22958756 Fax:xx-47-22694130 * *************************************************************************** From owner-software@net.bio.net Tue Sep 07 23:00:00 1993 Path: biosci!daresbury!daresbury!news From: bionet%FRCGM51.earn@uk.ac.earn-relay Newsgroups: bionet.software Subject: Re: HELP: Beta-strand (sheet) prediction!! Message-ID: <1993Sep8.110456.13452@gserv1.dl.ac.uk> Date: 8 Sep 93 14:46:19 GMT Sender: list-admin@daresbury.ac.uk Distribution: bionet Lines: 27 Precedence: first-class from FRCGM51.BITNET (MAILER) by FRMOP11.CNUSC.FR (Mailer R2.08) with BSMTP id 6242; Wed, 08 Sep 93 10: 48:19 GM Original-To: bio-software@uk.ac.daresbury > > I'm looking for a program which can predict beta-strands and/or beta-sheets > from primary structures. > Preferentially a program that has been used by auteurs before (reference > would be nice) > If you know how I can get such a program, please contact me as soon as > possible. > Thanks for the effort! > I think you should try the profile/neural network method of Rost & Sander. Predictions can be made by E-mail. To begin with, first send a message containing the word 'help' to: predictprotein@embl-heidelberg.de Good luck. -------------------------------------------------------------------- | Jean-Loup Risler | | | CNRS | risler@frcgm51.bitnet | | Centre de Genetique Moleculaire | risler@cgmvax.cgm.cnrs-gif.fr | | 91198 Gif sur Yvette Cedex France | | -------------------------------------------------------------------- From owner-software@net.bio.net Tue Sep 07 23:00:00 1993 Path: biosci!PHOENIX.PRINCETON.EDU!chuck From: chuck@PHOENIX.PRINCETON.EDU (Charles Epstein) Newsgroups: bionet.software Subject: Primer analysis software Message-ID: <199309082143.AA01532@phoenix.princeton.edu> Date: 8 Sep 93 21:43:03 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 11 Is anybody aware of any good, public domain, Primer analysis software? ie. for the design of oligonucleotide primers, for use in either PCR or sequencing? If so, please reply to me directly chuck@phoenix.princeton.edu since I am not a subscriber to this newsgroup. many thanks, C. Epstein From owner-software@net.bio.net Tue Sep 07 23:00:00 1993 Path: biosci!rutgers!gatech!europa.eng.gtefsd.com!uunet!pipex!uknet!dct.ac.uk!mlrgdm From: mlrgdm@dct.ac.uk Newsgroups: bionet.software Subject: Wanted Authorware Message-ID: <1993Sep8.195341.7591@dct.ac.uk> Date: 8 Sep 93 18:53:41 GMT Organization: Dundee Institute of Technology Lines: 17 WANTED Authorware. A copy of Authorware, Authorware Pro or Authorware Star. Must be the complete package with orginal media. If you have an unwanted copy of one of these packages please contact Dr Kevan Gartland Dept MLS Dundee Institue of Technology Dundee, DD1 1HG Email MLTKG@DCT.AC.UK or MLRGDM@DCT.AC.UK From owner-software@net.bio.net Tue Sep 07 23:00:00 1993 Path: biosci!daresbury!doc.ic.ac.uk!uknet!pavo.csi.cam.ac.uk!mbfs.bio.cam.ac.uk!seb1005 From: seb1005@mbfs.bio.cam.ac.uk (Steven Brenner) Newsgroups: bionet.software Subject: Re: MolScript Message-ID: <1993Sep8.111019.18728@infodev.cam.ac.uk> Date: 8 Sep 93 11:10:19 GMT References: <9309071902.AA10901@gcrc.scripps.edu> Sender: news@infodev.cam.ac.uk (USENET news) Distribution: bionet Organization: U of Cambridge, England Lines: 42 Nntp-Posting-Host: mbfs.bio.cam.ac.uk yagi2@SCRIPPS.EDU (Akemi Yagi/BCR7 4-8094) writes: >Hello, >If you know of a program named MolScript, would you let me know where >I can find it? This program presumably produces ribbon-type figures >from PDB data files. Thank you. >Akemi From the documentation: --- Copyright and licenses ====================== The program source code has been copyrighted by the author. The program may NOT be distributed freely. If you wish to obtain a copy, contact Per Kraulis for instructions. Generally, you should send an appropriate tape to him. He will return it with source code, documentation and example input files, together with a license agreement to be signed and returned. Alternatively, you may ask for permission to copy the program from some other lab. There is no fee for academic institutions. The address