From owner-software@net.bio.net Mon Aug 01 23:00:00 1994 Path: biosci!ISUMVS.IASTATE.EDU!JL.GJM From: JL.GJM@ISUMVS.IASTATE.EDU (Gerry McKiernan) Newsgroups: bionet.software Subject: CAI/CBT and Internet Date: 1 Aug 1994 19:16:34 -0700 Organization: Iowa State University, Ames, Iowa Lines: 14 Sender: daemon@net.bio.net Distribution: world Message-ID: <31j8hp$8m9@news.iastate.edu> Reply-To: JL.GJM@ISUMVS.IASTATE.EDU (Gerry McKiernan) NNTP-Posting-Host: net.bio.net Are any Netters aware of an expert system (of any type) that is accessible/usable over the Internet through Mosaic (or other interface)? Gerry McKiernan Coordinator, Science and Technology Section Reference and Instructional Services Department Iowa State University Ames IA 50011 gerrymck@iastate.edu "THINK RADICALLY, ACT LOGICALLY" From owner-software@net.bio.net Mon Aug 01 23:00:00 1994 Path: biosci!ISUMVS.IASTATE.EDU!JL.GJM From: JL.GJM@ISUMVS.IASTATE.EDU (Gerry McKiernan) Newsgroups: bionet.software Subject: CAI/CBT and Internet Date: 1 Aug 1994 19:18:08 -0700 Organization: Iowa State University, Ames, Iowa Lines: 18 Sender: daemon@net.bio.net Distribution: world Message-ID: <31j9j5$98h@news.iastate.edu> Reply-To: JL.GJM@ISUMVS.IASTATE.EDU (Gerry McKiernan) NNTP-Posting-Host: net.bio.net Are any Netters aware of a Mosaic Home Page (or other interface) that provides "online and real-time" access and use of computer-aided instruction (CAI) or computer-based training (CBT) sessions (of any type)? Please respond to me, or to the list or newsgroup. Gerry McKiernan Coordinator, Science and Technology Reference and Instructional Services Department Iowa State University 152 Parks Library Ames IA 50011 gerrymck@iastate.edu "THINK RADICALLY, ACT LOGICALLY" From owner-software@net.bio.net Mon Aug 01 23:00:00 1994 Newsgroups: bionet.general,bionet.software,bionet.biophysics Path: biosci!agate!howland.reston.ans.net!news.cac.psu.edu!news.tc.cornell.edu!travelers.mail.cornell.edu!newsstand.cit.cornell.edu!news.graphics.cornell.edu!ghost.dsi.unimi.it!univ-lyon1.fr!swidir.switch.ch!scsing.switch.ch!news.belwue.de!news.informatik.uni-stuttgart.de!schuetzl From: schuetzl@hermes.informatik.uni-stuttgart.de (Alexander Schuetzle) Subject: Searching for biological info-systems... Message-ID: Keywords: informationsystems, databases Sender: news@informatik.uni-stuttgart.de Organization: IPVR, University of Stuttgart, Germany Date: Tue, 2 Aug 1994 11:05:41 GMT Lines: 50 Xref: biosci bionet.general:10557 bionet.software:8905 bionet.biophysics:353 Hi all, I have some questions about biological databases. 1. I'm searching for names and short description of the contence of main databases in the biology, especially in the genome research. E.g.: name: GDB (Genome Data Base) contence: Human gene mapping data organized by map location. status: Schema and data ... public available. location: Source from John Hopkins University. ftp ... Also supportet by several national organisations like the German Cancer Resaearch Center within the EMBNET. ... queriing: Working with stored procedures datamodel: Relational database: Sybase remarks: There is a connection to OMIM (Online version of Mendelian Inheritance in Man; catalog of genes and genetic disorders) via a MIM number. ... ... 2. Or for the hints to sources or persons where I can get more information about this topic. Thank you for your kind cooperation Alexander Schuetzle ----------------------------------------------------------------------- Alexander Schuetzle University of Stuttgart Institute of Parallel and Distributed High-Performance Systems (IPVR) Breitwiesenstrasse 20-22 Phone: +49-711-7816-389 D-70565 Stuttgart Fax.: +49-711-7816-424 Germany alexander.schuetzle@informatik.uni-stuttgart.de From owner-software@net.bio.net Mon Aug 01 23:00:00 1994 Path: biosci!bcm!news.msfc.nasa.gov!europa.eng.gtefsd.com!howland.reston.ans.net!EU.net!Austria.EU.net!newsfeed.ACO.net!swidir.switch.ch!scsing.switch.ch!sun.rediris.es!obelix.cica.es!news From: bb1dopeg@lucano.uco.es (Gabriel Dorado) Newsgroups: bionet.software Subject: Lasergene (DNAStar) on an AWS 95 (A/UX) machine Date: 2 Aug 1994 08:23:15 GMT Organization: Centro Informatico Cientifico de Andalucia Lines: 14 Sender: -Not-Authenticated-[3387] Message-ID: <31kvpj$h3i@obelix.cica.es> NNTP-Posting-Host: macta.uco.es X-Posted-From: InterNews 1.0.1@macta.uco.es Xdisclaimer: No attempt was made to authenticate the sender's name. I am about to implement an EtherNet network of Lasergene (DNAStar) running from an Apple Workgroup Server 95 (AWS 95) with A/UX operating system. I would like to know if there is any similar network installed somewhere, as well as the number of simultaneous users it can support performing database searches. Thanks a lot for your help! Gabriel Dorado Dep. Bioquimica y Biol. Mol. Fac. Veterinaria 14071 Cordoba SPAIN Internet Email: bb1dopeg@lucano.uco.es From owner-software@net.bio.net Mon Aug 01 23:00:00 1994 Path: biosci!bcm!polka.imgen.bcm.tmc.edu!kworley From: kworley@polka.imgen.bcm.tmc.edu (Kim Worley) Newsgroups: bionet.general,bionet.software,bionet.biophysics Subject: Re: Searching for biological info-systems... Date: 2 Aug 1994 20:52:19 GMT Organization: Baylor College of Medicine, Houston, Tx Lines: 8 Distribution: world Message-ID: <31mbm3$fp9@gazette.bcm.tmc.edu> References: NNTP-Posting-Host: polka.imgen.bcm.tmc.edu Keywords: informationsystems, databases Xref: biosci bionet.general:10558 bionet.software:8909 bionet.biophysics:354 Check out the Survey of Molecular Biology Databases and Servers at http://www.ai.sri.com/people/pkarp/mimbd/rsmith.html It includes up-to-date lists of databases and servers as well as lists of lists and servers that link multiple databases. From owner-software@net.bio.net Mon Aug 01 23:00:00 1994 Path: biosci!rutgers!gatech!newsxfer.itd.umich.edu!jobone!news1.oakland.edu!news From: mje@pookie.pass.wayne.edu (Michael J. Edelman) Newsgroups: bionet.software Subject: algorithm for counting peaks Date: 2 Aug 1994 19:34:25 GMT Organization: Wayne State University Lines: 22 Message-ID: <31m741$sjq@oak.oakland.edu> Reply-To: mje@pookie.pass.wayne.edu NNTP-Posting-Host: pookie.pass.wayne.edu I've been asked to write a program that will read time-series data consisting of counts of events per period, and output the numbers of peaks in a given specified time interval. The Tricky part is in defining what constitutes a peak. The researchers are using some canned package from Data Translation that doesn't perform this task; they've been eyeballing the data up until now. It's been about 16 years since I did any work in electrophysiology where I used to do this kind of coding, so I'm at a loss where to start. Can someone direct me to a good reference, or perhaps suggest a simple algorithm? We may also have to deal with a shifting baseline in the data as well. --mike ----------------------------------------------------------------------- Michael Edelman KE8YY Wayne State University mje@pookie.pass.wayne.edu (Sun) Computing & Infomation Technology medelma@waynest1 (BITNET) Planning & Support Services usermje@mts.cc.wayne.edu (MTS) Detroit, MI 48202 1-313-577-0742 From owner-software@net.bio.net Mon Aug 01 23:00:00 1994 Newsgroups: bionet.software Path: biosci!lhc!gold!epstein From: epstein@gold.nlm.nih.gov (Jonathan Epstein) Subject: Re: Nentrez and Linux? Message-ID: <1994Aug2.175443.9042@nlm.nih.gov> Sender: news@nlm.nih.gov Organization: National Library of Medicine X-Newsreader: Tin 1.1 PL4 References: <316p00$h1t@usenet.INS.CWRU.Edu> Date: Tue, 2 Aug 94 17:54:43 GMT Lines: 48 axa12@po.CWRU.Edu (Ashok Aiyar) writes: : : : Can someone help me get Nentrez compiled and working under : Linux (Slackware 2.1); kernel 1.0.9? Better yet, if you have : a compiled binary, you are willing to share that would be : terrific!! : : Thanks, : Ashok : -- : Ashok Aiyar tel: (216) 368-3300 : Department of Biochemistry fax: (216) 368-4544 : CWRU School of Medicine ashok@biochemistry.cwru.edu I just wanted to follow-up to inform interested parties that, using a guest account on Ashok's machine (thanks, Ashok!), I have produced a header file for Linux which allows the NCBI toolbox to be compiled under Linux. Unfortunately, I wasn't able to produce Network Entrez (Nentrez) on Ashok's machine, because he doesn't yet have the Motif libraries and include files. However, I have confirmed the correct operation of the client/server software, using the Entrez Network Service. So, if you fit into one or more of the following catagories, please contact me: (1) Want to run Network Entrez on Linux, and you have Linux & Motif (2) Have Linux and Motif, and would like to help-out Ashok (he's a good guy, and helps a lot of people, including me) (3) Want to run other NCBI toolbox applications under Linux In any case, the new header file (corelib/ncbilcl.lnx) will appear in the next release of the NCBI toolbox, available by anonymous FTP from ncbi.nlm.nih.gov:/toolbox/ncbi_tools/ncbi.tar.Z. Please address general NCBI toolbox questions to toolbox@ncbi.nlm.nih.gov. Cheers, - Jonathan Jonathan Epstein Phone: (301)496-2475 National Center for Biotechnology Information E-mail: epstein@ncbi.nlm.nih.govNational Library of Medicine Building 38A, Room 8N805 National Institutes of Health 8600 Rockville Pike Bethesda, MD 20894 From owner-software@net.bio.net Mon Aug 01 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!cs.utexas.edu!convex!news.duke.edu!news-feed-1.peachnet.edu!ukma!hsdndev!NewsWatcher!user From: mjcoyne@warren.med.harvard.edu (Michael Coyne) Newsgroups: bionet.software Subject: Re: DNA pattern libraries Date: 2 Aug 1994 16:22:56 GMT Organization: Harvard Medical School Lines: 36 Distribution: world Message-ID: References: NNTP-Posting-Host: 134.174.147.40 In article , kofoid@biology.utah.edu (Eric Kofoid) wrote: > I am hunting for pattern or profile libraries of nucleic acid features > (promoters, transcriptional stops, ribosome binding sites, etc.) which can > be used with GCG programs such as FINDPATTERNS and PROFILESEARCH. Please > reply to the group, as I think this is of general interest. > > Cheers, > > Eric. > > __________________________________________________ > kofoid --- close to the truth, > --- far from the sea > __________________________________________________ I, too, am hunting for such a thing. I would be very interested in any replies you might get -- I scan this newsgroup (which doesn't seem to have much traffic), but if you get any replies via e-mail, I hope you'll share them. There was a thread on the bionet.molbio.methds-reagnts by someone looking for a database of transcription factor binding sequences. Apparently, there is a database(s) maintained at NCBI (ncbi.nlm.nih.gov) which may be what you're (we're) looking for. The description in the reply described a SITES database, available in many formats (GCG, FASTA, etc.) in the /repository/databses directory. I haven't had a chance to check it out (just picked up the methds-reagnts thread yesterday), but it might be helpful. Let me know if you trip over any other hot leads... Mike mjcoyne@warren.med.harvard.edu From owner-software@net.bio.net Mon Aug 01 23:00:00 1994 Path: biosci!biosci!not-for-mail From: Schuetzle@informatik.uni-stuttgart.de (Alexander Schuetzle) Newsgroups: bionet.general,bionet.molbio.genome-program,bionet.software,bionet.biophysics Subject: Searching for standards ... Date: 2 Aug 1994 16:30:23 -0700 Organization: IPVR, University of Stuttgart, Germany Lines: 33 Sender: kristoff@net.bio.net Distribution: world Message-ID: NNTP-Posting-Host: net.bio.net Keywords: standard Xref: biosci bionet.general:10559 bionet.molbio.genome-program:892 bionet.software:8911 bionet.biophysics:356 Hi all, I have some questions about standardisation efforts in the genom research (biology). Are there any exact and unique definitions (syntax) for the dataobjects ( like genes, chromosomes, . . . ) in the genom research? Are there some kinds of methods to handle these objects, i.e. how to represent ( graphical, textual, ...) them and so else? If you know some (de facto) standards or conventions please inform me or give some hints where I can get some further informations! Thank you for your kind cooperation Alexander Schuetzle ------------------------------------------------------------------------------- Alexander Schuetzle University of Stuttgart Institute of Parallel and Distributed High-Performance Systems (IPVR) Breitwiesenstrasse 20-22 Phone: +49-711-7816-389 D-70565 Stuttgart Fax.: +49-711-7816-424 Germany alexander.schuetzle@informatik.uni-stuttgart.de From owner-software@net.bio.net Mon Aug 01 23:00:00 1994 Path: biosci!agate!library.ucla.edu!csulb.edu!paris.ics.uci.edu!news.service.uci.edu!dialin33621.slip.nts.uci.edu!user From: cgochiku@e4e.oac.uci.edu (Clark Ochikubo, MD) Newsgroups: bionet.software Subject: Mac MEDLINE database organizer Followup-To: bionet.software Date: 2 Aug 1994 10:11:54 GMT Organization: Dept of Pediatrics, UC Irvine Med Center Lines: 11 Message-ID: NNTP-Posting-Host: dialin33621.slip.nts.uci.edu For those of you out there with Macs who use MEDLINE and would like a way to put those text files of downloaded references into a database, check out medline-hc.sit in the Stanford archives. It is a hypercard stack I wrote that allows fast importing of references, including the abstracts. -- Clark Ochikubo, MD Fellow, Neonatal/Perinatal Medicine Department of Pediatrics University of California at Irvine Medical Center Orange, California From owner-software@net.bio.net Tue Aug 02 23:00:00 1994 Newsgroups: bionet.software Path: biosci!rutgers!princeton!nimaster!news From: anders@phoenix.princeton.edu Subject: Environmental Simulators Message-ID: <1994Jul31.144831.20476@Princeton.EDU> Originator: news@nimaster Sender: news@Princeton.EDU (USENET News System) Nntp-Posting-Host: luma.princeton.edu Organization: Princeton University Date: Sun, 31 Jul 1994 14:48:31 GMT Lines: 39 The purpose of this post is to find software simulations of the earths environment, especially the atmosphere. But first a little background information. I am working for Professor Philander and Mr. Feiveson this summer. They are teaching a course this fall about the atmosphere and the environment. The course will be for undergraduates at Princeton University, and is not geared towards scientists but all students with a general interest in the environment. The lecturers hope to use computer programs, via a projector, to illustrate their concepts more effectively. This primarily takes the form of graphic simulations of environmental processes. For example one would like to show how altering mixes of gasses affects the climate, etc... SimEarth is one program which will probably be used, this should give you a real good idea of the kind of course being taught. (Though programs whose output is through graphs might be fine too.) Small Blue Planet might also be useful, though I don't think it is interactive (?). We are not sure of others but they should be for Mac or IBM, and may be on disk or CD-Rom. Among the variables and effects to be illustrated are Milankovitch Cycles, Ice Ages, the Ozone Layer and lack thereof, the Greenhouse Effect, deforestation, tilt and orbit of earth. In short these programs should be readily accessible to your average bright youth, and should not require massive quantities of computing power. Programs which encourage experimentation