From owner-software@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!bcm!cs.utexas.edu!swrinde!ihnp4.ucsd.edu!news.service.uci.edu!buggus.mmg.uci.edu!user From: mangalam@uci.edu (Harry Mangalam) Newsgroups: bionet.software Subject: Re: Looking for Mac version of RNA fold program Date: Wed, 02 Nov 1994 10:37:11 -0800 Organization: Microbiology and Molecular Genetics, UC Irvine Lines: 22 Message-ID: References: <38sdvf$aem@nnrp.ucs.ubc.ca> NNTP-Posting-Host: buggus.mmg.uci.edu In article <38sdvf$aem@nnrp.ucs.ubc.ca>, lpss@unixg.ubc.ca (Alex Chang) wrote: > HI, there: I am looking for the mac version of RNA fold program or > equivalent. Any information will be appreciated. You can check out a very much under-construction page about RNA folding at: http://hornet.mmg.uci.edu/~hjm/projects/biocomp/biocomp.html However, for any serious work, since you're posting from a unix machine, try the unix programs mentioned in that URL - RNA folding is a big memory problem and Unix machines tend to have more than Macs. Cheers Harry -- Harry J Mangalam, Microbiology and Molecular Genetics, College of Medicine, UC Irvine, Irvine, CA, 92717, (714) 856-4824, fax (714) 856 8598, --- That which does not kill me, makes me grouchier --- http://hornet.mmg.uci.edu/~hjm/hjm.html Computational Biology..SGI..Woodworking..Bicycling..Linux..WWW From owner-software@net.bio.net Tue Nov 01 22:00:00 1994 Newsgroups: bionet.software Path: biosci!rutgers!uwm.edu!lll-winken.llnl.gov!overload.lbl.gov!dog.ee.lbl.gov!news.cs.utah.edu!emba-news.uvm.edu!brianf From: brianf@med.uvm.edu (Brian Foley) Subject: Re: Software for comparing sequence homology from GenBank server? Message-ID: <1994Nov2.214626.1249@emba.uvm.edu> Sender: news@emba.uvm.edu Organization: EMBA Computer Facility, University of Vermont X-Newsreader: TIN [version 1.2 PL1] References: Date: Wed, 2 Nov 1994 21:46:26 GMT Lines: 77 Jason L. Buberel (jbuberel@uiuc.edu) wrote: : Could someone please let me know if there is a simple (straighforward) way : to ask GenBank (or a similar service) to compare sequence homology for me : if I give it the names of several related genes (or same gene between : different species). We are trying to find conserved areas among the : cytochrome enzyme genes. We have played with the GenBank web site, but : have not figured out how to do this. Others have assured me that it is : possible. 1) Retrieve one of the cytochrome gene sequences from GenBank by sending the ACCESSION number to "retrieve@ncbi.nlm.nih.gov" If you are not familiar with the RETRIEVE server, send a message with just "help" in the text first. The server will then send you detailed instructions. If you do not know an ACCESSION number for a cytochrome gene, use MEDLINE or another resource to look for a publication of a cytochrome sequence. 2) Send that cytochrome sequence to "blast@ncbi.nlm.nih.gov" in the proper BLAST format. If you are not familiar with the BLAST server, send a "help" message first to get detailed instructions. 3) The BLAST output will list the entries in the database that are the most similar to the one you queried with. Along with pairwise alignments. It does not produce a multiple sequence alignment. 4) RETRIEVE the sequences you are interested in. 5) Use a multiple sequence alignment program to do the multiple sequence alignment. There are so many programs available for multiple sequence alignment that I can't describe them all here. ----------Clipped from an earlier post by Keith Robison------------------- There is a short description of some of the issues in sequence searching available via the WWW at http://twod.med.harvard.edu/seqanal/ You should certainly read the extremely good review by Altschul et al in Nature Genetics (6:119-129). If you can find the recent book "Biocomputing" (D.Smith, ed) it has an excellent article on the subject by Steven Henikoff (the WWW reference above contains the full citations to these and many other good readings). As some other posters have noted, you should search multiple ways. Both DNA and protein databases have their drawbacks. Searching for matches at the protein level is more sensitive than at the DNA level, but many genes are not in the protein databases (see Nature Genetics 7:205-215 or the Rudd et al article in the current issue of TIBS), so you cannot rely on searches against protein databases (BLASTP, BLASTX, etc). Also, one must be careful in that both the protein and DNA databases contain various sorts of contaminants (vector sequence, foreign sequence, repetitive elements, etc) and other anomalies (rearrangements, mis-translations, annotation errors, etc) Keith Robison Harvard University Department of Cellular and Developmental Biology Department of Genetics / HHMI robison@mito.harvard.edu ------------------end clip---------------------------------------- -- ******************************************************************** * Brian Foley * If we knew what we were doing * * Molecular Genetics Dept. * it wouldn't be called research * * University of Vermont * * ******************************************************************** From owner-software@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!agate!howland.reston.ans.net!news.sprintlink.net!EU.net!Germany.EU.net!news.dfn.de!news.belwue.de!news.uni-freiburg.de!bio5.chemie.uni-freiburg.de!vonrhein From: vonrhein@bio5.chemie.uni-freiburg.de (Clemens Vonrhein) Newsgroups: bionet.software Subject: Re: 3D homology modelling on WWW? Date: 2 Nov 1994 14:57:59 GMT Organization: Inst. f. Org. Chemie u. Biochemie, Freiburg Lines: 23 Distribution: world Message-ID: <3989dn$q29@sun2.ruf.uni-freiburg.de> References: NNTP-Posting-Host: bio5.chemie.uni-freiburg.de In article , seow@unixg.ubc.ca (Kah-Tong, Seow) writes: |> Does anyone know if there is any WWW site to access program for either 3D |> homology modelling program or program which allow a search of PDB database |> for 3D homology to a query 3D protein. Thanks in advance. |> |> Kah-Tong, Seow |> West East Centre |> Univ of British Columbia |> Vancouver |> seow@unixg.ubc.ca There is something like swiss-model at http://expasy.hcuge.csh. Clemens -- ***************************************************************** * Clemens Vonrhein email:vonrhein@bio5.chemie.uni-freiburg.de * * * * Institut f"ur Organische Chemie * * und Biochemie * * Abt. Prof. G.E.Schulz * * Albertstr.21 * * D-79104 Freiburg i.Br., Germany * ***************************************************************** From owner-software@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!galaxy.ucr.edu!ihnp4.ucsd.edu!news.service.uci.edu!buggus.mmg.uci.edu!user From: mangalam@uci.edu (Harry Mangalam) Newsgroups: bionet.software Subject: Re: DNA motifs (does a searchable database exist) Date: Wed, 02 Nov 1994 10:31:21 -0800 Organization: Microbiology and Molecular Genetics, UC Irvine Lines: 29 Message-ID: References: NNTP-Posting-Host: buggus.mmg.uci.edu In article , m_cockerill@icrf.icnet.uk (Matthew Cockerill) wrote: > I'm wondering whether there is any analogue of PROSITE which catalogs DNA > motifs (e.g. transcription factor binding sites, promoter consensus > sequences, 3'UTR mRNA masking signals, things like that, which occur in > non coding regions of DNA). > > Seem it would be very useful. > Consensus sequences for thousands of these type of motifs are present in > the literature. Has anyone assembled them in searchable form? Hi Matt, Well, there's Ghosh' Transcription Factor Database (ftp://ncbi.nlm.nih.gov/repository/TFD) which contains much of what you're looking for, and you could agrep (approximate grep, with regular expresssion search) thru it for hits or make up a perl script to do more in one pass. Cheers harry -- Harry J Mangalam, Microbiology and Molecular Genetics, College of Medicine, UC Irvine, Irvine, CA, 92717, (714) 856-4824, fax (714) 856 8598, --- That which does not kill me, makes me grouchier --- http://hornet.mmg.uci.edu/~hjm/hjm.html Computational Biology..SGI..Woodworking..Bicycling..Linux..WWW From owner-software@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!agate!howland.reston.ans.net!swiss.ans.net!gatech!newsxfer.itd.umich.edu!zip.eecs.umich.edu!caen!saimiri.primate.wisc.edu!news.doit.wisc.edu!post.its.mcw.edu!not-for-mail From: psummer@post.its.mcw.edu (Phyllis M. Summerfelt) Newsgroups: bionet.software Subject: .gel files Date: 2 Nov 1994 08:06:41 -0600 Organization: Medical College of Wisconsin; Milwaukee Wisconsin Lines: 5 Message-ID: <3986dh$rrn@post.its.mcw.edu> NNTP-Posting-Host: post.its.mcw.edu X-Newsreader: TIN [version 1.2 PL2] I have been trying to figure out how to manage the .gel files (files made by Molecular Dynamics Phosphorimager of DNA sequences, etc.) on my hard drive. These files take up an inordinate amount of space and are not readily compacted by zip (they are already very compact). Any suggestions as to software that may compress these files? From owner-software@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!agate!spool.mu.edu!howland.reston.ans.net!pipex!cityscape.co.uk!usenet From: ae76@cityscape.co.uk (ae76) Newsgroups: bionet.software Subject: Re: grant management software Date: 2 Nov 1994 13:15:49 GMT Organization: IP-GOLD User Lines: 15 Message-ID: <3983e5$5fe@ns.cityscape.co.uk> References: NNTP-Posting-Host: ac067.du.pipex.com X-Newsreader: WinVN 0.91.6 In article , abranfor@immuno.imvs.sa.gov.au (Ann Branford) says: > >Does anyone know of a PC based grant management package - preferably windows >based? We wish to keep track of how much money is in a research grant and >what we have spent our money on. > Grant Accountant is a DOS based grant management package. If you email us your address we can send you details plus a demo disk. Geraint Jones Bilaney Consultanst Ltd ae76@cityscape.co.uk From owner-software@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!FUJIMI.HOSEI.AC.JP!akihara From: akihara@FUJIMI.HOSEI.AC.JP (Akira Kihara) Newsgroups: bionet.software Subject: EndNote 2.0 Price? Date: 2 Nov 1994 04:34:20 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 20 Sender: daemon@net.bio.net Distribution: world Message-ID: <9411021234.AA27784@leucine.c.dna.affrc.go.jp> NNTP-Posting-Host: net.bio.net Now a days, it is getting expensive to keep software fresh, since the up-grade costs too much, in some case. Today, I have received the up-grade information for EndNote Plus 2.0 (Mac) from my version 1.3. The Japanese "authorized" dealer bill us $200 (20,000 yen)! I am thinking that I have better to buy the up-grade or even new one from other country. Since I do not want to consume time for getting more money. Could you please let me know the up-grade price in US or else where. Thank you _____________________________________________ | Akira Kihara | Laboratory of Biology, Hosei University | Fujimi 2-17, Chioyoda, Tokyo 102, JAPAN | | FAX 81-3-3264-9368, Phone 81-3-3264-9390 From owner-software@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!agate!howland.reston.ans.net!gatech!mailer.acns.fsu.edu!freenet3.scri.fsu.edu!freenet1.scri.fsu.edu!dbradley From: dbradley@freenet1.scri.fsu.edu (David Bradley) Newsgroups: bionet.software,sci.edu,sci.chem Subject: Re: Want shareware "ChemDraw-like" program for Mac Followup-To: bionet.software,sci.edu,sci.chem Date: 2 Nov 1994 09:40:12 GMT Organization: Tallahassee Free-Net Lines: 14 Message-ID: <397mps$3g0@freenet3.scri.fsu.edu> References: NNTP-Posting-Host: freenet1.scri.fsu.edu X-Newsreader: TIN [version 1.2 PL2] Xref: biosci bionet.software:9881 sci.edu:3460 sci.chem:18769 Steven Zikopoulos (szikopou@superior.carleton.ca) wrote: : In reuber@hydra.rose.brandeis.edu (Kent Reuber) writes: : chem-edit is a _freeware_ program available for the mac via ftp. it : was written some time ago (1989) so i don't think it supports colour if : you need it. i find it quite good and easy to use. it will even : create 3-d models from your 2d image. Is there a Windows version or related package ftpable anywhere? Dave Bradley -- bradleyd1@rsc.org From