is: Dr Per Kraulis Center for Structural Biochemistry Karolinska Institute Novum S-141 57 Huddinge SWEDEN phone +46 8 608 9266 fax +46 8 608 9290 email pjk@oyster.csb.ki.se ----- Hope this helps. -- Steven E. Brenner | Department of Biochemistry seb1005@mbfs.bio.cam.ac.uk | University of Cambridge Lab +44 223 333671 | Tennis Court Road Fax +44 223 333345 | Cambridge CB2 1QW, UK From owner-software@net.bio.net Wed Sep 08 23:00:00 1993 Path: biosci!daresbury!doc.ic.ac.uk!agate!spool.mu.edu!uwm.edu!news.doit.wisc.edu!ted.bocklabs.wisc.edu!user From: sspencer@macc.wisc.edu (Stephan Spencer) Newsgroups: bionet.xtallography,bionet.software,bionet.info-theory Subject: CHAOS AND PROTEIN FOLDING Message-ID: Date: 9 Sep 93 02:38:57 GMT Followup-To: bionet.xtallography Organization: University of Wisconsin Lines: 12 Xref: biosci bionet.xtallography:437 bionet.software:5837 bionet.info-theory:1628 NNTP-Posting-Host: ted.bocklabs.wisc.edu I would like to know if it sounds feasible to come up with a strange attractor for protein folding in aqueous solution, and if so, can you predict tertiary structure with this strange attractor? Does anybody have any ideas about this subject? It seems to me that chaos theory would be very pertinent to the area of protein-protein interactions, protein-dna interactions and protein-solvent interactions. Are there people working on this in the scientific community? Stephan Spencer University of Wisconsin, Biochemistry sspencer@macc.wisc.edu From owner-software@net.bio.net Wed Sep 08 23:00:00 1993 Path: biosci!daresbury!doc.ic.ac.uk!agate!usenet.ins.cwru.edu!magnus.acs.ohio-state.edu!bgsuvax!uoft02.utoledo.edu!131!wmesser From: wmesser@uoft02.utoledo.edu (William S. Messer, Jr., Ph.D.) Newsgroups: bionet.software,comp.sys.mac.apps Subject: Re: Curve Fitting Message-ID: Date: 8 Sep 93 21:33:59 GMT References: Organization: The University of Toledo Lines: 30 Xref: biosci bionet.software:5838 comp.sys.mac.apps:20967 Nntp-Posting-Host: 131.183.82.161 X-Newsreader: VersaTerm Link v1.1 In Article , lwalsh@nemo.life.uiuc.edu (Laura L. Walsh) wrote: >We am looking for a program which will do curve fitting >using multiple exponentials. We need a fairly simple >program which will run on a Macintosh and which is >cheap. We have access to Mathematica, but so far haven't >found it easy enough to use for this purpose. My guess >is that Igor will do this, but I understand that is >isn't cheap. Any other ideas? >Laura Walsh (lwalsh@nemo.life.uiuc.edu) I am not sure that it will do multiple exponentials without some user-defined help, but DeltaGraph Pro could be useful. It does provide an exponential function "built-in" and has the capacity to accept user defined functions. Of course cheap is a relative term -- but I have seen ads selling DeltaGraph Pro as part of a bundle for $99. I have used DeltaGraph Pro to do some nonlinear curve fitting for pharmacological data, and have been fairly pleased with the results. It does allow you to define and save your own functions for later use. Hope this is of some use to you. Bill Messer WMESSER@uoft02.utoledo.edu Department of Medicinal and Biological Chemistry College of Pharmacy The University of Toledo Phone: (419) 537-4098 FAX: (419) 537-4940 From owner-software@net.bio.net Wed Sep 08 23:00:00 1993 Path: biosci!daresbury!doc.ic.ac.uk!mrccrc!nimr.mrc.ac.uk!a-aszodi From: a-aszodi@nimr.mrc.ac.uk (Andras Aszodi) Newsgroups: bionet.software Subject: Re: Curve-fitting sums of exponentials: variation on the theme Message-ID: <1993Sep9.112119.11364@crc.ac.uk> Date: 9 Sep 93 11:21:19 GMT References: <930907111802.fa4@CUCCFA.CCC.COLUMBIA.EDU> Sender: news@crc.ac.uk Distribution: bionet Organization: National-Institute-for-Medical-Research Lines: 23 Nntp-Posting-Host: nimsn43.nimr.mrc.ac.uk Fitting sums of exponentials is indeed very tricky and can be ill-conditioned. Do not blame the least-squares for this, it is because of the exponentials. The Pade'-Laplace approximation does a very attractive thing. Namely, it relies on the Laplace transform which is essentially an integral. Integrals are lovely because (due