and attendant manipulation of variables are to be preferred. However any information about anything "really neat" relating to this post is still greatly encouraged. Thank you for any forthcoming help. -Anders Mikkelsen P.S. Please reply via E-mail. Posted to bionet.software comp.edu comp.sys.mac.apps sci.edu sci.environment talk.environment misc.science.education From owner-software@net.bio.net Tue Aug 02 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!EU.net!Germany.EU.net!netmbx.de!zib-berlin.de!fauern!lrz-muenchen.de!ipp-garching.mpg.de!alf.biochem.mpg.de!krasel From: krasel@alf.biochem.mpg.de (Cornelius Krasel) Newsgroups: bionet.software Subject: Re: [?] UNIX sequence editor [?] Date: 3 Aug 1994 07:48:29 GMT Organization: Rechenzentrum der Max-Planck-Gesellschaft in Garching Lines: 17 Message-ID: <31ni4dINNsuf@sat.ipp-garching.mpg.de> References: <1994Aug3.000345.10047@midway.uchicago.edu> NNTP-Posting-Host: alf.biochem.mpg.de X-Newsreader: TIN [version 1.1 PL8] Eric Cabot (ecec@quads.uchicago.edu) wrote: : I agree with Brian Fristensky's comments regarding GDE. It is a : great application. The main problem regarding GDE, though, : is that it requires X-windows, to which many, if not most, : of us do not have access. Fortunately, with the advent of Linux, this is not longer true. Linux is a UNIX-compatible operating system for 386 and 486, running Xwindows happily with >= 8 MB of RAM. If you have a PC in your lab and about 100 MB of free space on your hard disk, give it a try! --Cornelius. -- /* Cornelius Krasel, Abt. Lohse, Genzentrum, D-82152 Martinsried, Germany */ /* email: krasel@alf.biochem.mpg.de fax: +49 89 8578 3795 */ /* "People are DNA's way of making more DNA." (Edward O. Wilson, 1975) */ From owner-software@net.bio.net Tue Aug 02 23:00:00 1994 Path: biosci!rutgers!gatech!news-feed-1.peachnet.edu!emory!darwin.sura.net!nellie.musc.edu!usenet From: afrinl@honc.mhs.musc.edu (Lawrence B. Afrin, M.D.) Newsgroups: bionet.software Subject: BLAST searching finally works with Win3.1 Mosaic! Date: 3 Aug 1994 00:01:45 GMT Organization: Hollings Cancer Center, Med. Univ. of South Carolina Lines: 38 Message-ID: <31mmp9$bjg@nellie.musc.edu> NNTP-Posting-Host: pcfrankel.musc.edu X-Newsreader: WinVN 0.91.6 Howdy, netters, Just thought y'all'd like to know... Forgive me if I'm telling you something you already know, but I thought this was fairly significant molecular biology software news from the World Wide Web front: the latest NCSA Mosaic for Windows release (July 27th, version 2.0 alpha 6) now allows successful BLAST searching from the Win3.1/WfW/WinNT platform! Previously, with versions 2.0 alpha 2 through alpha 5, you could get as far as displaying the form and entering your search parameters, but when you clicked on Submit, you would never get a response back -- no answers, no error messages, nothing. But with alpha 6 -- hurrah! -- you get the appropriate BLAST response. (Quiet, now, all of you HyperBLASTing Mac'ers out there who are laughing your heads off at how behind-the-times we IBM'ers are.) From the little bit of testing I've just finished with alpha 6 and BLAST, it looks like the BLAST folks could maybe tweak the HTML output a bit to improve the formatting of the response, but all in all, it's a 1,000% improvement over no response at all! Other improvements in alpha 6: plugging a memory leak which was causing (at least for my installation) serious performance degradation when retrieving *large* pages; a noticeable improvement in speed; elimination of some of the more serious page-display bugs; and significant bug fixes in page printing when using HP Laserjet drivers (the hardcopy is now pretty much readable, rather than being a candidate for "Portrait of the Month" at the Museum of Modern Art). Just sent a complimentary message to mosaic-win@ncsa.uiuc.edu -- maybe you other WinMosaic users should, too, if you feel like I do about alpha 6. Have fun! Larry Afrin, M.D. afrinl@honc.mhs.musc.edu Hollings Cancer Center Medical University of South Carolina From owner-software@net.bio.net Tue Aug 02 23:00:00 1994 Newsgroups: bionet.software Path: biosci!agate!howland.reston.ans.net!pipex!bnr.co.uk!uknet!festival!leeds.ac.uk!news From: bmb5meb@biovax.leeds.ac.uk Subject: PASCAL compiling problems Message-ID: <1994Aug3.111007.12311@leeds.ac.uk> Sender: news@leeds.ac.uk Reply-To: bmb5meb@biovax.leeds.ac.uk Organization: The University of Leeds, UK Date: Wed, 3 Aug 1994 11:10:07 GMT Lines: 21 Hi there, I'm having problems compiling the SCRUTINeer program on a VAX system and was wondering if someone could help out. When I try to compile the MAPMAKER section on a DEC MicroVAX 3600 series machine running VAX/VMS v5.5-2 I get the following error message. Entry_Array : [VOLATILE, ALIGNED( 9 ), BYTE(1548000)] ...........................................^ %PASCAL-E-SIZEATRTYPCON, Size attribute / type conflict No-one here seems to know anything about PASCAL and neither do I, so if anyone can give me a clue as to what is wrong and how to fix it, I would appreciate it. Mike. Michael Beck (Leeds University Rifle Coach) : Juggle 'til you drop Protein Database Group, University of Leeds : : To all masochists, try doing e-mail : bmb5meb@biovax.leeds.ac.uk : the Mills' Mess when drunk. From owner-software@net.bio.net Tue Aug 02 23:00:00 1994 Path: biosci!bcm!cs.utexas.edu!sdd.hp.com!nigel.msen.com!zib-berlin.de!informatik.tu-muenchen.de!lrz-muenchen.de!ipp-garching.mpg.de!alf.biochem.mpg.de!krasel From: krasel@alf.biochem.mpg.de (Cornelius Krasel) Newsgroups: bionet.software Subject: Re: [?] UNIX sequence editor [?] Date: 3 Aug 1994 18:11:46 GMT Organization: Rechenzentrum der Max-Planck-Gesellschaft in Garching Lines: 28 Message-ID: <31oml2INNqr3@sat.ipp-garching.mpg.de> References: NNTP-Posting-Host: alf.biochem.mpg.de X-Newsreader: TIN [version 1.1 PL8] Robert Miller - EECS (rmiller@ren.eecs.wsu.edu) wrote: : In article <31ni4dINNsuf@sat.ipp-garching.mpg.de> krasel@alf.biochem.mpg.de (Cornelius Krasel) writes: : >Eric Cabot (ecec@quads.uchicago.edu) wrote: : >: I agree with Brian Fristensky's comments regarding GDE. It is a : >: great application. The main problem regarding GDE, though, : >: is that it requires X-windows, to which many, if not most, : >: of us do not have access. : > : >Fortunately, with the advent of Linux, this is not longer true. Linux : >is a UNIX-compatible operating system for 386 and 486, running Xwindows : >happily with >= 8 MB of RAM. If you have a PC in your lab and about 100 MB : >of free space on your hard disk, give it a try! : > : Actually, the problem with GDE is that it requires XView, a widget set that is : public domain but doesn't quite run on every Unix around. As already stated, GDE runs just fine under Linux. Unfortunately, the executables for the latest version aren't available via ftp yet (maybe I'll try to compile it when I have put the complete XView includes on my machine). --Cornelius. -- /* Cornelius Krasel, Abt. Lohse, Genzentrum, D-82152 Martinsried, Germany */ /* email: krasel@alf.biochem.mpg.de fax: +49 89 8578 3795 */ /* "People are DNA's way of making more DNA." (Edward O. Wilson, 1975) */ From owner-software@net.bio.net Tue Aug 02 23:00:00 1994 Newsgroups: bionet.software Path: biosci!agate!ames!lll-winken.llnl.gov!fastrac.llnl.gov!osi-east2.es.net!pnl-oracle!netnews.nwnet.net!serval.net.wsu.edu!ren!rmiller From: rmiller@ren.eecs.wsu.edu (Robert Miller - EECS) Subject: Re: [?] UNIX sequence editor [?] Message-ID: Sender: news@serval.net.wsu.edu (News) Organization: Washington State University References: <1994Aug3.000345.10047@midway.uchicago.edu> <31ni4dINNsuf@sat.ipp-garching.mpg.de> Date: Wed, 3 Aug 1994 15:30:43 GMT Lines: 29 In article <31ni4dINNsuf@sat.ipp-garching.mpg.de> krasel@alf.biochem.mpg.de (Cornelius Krasel) writes: >Eric Cabot (ecec@quads.uchicago.edu) wrote: >: I agree with Brian Fristensky's comments regarding GDE. It is a >: great application. The main problem regarding GDE, though, >: is that it requires X-windows, to which many, if not most, >: of us do not have access. > >Fortunately, with the advent of Linux, this is not longer true. Linux >is a UNIX-compatible operating system for 386 and 486, running Xwindows >happily with >= 8 MB of RAM. If you have a PC in your lab and about 100 MB >of free space on your hard disk, give it a try! > Actually, the problem with GDE is that it requires XView, a widget set that is public domain but doesn't quite run on every Unix around. tkDCSE is a nice effort as well, but source code is not included -- so it's only for sun, sgi, and vaxen. Tom Flores has a nice product called DisGUIse, runs under Tcl/Tk (which does seem to run on most Unices, full functionality coming soon for Pcs and Macs), and includes a sequence editor as an example application. Should be out in September, I'm told... rob. rmiller@bsm.bioc.ucl.ac.uk From owner-software@net.bio.net Tue Aug 02 23:00:00 1994 Path: biosci!agate!ames!elroy.jpl.nasa.gov!usc!sdd.hp.com!nigel.msen.com!zib-berlin.de!gs.dfn.de!immunbio.mpg.de!immunbio.mpg.de!news Newsgroups: bionet.software Subject: Re: PASCAL compiling problems Message-ID: <1994Aug3.164236.137@immunbio.mpg.de> From: GARTMANN@IMMUNBIO.MPG.DE (Christoph Gartmann) Date: 3 Aug 94 16:42:35 +0100 References: <1994Aug3.111007.12311@leeds.ac.uk> Distribution: world Organization: Max-Planck-Institut fuer Immunbiologie Nntp-Posting-Host: mpi1.immunbio.mpg.de X-News-Reader: VMS NEWS 1.24In-Reply-To: bmb5meb@biovax.leeds.ac.uk's message of Wed, 3 Aug 1994 11:10:07 GMTLines: 24 Lines: 24 In <1994Aug3.111007.12311@leeds.ac.uk> bmb5meb@biovax.leeds.ac.uk writes: > I'm having problems compiling the SCRUTINeer program on a VAX system and was > wondering if someone could help out. When I try to compile the MAPMAKER > section on a DEC MicroVAX 3600 series machine running VAX/VMS v5.5-2 I get > the following error message. > > Entry_Array : [VOLATILE, ALIGNED( 9 ), BYTE(1548000)] > ...........................................^ > %PASCAL-E-SIZEATRTYPCON, Size attribute / type conflict Hm, probabely I can help but I need to see the whole variable definition. Thus, specify some more lines of the code in question. Regards Christoph Gartmann +----------------------------------------------------------------------------+ | Max-Planck-Institut fuer Phone : +49-761-5108-465 Fax: -221 | | Immunbiologie PSI : PSI%(0262)45050160374::GARTMANN | | Postfach 1169 Internet: gartmann@immunbio.mpg.de | | D-79011 Freiburg, FRG | +----------- Do you know MENUE, the user environment for OpenVMS? -----------+ From owner-software@net.bio.net Tue Aug 02 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!gatech!concert!bigblue.oit.unc.edu!not-for-mail From: Bill.Anderson@launchpad.unc.edu (C.Dr. C. William Anderson) Newsgroups: bionet.software Subject: ? CD-ROM drives/drivers for SGI Indy ? Date: 3 Aug 1994 10:50:28 -0400 Organization: The University of North Carolina at Chapel Hill, the Experimental Bulletin Board Service. Lines: 14 Sender: bbs@lambada.oit.unc.edu Distribution: na Message-ID: <31oark$i1i@lambada.oit.unc.edu> NNTP-Posting-Host: lambada.oit.unc.edu Does anyone know of a (3rd party) source for cd-rom drives and drivers that will fly on an SGI Indy? I need to add one but SGI's price is way beyond my current budget for these items. Thank you for any help you may be able to give me. Bill Anderson BILLA@TIGER.HSC.EDU -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- Launchpad is an experimental internet BBS. The views of its users do not necessarily represent those of UNC-Chapel Hill, OIT, or the SysOps. -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- From owner-software@net.bio.net Tue Aug 02 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!newsserver.jvnc.net!yale.edu!nigel.msen.com!zib-berlin.de!informatik.tu-muenchen.de!lrz-muenchen.de!ipp-garching.mpg.de!alf.biochem.mpg.de!jiang From: jiang@alf.biochem.mpg.de (Weiping Jiang) Newsgroups: bionet.software Subject: MacTCP Tool version Date: 3 Aug 1994 13:22:06 GMT Organization: Rechenzentrum der Max-Planck-Gesellschaft in Garching Lines: 5 Distribution: world Message-ID: <31o5luINNgd3@sat.ipp-garching.mpg.de> NNTP-Posting-Host: alf.biochem.mpg.de Hi, there! Is the version(MacX 1.2) of the communication tool(MacTCP Tool) for Macintosh current? Is MacTCP Tool(MacX 1.2) a free software? Where can I get it? From owner-software@net.bio.net Tue Aug 02 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!EU.net!Germany.EU.net!netmbx.de!zib-berlin.de!news.th-darmstadt.de!bc1.bc.chemie.th-darmstadt.de!user From: dh30@pop.th-darmstadt.de (Bernhard Seehaus) Newsgroups: bionet.software Subject: multiple alignment resource needed Followup-To: bionet.software Date: 3 Aug 1994 12:56:56 GMT Organization: Institut of Biochemistry, Univ. of Darmstadt, Germany Lines: 17 Distribution: world Message-ID: NNTP-Posting-Host: bc1.bc.chemie.th-darmstadt.de Dear listener, I«m looking for a free of charge internet resource to perform multiple alignments between DNA sequences. I didn«t find one until now; does anybody know something? I often wonder why you can«t specify a(some) certain acession number(s) instead of whole databases when performing e.g. a blast search at NCBI. The problem is I can«t see some interesting alignments due to sequences occuring only in the score list but not as aligned sequences. Any help is highly appreciated, thanks in advance Bernhard Seehaus Institut of biochemistry University of Darmstadt Germany e-mail dh30@pop.th-darmstadt.de From owner-software@net.bio.net Tue Aug 02 23:00:00 1994 Newsgroups: bionet.software Path: biosci!rutgers!uwvax!uchinews!quads!ecec From: ecec@quads.uchicago.edu (Eric Cabot) Subject: Re: [?] UNIX sequence editor [?] Message-ID: <1994Aug3.000345.10047@midway.uchicago.edu> Sender: news@uchinews.uchicago.edu (News System) Reply-To: ecec@midway.uchicago.edu Organization: University of Chicago References: <315lbf$m9m@osiris.wu-wien.ac.at> <31b8sh$c9r@canopus.cc.umanitoba.ca> Date: Wed, 3 Aug 1994 00:03:45 GMT Lines: 16 I agree with Brian Fristensky's comments regarding GDE. It is a great application. The main problem regarding GDE, though, is that it requires X-windows, to which many, if not most, of us do not have access. With respect to S. Bunka's original query: > Where can I find a (the sources) sequence editor like "esee" > for U*IX (Linux; gcc / ansi compiler) ? I can offer only a little help. I'd be glad to send the Esee source code to anyone who wants to take a stab a writing a version for their favorite platform. Unfortunately, Esee is not written in any flavor of C, it is in (Borland) Pascal. Regards, Eric Cabot From owner-software@net.bio.net Tue Aug 02 23:00:00 1994 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!spool.mu.edu!nigel.msen.com!zib-berlin.de!informatik.tu-muenchen.de!lrz-muenchen.de!news.informatik.uni-muenchen.de!wap18.zi.biologie.uni-muenchen.de!salger From: salger@wap18.zi.biologie.uni-muenchen.de (Klaus Salger) Newsgroups: bionet.software Subject: Re: multiple alignment resource needed Date: 3 Aug 1994 22:41:30 GMT Organization: Institut fuer Informatik der Universitaet Muenchen Lines: 18 Distribution: world Message-ID: <31p6eq$e3t@arcadia.informatik.uni-muenchen.de> References: NNTP-Posting-Host: wap18.zi.biologie.uni-muenchen.de X-Newsreader: TIN [version 1.2 PL2] Bernhard Seehaus (dh30@pop.th-darmstadt.de) wrote: : Dear listener, : I«m looking for