owner-software@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!agate!howland.reston.ans.net!vixen.cso.uiuc.edu!ux1.cso.uiuc.edu!elarson From: elarson@ux1.cso.uiuc.edu (larson eric) Newsgroups: bionet.software Subject: Re: RasMol 2.5 Molecular Graphics Package Available Date: 2 Nov 1994 15:27:31 GMT Organization: University of Illinois at Urbana Lines: 23 Message-ID: <398b53$tp@vixen.cso.uiuc.edu> References: <38tr47$or4@vixen.cso.uiuc.edu> <393pc9$gel@matt.ksu.ksu.edu> <397kvs$3j5@kruuna.Helsinki.FI> NNTP-Posting-Host: ux1.cso.uiuc.edu Keywords: RasMol, RasWin, RasMac, PDB, Molecular Graphics, 3D Rendering frilande@cc.Helsinki.FI (Mikko Frilander) writes: >>I have had a similar problem-- trying strands gives me a GPF. Trying ribbons >>caused the display window to go black, but it didn't crash. I could go back >>and switch to other modes without problem. I am using the windows compiled >>version, on a 486-33. How about anybody else? >A similar problem also in here. Neither strands nor ribbons work. I'm >using windows version on a 486-50. ========== Roger Sayles has already posted about the fix for Raswin 2.5, I've tried the new version, it seems to work fine (but I haven't put it through it's paces yet). I'd suggest trying to FTP during the "night" for the UK, file transfer rates were exceedingly low this morning (USA morning = UK afternoon). -- Eric Larson | University of Illinois at Urbana-Champaign USDA/Agronomy | 190 PABL; 1201 W. Gregory; Urbana, IL 61801 elarson@ux1.cso.uiuc.edu | Voice 217.244.3079 Fax 217.244.4419 Fidonet: 1:233/4.1 | My opinions are my own, but correct :-) From owner-software@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!agate!howland.reston.ans.net!news.sprintlink.net!pipex!lyra.csx.cam.ac.uk!tjrc1 From: tjrc1@cus.cam.ac.uk (Tim Cutts) Newsgroups: bionet.software Subject: Re: Reference Management Date: 2 Nov 1994 10:04:52 GMT Organization: University of Cambridge, England Lines: 37 Message-ID: <397o84$314@lyra.csx.cam.ac.uk> References: <01HIQ98CUEGY8Y6WAG@kids.wustl.edu> NNTP-Posting-Host: ursa.cus.cam.ac.uk X-Newsreader: NN version 6.5.0 #2 (NOV) Peter Myler writes: >On 26 Oct 1994, GUOJUN BU wrote: >> Does anybody know a good reference management program that runs on Window and >> allows you to randomly pick references while writing a paper? Please give me >> phone and/or the Fax number of the source if you happen to know. Thank you in >> advance! >> >> >Reference Manager 6.0 does this very well. You can get it from: >Research Information Systems >(619) 438-5526 >(619) 438-5573 (FAX) >risinfo@ris.risinc.com (e-mail) You can also try my reference management program, Refs, which is shareware. See my announcement, also in this newsgroup. You can get a screenshot, and the program itself, from the WWW: http://cyclin.zoo.cam.ac.uk/ or by anonymous ftp, also from cyclin.zoo.cam.ac.uk Please e-mail me with any questions you have. Regards, Tim. -- ------------------------------------------------------------------------------- 194, Vinery Rd, Cambridge, CB1 3DS, UK (+44) 1223 572622 http://cyclin.zoo.cam.ac.uk/ ------------------------------------------------------------------------------- From owner-software@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!agate!howland.reston.ans.net!EU.net!sunic!news.funet.fi!hydra.Helsinki.FI!news.helsinki.fi!not-for-mail From: frilande@cc.Helsinki.FI (Mikko Frilander) Newsgroups: bionet.software Subject: Re: RasMol 2.5 Molecular Graphics Package Available Date: 2 Nov 1994 11:09:16 +0200 Organization: University of Helsinki Lines: 18 Message-ID: <397kvs$3j5@kruuna.Helsinki.FI> References: <38tr47$or4@vixen.cso.uiuc.edu> <393pc9$gel@matt.ksu.ksu.edu> NNTP-Posting-Host: kruuna.helsinki.fi Mime-Version: 1.0 Content-Type: text/plain; charset=ISO-8859-1 Content-Transfer-Encoding: 8bit Keywords: RasMol, RasWin, RasMac, PDB, Molecular Graphics, 3D Rendering In article <393pc9$gel@matt.ksu.ksu.edu>, Craig Behnke wrote: >In article <38tr47$or4@vixen.cso.uiuc.edu> elarson@ux1.cso.uiuc.edu (larson eric) writes: >> >>We tried it yesterday and couldn't get either ribbons or stands to function >>without the system GPFing on two different computers (a Pentium running >>Windows and a 486/66 using OS/2). > >I have had a similar problem-- trying strands gives me a GPF. Trying ribbons >caused the display window to go black, but it didn't crash. I could go back >and switch to other modes without problem. I am using the windows compiled >version, on a 486-33. How about anybody else? A similar problem also in here. Neither strands nor ribbons work. I'm using windows version on a 486-50. Mikko Frilander, University of Helsinki, Dept. of genetic From owner-software@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!agate!library.ucla.edu!europa.eng.gtefsd.com!newsxfer.itd.umich.edu!zip.eecs.umich.edu!caen!saimiri.primate.wisc.edu!news.doit.wisc.edu!decwrl!tribune.usask.ca!quartz.ucs.ualberta.ca!unixg.ubc.ca!port53.annex4.net.ubc.ca!user From: seow@unixg.ubc.ca (Kah-Tong, Seow) Newsgroups: bionet.software Subject: 3D homology modelling on WWW? Followup-To: bionet.software Date: 2 Nov 1994 07:28:11 GMT Organization: West East Centre, UBC Lines: 9 Distribution: world Message-ID: NNTP-Posting-Host: port53.annex4.net.ubc.ca Does anyone know if there is any WWW site to access program for either 3D homology modelling program or program which allow a search of PDB database for 3D homology to a query 3D protein. Thanks in advance. Kah-Tong, Seow West East Centre Univ of British Columbia Vancouver seow@unixg.ubc.ca From owner-software@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!agate!library.ucla.edu!europa.eng.gtefsd.com!paladin.american.edu!newsfeed.ACO.net!osiris.wu-wien.ac.at!i102pc1.vu-wien.ac.at!seb From: seb@i102pc1.vu-wien.ac.at (Sebastian W. Bunka) Newsgroups: bionet.software Subject: Re: antigenic peptides Date: 2 Nov 1994 07:20:08 GMT Organization: Veterinary University Vienna Lines: 27 Message-ID: <397ej8$60c@osiris.wu-wien.ac.at> References: <1994Oct31.154032.18262@ciba-geigy.ch> Reply-To: Sebastian.Bunka@vu-wien.ac.at NNTP-Posting-Host: i102pc1.vu-wien.ac.at X-Newsreader: TIN [version 1.2 PL2] Kolbing Frank (kolbing@fmi.ch) wrote: : I am searching for programs able to reveal antigenic sites in a given : protein sequence. I know of two programs that include this: # Name=predict.exe [ 2Nov93, 82kb] Path=9/EMBnet BioInformation Resource EMBL/Software/dos/predict Host=felix.embl-heidelberg.de # Name=sqaid381.exe [ 2Nov93, 208kb] Path=9/EMBnet BioInformation Resource EMBL/Software/dos/sqaid381 Host=felix.embl-heidelberg.de # Both are PD/Shareware and are using the antigenicity calculation proc. of Welling et.al 1985. Predict shows a nice graph on this, but lacks output other than plotter. Seqaid does a lot on nucleic acid analysis, as well as protein analysis. The output is ascii graphics, but also raw data. These can be easily imported in gnuplot or ACE/gr (or other) for high quality graphics output. Hope this helps, Sebastian -- email: [ Sebastian.Bunka@vu-wien.ac.at ] voice: FAX: +43-1-71155260 +43-1-7149110 Location: earth, europe, austria, vienna Inst. of Bacteriology Vet.Univ. From owner-software@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!agate!library.ucla.edu!europa.eng.gtefsd.com!newsxfer.itd.umich.edu!caen!msuinfo!harbinger.cc.monash.edu.au!news.uwa.edu.au!darrins From: darrins@uniwa.uwa.edu.au (Darrin Smith) Newsgroups: bionet.software Subject: Re: PC Graphing software Date: 2 Nov 1994 04:49:43 GMT Organization: The University of Western Australia Lines: 29 Message-ID: <3975p7$llv@styx.uwa.edu.au> References: <38paba$5ip@ixnews1.ix.netcom.com> <38qski$jdh@vixen.cso.uiuc.edu> NNTP-Posting-Host: uniwa.uwa.edu.au X-Newsreader: TIN [version 1.2 PL2] larson eric (elarson@ux1.cso.uiuc.edu) wrote: : MOTULSKY@ix.netcom.com (Harvey Motulsky) writes: : >Try calling GraphPad Software and asking about their new Windows program, : >GraphPad Prism. 800-388-4723 : ===== : : Has anyone tried the WIndows version of Axum? : : I bought the DOS version and used it for a couple of years but abandoned it : because it was slow and klunky. I'm also not sure $164 is worth it to find : out they've just transferred their clunky DOS software (which had some very : unique attributes) to Windows. : -- : Eric Larson | University of Illinois at Urbana-Champaign : USDA/Agronomy | 190 PABL; 1201 W. Gregory; Urbana, IL 61801 : elarson@ux1.cso.uiuc.edu | Voice 217.244.3079 Fax 217.244.4419 : Fidonet: 1:233/4.1 | My opinions are my own, but correct :-) -- Get Graphpad PRISM. Anything else is just a waste of time.. Darrin Smith darrins@uniwa.uwa.edu.au Ph.D Student Department of Physiology University of Western Australia From owner-software@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!agate!library.ucla.edu!europa.eng.gtefsd.com!newsxfer.itd.umich.edu!zip.eecs.umich.edu!panix!ddsw1!godot.cc.duq.edu!hudson.lm.com!news.pop.psu.edu!psuvax1!news.ecn.bgu.edu!usenet.ins.cwru.edu!meds38936.BIOC.CWRU.Edu!samols From: samols@biochemistry.cwru.edu (David Samols) Newsgroups: bionet.software Subject: transcription element database Date: Wed, 2 Nov 1994 05:02:28 GMT Organization: CWRU Department of Biochemistry Lines: 3 Message-ID: NNTP-Posting-Host: meds38936.bioc.cwru.edu Keywords: transcription X-Newsreader: Trumpet for Windows [Version 1.0 Rev B] We are looking for a on-line database where we can search binding motifs of transcription factors for our promoter sequence. Can anyone suggest such a server to which we can send our sequence? From owner-software@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!biosci!not-for-mail From: RasMol Molecular Graphics Newsgroups: bionet.software,bionet.announce Subject: RasWin problems displaying ribbons Followup-To: bionet.software Date: 1 Nov 1994 20:29:40 -0800 Organization: Biocomputing Research Unit, University of Edinburgh Lines: 23 Sender: biohelp@net.bio.net Approved: bionews-moderator@net.bio.net Distribution: world Message-ID: NNTP-Posting-Host: net.bio.net Keywords: raswin, bug, strands, ribbons, v2.5.1 Xref: biosci bionet.software:9872 bionet.announce:1547 My sincerest apologies to all those people experiencing problems with the latest release of RasMol under Microsoft Windows. Any attempt to display all (or part) of a molecule as either a solid ribbon or parallel strands results in `undefined' behaviour such as the program crashing. This problem only effects the Microsoft Windows and OS/2 versions of RasMol. The Microsoft Windows NT, UNIX, VMS and Macintosh versions are not effected by this problem. This problem has now been corrected and a new version of "raswin.zip" may be obtained by anonymous FTP from ftp.dcs.ed.ac.uk in the directory /pub/rasmol. For those users not wishing to download the source, example files, online-help or documentation again, the file "raswin.exe" is also available in this directory. My many thanks to the users that pointed this error out to me. I'm sorry for any inconvenience this may have caused. Roger -- Roger Sayle INTERNET: ras32425@ggr.co.uk Glaxo Research Inc (GRI) rasmol@ggr.co.uk Venture Centre, Emperor Boulevard Tel: (+1) (919) 941 4023 (direct line) RTP, North Carolina, USA. Fax: (+1) (919) 941 3704 From owner-software@net.bio.net Tue Nov 01 22:00:00 1994 Newsgroups: bionet.software,sci.edu,sci.chem Path: biosci!agate!overload.lbl.gov!lll-winken.llnl.gov!uwm.edu!news.alpha.net!news.mathworks.com!europa.eng.gtefsd.com!howland.reston.ans.net!cs.utexas.edu!utnut!nott!cunews!szikopou From: szikopou@superior.carleton.ca (Steven Zikopoulos) Subject: Re: Want shareware "ChemDraw-like" program for Mac Message-ID: Sender: news@cunews.carleton.ca (News Administrator) Organization: Carleton University References: Date: Wed, 2 Nov 1994 01:30:38 GMT Lines: 25 Xref: biosci bionet.software:9871 sci.edu:3459 sci.chem:18754 In reuber@hydra.rose.brandeis.edu (Kent Reuber) writes: chem-edit is a _freeware_ program available for the mac via ftp. it was written some time ago (1989) so i don't