to their "averaging" nature) they 'smooth' the data, rendering them more tractable by numerical analysis (i.e. parameter estimation in this case). However, be warned: there are no wonders. IMHO everyone should refrain from fitting complicated models to noisy data -- and ALL data are noisy in biology. Try to prune your models first, do not attempt estimating more than, say, 3 parameters. Perform sensitivity analysis, hunt down hidden relationships between parameters, always test your estimated correlation matrix to see the eigenvalue spectrum... I'm speaking from experience; I have suffered enough ;-) Good luck to all fitters, , Andras From owner-software@net.bio.net Wed Sep 08 23:00:00 1993 Path: biosci!daresbury!doc.ic.ac.uk!uknet!pipex!zaphod.crihan.fr!vishnu.jussieu.fr!univ-lyon1.fr!cri.ens-lyon.fr!ibcp.fr!deleage From: deleage@ibcp.fr (G.Delage) Newsgroups: bionet.software Subject: ANTHEPROT availability Message-ID: <26mlc9$8p6@cri.ens-lyon.fr> Date: 9 Sep 93 07:18:33 GMT Organization: Institut de Biologie et Chimie des Proteines. CNRS-Lyon Lines: 15 NNTP-Posting-Host: ibcp.fr X-Newsreader: TIN [version 1.2 PL1] -- Hi The ANTHEPROT package is now available by anonymous ftp to ibcp.fr ===================================================================== # Institut de Biologie et Chimie des Proteines. UPR 412-CNRS # # ***** ***** **** ***** Dr Gilbert Deleage # # # # # # # # # 7, passage du Vercors # # # ***** # # # 69367 Lyon Cedex 07 # # # # # # #**** Tel: (33) 72-72-26-47 # # # # # # # # Fax: (33) 72-72-26-01 # # ***** ****** **** # deleage@ibcp.fr # ===================================================================== From owner-software@net.bio.net Wed Sep 08 23:00:00 1993 Path: biosci!THEORY.BCHS.UH.EDU!dbd From: dbd@THEORY.BCHS.UH.EDU (Dan Davison) Newsgroups: bionet.software Subject: New Journal-Call for Papers: Computational Biology Message-ID: <9309092037.AA01752@theory.BCHS.UH.EDU> Date: 9 Sep 93 20:37:36 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 52 CALL FOR PAPERS Announcing a new quarterly peer-reviewed journal COMPUTATIONAL BIOLOGY Editors: Daniel B. Davison, Ph.D. David T. Kingsbury, Ph.D. University of Houston Johns Hopkins University, School of Medicine Thomas Marr, Ph.D. Michael S. Waterman, Ph.D. Cold Spring Harbor Labs University of Southern California Goals: First, to provide a forum for communication of scientific and technical issues associated with the analysis and management of biological information at the molecular level. COMPUTATIONAL BIOLOGY will accept papers on the computational, mathematical, and statistical aspects of molecular biology. This includes sequence comparisons, analysis and searching; DNA and protein sequence determination; DNA topological structure; protein structure; RNA secondary and tertiary structure; genetic mapping; physical mapping; molecular evolution including phylogenetic reconstructions; parallel methods of computation; design and implementation of biological databases; biological expert system design and use; application of artificial intelligence methods to biological systems. Second, to provide a forum for the exchange of problems and methods between and within the biological and the mathematical/computational communities. This will be accomplished by soliciting mini-reviews in diverse areas, and by providing a forum for the informal exchange of theories and experimental approaches. The growth of molecular biology has produced large amounts of complex data consequently creating challenging new problems in the analysis, interpretation, and handling of these data. The mounting volume and richness of data require multidisciplinary and quantitative approaches for analysis and interpretation. For submission of manuscripts send three copies to: David T. Kingsbury Johns Hopkins University, School of Medicine Applied Research Laboratory 2024 East Monument Street Baltimore, MD 21205-2100 e-mail: compbio@brut.welch.jhu.edu Subscriptions rate: Volume 1, Number 1, quarterly 1994. Personal rate USA $80. Library $160. Outside USA: Personal rate $95. Library $200. From owner-software@net.bio.net