a free of charge internet resource to perform multiple : alignments between DNA sequences. I didn«t find one until now; does anybody : know something? (snip) Bernhard, try ClustalV. It's available via FTP from ftp.embl-heidelberg.de (or via www http://www.embl-heidelberg.de) at least for UNIX, DOS and Mac, the sources are included. Klaus Klaus Salger Zoologisches Institut der LMU Muenchen e-mail: salger@zi.biologie.uni-muenchen.de From owner-software@net.bio.net Tue Aug 02 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!news.cac.psu.edu!news.tc.cornell.edu!travelers.mail.cornell.edu!newsstand.cit.cornell.edu!news.graphics.cornell.edu!ghost.dsi.unimi.it!univ-lyon1.fr!swidir.switch.ch!scsing.switch.ch!sun.rediris.es!obelix.cica.es!news From: bb1dopeg@lucano.uco.es (Gabriel Dorado) Newsgroups: bionet.software Subject: Lasergene (DNAStar) on an AWS 95 (A/UX) machine Date: 3 Aug 1994 10:55:55 GMT Organization: Centro Informatico Cientifico de Andalucia Lines: 10 Sender: -Not-Authenticated-[3387] Message-ID: <31nt3r$36b@obelix.cica.es> NNTP-Posting-Host: macta.uco.es X-Posted-From: InterNews 1.0.1@macta.uco.es Xdisclaimer: No attempt was made to authenticate the sender's name. I am about to implement an EtherNet network of Lasergene (DNAStar) running from an Apple Workgroup Server 95 (AWS 95) with A/UX operating system. I would like to know if there is any similar network installed somewhere, as well as the number of simultaneous users it can support performing database searches. Thanks a lot for your help! Gabriel Dorado Internet Email: bb1dopeg@lucano.uco.es From owner-software@net.bio.net Tue Aug 02 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!wupost!cerberus-138.wustl.edu!usenet From: HAVILAND@KIDS.WUSTL.EDU (David L. Haviland, Ph.D.) Newsgroups: bionet.software Subject: Re: Papyrus Date: 3 Aug 1994 20:51:22 GMT Organization: Washington University School of Med. Lines: 33 Distribution: world Message-ID: <31p00b$rhe@cerberus-138.wustl.edu> References: <315b8a$13v@alf.uib.no> NNTP-Posting-Host: kids1.wustl.edu X-News-Reader: VMS NEWS v1.25 In-Reply-To: mblgj@alf.uib.no's message of 27 Jul 1994 10:00:42 GMT In <315b8a$13v@alf.uib.no> mblgj@alf.uib.no writes: > Is the Macintosh version of Papyrus released? > > -- > Geir Johannessen * Phone : + 47 55 54 45 29 > Laboratory for biotechnology * Fax : + 47 55 31 49 52 > University of Bergen * E-mail:mblgj@alf.uib.no > Norway * Having just e-mailed Dave Goldman on that very subject, his response is 'yes'. A Mac version of Papyrus is currently under development and if he is on schedule, a beta-version should be tested shortly. Dave was predicting a late fall release of a papyrus mac version. After the mac version, next on the slate is a Windoze version with an unknown release date. hope this helps, David p.s. no afilliation with RSD, wish there were, but just a rabid Papyrus user! =========================================================================== + David L. Haviland, Ph.D. Internet:"haviland@kids.wustl.edu" + + Washington Univ. School of Med. A.K.A : The Compiler + + Dept. of Peds./Pulm. Box 8116 ICBM-Net : Just hit St. Louis + + 400 S. Kingshighway &-6 <- User is Brain Dead... + + St. Louis, MO 63110 FAX: 314-454-2476 + + (314) 454-6076 Never will be politically correct! + + ------------------------------------------------------------------- + + REALITY.SYS - File Corrupted! Re-BOOT Universe? (Y/N)... + =========================================================================== From owner-software@net.bio.net Tue Aug 02 23:00:00 1994 Path: biosci!bcm!news.msfc.nasa.gov!europa.eng.gtefsd.com!howland.reston.ans.net!usc!nic-nac.CSU.net!csulb.edu!paris.ics.uci.edu!news.service.uci.edu!dialin33616.slip.nts.uci.edu!user From: cgochiku@e4e.oac.uci.edu (Clark Ochikubo, MD) Newsgroups: bionet.software Subject: Mac MEDLINE database organizer Followup-To: bionet.software Date: 3 Aug 1994 22:23:22 GMT Organization: Dept of Pediatrics, UC Irvine Med Center Lines: 23 Message-ID: References: NNTP-Posting-Host: dialin33616.slip.nts.uci.edu In article , cgochiku@e4e.oac.uci.edu (Clark Ochikubo, MD) wrote: > For those of you out there who have Macintoshes and are looking for a > program to organize your MEDLINE references, check out medline-hc.sit in > the Stanford archives via FTP - it's a hypercard stack I've written to do > exactly this, including reading in the abstract... > The Stanford archives are at: sumex-aim.stanford.edu /info-mac/rec/medline-hc There are also mirror sites available In addition, should be available soon on Univ. Michigan mac archives at: mac.archive.umich.edu -- Clark Ochikubo, MD Fellow, Neonatal/Perinatal Medicine Department of Pediatrics University of California at Irvine Medical Center Orange, California From owner-software@net.bio.net Wed Aug 03 23:00:00 1994 Path: biosci!MATISSE.LS.HUJI.AC.IL!igor0 From: igor0@MATISSE.LS.HUJI.AC.IL (Igor Pechersky) Newsgroups: bionet.software Subject: Protein topology representation Date: 4 Aug 1994 02:49:45 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 11 Sender: daemon@net.bio.net Distribution: world Message-ID: <9408040937.AA26432@matisse.ls.huji.ac.il> NNTP-Posting-Host: net.bio.net Hi everyone, I would appreciate any information about accessibility of protein topology software (such as TOPS, algorithm described by Flores, Moss & Thornton in Prot Eng, vol. 7 (1993) , 31-37). Thanks in advance, Igor Pechersky The Alexander Silberman Institute of Life Science The Hebrew University of Jerusalem From owner-software@net.bio.net Wed Aug 03 23:00:00 1994 Path: biosci!agate!doc.ic.ac.uk!daresbury!trane.uninett.no!sunic!news.funet.fi!zippo.uwasa.fi!freeport.uwasa.fi!okapi From: okapi@freeport.uwasa.fi (Nikolaj Pecenko) Newsgroups: bionet.software Subject: CD-ROMs Date: 4 Aug 1994 00:33:49 GMT Organization: University of Vaasa, Finland Lines: 16 Message-ID: <31pd1d$75i@zippo.uwasa.fi> NNTP-Posting-Host: freeport.uwasa.fi Hi! I would like to collect as many biology related CD-ROM titles as possible. I mean, only titles:-) I know about Multimedia Encyclopedia of Mammalian Biology (in fact I have this one and I can say it is excelent). I also know about Animals! (San Diego Zoo), Mammals (Natl. geographics), Multimedia Animals Encyclopedia and that's about it. I figure there must be some more of them, so if you know one, please let me know. Thanks. Nikolaj. -- ----------------------- Nikolaj Pecenko Biological Institute Ljubljana From owner-software@net.bio.net Wed Aug 03 23:00:00 1994 Path: biosci!daresbury!not-for-mail From: kulmburg@sun1.ukl.uni-freiburg.de (Peter Kulmburg) Newsgroups: bionet.software Subject: Plotting of cloning results Date: 4 Aug 1994 08:36:12 +0100 Lines: 42 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <31q5pc$m8b@mserv1.dl.ac.uk> X-Sender: kulmburg@skl1.ukl.uni-freiburg.de Original-To: bio-software@dl.ac.uk Dear collegues, I did a lot of transfections recently and got lots of clones. To compare the efficiency of different transfection procedures, I would like the data as follows: Imagine, I have 10 clones, where 5 produce nothing, 4 produce 1 unit and one produces 16 units. The mean is 2 units. Presentation should be like that: 16u + indicates one clone 15 14 13 12 11 10 9 8 7 6 5 4 3 2 ------ shows the mean 1 ++++ indicates four clones 0 +++++ indicates five clones How is this presentation called. And of course, are there computer programs that allow this sort of presentation. (Of course, I could do a normal scatter with cricketGraph or GraphMaster, but this gives me only one point at zero units instead of five.) Are there any free programs I could get quicklier rather then wait to buy one? Thank you very much in advance Peter Peter KULMBURG (193.196.226.110 MacName: ktl110.ukl.uni-freiburg.de) home: Tel./Fax:+49 761 808439 work: Tel.:+49 761 270/7195 Fax:/7177 From owner-software@net.bio.net Wed Aug 03 23:00:00 1994 Path: biosci!agate!library.ucla.edu!europa.eng.gtefsd.com!emory!swrinde!pipex!warwick!unicorn.nott.ac.uk!pmbcaj.nott.ac.uk!Chris.Jones From: Chris.Jones@nottingham.ac.uk (Chris Jones) Newsgroups: bionet.software Subject: "Flat tape format"? Date: Thu, 4 Aug 1994 09:47:16 Organization: Univ. of Nottingham Biochemistry Dept Lines: 10 Message-ID: NNTP-Posting-Host: pmbcaj.nottingham.ac.uk X-Newsreader: Trumpet for Windows [Version 1.0 Rev A] We use the Hitachi DNA analysis software package DNASIS and I always have trouble importing DNA files I pull off using Gopher. When I asked Hitachi they told me that I should be able to do it if I download in "flat tape format". Does anyone know what this is and how I ensure that I down load my files using it? I should saw that I use Hgopher and usually go in via the Oxford Mol Biol gopher. Thanks a lot Chris Jones From owner-software@net.bio.net Wed Aug 03 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!pipex!lyra.csx.cam.ac.uk!doc.ic.ac.uk!daresbury!daresbury!not-for-mail From: TOMASI@MVCHSS.CINECA.IT Newsgroups: bionet.software Subject: RE: ALGORITHM FOR COUNTING PEAKS Date: 3 Aug 1994 17:32:51 +0100 Lines: 53 Sender: lpddist@mserv1.dl.ac.uk Message-ID: <31ogrj$b78@mserv1.dl.ac.uk> Reply-To: TOMASI@MVCHSS.CINECA.IT Comments: CINECA.IT mail gateway X-Original-To: bio-software@dl.ac.uk, TOMASI Original-To: BIO-SOFTWARE@DL.AC.UK Michael Edelman wrote: >I've been asked to write a program that will read time-series data consisting >of counts of events per period, and output the numbers of peaks in a given >specified time interval.The Tricky part is in defining what constitutes a peak. >The researchers are using some canned package from Data Translation that does >not perform this task; they've been eyeballing the data up until now. It's been >about 16 years since I did any work in electrophysiology where I used to do >this kind of coding, so I'm at a loss where to start. >Can someone direct me to a good reference, or perhaps suggest a simple >algorithm? >We may also have to deal with a shifting baseline in the data as well. Dear Michael, there is a wealth of peak detection programs, used mainly by endocrinologists to analyze hormonal data series. None of theme is a simple routine, however. It is not easy to discriminate between noise and signal, especially in biological data, and these programs are not so objective as they purport to be, since the user has to set a number of parameters which can completely change the output of the program. The shifting baseline (as, for example, in cortisol or TSH secretion) or a zero baseline but with peaks mainly in one half of a 24-hr period (as for GH secretion) pose an additional problem. Some of the available programs are: - Detect 5.0, by Munson and Rodbard (PJM@HELIX.NIH.GOV, I believe), is an all-purpose, well known program. It is freeware, and they send you the manual as well (very useful...) - Cluster, by J.D. Veldhuis, uses a different mathematical approach (simpler) and gives comparable results. - Ultra, is a program (not IBM compatible) of which I have no details except for its name, and a reference: Computers in Endocrinology, by Forti and Guardabasso, Serono Symposia from Raven press). - Pulsar, is a program that could solve your shifting baseline problem, since it includes a routine to eliminate trends. A new version including data deconvolution (calculation of instantaneous secretion rate) was scheduled to come out this year, but I have not heard of it to date. I suggest that you ask your local endocrinologists, they may have a copy of these programs. If the above Internet address is not correct, write me again and I'll try to dig it out from my mountain of notes/photocopies. Hope I have been of some help, Paolo *********************************************************************** * Paolo Tomasi MD PhD voice: +39-79-228283 ________________ * * Ist. di Endocrinologia voice: +39-79-271692 | Sardinia - the | * * Viale S. Pietro 12 fax : +39-79-228282 | sun island | * * 07100 Sassari - Italy |________________| * * E-Mail: TOMASI@MVCHSS.CINECA.IT (preferred) * * E-Mail: UY8SSQ21@CINE88.CINECA.IT CIS: 100343.771@COMPUSERVE.COM * *********************************************************************** From owner-software@net.bio.net Wed Aug 03 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!pipex!lyra.csx.cam.ac.uk!doc.ic.ac.uk!daresbury!daresbury!not-for-mail From: kulmburg@sun1.ukl.uni-freiburg.de (Peter Kulmburg) Newsgroups: bionet.software Subject: data bases programs Date: 3 Aug 1994 16:01:33 +0100 Lines: 21 Sender: lpddist@mserv1.dl.ac.uk Message-ID: <31obgd$6us@mserv1.dl.ac.uk> X-Sender: kulmburg@skl1.ukl.uni-freiburg.de Original-To: bio-software@dl.ac.uk Dear netters, I just talked to a friend of mine who is working with Macs in Austria. He asked me whether I knew a good and performant program for data bases. It is quite nice what he wants to get out of it. it must 1) treat formatted text and numbers 2) allow large texts (>2 pages) per cell 3) deal with about 10 Mb finally 4) coordinate over 1000 data groups, each with many data fields Ouf, I do not know any program like that. Once I have been told about 4th dimension. Would it be a good program? Thank you for any information Peter Peter KULMBURG (193.196.226.110 MacName: ktl110.ukl.uni-freiburg.de) home: Tel./Fax:+49 761 808439 work: Tel.:+49 761 270/7195 Fax:/7177 From owner-software@net.bio.net Wed Aug 03 23:00:00 1994 Path: biosci!bcm!news.msfc.nasa.gov!europa.eng.gtefsd.com!library.ucla.edu!news.mic.ucla.edu!unixg.ubc.ca!hem052.terryfox.ubc.ca!user From: dixie@unixg.ubc.ca (Dixie Mager) Newsgroups: bionet.software Subject: substitution rates Followup-To: bionet.software Date: 4 Aug 1994 22:11:26 GMT Organization: Terry Fox Laboratory Lines: 5 Distribution: world Message-ID: NNTP-Posting-Host: hem052.terryfox.ubc.ca I am looking for a program that determines the rates of synonymous and nonsynonymous substititions between two sequences. My preference is for a Mac based program but I would appreciate info on anything that is available. Thanks. From owner-software@net.bio.net Wed Aug 03 23:00:00 1994 Newsgroups: bionet.software Path: biosci!bcm!news.msfc.nasa.gov!europa.eng.gtefsd.com!newsxfer.itd.umich.edu!uunet!hearst.acc.Virginia.EDU!murdoch!dayhoff.med.Virginia.EDU!wrp From: wrp@dayhoff.med.Virginia.EDU (William R. Pearson) Subject: eugene vs GB83 Message-ID: Sender: usenet@murdoch.acc.Virginia.EDU Organization: University of Virginia Date: Thu, 4 Aug 1994 18:43:27 GMT Lines: 18 The latest release of Genbank (83, but 82 may have had a problem as well) broke the part of the Eugene/SAM software package that extracts sequences from Genbank. Eugene was not prepared for a gbpri.seq file (or any other .seq) longer than 100 mbytes. The fix is simple; in the file: eugene3.3/src/programs/genbank/src/gbindex/gbindex.c change the two lines in the printf() statements that write out the .idx files to larger values. (hint: look for \t%8d\t%8d and change the 8's to 10's). Then re-index the database. Bill Pearson the last Eugene/SAM ... From owner-software@net.bio.net Wed Aug 03 23:00:00 1994 Newsgroups: bionet.software Path: biosci!agate!msuinfo!harbinger.cc.monash.edu.au!news.cs.su.oz.au!metro!rossl.wh.su.edu.au!rossl From: rossl@gmu.wh.su.edu.au (Dr. Ross Lazarus) Subject: Re: algorithm for counting peaks Message-ID: Summary: counting peaks is a black art ! Keywords: pulsar, peak counting Lines: 33 Sender: news@ucc.su.OZ.AU Nntp-Posting-Host: rossl.wh.su.edu.au Organization: Westmead Hospital, Department of Community Medicine References: <31m741$sjq@oak.oakland.edu> Date: Thu, 4 Aug 1994 02:15:08 GMT There's a whole raftload of literature on peak identification and characterization in noisy data. I'm a little familiar with the problem in the context of endocrine research into pulsatile hormone activity - typical of hormones such as LH and growth hormone in most species. Suffice it to say the problem is far from trivial ! The shifting baseline is a particular challenge. I've implemented two of the most commonly used algorithms (Veldhuis' CLUSTER and Merriam & Wachter's PULSAR) in a pc package which can cope with fairly horrible data - be warned, it's a black art. I'd be happy to discuss availability and pricing via direct email with anyone interested... In article <31m741$sjq@oak.oakland.edu> mje@pookie.pass.wayne.edu (Michael J. Edelman) writes: >From: mje@pookie.pass.wayne.edu (Michael J. Edelman) >Subject: algorithm for counting peaks >Date: 2 Aug 1994 19:34:25 GMT >I've been asked to write a program that will read time-series data consisting >of counts of events per period, and output the numbers of peaks in a given >specified time interval. The Tricky part is in defining what constitutes a peak. >The researchers are using some canned package from Data Translation that doesn't >perform this task; they've been eyeballing the data up until now. It's been >about 16 years since I did any work in electrophysiology where I used to do >this kind of coding, so I'm at a loss where to start. >Can someone direct me to a good reference, or perhaps suggest a simple algorithm? >We may also have to deal with a shifting baseline in the data as well. Dr Ross Lazarus, Head, Epidemiology and Biostatistics Unit, Community Medicine, Westmead Hospital, Westmead NSW 2145, Australia. Email: rossl@gmu.wh.su.edu.au Fax: +61 2 6891049 Tel: +61 2 6336677 From owner-software@net.bio.net Wed Aug 03 23:00:00 1994 Path: biosci!agate!library.ucla.edu!csulb.edu!nic-nac.CSU.net!usc!cs.utexas.edu!convex!news.duke.edu!news-feed-1.peachnet.edu!ukma!news.cuny.edu!mihhc From: Michael Harvey Newsgroups: bionet.software Subject: Re: gopher GIF files (fwd) Date: Thu, 4 Aug 1994 09:26:46 EDT Organization: City University of New York/University Computer Center Lines: 3 Distribution: bionet Message-ID: <94216.092646MIHHC@CUNYVM.CUNY.EDU> References: <317tpg$gm2@mserv1.dl.ac.uk> NNTP-Posting-Host: cunyvm.cuny.edu Disclaimer: Author bears full responsibility for this post I too had problems getting gif files from gopher. The solution I used was to look at the site where the files were and then transferred them using ftp. Michael From owner-software@net.bio.net Wed Aug 03 23:00:00 1994 Newsgroups: bionet.software Path: biosci!agate!library.ucla.edu!europa.eng.gtefsd.com!emory!swrinde!pipex!uknet!festival!leeds.ac.uk!news From: bmb6jrm@leeds.ac.uk (Jon Maber) Subject: Re: CAI/CBT and Internet Message-ID: Sender: news@leeds.ac.uk Organization: University of Leeds Date: Thu, 4 Aug 1994 09:43:43 GMT References: <31j9j5$98h@news.iastate.edu> X-Newsreader: Trumpet for Windows [Version 1.0 Rev A] Lines: 51 > Are any Netters aware of a Mosaic Home Page (or other >interface) that provides "online and real-time" access and >use of computer-aided instruction (CAI) or computer-based >training (CBT) sessions (of any type)? >Please respond to me, or to the list or newsgroup. I am currently developing a CAL package on the Web. It is a WWW version of A.G.Booth's Case Notes in Preclinical Biochemistry. Perhaps I should introduce myself. I work for BioNet TLTP - no relation to biosci bionet. TLTP is the U.K.'s Teaching and Learning Technology Project. Our consortium's aim is the effective implementation of CAL in our courses and dissemination of best practice. I've become interested in W3 recently and we have set up an experimental W3 service to explore ways in which it could help meet our objectives. Many of my fellow teachers are sceptical about W3 as a teaching tool because they, like me, believe that education is about far more than just soaking up information. However, although WWW is a powerful source of information, it is capable of being much more. So to convince myself that WWW can be as interactive as any other delivery platform for CAL I set about writing WWW Case Notes. Case Notes was designed by Andrew Booth (Now BioNet TLTP director) to teach Biochemistry in a Clinical Setting. Patient notes are presented and tests can be requested. The program is sensitive to the context in which information is requested and will warn or rebuke the student as appropriate. For example, if you ask for a liver biopsy before you have examined the patient you receive a stern reply. It is also possible to kill a patient. E.g. if the patient is suffereing from low blood glucose any procedures that involve fasting may be fatal. Eventually a diagnosis is possible. Keeping track of many simultaneous sessions is a real serious programming problem but it is solved and seems to work effectively. To try out the experimental WWW Case Notes patient 'Peter' go to our home page and turn off to our discussion area. URL: http://www.leeds.ac.uk/bionet.html Jon Maber From owner-software@net.bio.net Wed Aug 03 23:00:00 1994 Path: biosci!agate!library.ucla.edu!europa.eng.gtefsd.com!newsxfer.itd.umich.edu!uunet!newsfeed.ACO.net!osiris.wu-wien.ac.at!i102pc1.vu-wien.ac.at!seb From: seb@i102pc1.vu-wien.ac.at (Sebastian W. Bunka) Newsgroups: bionet.software Subject: Re: [?] UNIX sequence editor [?] Date: 4 Aug 1994 09:57:46 GMT Organization: Veterinary University Vienna Lines: 25 Message-ID: <31qe2q$j78@osiris.wu-wien.ac.at> References: <31oml2INNqr3@sat.ipp-garching.mpg.de> Reply-To: Sebastian.Bunka@vu-wien.ac.at NNTP-Posting-Host: i102pc1.vu-wien.ac.at X-Newsreader: TIN [version 1.2 PL2] : As already stated, GDE runs just fine under Linux. Unfortunately, the : executables for the latest version aren't available via ftp yet (maybe : I'll try to compile it when I have put the complete XView includes : on my machine). : --Cornelius. For all that answered my posting thanks a lot. I've found on the net GDE 2.1 for Linux and am mostly happy with this. If someone is interested: (binaries AND the required OLD Xview libs) 130.91.180.84 opened at Wed Jul 27 14:12:44 1994 megasun.bch.umontreal.ca -> "/pub/gde/linux/GDE2.0_manual.ps.z" -> "/pub/gde/linux/GDE2.1-Linux-.GDEmenus.z" -> "/pub/gde/linux/GDE2.1-Linux-bin.tar.z" -> "/pub/gde/linux/GDE2.1-Linux-help.tar.z" -> "/pub/gde/linux/GDE2.1-Linux-xview-libs.tar.z" Cheers, Sebastian [ Sebastian.Bunka@vu-wien.ac.at ] phone: FAX: +43-1-71155260 +43-1-7149110 Location: earth, europe, austria, vienna Inst. of Bacteriology Vet.Univ. From owner-software@net.bio.net Wed Aug 03 23:00:00 1994 Newsgroups: bionet.general,bionet.software,bionet.biophysics Path: biosci!bcm!news.msfc.nasa.gov!europa.eng.gtefsd.com!library.ucla.edu!csulb.edu!nic-nac.CSU.net!gopher.sdsc.edu!news.tc.cornell.edu!travelers.mail.cornell.edu!newsstand.cit.cornell.edu!news.graphics.cornell.edu!ghost.dsi.unimi.it!genes!heitor From: heitor@genes.icgeb.trieste.it (Heitor Luiz da C. Coutinho) Subject: Re: Searching for biological info-systems... Message-ID: <1994Aug4.173210.10282@genes.icgeb.trieste.it> Organization: ICGEB References: Date: Thu, 4 Aug 1994 17:32:10 GMT Lines: 9 Xref: biosci bionet.general:10581 bionet.software:8938 bionet.biophysics:359 You could also look for the following paper: - Canhos et al. Software tools and databases for bacterial systematics and their dissemination via global networks. Antonie van Leeuwenhoek 64:205-229, 1993. Regards, Heitor From owner-software@net.bio.net Wed Aug 03 23:00:00 1994 Path: biosci!cmb.bcm.tmc.edu!solovyev From: solovyev@cmb.bcm.tmc.edu (Victor V. Solovyev) Newsgroups: bionet.software Subject: (none) Date: 4 Aug 1994 16:12:58 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 190 Sender: daemon@net.bio.net Distribution: world Message-ID: <199408042312.SAA14471@dove.cellb.bcm.tmc.edu> NNTP-Posting-Host: net.bio.net Some comments about using The BCM Genefinder new service: ============================================================================ > From: bayer@darwin.med.utah.edu (Steve Bayer) > Message-Id: <9408042039.AA25499@darwin.med.utah.edu> > To: solovyev@cmb.bcm.tmc.edu > Subject: Re: New gene identification service On August 4, 2:39pm, Steve Bayer wrote: > Hi. I've tried your gene id servers with good results when comparing > the results with GRAIL and our in-house software called XPound. The > programs you have made available are very impressive. Thank you. > > However, I'm having trouble understanding the difference between the > various servers. The descriptions you posted make some of them (e.g., > FGENEH, FEXH, HEXON) appear to do the same thing. Could you please > send a little more information about how the various programs (i.e., > FGENEH, FEXH, HEXON, and HSPL) differ? Some comments about using The BCM Genefinder new service: ============================================================================ The Baylor College Of Medicine Computational Biology Group Houston, TX The services are FGENEH - search for gene structure with exons assembling by dynamic programming FEXH - search for 5'-, internal and 3'-exons HEXON - search for internal exons HSPL - search for splice sites SSP - prediction of a-helix and b-starnd segments in globular proteins. The first four program are designed for Human gene analysis, but they are still work good for Rodenta genes too. The short descriptions of the programs have been sent to BIONEWS users one week ago, and can be received from solovyev@cmb.bcm.tmc.edu. The main differences of the programs: 1. FGENEH makes exon assembling and this is very important for true gene model construction. But in a case when one of the internal exons is not predicted (for example due to sequence errors in splice site conservative positions), the final gene structure may be significantly disturbed. Therefore, it will be useful to predict the potential exons without assembling (by FEXH program) and check the difference of exons prediction. 2. Sometimes FEXH predicts 5'- and 3'-exons which win in competition with flanked internal exons. If you have a partially sequenced gene without 5'- or 3'-flanked region, you can compare results of FEXH and HEXON and get a more accurate decision. 3. Splice sites prediction will be more reliable if you will predict gene structure (FGENEH) or exons (FEXH or HEXON). But for special analysis (for example, search for alternative splicing variants) you may use splice site prediction itself (HSSP). ================================================================================= REPEAT: The Baylor College Of Medicine Computational Biology Group Houston, TX announces a new service The BCM Genefinder. The services are FGENEH, FEXH, HEXON, HSPL, and SSP. This message details FGENEH NOTE: This service is temporarily being provided through the University of Houston Gene-Server. Only two jobs will be run at a time. FGENEH Prediction of gene structure in Human DNA sequences Analysis of uncharacterized human sequences is available by sending the file containing a sequence name and a sequence (no more than 80 char/line) to service@theory.bchs.uh.edu with the subject line "FGENEH". Example: mail -s FGENEH service@theory.bchs.uh.edu < test.seq where test.seq a file with the sequence. Method description: ********************** Algorithm firstly predicts all possible potential internal exons, and potential 5' and 3'-exon for each internal by linear discriminant functions combining characteristics describing various contextual features of these exons. Then by method of dynamic programming it searches for optimal combination of these exons and construct gene model. Accuracy: ************ Accuracy have been estimated for the set of 212 complete human genes extracted from GenBank and compared with the accuracy of Grail-2 Email server for the same data set. It must be noted that these sequences are not independent from the "Fgeneh" and "Grail-2" training data. Test1 contains the nucleotide sequences from -150 bp before the first coding region and until +150 bp after the last coding region. Test2 contains nucleotide sequences of whole GenBank entries. Test1: Fgeneh Grail-2 Test2: Fgeneh Grail-2 Exact exons 80% 39% 73% 39% Exon nucleotides 91%(0.88) 76%(0.74) 90%(0.82) 73%(0.75) The numbers in () are the correlation coefficients. For exon prediction in partially sequenced genes you can use "fexh" (5'-, internal and 3'-exon prediction) and "hexon" (internal exon prediction), see below. Submitting sequences via email: ******************************* For email submission the sequences must have the following format: Name of your sequence ccatctctgtcttgcaggacaatgccgtcttctgtctcgtggggcatcctcctgctggca ggcctgtgctgcctggtccctgtctccctggctgaggatccccagggagatgctgcccag aagacagatacatcccaccatgatcaggatcacccaaccttcaacaagatcacccccaac ctggctgagttcgccttcagcctataccgccagctggcacaccagtccaacagcaccaat atcttcttctccccagtgagcatcg............... (Restrict the line length to 80 characters or less). You have to send the file containing the sequence to: service@theory.bchs.uh.edu Subject line must be: FGENEH Example: mail -s FGENEH service@theory.bchs.uh.edu < test.seq Fgeneh output: **************** 1st line - name of your sequence 2nd line - length of your sequence 3d line - number of potential exons 4th line and next - positions of predicted exons For example: HUMALPHA 4556 bp ds-DNA PRI 15-SEP-1 length of sequence - 4556 number of potential exon: 10 380 - 516 611 - 727 839 - 954 1147 - 1321 1819 - 1953 2053 - 2125 2254 - 2388 2470 - 2661 2881 - 2997 3120 - 3562 Reference: 1. Solovyev V.V.,Salamov A.A., Lawrence C.B. Predicting internal exons by oligonucleotide composition and discriminant analysis of spliceable open reading frames. (Nucl.Acids Res.,1994, in press). 