think it supports colour if you need it. i find it quite good and easy to use. it will even create 3-d models from your 2d image. >I have a request from a professor in the BioChem department for a >shareware 2D ChemDraw like program for the Mac. Basically, he wants to be >able to draw the rings, bonds, etc. and paste it into a word processor. >It seems like you could do a fair amount of this in a full function >drawing program such as Canvas, but I'd like to see if there are >alternative programs in the Shareware world first. >Please respond by mail. >-- >Kent Reuber >Computational Specialist >Brandeis University Biology Dept. >reuber@hydra.rose.brandeis.edu -- Steven Zikopoulos From owner-software@net.bio.net Tue Nov 01 22:00:00 1994 Newsgroups: bionet.software Path: biosci!bcm!news.msfc.nasa.gov!sol.ctr.columbia.edu!usenet.ucs.indiana.edu!sunflower.bio.indiana.edu!gilbertd From: gilbertd@sunflower.bio.indiana.edu (Don Gilbert) Subject: Re: Looking for Mac version of RNA fold program Message-ID: Sender: news@usenet.ucs.indiana.edu (USENET News System) Nntp-Posting-Host: sunflower.bio.indiana.edu Organization: Biology, Indiana University - Bloomington References: <38sdvf$aem@nnrp.ucs.ubc.ca> Date: Tue, 1 Nov 1994 23:16:08 GMT Lines: 19 This is a port of Michael Zuker's MFOLD (from about 1990 or 1991) Name=mulfold.hqx [14May91, 285kb] Path=0/IUBio-Software+Data/molbio/mac/mulfold Host=ftp.bio.indiana.edu Port=70 URL: gopher://ftp.bio.indiana.edu/40/IUBio-Software%2bData/molbio/mac/mulfold This is a program for viewing output of MulFold Name=loopviewer.hqx [14May91, 153kb] Path=0/IUBio-Software+Data/molbio/mac/loopviewer Host=ftp.bio.indiana.edu Port=70 URL: gopher://ftp.bio.indiana.edu/40/IUBio-Software%2bData/molbio/mac/loopviewer -- -- d.gilbert--biocomputing--indiana u--bloomington--gilbertd@bio.indiana.edu From owner-software@net.bio.net Tue Nov 01 22:00:00 1994 Newsgroups: bionet.software Path: biosci!rutgers!uwm.edu!lll-winken.llnl.gov!overload.lbl.gov!dog.ee.lbl.gov!news.cs.utah.edu!emba-news.uvm.edu!brianf From: brianf@med.uvm.edu (Brian Foley) Subject: Re: DNA seq intron/exon boundary search program for Mac ? Message-ID: <1994Nov2.205709.322@emba.uvm.edu> Sender: news@emba.uvm.edu Organization: EMBA Computer Facility, University of Vermont X-Newsreader: TIN [version 1.2 PL1] References: <37mik9$hi4@guru.med.cornell.edu> Date: Wed, 2 Nov 1994 20:57:09 GMT Lines: 137 Peter Hinely (phinely@uhunix.uhcc.Hawaii.Edu) wrote: : In article <37mik9$hi4@guru.med.cornell.edu> jsmith@med.cornell.edu (jsmith) writes: : >We're looking for a Mac program that will allow us to identify : >intron/exon boundaries in genomic DNA sequences. Does anyone have any : >good suggestions of shareware or commercial packages that will do this I doubt any commercial or shareware programs use algorithms as powerful, well-documented and thoroughly tested as those in use by: The Baylor College Of Medicine Computational Biology Group Houston, TX re-announces a new service The BCM Genefinder. *************************************************************************** *********** NOTE ADDRESSES AND FORMATS HAVE CHANGED!! ********************* *************************************************************************** The services are FGENEH, FEXH, HEXON, HSPL, SSP, and NNSSP. This message details FGENEH; subsequent messages will detail FEXH, HEXON, HSPL, SSP, and NNSSP. NOTE: This service is temporarily being provided through the University of Houston Gene-Server. Only two jobs will be run at a time. FGENEH - Prediction of gene structure in Human DNA sequences (Version 2. 10.5.94) Department of Cell Biology, Baylor College of Medicine ========================================================================= Analysis of uncharacterized human sequences is available through the University of Houston Gene-Server by sending the file containing a sequence (a sequence name is in the first string) to service@bchs.uh.edu with the subject line "fgeneh". Example: mail -s fgeneh service@bchs.uh.edu < test.seq where test.seq a file with the sequence. Method description: ********************** Algorithm firstly predicts all possible potential internal exons, and potential 5' and 3'-exon for each internal by linear discriminant functions combining characteristics describing various contextual features of these exons. Then by method of dynamic programming it searches for optimal combination of these exons and construct gene model. Accuracy: ************ The accuracy have been estimated for the set of 193 complete human gene entries extracted from GenBank. The accuracy of precise exon recognition is 81% with a specificity of 79%. The recognition quality computed at the level of individual nucleotides is 90% for exons sequences (Sp=93%). For exon prediction in partially sequenced genes you can use "fexh" (5'-, internal and 3'-exon prediction) and "hexon" (internal exon prediction) programs from the Gene_Server. Submitting sequences via email: ******************************* For email submission the sequences must have the following format: Name of your sequence ccatctctgtcttgcaggacaatgccgtcttctgtctcgtggggcatcctcctgctggca ggcctgtgctgcctggtccctgtctccctggctgaggatccccagggagatgctgcccag aagacagatacatcccaccatgatcaggatcacccaaccttcaacaagatcacccccaac ctggctgagttcgccttcagcctataccgccagctggcacaccagtccaacagcaccaat atcttcttctccccagtgagcatcg............... (Restrict the line length to 80 characters or less). You have to send the file containing the sequence to: service@bchs.uh.edu Subject line must be: fgeneh Example: mail -s fgeneh service@bchs.uh.edu < test.seq Fgeneh output: **************** 1st line - name of your sequence 2nd line - length of your sequence 3d line - number of potential exons 4th line and next - positions of predicted exons For example: HUMALPHA 4556 bp ds-DNA PRI 15-SEP-1 length of sequence - 4556 number of potential exon: 10 380 - 516 611 - 727 839 - 954 1147 - 1321 1819 - 1953 2053 - 2125 2254 - 2388 2470 - 2661 2881 - 2997 3120 - 3562 Reference: 1. Solovyev V.V.,Salamov A.A., Lawrence C.B. Predicting internal exons by oligonucleotide composition and discriminant analysis of spliceable open reading frames. (Nucl.Acids Res.,1994, in press). 