Wed Sep 08 23:00:00 1993 Path: biosci!daresbury!doc.ic.ac.uk!agate!spool.mu.edu!sdd.hp.com!saimiri.primate.wisc.edu!news.doit.wisc.edu!ted.bocklabs.wisc.edu!user From: sspencer@macc.wisc.edu (Stephan Spencer) Newsgroups: bionet.software Subject: Electronic newsletter "Using Mac in Mol Bio" Message-ID: Date: 9 Sep 93 20:11:11 GMT Followup-To: bionet.software Organization: University of Wisconsin Lines: 8 NNTP-Posting-Host: ted.bocklabs.wisc.edu Does anyone know how to get ahold of Dr. Peter Markiewicz's electronic newsletter "Using the Apple Macintosh in Molecular Biology"? Thanks... Stephan Spencer University of Wisconsin, Biochemistry sspencer@macc.wisc.edu From owner-software@net.bio.net Wed Sep 08 23:00:00 1993 Path: biosci!NET.BIO.NET!kristoff From: kristoff@NET.BIO.NET (David Kristofferson) Newsgroups: bionet.software Subject: IMPORTANT BIOSCI INFORMATION Message-ID: <9309090900.AA22536@net.bio.net> Date: 9 Sep 93 09:00:02 GMT Sender: kristoff@net.bio.net Distribution: bionet Lines: 243 Three important items follow: BIOSCI archive searching by e-mail, the BIOSCI FAQ, and the BIOSCI User Address Directory form. If you have not yet listed yourself in our e-mail address directory, please take a few minutes to complete and return the form below. If your address information has changed since you listed yourself, please send us an updated form. Sincerely, Dave Kristofferson BIOSCI/bionet Manager kristoff@net.bio.net **** SEARCHING BIOSCI ARCHIVES WITH WAISMAIL **** E-mail users can search the BIOSCI archives by using our waismail e-mail server. For instructions send the message help to waismail@net.bio.net. Leave the Subject: line blank. Other methods of searching the archives via WAIS and gopher are described in the BIOSCI FAQ. **** BIOSCI FREQUENTLY ASKED QUESTIONS (FAQ) SHEET **** New users of BIOSCI/bionet may want to read the "Frequently Asked Questions" or "FAQ" sheet for BIOSCI. The FAQ provides details on how to participate in these forums and is available for anonymous FTP from net.bio.net [134.172.2.69] in pub/BIOSCI/biosci.FAQ. It may also be requested by sending e-mail to biosci@net.bio.net (use plain English for your request). The FAQ is also posted on the first of each month to the newsgroup BIONEWS/bionet.announce immediately following the posting of the BIOSCI information sheet. **** BIOSCI USER ADDRESS DIRECTORY **** Please take this opportunity to add your name and address information to the BIOSCI User Address Database if you have not already done so. Below is the address form that we would like each reader of the BIOSCI/bionet newsgroups to complete and return if you would like to be listed in our database. The database serves as a directory that enables biologists, who are currently using (or even just reading) the BIOSCI newsgroups, to look up e-mail addresses and other information about our users. The address database is reindexed nightly for WAIS and waismail access (waismail is our WAIS e-mail server, more below) and will also be available for access via other gopher sites if they wish to permit it. The raw unindexed data is available for FTP from net.bio.net and is atomized sufficiently to allow import into your local RDBMS should you so desire. Please carefully follow the instructions for completing the form below and return it to either of the following two addresses (whichever is more convenient for you). Thanks in advance for taking the time to complete and return the form. Addresses for returning forms Location Network ----------------------------- -------- ------- biovote@net.bio.net U.S.A. Internet/BITNET biovote@daresbury.ac.uk U.K. JANET MAKING SURE THAT YOUR INFORMATION IS CURRENT This notice will be mailed bimonthly to each newsgroup. You should check our WAIS source or waismail e-mail server from time-to-time to see if your address information is still up-to-date. Send the message help to waismail@net.bio.net for instructions on using waismail. Leave the Subject: line in your message blank. Using Gopher to complete the form --------------------------------- If you don't want to use a text editor, you