2. Solovyev V.V., Salamov A.A. , Lawrence C.B. The prediction of human exons by oligonucleotide composition and discriminant analysis of spliceable open reading frames. in: The Second International conference on Intelligent systems for Molecular Biology (eds. Altman R., Brutlag D., Karp R., Latrop R. and Searls D.), AAAI Press, Menlo Park, CA (1994, in press) 3. Solovyev,V., Lawrence,C.B. Prediction of human gene structure using dynamic programming and oligonucleotide composition. In: Abstracts of the 4th annual Keck symposium. Pittsburgh, 47,1993. Problems, comments, and suggestions: can be mailed to solovyev@cmb.bcm.tmc.edu. From owner-software@net.bio.net Thu Aug 04 23:00:00 1994 Newsgroups: bionet.software Path: biosci!agate!howland.reston.ans.net!europa.eng.gtefsd.com!library.ucla.edu!news.ucdavis.edu!nguyenj From: nguyenj@cs.ucdavis.edu (John Hanh Nguyen) Subject: Re: OLGCG.....the GUI for the GCG program....who has it!!?! Message-ID: Sender: usenet@ucdavis.edu (News Guru) Organization: University of California, Davis X-Newsreader: TIN [version 1.2 PL2] References: <9408050336.AA00695@nick.med.usf.edu> Date: Fri, 5 Aug 1994 16:53:41 GMT Lines: 32 Gregory Quinn Ph.D. (gquinn@NICK.MED.USF.EDU) wrote: : Does anyone have any more info on OLGCG, the GUI for GCG. : I have Emailed Scott Sammons at Emory (bcresas@bimcore.emory.edu) for some : information on this, but have heard nothing yet. : Does anyone know any more about this? Yes, I sent him email on this matter a while back. Here is a little cut and paste of Scott's response: ____________________________________________________________ Our GUI was written in C for Solaris 2.3 using a developers program called devGuide. It uses the OPENLOOK interface (which seemed like a good choice at the time, but which Sun is dropping support for) and the Xview library. Be aware that GCG is about to release version 8 (within the next couple of months) of their software which includes a motif-based GUI that will work on several platforms (VAX, SGI, Solaris). I currently have a beta copy and it does seem to include all the functionality that ours has. ______________________________________________________________ If you have access to mosaic, you can use this address to get more information: http://bimcore.emory.edu/bimcore_information_page.html John N From owner-software@net.bio.net Thu Aug 04 23:00:00 1994 Path: biosci!NICK.MED.USF.EDU!gquinn From: gquinn@NICK.MED.USF.EDU (Gregory Quinn Ph.D.) Newsgroups: bionet.software Subject: OLGCG.....the GUI for the GCG program....who has it!!?! Date: 4 Aug 1994 20:40:07 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 9 Sender: daemon@net.bio.net Distribution: world Message-ID: <9408050336.AA00695@nick.med.usf.edu> NNTP-Posting-Host: net.bio.net Does anyone have any more info on OLGCG, the GUI for GCG. I have Emailed Scott Sammons at Emory (bcresas@bimcore.emory.edu) for some information on this, but have heard nothing yet. Does anyone know any more about this? Thanks Quinn From owner-software@net.bio.net Thu Aug 04 23:00:00 1994 Path: biosci!bcm!news.msfc.nasa.gov!europa.eng.gtefsd.com!newsxfer.itd.umich.edu!uunet!sparky!docman.doc.state.ne.us!news.nde.state.ne.us!in22.esu18.k12.ne.us!sferris From: G. Steven Ferris Newsgroups: bionet.software Subject: Re: CD-ROMs Date: 5 Aug 1994 19:22:13 GMT Organization: Lincoln (NE) High School / Science Lines: 21 Distribution: world Message-ID: <31u3h5$gdc@news.nde.state.ne.us> References: <31pd1d$75i@zippo.uwasa.fi> NNTP-Posting-Host: 162.127.183.22 X-Newsreader: Nuntius Version 1.2 X-XXMessage-ID: X-XXDate: Fri, 5 Aug 1994 20:37:42 GMT In article <31pd1d$75i@zippo.uwasa.fi> Nikolaj Pecenko, okapi@freeport.uwasa.fi writes: >I would like to collect as many biology related CD-ROM titles as possible. >I mean, only titles:-) >I know about Multimedia Encyclopedia of Mammalian Biology (in fact I have this >one and I can say it is excelent). I also know about Animals! (San Diego Zoo), >Mammals (Natl. geographics), Multimedia Animals Encyclopedia and that's about >it. >I figure there must be some more of them, so if you know one, please let me know. Thanks. Greetings from the Great Plains of North America. You might consider the CIA World Fact Book CD-ROM (ca $39.00) for bio-geographical information, the TimeLine of Science and Technology (ca $50.00) for earth history and tech-history, and the Mayo Family Health Book CD-ROM (ca $70.00) for human biology/health information. Good luck to you! From owner-software@net.bio.net Thu Aug 04 23:00:00 1994 Path: biosci!rutgers!gatech!howland.reston.ans.net!news.cac.psu.edu!news.tc.cornell.edu!travelers.mail.cornell.edu!newsstand.cit.cornell.edu!news.graphics.cornell.edu!ghost.dsi.unimi.it!univ-lyon1.fr!swidir.switch.ch!scsing.switch.ch!sun.rediris.es!obelix.cica.es!news From: bb1dopeg@lucano.uco.es (Gabriel Dorado) Newsgroups: bionet.software Subject: Lasergene (DNAStar) on an AWS 95 (A/UX) machine Date: 4 Aug 1994 22:13:52 GMT Organization: Centro Informatico Cientifico de Andalucia Lines: 10 Sender: -Not-Authenticated-[3387] Message-ID: <31rp70$8fg@obelix.cica.es> NNTP-Posting-Host: macta.uco.es X-Posted-From: InterNews 1.0.1@macta.uco.es Xdisclaimer: No attempt was made to authenticate the sender's name. I am about to implement an EtherNet network of Lasergene (DNAStar) running from an Apple Workgroup Server 95 (AWS 95) with A/UX operating system. I would like to know if there is any similar network installed somewhere, as well as the number of simultaneous users it can support performing database searches. Thanks a lot for your help! Gabriel Dorado Internet Email: bb1dopeg@lucano.uco.es From owner-software@net.bio.net Thu Aug 04 23:00:00 1994 Path: biosci!biosci!not-for-mail From: kckim@phantom.com (Kim Konrad) Newsgroups: bionet.software,bionet.cellbiol,bionet.general,bionet.molbio.methds-reagnts,bionet.software.acedb,bionet.software.gcg Subject: Scanning Cell Culture Colonies Date: 5 Aug 1994 15:35:48 -0700 Organization: [MindVox] / Phantom Access Technologies / (+1 800-MindVox) Lines: 14 Sender: kristoff@net.bio.net Distribution: world Message-ID: <31u5n2$r52@dockmaster.phantom.com> NNTP-Posting-Host: net.bio.net Xref: biosci bionet.software:8949 bionet.cellbiol:788 bionet.general:10597 bionet.molbio.methds-reagnts:16997 bionet.software.acedb:370 bionet.software.gcg:692 Hi, I'm wondering if there exisits scanning software(for Mac or PC) to count colonies on a given cell culture bottle. This is especially helpful if one counts large amounts of cell cultures colonies. Tell me what you use and what's the best (fastest, most functions, can export to favorite spreadsheet) on the market. Thanks, all suggestions are welcome. :) Konrad C. Kim Senior Lab Tech From owner-software@net.bio.net Thu Aug 04 23:00:00 1994 Newsgroups: bionet.software Path: biosci!CS.Arizona.EDU!rainbow.cse.nau.edu!nauvax.ucc.nau.edu!schupp From: schupp@nauvax.ucc.nau.edu Subject: RE: Win3.1 software to produce bar graphs with I-beam markers? Message-ID: <5AUG94.11505833@nauvax.ucc.nau.edu> Sender: news@rainbow.cse.nau.edu (Usenet News (system)) Nntp-Posting-Host: nauvax.ucc.nau.edu Organization: Northern Arizona University References: <31c028$su9@nellie.musc.edu> Date: Fri, 5 Aug 1994 11:50:58 GMT Lines: 2 Have you looked at Freelance for Win.2.01? From owner-software@net.bio.net Thu Aug 04 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!news.cac.psu.edu!news.pop.psu.edu!ra.nrl.navy.mil!usenet From: mcfarlan@seas.gwu.edu (Daniel McFarlane) Newsgroups: bionet.software Subject: NervousSystem: Neuron Modeling & Simulation Tool Date: 5 Aug 1994 22:39:38 GMT Organization: George Washington University Lines: 103 Sender: mcfarlan@itd.nrl.navy.mil Message-ID: <31uf3a$5np@ra.nrl.navy.mil> NNTP-Posting-Host: xoxo.itd.nrl.navy.mil X-Posted-From: InterNews 1.0.1@xoxo.itd.nrl.navy.mil X-Authenticated: mcfarlan on Unix host itd.nrl.navy.mil We announce the release for free distribution of "NervousSystem 1.0.gwu"; a neuron modeling and simulation environment for Apple Macintosh computers (application, source code, and documentation). "NervousSystem" is a useful context for learning/teaching two popular topics: computational neuroscience, and object-oriented programming within a framework. Here are the contents of the "Read Me" file. *** ANNOUNCING: *** NervousSystem 1.0.gwu -- Neuron Modeling and Simulation Environment for Apple Macintosh *** WHAT: *** NervousSystem is an exciting new simulation tool for exploring the behavior of networks of neurons, based on a biological model. 1. Application (Apple Macintosh computers); 2. User's Guide (MS Word format); 3. Source Code & Project File (OOP using the Think Class Library Framework); 4. Programmer's Guide (MS Word format). *** WHY (For Computational Neuroscience): *** NervousSystem has the following attractive properties for investigating a biologically based model of neurons and networks of neurons. 1. free; 2. it is VERY easy to learn and use (direct manipulation interaction style); 3. "easily" expandable and customizable because of well structured OOP source code; 4. free. *** WHY (For Computer Science): *** NervousSystem has the following attractive properties for learning direct-manipulation object-oriented programming within a framework. 1. free; 2. elegant direct-manipulation solution; 3. employs "Model-View-Controller" paradigm; 4. popular OOP language, C++ (Think Class Objects); 5. popular framework (Think Class Library); 6. popular, and inexpensive, development tools (Think C v.5, and AppMaker); 7. well crafted by OOP experts (two doctoral student in human-computer interaction at George Washington University); 8. robust, ample structure, supports expansion and reuse; 9. free. *** WHERE: *** This software is now available by anonymous ftp from Info-Mac, "sumex-aim.stanford.edu", in the directory, "sci". The file is named "nervous-system-10.hqx". I suggest copying NervousSystem from a mirror site, sumex is often too busy (for example, "grind.isca.uiowa.edu" "mac/infomac/sci/nervous-system-10.hqx"). *** WHEN: *** Now!! (as of July 1994) *** HOW: *** It's free (and for non-profit use) -- Copy it by anonymous ftp! "NervousSystem.sea" is a self-extracting compressed file. After copying it to your local directory, double click on it. "NervousSystem.1.0.gwu.sea" will self-extract into a folder named "NervousSystem". The application, source, user's guide, programmer's guide, and "Read Me" are located within this folder. *** WHO: *** Daniel C. McFarlane The Naval Research Laboratory, Code 5513 Human-Computer Interaction Lab 4555 Overlook Ave., N.W. Washington, D.C. 20375-5337 mcfarlan@seas.gwu.edu (internet address) Joe Geigel Pittsburgh Supercomputing Center BioMedical Group *** DETAILS: *** We release these NervousSystem products under the terms of the GNU General Public License Version 2 as published by the Free Software Foundation, Inc., 675 Massachusetts Ave., Cambridge, MA 02139, 617-876-3296. (A copy of this license is included in the Programmer's Guide.) Please feel free to redistribute it as you see fit (according to the provisions of the GNU General Public License). Copyright (c) 1994, Daniel C. McFarlane and Joe Geigel. We hope that you will find this program useful. However, there is NO WARRANTY WHATEVER. We do not offer any warranty or guarantee of any kind, implied or otherwise. The uncompressed "NervousSystem" folder will require about 5MB of hard disk space. I am curious about the future of NervousSystem. If you copy it, and are interested in it, please send me a note at mcfarlan@seas.gwu.edu and just let me know who you are. From owner-software@net.bio.net Thu Aug 04 23:00:00 1994 Newsgroups: bionet.general,bionet.software,bionet.biophysics Path: biosci!agate!howland.reston.ans.net!gatech!newsxfer.itd.umich.edu!uunet!emba-news.uvm.edu!brianf From: brianf@med.uvm.edu (Brian Foley) Subject: Re: Searching for biological info-systems... Message-ID: <1994Aug5.194332.25220@emba.uvm.edu> Followup-To: bionet.general,bionet.software,bionet.biophysics Sender: news@emba.uvm.edu Organization: EMBA Computer Facility, University of Vermont X-Newsreader: TIN [version 1.2 PL1] References: Date: Fri, 5 Aug 1994 19:43:32 GMT Lines: 19 Xref: biosci bionet.general:10596 bionet.software:8947 bionet.biophysics:360 Alexander Schuetzle (schuetzl@hermes.informatik.uni-stuttgart.de) wrote: : I have some questions about biological databases. What you want to find is LiMB: The list of Molecular Biology databases. Last I knew it was being updated regularly by Gifford Keen of Los Alamos National Laboratories. Recent releases of LiMB are available via GOPHER or FTP from the Indiana University Archives (ftp to fly.bio.indiana.edu or gopher to IUBIO) and also available at the NCBI. If you have trouble getting it, write to me, and I'll mail you a copy. -- ******************************************************************** * Brian Foley * If we knew what we were doing * * Molecular Genetics Dept. * it wouldn't be called research * * University of Vermont * * ******************************************************************** From owner-software@net.bio.net Fri Aug 05 23:00:00 1994 Path: biosci!WUDCM.WUSTL.EDU!KEN From: KEN@WUDCM.WUSTL.EDU ("Ken Boschert") Newsgroups: bionet.software Subject: CHANGED LIST: VETINFO (Veterinary Informatics) Date: 5 Aug 1994 18:04:14 -0700 Organization: Washington Univ. - Comparative Med. Lines: 116 Sender: daemon@net.bio.net Distribution: world Message-ID: <6D329B23B21@wudcm.wustl.edu> NNTP-Posting-Host: net.bio.net Pardon the multiple cross-postings....kb ****** The VETINFO (Veterinary Informatics Mailing List) has moved to a new location. New subscription information is detailed below. New subscribers must complete directory information prior to acceptance on the list. -------------------------------------------------------------------------- VETINFO Veterinary Informatics Discussion List VETINFO is an Internet mailing list for discussing the topics of veterinary medical informatics and uses of computers in veterinary medicine. Generally, the target audience includes: veterinarians, researchers, computer staff professionals at veterinary hospitals, veterinary medical record professionals, interested management and staff at veterinary institutions, veterinary students, and interested members of the lay public. Subject matter may include: informatics, clinical decision support systems, laboratory information management, imaging, disease nomenclature and coding systems, expert systems, knowledge bases, meeting announcements, research issues, information requests, job notices, graduate fellowships, equipment exchange, news items, grant information, new books or book reviews. Discussions related to specific hardware and software implementations are welcome, as well as specific approaches to challenges in veterinary informatics. The primary emphasis of discussion on this list is to stimulate discussion in the area of Informatics, with special reference to the field of Veterinary Medicine. VETINFO is *NOT* the appropriate list to discuss general veterinary medicine. For those issues, we refer you to the VETMED-L list at . Also, the primary list to discuss issues surrounding Veterinary Hospital Information Systems is the VETHIS-L list at , although this topic may also be included on VETINFO. VETINFO is hosted by the Washington University Division of Comparative Medicine in St. Louis, Missouri. This is a LISTSERV-managed list, so normal subscription instructions apply as follows. To subscribe to the VETINFO mailing list, send e-mail to: LISTSERV@WULIST.WUSTL.EDU with the BODY of the mail consisting of the following command (the command MUST be in the BODY, NOT the subject): SUBscribe VETINFO Yourfirstname Yourlastname (Example) SUBscribe VETINFO John Doe You should receive a message acknowledging your subscription request. Upon review, you will be added to the list and begin receiving messages from the VETINFO discussion group. ***************************************************************** To send a message to the list, so that everyone can read it, use the address: VETINFO@WULIST.WUSTL.EDU To send administrative requests to the list manager, use the address: LISTSERV@WULIST.WUSTL.EDU ***************************************************************** VETINFO archives and related files are stored in the VETINFO FILELIST. To receive a list of files, send the command INDEX VETINFO in the body of an email message to: LISTSERV@WULIST.WUSTL.EDU All VETINFO archives may also be searched at the following Gopher and World Wide Web Servers: NETVET Veterinary Resources Gopher Server URL: gopher://netvet.wustl.edu:70/11n:/vet NETVET Veterinary Resources World Wide Web Server URL: http://netvet.wustl.edu/ ***************************************************************** Join your colleagues online and contribute to: VETINFO - Veterinary Informatics Discussion List ------- ---- ------ VETINFO List