2. Solovyev V.V., Salamov A.A. , Lawrence C.B. The prediction of human exons by oligonucleotide composition and discriminant analysis of spliceable open reading frames. in: The Second International conference on Intelligent systems for Molecular Biology (eds. Altman R., Brutlag D., Karp R., Latrop R. and Searls D.), AAAI Press, Menlo Park, CA (1994, in press) 3. Solovyev,V., Lawrence,C.B. Prediction of human gene structure using dynamic programming and oligonucleotide composition. In: Abstracts of the 4th annual Keck symposium. Pittsburgh, 47,1993. Problems, comments, and suggestions: can be mailed to solovyev@cmb.bcm.tmc.edu. -- ******************************************************************** * Brian Foley * If we knew what we were doing * * Molecular Genetics Dept. * it wouldn't be called research * * University of Vermont * * ******************************************************************** From owner-software@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!rutgers!gatech!howland.reston.ans.net!news.sprintlink.net!news.infi.net!larry!tmeade From: tmeade@larry.wyvern.com (Tony Meade) Newsgroups: bionet.software Subject: Medical Software Date: 2 Nov 94 22:59:25 GMT Organization: InfiNet Lines: 23 Distribution: usa Message-ID: NNTP-Posting-Host: larry.infi.net Summary: Practice Management Made Easy Modern Technology sure has changed things when it comes to equipment and procedures for doctors. In the past, office managers, billing and insurance clerks have had to schedule and reschedule appointments by hand, hoping they don't somehow overlap. All insurance claims had to be filed by hand and even with some typed on a typewriter. Accounts receivables were done manually, hoping that errors were not made. But now with a computer, modem, and a practice management software package that works like a health care practice works, following the same simple steps as a manual accounting system only easier and less time consuming, doctors can save valuable time and money. If you would like more information on how your office can operate more effectively, please send an e-mail to tmeade@infi.net or call (804) 471-5385. -- Tony Meade tmeade@infi.net Medical Services 2001 Phone: (804)-471-5385 Fax: (804)-471-5663 From owner-software@net.bio.net Tue Nov 01 22:00:00 1994 Newsgroups: bionet.software,sci.edu,sci.chem Path: biosci!agate!darkstar.UCSC.EDU!news.hal.COM!olivea!charnel.ecst.csuchico.edu!yeshua.marcam.com!news.mathworks.com!udel!gatech!howland.reston.ans.net!cs.utexas.edu!utnut!nott!cunews!szikopou From: szikopou@superior.carleton.ca (Steven Zikopoulos) Subject: Re: Want shareware "ChemDraw-like" program for Mac Message-ID: Sender: news@cunews.carleton.ca (News Administrator) Organization: Carleton University References: <397mps$3g0@freenet3.scri.fsu.edu> Date: Wed, 2 Nov 1994 20:48:29 GMT Lines: 19 Xref: biosci bionet.software:9890 sci.edu:3462 sci.chem:18791 In <397mps$3g0@freenet3.scri.fsu.edu> dbradley@freenet1.scri.fsu.edu (David Bradley) writes: >Steven Zikopoulos (szikopou@superior.carleton.ca) wrote: >: In reuber@hydra.rose.brandeis.edu (Kent Reuber) writes: >: chem-edit is a _freeware_ program available for the mac via ftp. it >: was written some time ago (1989) so i don't think it supports colour if >: you need it. i find it quite good and easy to use. it will even >: create 3-d models from your 2d image. >Is there a Windows version or related package ftpable anywhere? not sure. i'm not running on a windows platform. i would guess there is but finding it is another matter. -- Steven Zikopoulos From owner-software@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!rutgers!gatech!udel!news.sprintlink.net!EU.net!uunet!heifetz.msen.com!emory!usenet From: bcresas@bimcore.emory.edu (Scott Sammons) Newsgroups: bionet.software.gcg,bionet.software,bionet.molbio.embldatabank Subject: E. coli Database Collection --> GCG format Date: 2 Nov 1994 20:28:59 GMT Organization: Biomolecular Computing Resource, Emory University Lines: 16 Distribution: world Message-ID: <398sqb$79b@emory.mathcs.emory.edu> Reply-To: bcresas@bimcore.emory.edu NNTP-Posting-Host: bimcore.cc.emory.edu Xref: biosci bionet.software.gcg:801 bionet.software:9889 bionet.molbio.embldatabank:384 Greetings: Has anyone successfully reformatted the ECD data into GCG formatted databases. The program embltogcg core dumps when I try it with one of the ECD .dat files. Scott Sammons ======================================================================= | Scott A. Sammons (404) 727-2780 | | Emory University FAX: (404) 727-3659 | | Biomolecular Computing Resource | | 3025 Rollins Research Center Email: sammons@bimcore.emory.edu | | Atlanta, GA 30322 | ======================================================================= From owner-software@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!agate!spool.mu.edu!uwm.edu!cs.utexas.edu!swrinde!pipex!lyra.csx.cam.ac.uk!tjrc1 From: tjrc1@cus.cam.ac.uk (Tim Cutts) Newsgroups: bionet.software Subject: ANNOUNCE: Refs 7.5 reference management software Date: 2 Nov 1994 10:25:22 GMT Organization: University of Cambridge, England Lines: 88 Message-ID: <397pei$3g3@lyra.csx.cam.ac.uk> NNTP-Posting-Host: ursa.cus.cam.ac.uk Keywords: Windows, shareware, MedLine, ISI, Chemical Abstracts X-Newsreader: NN version 6.5.0 #2 (NOV) Are you tired of waiting for EndNote for Windows to appear? Do you want to get your references sorted out with the minimum of hassle, and expense? Do you want a flexible, easy-to-use Windows program? Do you want to be able to import your on-line literature searches straight into your reference database, from formats such as MedLine, Current Contents, Chemical Abstracts and ISI? Do you want to be able to compile bibliographies from multiple source databases? Do you want full control over how your references