can also use Dan Jacobson's gopher site to fill out the address database form as follows. Otherwise skip this section on gopher and proceed to the instructions for filling out the form below. > To add yourself to the database just point your > gopher client at merlot.welch.jhu.edu and select the following: > > --> 15. Searching For Biologists/ > > --> 9. E-mail Addresses of Biosci-Bionet Users/ > > --> 1. Add (or Correct) Your Address to the BIOSCI User Address > Data.. > > > And fill out the form. or Rob Harper's gopher site in Europe as follows: > Europeans can point their gopher client at gopher.csc.fi and add their > information to the database. All entries will be mailed directly to > Dave for incorporation in a wais source. > > The path to the questionare is as follows. > > ---> 10. Finnish EMBnet BioBox/ > > ---> 8. FAQ Files/ > > FAQ Files > > 1. EMBnet: Information. > 2. EMBnet: Internet resources guide. > 3. A Biologist's Guide to Internet Resources/ > 4. All FAQs (Frequently Asked Questions) Searches and Archives/ > --->5. Bionauts Address Database (questionaire) IMPORTANT INSTRUCTIONS - PLEASE READ CAREFULLY Please enter all responses after the : on each line, leaving one (1) blank space after the : (i.e., before the start of your text). Please do NOT extend your responses past the end of each line (80 characters) or alter any of the field identifiers such as "first name: ". Several lines are provided at the end of the form for comments, but, please adhere to the line length restriction. On the date: line, please enter the date in the DD-MM-YY format, e.g., 05-05-93 for 5 May 1993. This line will tell others when the information was last updated. Please be sure to include the 0's for single digit days or months, e.g., 05-05-93, not 5-5-93. Note that the "e-mail network: " line below is for specifying, e.g., "Internet," "BITNET," "EARN," "JANET," or whatever other network that your computer may be on. If you are uncertain about any field, please feel free to leave it blank, but please DO NOT DELETE the field identifier from the form! In the first field below, "New information or Update ...", please enter "N" if this is the first time that you have registered in the directory or "U" if you are correcting a listing that you sent to us previously. The comment: lines may be used for anything that you like but PLEASE DO NOT DELETE THEM FROM THE FORM OR ALTER THEM. One suggested use is to list the names of the newsgroups in which you participate. Please use the MAILING LIST name (see below - the latest version of the list can be requested from biosci@net.bio.net) instead of the USENET name even if you don't participate by e-mail. WAIS might get confused by the periods in the USENET names. This allows one to retrieve via WAIS or waismail the list of participants in a particular group. For example: comment: ARABIDOPSIS PLANT-BIOLOGY BIONEWS On the comment: lines use these names below ---- NOT the USENET names below MAILING LIST NAME USENET Newsgroup Name ----------------- --------------------- ACEDB-SOFT bionet.software.acedb AGEING bionet.molbio.ageing AGROFORESTRY bionet.agroforestry ARABIDOPSIS bionet.genome.arabidopsis BIOFORUM bionet.general BIO-INFORMATION-THEORY bionet.info-theory BIONAUTS bionet.users.addresses BIONEWS bionet.announce BIO-JOURNALS bionet.journals.contents BIO-MATRIX bionet.molbio.bio-matrix BIO-SOFTWARE bionet.software CHROMOSOMES bionet.genome.chromosomes COMPUTATIONAL-BIOLOGY bionet.biology.computational DROSOPHILA bionet.drosophila EMBL-DATABANK bionet.molbio.embldatabank EMPLOYMENT bionet.jobs GDB bionet.molbio.gdb GENBANK-BB bionet.molbio.genbank GENETIC-LINKAGE bionet.molbio.gene-linkage HIV-MOLECULAR-BIOLOGY bionet.molbio.hiv HUMAN-GENOME-PROGRAM bionet.molbio.genome-program IMMUNOLOGY bionet.immunology INFO-GCG bionet.software.gcg JOURNAL-NOTES bionet.journals.note METHODS-AND-REAGENTS bionet.molbio.methds-reagnts MOLECULAR-EVOLUTION bionet.molbio.evolution NEUROSCIENCE bionet.neuroscience N2-FIXATION bionet.biology.n2-fixation PHOTOSYNTHESIS bionet.photosynthesis PLANT-BIOLOGY bionet.plants POPULATION-BIOLOGY b