Owners ------- ---- ------ Ken Boschert, DVM Associate Director Washington University Division of Comparative Medicine Box 8061, 660 South Euclid Ave. St. Louis, Missouri 63110 Phone: 314-362-3700 Fax: 314-362-6480 E-Mail Addresses: ken@wudcm.wustl.edu (Main E-Mail address) ken.boschert@aalas.org (LABBS-AALAS address) 74431.2545@compuserve.com (NOAH-CompuServe address) kenb52@aol.com (VIN-AOL address) Jim Case, DVM, Ph.D Head, Information Systems California Veterinary Diagnostic Laboratory System University of California School of Veterinary Medicine P.O. Box 1770 Davis, California 95617 Phone: 916-752-4408 Fax: 916-752-5680 E-Mail Addresses: jcase@gypsy.ucdavis.edu (Main E-Mail address) 74232.31@compuserve.com (NOAH-CompuServe address) jimcase@aol.com (VIN-AOL address) ============================================================================= ### From owner-software@net.bio.net Fri Aug 05 23:00:00 1994 Path: biosci!CUHHCA.HHMI.COLUMBIA.EDU!wpdb From: wpdb@CUHHCA.HHMI.COLUMBIA.EDU (WPDB Account) Newsgroups: bionet.software Subject: WPDB v1.0 Available Date: 6 Aug 1994 06:06:59 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 78 Sender: daemon@net.bio.net Distribution: world Message-ID: <9408061303.AA02125@cuhhca.hhmi.columbia.EDU> NNTP-Posting-Host: net.bio.net ------------------------------------------------------ WPDB - PC-based Macromolecular Structure Interrogation Version 1.0 Available ------------------------------------------------------ WPDB (the Protein Data Bank through Microsoft Windows) is a macromolecular structure query and analysis tool designed to complement rendering tools such as Raswin and Kinemage. Typical uses ------------ o Analysis of protein-protein and protein-ligand interactions using the three-level zooming feature of the contact map viewer and the residue selection feature of the 3D-viewer. o Analysis of internal interactions in proteins to reveal different folds (e.g. helix-helix hydrophobic stacking, 4-helix bundle) using contact map, hydrophobicity profile and secondary structure selection feature in 3D-view. o Analysis of sequence-structure correlations using sequence search and static property profiles. o Analysis of thermal motion using dynamic property profiles. o Locate structures based on string searches of combinations of PDB record types and/or sequence patterns. To take a peek -------------- http://cuhhca.hhmi.columbia.edu/wpdb.html How to get it? ------------- 1. Anonymous ftp to cuhhca.hhmi.columbia.edu (128.59.98.1). 2. Change directory to /pub/programs/WPDB/doc. 3. Get the file install. 4. Follow instructions in the install file. Note: Two compressed databases are available: (i) random selection of 100 structures; (ii) "unique" structures (320) as defined by Hobohm and Sander. The README file in /pub/programs/WPDB/doc describes how to get the software to build your own database. Please send questions/comments/criticisms to wpdb@cuhhca.hhmi.columbia.edu Some features ------------- o 20-fold compression of PDB files (minus REMARK records). o Real-time query based on text string searches of PDB record types and sequence. o Clickable contact map with three levels of zooming for analyzing intra- and inter-molecular interactions: level 1 - molecules, level 2 - fragments, level 3 - atoms. o Clickable profile with two levels of zooming to examine static properties (volume, polarity, isoelectric point, hydrophobicity, mean exposure) and isotropic temperature factor. o 3D rendering tool with special capabilities for easy selection of substructures and fragments by specifying chains, secondary structure, residues (by location or name). o Interoperability between display tools (3-D renderer, contact maps and profile), i.e. selection made in one object will be propagated to other visible display objects. For example selecting a close contact in a contact map will be highlighted in the structure. o Secondary structure analysis according to Kabsch and Sander. o Comprehensive manual and Windows-based help. o A hook to the more advanced display features of Raswin. Hardware/software requirements ------------------------------ Intel 486/33 processor or above with a color monitor, 4MB RAM or better, and Windows. WPDB was designed, written and produced by Ilya Shindyalov and Phil Bourne. ---------------------------------- From owner-software@net.bio.net Fri Aug 05 23:00:00 1994 Path: biosci!CC.IITB.ERNET.IN!chyusia From: chyusia@CC.IITB.ERNET.IN Newsgroups: bionet.software Subject: query on programs like DISMAN DIANA etc Date: 5 Aug 1994 23:41:53 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 13 Sender: daemon@net.bio.net Distribution: world Message-ID: <940806120806347-MTACYBER*chyusia@cc.iitb.ernet.in> NNTP-Posting-Host: net.bio.net dear netters, i would like to know if programs like DISMAN, DIANA,DISGEO meant for distance geometry calculations work on PCs (PC 486). if so what are the hard ware requirements. also i would be very thankful if somebody would tell me where i could get programs like ECEPP/2 (hydration shell model included). this would be of a great help to me for studying the conformational features of small peptides. thanking you in advance ramkrishna graduate student email: rama@cc.iitb.ernet.in From owner-software@net.bio.net Fri Aug 05 23:00:00 1994 Newsgroups: bionet.general,bionet.molbio.genome-program,bionet.software Path: biosci!agate!library.ucla.edu!europa.eng.gtefsd.com!gatech!swrinde!pipex!sunic!trane.uninett.no!eunet.no!nuug!EU.net!uunet!emba-news.uvm.edu!brianf From: brianf@med.uvm.edu (Brian Foley) Subject: Re: Searching for standards ... Message-ID: <1994Aug6.222442.29931@emba.uvm.edu> Followup-To: bionet.molbio.genome-program Sender: news@emba.uvm.edu Organization: EMBA Computer Facility, University of Vermont X-Newsreader: TIN [version 1.2 PL1] References: Date: Sat, 6 Aug 1994 22:24:42 GMT Lines: 42 Xref: biosci bionet.general:10605 bionet.molbio.genome-program:893 bionet.software:8954 Alexander Schuetzle (Schuetzle@informatik.uni-stuttgart.de) wrote: : Hi all, : I have some questions about standardisation efforts in the : genom research (biology). : Are there any exact and unique definitions (syntax) for : the dataobjects ( like genes, chromosomes, . . . ) in the : genom research? : Are there some kinds of methods to handle these objects, i.e. : how to represent ( graphical, textual, ...) them and so else? : If you know some (de facto) standards or conventions please : inform me or give some hints where I can get some further : informations! Well GenBank at NCBI (the United States National Center for Biotechnology Information) has ONE set of standards and routines for using them. I beleive they collaborate with some of the Genome Databases in developing these standards, but I'm not absolutely sure that they do. The people who run OMIM, GDB and other databases may have different standards and routines. For GenBank information: The DDBJ/EMBL/GenBank Feature Table: Definition, Version 1.06, World Wide Web Universal Record Locator (URL) ftp://ncbi.nlm.nih.gov/ncbi-genbank/docs Also avaiable there are a set of C progamming language routines for dealing with "objects" defined in the ASN.1 documents. -- ******************************************************************** * Brian Foley * If we knew what we were doing * * Molecular Genetics Dept. * it wouldn't be called research * * University of Vermont * * ******************************************************************** From owner-software@net.bio.net Sat Aug 06 23:00:00 1994 Path: biosci!news.ohsu.edu!rootd From: rootd@ohsu.edu (Darrell Root) Newsgroups: bionet.software Subject: Re: MacTCP Tool version Date: 7 Aug 1994 22:59:41 GMT Organization: Oregon Health Sciences University Lines: 24 Message-ID: <323p0t$pca@steele.ohsu.edu> References: <31o5luINNgd3@sat.ipp-garching.mpg.de> NNTP-Posting-Host: 137.53.1.40 > A popular way to get a recent copy of MacTCP in the U.S. is to buy the > book The Internet Starter Kit by Adam Engst. It's got a Macintosh disk > with Mosaic and other Internet tools that require MacTCP. The internet starter kit is a great way to get the MacTCP stuff. Be advised, however, that NCSA just released revision 6 of their alphatest macmosaic client (revision 2 had many problems, revision 3 caused hard crashes and was removed from the ftp site, revisions 4 and 5 were never released to the public--just last week revision 6 came out). I haven't installed MacMosaic revision 6 yet, but I hope it's more stable than the revision-2's I've seen. My point is, if you get the Internet starter kit, I'll bet it has an old version of macMosaic, and that you might want to pick up a more recent one (anonymous ftp from ftp.ncsa.uiuc.edu). Darrell Root rootd@ohsu.edu From owner-software@net.bio.net Sat Aug 06 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!usc!nic-nac.CSU.net!charnel.ecst.csuchico.edu!rat!decwrl!netcomsv!netcomsv!cowpoke.biodata.com!mac114.biodata.com!user From: vern@BioData.COM (Vernon Keenan) Newsgroups: bionet.software Subject: Re: MacTCP Tool version Date: 6 Aug 1994 18:13:03 GMT Organization: BioData, Inc. (San Mateo, CA) Lines: 34 Message-ID: References: <31o5luINNgd3@sat.ipp-garching.mpg.de> NNTP-Posting-Host: mac114.biodata.com In article <31o5luINNgd3@sat.ipp-garching.mpg.de>, jiang@alf.biochem.mpg.de (Weiping Jiang) wrote: > Hi, there! > > Is the version(MacX 1.2) of the communication tool(MacTCP Tool) for Macintosh > current? Is MacTCP Tool(MacX 1.2) a free software? Where can I get it? The current version of MacTCP is 2.0.4. I suspect the version you have (1.2) works OK, but it has a rather serious bug in Domain Name Service. This makes Mosaic and other neato Internet programs crash. When System 7.5 for Macintosh comes out it will have the latest version of MacTCP built into the operating system (finally!). Until then, any Apple authorized reseller can order TCP/IP Connection from the Apple price list for you. The list price is only US$25 or so. Note that this defies the popular myth you can't really get MacTCP from Apple resellers. In fact, a 20 user pack is only around US$125 and you get SNMP agents to boot! A popular way to get a recent copy of MacTCP in the U.S. is to buy the book The Internet Starter Kit by Adam Engst. It's got a Macintosh disk with Mosaic and other Internet tools that require MacTCP. Vern -- --------------------------------------------------------------------- | Vernon Keenan | BioData, Inc. | | President | 1828 South Grant Street Suite 820 | | Phone: +1 415-513-8950 | San Mateo, California 94402 | | E-Mail: vern@BioData.COM | WWW: http://www.biodata.com/ | --------------------------------------------------------------------- From owner-software@net.bio.net Sun Aug 07 23:00:00 1994 Path: biosci!daresbury!not-for-mail From: ajb@seqnet.dl.ac.uk Newsgroups: bionet.software Subject: PRIMER: melting points Date: 8 Aug 1994 12:08:37 +0100 Lines: 8 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <3253nl$ftn@mserv1.dl.ac.uk> Original-To: bio-soft@dl.ac.uk Does anyone have a citation for the basis of the melting point calculation used in the PRIMER program? Thanks in Advance Alan Bleasby daresbury From owner-software@net.bio.net Sun Aug 07 23:00:00 1994 Path: biosci!agate!msuinfo!harbinger.cc.monash.edu.au!newshost.anu.edu.au!helios!ingrid From: ingrid@helios.anu.edu.au (Ingrid Jakobsen) Newsgroups: bionet.software Subject: Blast alignments (was: multiple alignment resource needed) Date: 8 Aug 1994 01:07:31 GMT Organization: Australian National University Lines: 24 Sender: ingrid@helios (Ingrid Jakobsen) Distribution: world Message-ID: <3240gj$t4@manuel.anu.edu.au> References: NNTP-Posting-Host: 150.203.7.83 In article , dh30@pop.th-darmstadt.de (Bernhard Seehaus) writes: .... |> I often wonder why you can«t specify a(some) certain acession number(s) |> instead of whole databases when performing e.g. a blast search at NCBI. The |> problem is I can«t see some interesting alignments due to sequences |> occuring only in the score list but not as aligned sequences. |> |> Any help is highly appreciated, thanks in advance |> |> Bernhard Seehaus |> Institut of biochemistry |> University of Darmstadt |> Germany |> e-mail dh30@pop.th-darmstadt.de I can deal with that one, you change the setting for the number of alignments to display. But when I have over 700 matches, and I'm not interested in the first 500 alignments (because they are so obvious I can do them by hand), then I wish, like Bernhard, that I could see the alignments for only a subset of the matches. Perferably the matches near the end. Cheers, Ingrid From owner-software@net.bio.net Sun Aug 07 23:00:00 1994 Newsgroups: bionet.software Path: biosci!rutgers!koriel!cs.utexas.edu!howland.reston.ans.net!europa.eng.gtefsd.com!newsxfer.itd.umich.edu!uunet!arris!diachun From: diachun@arris.com (Justin Diachun) Subject: Re: MacTCP Tool version Message-ID: Sender: usenet@arris.com Nntp-Posting-Host: oyster.arris.com Organization: Arris Pharmaceutical Corp. References: <31o5luINNgd3@sat.ipp-garching.mpg.de> Date: Mon, 8 Aug 1994 22:27:14 GMT Lines: 25 In article vern@BioData.COM (Vernon Keenan) writes: >In article <31o5luINNgd3@sat.ipp-garching.mpg.de>, >jiang@alf.biochem.mpg.de (Weiping Jiang) wrote: > >> Hi, there! >> >> Is the version(MacX 1.2) of the communication tool(MacTCP Tool) for Macintosh >> current? Is MacTCP Tool(MacX 1.2) a free software? Where can I get it? > >The current version of MacTCP is 2.0.4. I suspect the version you have >(1.2) works OK, but it has a rather serious bug in Domain Name Service. >This makes Mosaic and other neato Internet programs crash. I found that our version of MacX came with MacTCP 2.00, but there is an update program available for ftp from ftp.austin.apple.com that will upgrade 2.00 or 2.02 up to 2.04. The URL to download it is: ftp://ftp.austin.apple.com/Apple.Support.Area/Apple.Software.Updates/Net.and.Comm.SW/MacTCP.2.0.4.Update/MacTCP.2.0.4.sea.Hqx -- Justin Diachun diachun@arris.com System Administrator Arris Pharmaceutical From owner-software@net.bio.net Sun Aug 07 23:00:00 1994 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!gatech!concert!bigblue.oit.unc.edu!plc From: plc@med.unc.edu (Philip L. Carl) Newsgroups: bionet.software Subject: Logit software Date: 8 Aug 1994 19:51:32 GMT Organization: UNC-CH School of Medicine Lines: 2 Distribution: world Message-ID: <3262c4$ivn@bigblue.oit.unc.edu> NNTP-Posting-Host: cahaba.med.unc.edu Originator: plc@cahaba Phil Carl From owner-software@net.bio.net Sun Aug 07 23:00:00 1994 Newsgroups: bionet.software Path: biosci!agate!howland.reston.ans.net!pipex!sunic!news.lth.se!news.lu.se!bosse-q840.wblab.lu.se!Bo.Servenius From: Bo Servenius Subject: Kabat database via www??? Message-ID: <1994Aug8.135144.23345@nomina.lu.se> X-Xxmessage-Id: X-Xxdate: Mon, 8 Aug 94 15:46:42 GMT Sender: news@nomina.lu.se (USENET News System) Nntp-Posting-Host: bosse-q840.wblab.lu.se Organization: Lund university, Sweden X-Useragent: Version 1.1.3 Date: Mon, 8 Aug 1994 13:51:44 GMT Lines: 5 Do anyone know if the Kabat database is awailable via www? yours BOSSE From owner-software@net.bio.net Mon Aug 08 23:00:00 1994 Path: biosci!bcm!news.msfc.nasa.gov!europa.eng.gtefsd.com!howland.reston.ans.net!usenet.ins.cwru.edu!axa12-slip.cwru.edu!ashok From: ashok@biochemistry.cwru.edu (Ashok Aiyar) Newsgroups: bionet.software Subject: Network Entrez for Linux available Date: Tue, 9 Aug 1994 00:49:11 GMT Organization: Department of Biochemistry, Case Western Reserve University Lines: 29 Distribution: bionet Message-ID: NNTP-Posting-Host: axa12-slip.dialin.cwru.edu X-Newsreader: Trumpet for Windows [Version 1.0 Rev B final beta #1] NCBI Entrez version 2.011 is now available for Linux. This is an unsupported release. The Linux port was kindly developed by Jonathan Epstein (epstein@gold.nlm.nih.gov). System requirements: Linux (kernel version 1.0.x and above) XFree86 installed correctly This release has statically compiled Motif libraries, so you need not purchase Motif in order to run Entrez. The files can be ftped from: mirage.bioc.cwru.edu as /pub/linux.tar.Z and ncbi.nlm.nih.gov along with other Entrez distributions. Later, Ashok -- Ashok Aiyar Mail: ashok@biochemistry.cwru.edu Department of Biochemistry Tel: (216) 368-3300 CWRU School of Medicine, Cleveland, Ohio Fax: (216) 368-4544 MIME Enclosures OK From owner-software@net.bio.net Mon Aug 08 23:00:00 1994 Path: biosci!galaxy.ucr.edu!usenet From: learn@smaug.ucr.edu (Jerry Learn) Newsgroups: bionet.software Subject: Re: NetEntrez crashing Sun X! Date: 9 Aug 1994 16:45:36 GMT Organization: University of California, Riverside Lines: 41 Distribution: world Message-ID: <328brg$mob@galaxy.ucr.edu> References: <1994Aug9.110804.34058@hulaw1.harvard.edu> Reply-To: learn@smaug.ucr.edu NNTP-Posting-Host: smaug.ucr.edu In article 34058@hulaw1.harvard.edu, robison@lipid.harvard.edu (Keith Robison) writes: >I was wondering if anyone else has had this problem. Sometimes >when I attempt to start NetEntrez on my Sun (1+), it crashes out >the window server (olwm). The problem seems to have some correlation >with what I choose for foreground & background colors, and perhaps >with whether I've run other software first (Mosaic using up >my color map?). I've also had some other X software do this, >and a colleague just had it happen on their machine with Entrez. > >Has anyone else encountered a similar problem? I apologize for >the sketchy details, but I haven't had the patience yet to try >to exhaustively investigate this. Keith, I've had similar problems, but they are nearly so intermittent as to defy description. About a year ago when I switched from olwm to olvwm (OPEN LOOK virtual window manager), it very consistently crashed the window manager. If I used olwm it would work. I contacted Jonathan Gold at NCBI and he provided some sort of fixed version of the Sun Nentrez binary. I seem to remember display crashes similar to yours since then, but as I said they were intermittent. My recollection is that they might have been related to color allocation. The only other X software that I have seen behave this way was when I recently tried running BoB (the Blast output Browser, also from NCBI). The program crashed due to a configuration problem (mine, not theirs) and brought down olvwm with it. Once I fixed my configuration problem, it worked fine. If there is a bottom line to this discussion, it might be to contact the folks at NCBI. They might have a better line on such intermittent problems, since they are dealing with so many users. I have always found them very helpful. --- Jerry Learn Dept. of Botany & Plant Sciences | learn@smaug.ucr.edu | LEARN@UCRVMS.BITNET University of California | (909) 787-4673 | FAX: (909) 787-4437 Riverside, CA 92521 USA From owner-software@net.bio.net Mon Aug 08 23:00:00 1994 Path: biosci!agate!ames!decwrl!decwrl!amd!netcomsv!cowpoke.biodata.com!mac112.biodata.com!user From: vern@BioData.COM (Vernon Keenan) Newsgroups: bionet.software Subject: Re: MacTCP Tool version Date: 9 Aug 1994 06:33:11 GMT Organization: BioData, Inc. (San Mateo, CA) Lines: 27 Message-ID: References: <31o5luINNgd3@sat.ipp-garching.mpg.de> <323p0t$pca@steele.ohsu.edu> NNTP-Posting-Host: mac112.biodata.com In article <323p0t$pca@steele.ohsu.edu>, rootd@ohsu.edu (Darrell Root) wrote: > if you get the Internet starter kit, I'll bet it has > an old version of macMosaic, and that you might want to pick up > a more recent one (anonymous ftp from ftp.ncsa.uiuc.edu). > > Darrell Root > rootd@ohsu.edu Quite right, Darrell. In fact, Adam Engst maintains an FTP site at ftp://ftp.tidbits.com/pub/tisk as a repository of updates to the software distributed on the book disk, including a MacTCP 2.0.2 to 2.0.4 updater. I'd only advise users to upgrade to NCSA Mosaic 2.0a6 for Macintosh if they really need access to the NCBI genomic browsers ;-) Alpha software can be a problem more most users. NCSA Mosaic v1.0.3 is OK (minus the forms capability) and is extremely reliable for 90% of everyone's browing needs. Vern -- --------------------------------------------------------------------- | Vernon Keenan | BioData, Inc. | | President | 1828 South Grant Street Suite 820 | | Phone: +1 415-513-8950 | San Mateo, California 94402 | | E-Mail: vern@BioData.COM | WWW: http://www.biodata.com/ | --------------------------------------------------------------------- From owner-software@net.bio.net Mon Aug 08 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!vixen.cso.uiuc.edu!newsfeed.ksu.ksu.edu!moe.ksu.ksu.edu!kuhub.cc.ukans.edu!husc-news.harvard.edu!lipid!robison Newsgroups: bionet.software Subject: NetEntrez crashing Sun X! Message-ID: <1994Aug9.110804.34058@hulaw1.harvard.edu> From: robison@lipid.harvard.edu (Keith Robison) Date: 9 Aug 94 11:08:03 EDT Nntp-Posting-Host: lipid.harvard.edu X-Newsreader: TIN [version 1.2 PL2] Lines: 20 I was wondering if anyone else has had this problem. Sometimes when I attempt to start NetEntrez on my Sun (1+), it crashes out the window server (olwm). The problem seems to have some correlation with what I choose for foreground & background colors, and perhaps with whether I've run other software first (Mosaic using up my color map?). I've also had some other X software do this, and a colleague just had it happen on their machine with Entrez. Has anyone else encountered a similar problem? I apologize for the sketchy details, but I haven't had the patience yet to try to exhaustively investigate this. Keith Robison Harvard University Department of Cellular and Developmental Biology Department of Genetics / HHMI robison@mito.harvard.edu From owner-software@net.bio.net Mon Aug 08 23:00:00 1994 Newsgroups: bionet.software Path: biosci!agate!spool.mu.edu!howland.reston.ans.net!vixen.cso.uiuc.edu!uchinews!ellis!gluc From: gluc@ellis.uchicago.edu (Anton Gluck) Subject: prediction of migration in 2D gels Message-ID: <1994Aug9.163247.2275@midway.uchicago.edu> Sender: news@uchinews.uchicago.edu (News System) Reply-To: gluc@midway.uchicago.edu Organization: University of Chicago -- Academic Information Technologies Date: Tue, 9 Aug 1994 16:32:47 GMT Lines: 15 Hello, We are interested in predicting the (relative) migration of a protein in a two-dimensional gel from the protein's primary structure. Does anybody have or know of a program which can do that? The program would have to take into account the particular conditions used during first and second dimension electrophoresis, and the result would probably be migration in relation to one or more other proteins. Any information or comments will be appreciated. Joe Olvera and Anton Glueck laboratory of Prof. I. G. Wool e-mail: jolvera@midway.uchicago.edu gluc@midway.uchicago.edu From owner-software@net.bio.net Mon Aug 08 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!pipex!warwick!unicorn.nott.ac.uk!vaxa.nott.ac.uk!PAZGSB From: pazgsb@vaxa.nott.ac.uk (Mad Tommy) Newsgroups: bionet.software Subject: Molscript Date: 8 Aug 1994 12:42:04 GMT Organization: University of Nottingham, UK Lines: 11 Message-ID: <32596s$obf@unicorn.ccc.nottingham.ac.uk> Reply-To: pazgsb@vaxa.nott.ac.uk NNTP-Posting-Host: vaxa.ccc.nottingham.ac.uk Dear All, Does anyone know where I can get a PC executable version of this programme, or any other programme for a PC that will draw protein cartoons and plot them to disk. please note that I am asking for a PC DOS based programme, not one that requires windows or X-windows to run. Thanks, Geoff Briggs, Pharmaceutical Sciences, University of Nottingham. From owner-software@net.bio.net Mon Aug 08 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!EU.net!Germany.EU.net!netmbx.de!zib-berlin.de!rs1-hrz.uni-duisburg.de!news.rz.uni-duesseldorf.de!myhost.subdomain.domain!mundt1 From: mundt1@myhost.subdomain.domain () Newsgroups: bionet.software Subject: Re: Kabat database via www??? Date: 9 Aug 1994 09:04:51 GMT Organization: Biophysikalische Biologie Uni-Duesseldorf Lines: 14 Message-ID: <327gs1$60k@news.rz.uni-duesseldorf.de> References: <1994Aug8.135144.23345@nomina.lu.se> NNTP-Posting-Host: amber.biophys.uni-duesseldorf.de X-Newsreader: TIN [version 1.2 PL2] Bo Servenius (Bo.Servenius@wblab.lu.se) wrote: : Do anyone know if the Kabat database is awailable via www? : yours : BOSSE It is available, but where ... ;-) Links may be in http://info.er.usgs.gov/network/science/biology/index.html or http://golgi.harvard.edu/biopages.list At these sides only the original databases are stored. Stefan. From owner-software@net.bio.net Mon Aug 08 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!cs.utexas.edu!convex!news.duke.edu!concert!bigblue.oit.unc.edu!plc From: plc@med.unc.edu (Philip L. Carl) Newsgroups: bionet.software Subject: Logit software Date: 9 Aug 1994 13:51:47 GMT Organization: UNC-CH School of Medicine Lines: 8 Distribution: world Message-ID: <3281lj$i0b@bigblue.oit.unc.edu> NNTP-Posting-Host: cahaba.med.unc.edu Originator: plc@cahaba I'm sorrry that this posting earlier got truncated. What I would like to find is a PC based program for carrying out Logit transformations. I assume this might be part of a more extensive package of statistical routines, but an inexpensive stand alone program would be fine too. Also any information about the use of this plot and/or pitfalls would be appreciated. Phil Carl From owner-software@net.bio.net Mon Aug 08 23:00:00 1994 Path: biosci!daresbury!trane.uninett.no!eunet.no!nuug!EU.net!uunet!europa.eng.gtefsd.com!newsxfer.itd.umich.edu!nntp.cs.ubc.ca!unixg.ubc.ca!news.bc.net!news.mic.ucla.edu!inherit2.dna.ucla.edu!hansen From: hansen@inherit2.dna.ucla.edu (Susan Hansen) Newsgroups: bionet.software Subject: RmVec for Macs available Date: 9 Aug 1994 22:35:56 GMT Organization: UCLA Microcomputer Support Office Lines: 17 Distribution: world Message-ID: <3290cc$3ll@news.mic.ucla.edu> NNTP-Posting-Host: inherit2.dna.ucla.edu If anyone is interested in our software to screen and remove vectors from ABI files, please send email to rmvec@inherit2.dna.ucla.edu or to help@inherit2.dna.ucla.edu. It uses the FastA algorithm to find matches. If you're interested, but you want to know more about what it does before you decide if you want it, you can ftp documentation from inherit2.dna.ucla.edu:pub/CATALOG. There are FrameMaker and postscript copies available. -- ####################################################################### | Take a hike. Susan Hansen | Take the bus. UCLA Biology | Take a turn. ####################################################################### From owner-software@net.bio.net Mon Aug 08 23:00:00 1994 Path: biosci!agate!barrnet.net!biosys!intron!gene From: gene@apldbio.com (Gene Shpaer) Newsgroups: bionet.software Subject: NBRF -> CODATA -- PIR file format conversion Keywords: PIR, NBRF, CODATA Message-ID: <1264@biosys.apldbio.COM> Date: 9 Aug 94 18:12:43 GMT References: <31j8hp$8m9@news.iastate.edu> Sender: news@biosys.apldbio.COM Reply-To: gene@apldbio.com Organization: Applied Biosystems, Inc. Lines: 19 Hi: The PIR database exists in two distinctly different formats: CODATA and NBRF. Since new releases come in both of these two formats simultaneously. there should be a utility which converts one into another. Can you please point where can I get the program to convert pir1, pir2 and pir3 from the NBRF to CODATA format? I know and use READSEQ program, but this excellent tool is not designed for the BIG files and does not parse the Annotations. Thank you for your help. Eugene Shpaer From owner-software@net.bio.net Mon Aug 08 23:00:00 1994 Path: biosci!galaxy.ucr.edu!usenet From: learn@smaug.ucr.edu (Jerry Learn) Newsgroups: bionet.software Subject: Re: NetEntrez crashing Sun X! Date: 9 Aug 1994 19:31:38 GMT Organization: University of California, Riverside Lines: 17 Distribution: world Message-ID: <328liq$qpa@galaxy.ucr.edu> References: <328brg$mob@galaxy.ucr.edu> Reply-To: learn@smaug.ucr.edu NNTP-Posting-Host: smaug.ucr.edu In article mob@galaxy.ucr.edu, learn@smaug.ucr.edu (Jerry Learn) writes: (lotta stuff deleted) >I used olwm it would work. I contacted Jonathan Gold at NCBI and he provided ^^^^---should read Epstein, Sorry, Jonathan. --- Jerry Learn Dept. of Botany & Plant Sciences | learn@smaug.ucr.edu | LEARN@UCRVMS.BITNET University of California | (909) 787-4673 | FAX: (909) 787-4437 Riverside, CA 92521 USA From owner-software@net.bio.net Mon Aug 08 23:00:00 1994 Newsgroups: bionet.software Path: biosci!daresbury!trane.uninett.no!nac.no!eunet.no!nuug!EU.net!uunet!emba-news.uvm.edu!brianf From: brianf@med.uvm.edu (Brian Foley) Subject: Re: "Flat tape format"? Message-ID: <1994Aug9.202433.19423@emba.uvm.edu> Sender: news@emba.uvm.edu Organization: EMBA Computer Facility, University of Vermont X-Newsreader: TIN [version 1.2 PL1] References: Date: Tue, 9 Aug 1994 20:24:33 GMT Lines: 30 Chris Jones (Chris.Jones@nottingham.ac.uk) wrote: : We use the Hitachi DNA analysis software package DNASIS and I always have : trouble importing DNA files I pull off using Gopher. When I asked Hitachi : they : told me that I should be able to do it if I download in "flat tape format". : Does anyone know what this is and how I ensure that I down load my files : using : it? I should saw that I use Hgopher and usually go in via the Oxford Mol Biol : gopher. They mean "flat file" format. That is the format that GenBank "entries" are stored on magnetic tapes. It is the most common form for GenBank entries over the past 10 years or so. "Flat file" means that the information is stored as a string of text. Other file formats can include complex "links" to indices and so on, so they are more like a database than a list of entries. You might be "pulling off" the entries in GenBank flat file format now. Your problem may have something to do with your downloading procedure. Are you sure the files are being downloaded onto you computer as ASCII text files, and no "mail headers" or anything are added to them? What error message does DNASIS gove you? Call DNASIS back and get better info. You paid for their software didn't you? -- ******************************************************************** * Brian Foley * If we knew what we were doing * * Molecular Genetics Dept. * it wouldn't be called research * * University of Vermont * * ******************************************************************** From owner-software@net.bio.net Tue Aug 09 23:00:00 1994 Path: biosci!agate!trib.apple.com!amd!netcomsv!cowpoke.biodata.com!mac112.biodata.com!user From: vern@BioData.COM (Vernon Keenan) Newsgroups: bionet.software Subject: Re: SOFTWARE RIP-OFFS! Date: 10 Aug 1994 07:22:21 GMT Organization: BioData, Inc. (San Mateo, CA) Lines: 66 Message-ID: References: <318i3o$dpv@netnews.upenn.edu> <3197dv$5b2@news.doit.wisc.edu> NNTP-Posting-Host: mac112.biodata.com In article <3197dv$5b2@news.doit.wisc.edu>, lehn@islet.medsch.wisc.edu wrote: > Although many people here are speaking in support of the software > companies I won't. For the most part the DNA analysis software > suppliers are greedy self serving S.O.B.s. > > [inspired prose goes here] > I find it truly amazing that these software companies freely > use algorithims developed with taxpayer money yet are so > arrogent in their ways. > > Don Don, you right that the companies making money in bioinformatics are essentially reaping the harvest of many years of dedicated effort and millions of dollars spent on collaborative research in the biology community. A falicy in your perspective on the issue is the fact you haven't realized that bioinformatics is now a global commercial enterprise helping to deliver therapeutic products that improves the lives of millions of people. The bioinformatics databases now controlled by the United States government have nearly infinite commercial value, on the order of a hundred billion dollars. This fact is not ignored by businesses in pharmaceutical circles. Witness the success of GeneWorks and MacVector, the deal between SmithKline Beecham and Human Genome Sciences and over $200M spent on companies like Incyte, Darwin, Sequana and Millenium as evidence. This brings up a legal problem in U.S. commerce. If the bioinformatics systems controlled by the U.S. Government have vast commercial value, does the U.S. Government have the legal right to own these resources? By law, the U.S. government cannot compete with commercial enterprise. I'm sure that everyone would agree that no one can complete with the Entrez CD-ROMs for genetic data distribution. Does the existance of Entrez create an unfair barrier to a commercial product that delivers the same service? I think it does. What I'm suggesting is that the wonderful data collection activity set up by the Human Genome Project and NCBI may eventually be found to be anticompetitive to a multibillion dollar commercial bioscience industry and will be taken away from the U.S. government and privatized. Moving into 21st centry medicine is not as simple as taking the databases away from the government, however. What about biodiversity, the concept that no one person or nation may own the very substance of life? Doesn't U.S. government and international bodies have at least have an oversight role in the governance of genomic data and organic samples? Of course they do! The very concept of privatization of NCBI may make some people sick, but it may be an inevitable consequence of U.S. law and the commercialization of biology. Somehow we need to reconcile the reality of commercial biotechnology with the needs of humanity and the planet. I don't have the answers, but I've got plenty of questions! Vern -- --------------------------------------------------------------------- | Vernon Keenan | BioData, Inc. | | President | 1828 South Grant Street Suite 820 | | Phone: +1 415-513-8950 | San Mateo, California 94402 | | E-Mail: vern@BioData.COM | WWW: http://www.biodata.com/ | --------------------------------------------------------------------- From owner-software@net.bio.net Tue Aug 09 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!usenet.ins.cwru.edu!axa12-slip.cwru.edu!ashok From: ashok@biochemistry.cwru.edu (Ashok Aiyar) Newsgroups: bionet.software Subject: Re: NetEntrez crashing Sun X! Date: Wed, 10 Aug 1994 02:16:27 GMT Organization: Department of Biochemistry, Case Western Reserve University Lines: 15 Distribution: world Message-ID: References: <1994Aug9.110804.34058@hulaw1.harvard.edu> <328brg$mob@galaxy.ucr.edu> NNTP-Posting-Host: axa12-slip.dialin.cwru.edu X-Newsreader: Trumpet for Windows [Version 1.0 Rev B final beta #1] In article <328brg$mob@galaxy.ucr.edu> learn@smaug.ucr.edu (Jerry Learn) writes: > I contacted Jonathan Gold at NCBI and he provided Shouldn't that be Jonathan Epstein (epstein@gold.nlm.nih.gov) .... :-) Actually contacting Jonathan is an excellent idea. He is very helpful, and a very nice person. Later, Ashok -- Ashok Aiyar Mail: ashok@biochemistry.cwru.edu Department of Biochemistry Tel: (216) 368-3300 CWRU School of Medicine, Cleveland, Ohio Fax: (216) 368-4544 MIME Enclosures OK From owner-software@net.bio.net Tue Aug 09 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!europa.eng.gtefsd.com!sundog.tiac.net!usenet.elf.com!rpi!ghost.dsi.unimi.it!univ-lyon1.fr!news From: duret@evoserv.univ-lyon1.fr (Laurent Duret) Newsgroups: bionet.software Subject: where to get ATLAS user manual? Date: 10 Aug 1994 07:55:12 GMT Organization: Universite Claude Bernard - Lyon 1 Lines: 10 Distribution: world Message-ID: <32a150$bv4@cismsun.univ-lyon1.fr> Reply-To: duret@evoserv.univ-lyon1.fr NNTP-Posting-Host: evoserv.univ-lyon1.fr Does anyone know where I can find the user manual of ATLAS, the sequence retrieval software provided with PIR database? Please reply by e-mail. Thank you for your help. Laurent Duret From owner-software@net.bio.net Tue Aug 09 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!pipex!sunic!trane.uninett.no!eunet.no!nuug!EU.net!uunet!munnari.oz.au!newsroom.utas.edu.au!NewsWatcher!user From: Rob.Wiltshire@plant.utas.edu.au (Rob Wiltshire) Newsgroups: bionet.software Subject: tertiary.teaching-genetics Followup-To: bionet.software Date: 10 Aug 1994 07:19:22 GMT Organization: Uni.Tasmania Lines: 4 Distribution: world Message-ID: NNTP-Posting-Host: 131.217.59.77 Hi, I need some help finding some interactive software (hopefully on a Mac platform) to provide first year undergraduates with some tutorial assistance. If anyone has any ideas, I would love to hear from you. Cheers. From owner-software@net.bio.net Tue Aug 09 23:00:00 1994 Newsgroups: bionet.software Path: biosci!rutgers!princeton!nimaster!news From: anders@phoenix.princeton.edu Subject: Looking for Software Message-ID: <1994Aug8.144917.21221@Princeton.EDU> Originator: news@nimaster Sender: news@Princeton.EDU (USENET News System) Nntp-Posting-Host: chroma.princeton.edu Organization: Princeton University Date: Mon, 8 Aug 1994 14:49:17 GMT Lines: 21 I am searching for a mac or IBM program which simulates the relationship between the earth's orbit and it's climate. The program should preferably be interactive, thus allowing the student to experiment and discover for herself why summertime is hotter than winter. The variables include the tilt of the earth, the shape of the orbit (when it reaches perihilion), and also the albedo (reflectivity). This program will be used in conjunction with a course at Princeton University for undergraduates. If you know of anything along these lines please e-mail me at Anders@Phoenix.princeton.edu Thank you very much for you forthcoming assistance. -Anders Mikkelsen Posted to bionet.software comp.edu comp.sys.mac.apps sci.edu sci.environment talk.environment misc.education.multimedia misc.education.science From owner-software@net.bio.net Tue Aug 09 23:00:00 1994 Path: biosci!agate!spool.mu.edu!howland.reston.ans.net!europa.eng.gtefsd.com!news.uoregon.edu!netnews.nwnet.net!news.u.washington.edu!Eli.Meir From: meir@zoology.washington.edu (Eli Meir) Newsgroups: bionet.software Subject: Re: CD-ROMs Date: 10 Aug 1994 02:40:55 GMT Organization: Dept. of Zoology, Univ. of Washington Lines: 13 Sender: -Not-Authenticated-[3641] Message-ID: <329enn$cb9@news.u.washington.edu> References: <31pd1d$75i@zippo.uwasa.fi> <31u3h5$gdc@news.nde.state.ne.us> NNTP-Posting-Host: quaternary.zoology.washington.edu X-Posted-From: InterNews 1.0@news.u.washington.edu. Xdisclaimer: No attempt was made to authenticate the sender's name. There is a book of software reviews done by Carol Ann Paul and Graham Kent (Wellesley and Smith colleges respectively) which includes a list of perhaps 100 CD's in the back. I don't know about availability or pricing of this publication, but you can write to them at Department of Biological Sciences, Smith College, Northampton, Massachesetts 01063, USA. The project is called NECUSE. If you have Mosaic, you should also check out the CTI Centre for Biology in the UK, which has a large listing of biological software (somewhat dated, however). Eli Meir Dept of Zoology, Univ of Washington meir@zoology.washington.edu From owner-software@net.bio.net Tue Aug 09 23:00:00 1994 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!spool.mu.edu!darwin.sura.net!nellie.musc.edu!usenet From: afrinl@honc.mhs.musc.edu (Danny Newton) Newsgroups: bionet.software Subject: Here's the WWW URL for BLAST DNA sequence searching Date: 10 Aug 1994 20:27:59 GMT Organization: Hollings Cancer Center, Med. Univ. of S.C. Lines: 22 Message-ID: <32bd8f$3j0@nellie.musc.edu> Reply-To: afrinl@honc.mhs.musc.edu NNTP-Posting-Host: 128.23.92.59 X-Newsreader: WinVN 0.91.4 Since I've been receiving so many e-mail queries on the subject, I figured I'd just post the following info for everybody to see. The direct URL for BLAST DNA sequence searching is: http://www.ncbi.nlm.nih.gov/Recipon/bs_seq.html However, for first-time users, I recommend linking into this page indirectly via NLM's HyperDoc page, available at URL: http://www.nlm.nih.gov There's a link on this page to NCBI (National Center for Biotechnology Information), and the links from there on to the actual sequence searching page ought to be obvious. This route will allow you to browse through a lot of other great resources available from NLM and NCBI, so you might find some other interesting things out along the way to the BLAST page. Have fun! -- LBA From owner-software@net.bio.net Tue Aug 09 23:00:00 1994 Path: biosci!agate!trib.apple.com!olivea!news.bu.edu!acs.bu.edu!lwetzler From: lwetzler@acs.bu.edu (Lee M. Wetzler) Newsgroups: bionet.software Subject: plasmid software for the pc Date: Wed, 10 Aug 1994 15:50:29 Organization: Boston University School of Medicine Lines: 4 Message-ID: NNTP-Posting-Host: ppp-83-14.bu.edu Keywords: plasmid pc X-Newsreader: Trumpet for Windows [Version 1.0 Rev A] Any recommendations for plasmid drawing software for the PC, especially for windows. Lee From owner-software@net.bio.net Tue Aug 09 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!usenet.ins.cwru.edu!cleveland.Freenet.Edu!ez257 From: ez257@cleveland.Freenet.Edu (Henry A. Gabb) Newsgroups: bionet.software Subject: Looking for nucleic acid structure analysis programs. Date: 10 Aug 1994 08:02:21 GMT Organization: Case Western Reserve University, Cleveland, Ohio (USA) Lines: 20 Message-ID: <32a1id$psa@usenet.INS.CWRU.Edu> NNTP-Posting-Host: kanga.ins.cwru.edu I'm looking for a program that examines a series of structure files (from a molecular dynamics trajectory, for example) and reports information about hydrogen bonding and base stacking in nucleic acids. Before I write my own from scratch, I wanted to know if there are programs like this already available in the research community. I already know about Curves since I work in the lab where it was written. It's too slow for the number of structures that I have and gives more information than I currently need. After I get the rudimentary structural info I will perform a Curves analysis on the important structures. Thanks, -- Henry Gabb (henry@ibpc.fr) 13 rue Pierre et Marie Curie Paris 75005 France From owner-software@net.bio.net Tue Aug 09 23:00:00 1994 Path: biosci!rutgers!csn!col.hp.com!sdd.hp.com!elroy.jpl.nasa.gov!swrinde!emory!europa.eng.gtefsd.com!newsxfer.itd.umich.edu!newsrelay.iastate.edu!vixen.cso.uiuc.edu!phylo!badger From: badger@phylo.life.uiuc.edu (Jonathan Badger) Newsgroups: bionet.software Subject: Re: GDE 2.1 crashes my linux Date: 10 Aug 94 19:00:49 GMT Organization: University of Illinois at Urbana Lines: 13 Message-ID: References: NNTP-Posting-Host: phylo.life.uiuc.edu john@myhost.subdomain.domain (John Gillespie) writes: >Does GDE need to be recompiled with newer libraries. Does anyone else >have problems under a recent slackware release? Is GDE under current >development? Speak to me! Probably yes -- If you are referrring to to the version on megasun, I compiled that last summer so it probably is using lots of old libraries. I haven't been using GDE lately because I lost it during a hard drive crash, but I (or someone else) could try compiling a new version. I think the current version is 2.2 From owner-software@net.bio.net Tue Aug 09 23:00:00 1994 Newsgroups: bionet.software Path: biosci!agate!howland.reston.ans.net!europa.eng.gtefsd.com!library.ucla.edu!news.ucdavis.edu!myhost.subdomain.domain!john From: john@myhost.subdomain.domain (John Gillespie) Subject: GDE 2.1 crashes my linux Message-ID: Sender: usenet@ucdavis.edu (News Guru) Organization: String to put in the Organization Header X-Newsreader: TIN [version 1.2 PL2] Date: Wed, 10 Aug 1994 17:56:49 GMT Lines: 14 I am using GDE 2.1 under linux 1.0.9 (from the slackware 2.0 distribution). It does some things well, like opening files and editing, but crashes when it runs external functions like clustalv or those in phylip. When running clustalv, for example, the x server just hangs, requiring a reboot. Sometimes it semi-hangs and I can see that clustalv is grabbing 90% of the cpu on an alignment task that takes seconds when given the sequences independent of gde. Does GDE need to be recompiled with newer libraries. Does anyone else have problems under a recent slackware release? Is GDE under current development? Speak to me! john From owner-software@net.bio.net Tue Aug 09 23:00:00 1994 Newsgroups: bionet.software Path: biosci!agate!ames!waikato!comp.vuw.ac.nz!actrix.gen.nz!lhunter From: lhunter@actrix.gen.nz (Lindsay Hunter) Subject: Biology Learning Software Message-ID: Organization: Actrix Information Exchange Date: Wed, 10 Aug 1994 11:01:02 GMT Lines: 9 Does anyone have a comment on Essence of Biology Software by James L Gould. I seek the PC version. Delivery is slow in New Zealand. Email reply and I will summarise. Lindsay Hunter lhunter@actrix.gen.nz From owner-software@net.bio.net Tue Aug 09 23:00:00 1994 Path: biosci!bcm!news.msfc.nasa.gov!europa.eng.gtefsd.com!newsxfer.itd.umich.edu!uunet!zib-berlin.de!rs1-hrz.uni-duisburg.de!news.rz.uni-duesseldorf.de!myhost.subdomain.domain!micha From: micha@myhost.subdomain.domain () Newsgroups: bionet.software Subject: Re: PRIMER: melting points Date: 10 Aug 1994 21:10:37 GMT Organization: String to put in the Organization Header Lines: 41 Distribution: bionet Message-ID: <32bfos$50u@news.rz.uni-duesseldorf.de> References: <3253nl$ftn@mserv1.dl.ac.uk> NNTP-Posting-Host: amber.biophys.uni-duesseldorf.de X-Newsreader: TIN [version 1.2 PL2] ajb@seqnet.dl.ac.uk wrote: : Does anyone have a citation for the basis of the melting point calculation : used in the PRIMER program? - supposed you are talking about the Whitehead Institute Primer program ... - A guy in our lab (working often with PCR and using Primer, even having ported it to the PC) says it is using the same formula as appears in Maniatis' Molecular Cloning - including corrections for oligonucleotides. The Q&A document, however, says it is _not_ using GC/AT ratios but thermo- dynamic data ... We will check this out, but we are running PRIMER 0.5, so YMMV :-) : Thanks in Advance : Alan Bleasby : daresbury By the way: A recent description of good combinations of thermodynamic parameters was recently published in Nucleic Acids Research, 1994, Vol. 22 No. 14 pp 2760-2768 G. Steger : Thermal denaturation of double-stranded nucleic acids: prediction of temperatures critical for gradiemt gel electrophoresis and polymerase chain r