are sorted, and rapid searching? If you want any of these features, they are all found in the current version of Refs. INTRODUCTION ============ Refs is a small Windows program (it will take up about 200k of your hard disk), designed to be as flexible and extensible as possible. It maintains databases in the standard Unix refer format, which means that its files can be used with a whole host of other reference management programs, including EndNote for the Macintosh and WinRefer. It comes with modules for reading Medline, ISI, Chemical Abstracts and Current Contents file formats, and is supplied with programming information for writing your own filters. The older version, 7.42, is also available from the same site as this one, and comes with a module for operation in German, which 7.5 does not yet have. It has a simple Multiple Document Interface, so you can load and search multiple databases simultaneously, and drag and drop references from one database to another. It allows you to format bibliographies in a style you choose, and this can then be printed out, saved to disk or copied to the clipboard for pasting into other programs. HOW MUCH DOES THIS COST? ======================== A single user licence for Refs is 30 pounds sterling. There are discounts for purchases of four or more licences. More details and an order form can be found in the help file. WHERE DO I GET REFS? ==================== Refs 7.5 is available on both the World Wide Web, and for anonymous FTP: WWW: http://cyclin.zoo.cam.ac.uk/ FTP: cyclin.zoo.cam.ac.uk Refs 7.42 is also available from this site, and can also be found on CICA mirror, under the win3/utils directory. CONTACTING THE AUTHOR ===================== If you have any queries, please send them to me: tjrc1@cus.cam.ac.uk Best regards, Tim Cutts. -- ------------------------------------------------------------------------------- 194, Vinery Rd, Cambridge, CB1 3DS, UK (+44) 1223 572622 http://cyclin.zoo.cam.ac.uk/ ------------------------------------------------------------------------------- From owner-software@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!agate!howland.reston.ans.net!gatech!news-feed-1.peachnet.edu!news.duke.edu!godot.cc.duq.edu!newsfeed.pitt.edu!dsinc!netnews.upenn.edu!amalthea.humgen.upenn.edu!tisdall From: tisdall@amalthea.humgen.upenn.edu (James Tisdall) Newsgroups: bionet.software Subject: Re: DNA Workbench for X-windows Date: 3 Nov 1994 16:24:29 GMT Organization: University of Pennsylvania Lines: 65 Message-ID: <39b2rt$sie@netnews.upenn.edu> References: <39arfu$dol@inet.up.ac.za> NNTP-Posting-Host: amalthea.humgen.upenn.edu In article <39arfu$dol@inet.up.ac.za> fourie@ccnet.up.ac.za writes: > >Hi > >I saw in TIBS that a X-windows version for DNA Workbench is >available... >Does anyone know where I can find this? > >Thanks! > >--- >Fourie Joubert >Department of Biochemistry >University of Pretoria >fourie@ccnet.up.ac.za >http://sungtiger.ee.up.ac.za/biodocs >+27-12-420-2011 > Hi. I'm the author. Actually, I think the article stated that the xwindows version was in development - I'm not sure, I don't have a copy here. I've got a mostly-working xwindows version. It requires that you have the tcl/tk "wish" program available. Also, not everything works, but most things do. I can send it to you if you send me email requesting it. I'm planning on releasing a version of DNA WorkBench that includes xwindows support for the Unix users. It will be based on the new version 5 of the "perl" language, that includes a "Tk extension". Now, perl version 5 has just been officially released. The Tk extension is still in alpha testing. (Which means it still has a way to go before its official release.) Finally, I've just begun porting DNA WorkBench from its perl4-wish version to the new perl5-tk version. So it will be some weeks before I announce it here. There are plans afoot to make Tk work on macs and on IBM pc's with windows - that will probably take awhile to be accomplished, but is one reason I'm using the language(s) that I'm using. (Also, perl and tk are free and have large and growing followings.) I have used perl 5 w/Tk for another application - a fingerprint data visual editor - and perl w/Tk is not too bad for software writing even in its "alpha" development stage. In related news, things look very promising for VMS and IBMpc users with internet hookups to use DNA WorkBench. The new version 5 of perl has prompted a flurry of porting work. I'll make announcements here when these become available for DNA WorkBench. Finally, I'm swapping coasts soon - from Philadelphia to San Francisco. My current email is tisdall@gradient.cis.upenn.edu - soon it will be tisdall@mercator.com Either one should work for some time. Jim ====================================================================== James Tisdall Departments of Genetics and Computer and Information Science Computational Biology and Informatics Laboratory, Human Genome Project University of Pennsylvania, Philadelphia, Pennsylvania, USA tisdall@cbil.humgen.upenn.edu 215-573-3113 fax 215-573-3111 ====================================================================== From owner-software@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!daresbury!bioftp.unibas.ch!citi2.fr!jussieu.fr!cea.fr!usenet From: cisitm@albert.cad.cea.fr (Pierre Didierjean) Newsgroups: bionet.software Subject: *** Q: WHAT KIND OF PEOPLE ON THE NET ? Date: 3 Nov 1994 16:17:34 GMT Organization: SSII Lines: 28 Sender: cisitm@albert.cad.cea.fr Message-ID: <39b2eu$9ql@anemone.saclay.cea.fr> NNTP-Posting-Host: nyassa.cad.cea.fr I'd like to know what kind of people i find on the net. Students, Commercials, Adminitrations, Scientifics or what ?? Is anybody knows that or have statistical results ? What are YOU doing in life ? I am a system administrator. Thanks for the answers and sorry for my english ..... Bye +-----------------------------------------------------------------------------+ | Pierre DIDIERJEAN | | | | Administrateur Systeme UNIX | | Cisi, Aix-en-Provence | | France | +-----------------------------------------------------------------------------+ | email : cisitm@albert.cad.cea.fr | +-----------------------------------------------------------------------------+ From owner-software@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!agate!howland.reston.ans.net!EU.net!uknet!strath-cs!st-and!Aberdeen!u02dg From: u02dg@nof.abdn.ac.uk (u02dg) Newsgroups: bionet.software,sci.edu,sci.chem,sci.chem.electrochem,sci.chem.organomet Subject: Re: Want shareware "ChemDraw-like" program for Mac Date: 3 Nov 1994 15:29:52 GMT Organization: University of Aberdeen, Scotland Lines: 27 Message-ID: <39avlg$cq2@nof.abdn.ac.uk> References: <397mps$3g0@freenet3.scri.fsu.edu> NNTP-Posting-Host: emps.abdn.ac.uk X-Newsreader: TIN [version 1.2 PL2] Xref: biosci bionet.software:9908 sci.edu:3466 sci.chem:18835 sci.chem.electrochem:600 sci.chem.organomet:507 David Bradley (dbradley@freenet1.scri.fsu.edu) wrote: : : chem-edit is a _freeware_ program available for the mac via ftp. it : : was written some time ago (1989) so i don't think it supports colour if : : you need it. i find it quite good and easy to use. it will even : : create 3-d models from your 2d image. : Is there a Windows version or related package ftpable anywhere? I think there's one available called hyperchem (there's a copy of it in our department) but I'm not sure if it's shareware or not. How about one for X-windows? Preferably which will dump out PostScript format images for inclusion to other documents (e.g. FrameMaker/LaTeX). Dave. +---------------------------------------------------------------------------+ | u02dg@abdn.ac.uk | | http://www.abdn.ac.uk/~u02dg | +---------------------------------------------------------------------------+ | | | Hourn-de-scourbee-doo- | | dee- ... | | Bork!Bork!Bork! | | | +---------------------------------------------------------------------------+ From owner-software@net.bio.net Wed Nov 02 22:00:00 1994 Newsgroups: bionet.software Path: biosci!agate!howland.reston.ans.net!vixen.cso.uiuc.edu!uchinews!beroe.uchicago.edu!user From: vam2@midway.uchicago.edu (Viraj Master) Subject: Re: Software for comparing sequence homology from GenBank server? Message-ID: Sender: news@uchinews.uchicago.edu (News System) Organization: University of Chicago References: <1994Nov2.220357.1622@emba.uvm.edu> Date: Thu, 3 Nov 1994 16:18:58 GMT Lines: 27 In article <1994Nov2.220357.1622@emba.uvm.edu>, brianf@med.uvm.edu (Brian Foley) wrote: > If you have a WWW browser, you should find out more about > ENTREZ. The ENTREZ service is now available on the web: > > http://www.ncbi.nlm.nih.gov/Search/Entrez/index.html > > > You have to register your machine (IP address) to get full > function from Netwrok-ENTREZ or WWW-ENTREZ, but once you do, you > will have a world of info at your fingertips. Hi Brian Sorry if this is a FAQ, but *how* does one go about registering one's machine to get full function from Entrez? Thanks Viraj -- Viraj Master Dept. of Organismal Biology and Anatomy University of Chicago From owner-software@net.bio.net Wed Nov 02 22:00:00 1994 Newsgroups: bionet.software Path: biosci!lhc!gold!epstein From: epstein@gold.nlm.nih.gov (Jonathan Epstein) Subject: Re: Software for comparing sequence homology from GenBank server? Message-ID: <1994Nov3.141819.14520@nlm.nih.gov> Sender: news@nlm.nih.gov Organization: National Library of Medicine X-Newsreader: TIN [version 1.2 PL2] References: <1994Nov2.220357.1622@emba.uvm.edu> Date: Thu, 3 Nov 94 14:18:19 GMT Lines: 54 Brian Foley (brianf@med.uvm.edu) wrote: > Jason L. Buberel (jbuberel@uiuc.edu) wrote: > : Could someone please let me know if there is a simple (straighforward) way > : to ask GenBank (or a similar service) to compare sequence homology for me > : if I give it the names of several related genes (or same gene between > : different species). We are trying to find conserved areas among the > : cytochrome enzyme genes. We have played with the GenBank web site, > If you have a WWW browser, you should find out more about > ENTREZ. The ENTREZ service is now available on the web: > http://www.ncbi.nlm.nih.gov/Search/Entrez/index.html > You have to register your machine (IP address) to get full > function from Netwrok-ENTREZ or WWW-ENTREZ, but once you do, you > will have a world of info at your fingertips. Thanks for pointing out this information, Brian. I want to clarify, though, that registration is _not_ required to use WWW-Entrez, although it is required for Network Entrez. Information regarding both of these services, as well as the Entrez CD-ROM is available by following the "Entrez Browser" hypertext link from the above WWW page. Information about Network Entrez is also available by viewing the file ftp://ncbi.nlm.nih.gov/entrez/network/README or by writing to net-info@ncbi.nlm.nih.gov. > ENTREZ has not only gene and protein sequences, but also a > large subset of medline (articles pertaining to genes and proteins > are there, clinical trials and such are not). > ENTREZ also has a VERY POWERFUL "neighboring" function. > NCBI has already compared every sequence to every other one, so if > you select a gene, protein or medline abstract and click the > "neighbors" button, ENTREZ will show you the other genes, proteins > or abstracts that are most similar to the one you selected. > -- > ******************************************************************** > * Brian Foley * If we knew what we were doing * > * Molecular Genetics Dept. * it wouldn't be called research * > * University of Vermont * * > ******************************************************************** - Jonathan Jonathan Epstein epstein@ncbi.nlm.nih.gov National Center for Biotechnology Information Phone: (301)496-2475 National Library of Medicine Building 38A, Room 8N805 National Institutes of Health 8600 Rockville Pike Bethesda, MD 20894 From owner-software@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!agate!howland.reston.ans.net!ee.und.ac.za!inet.up.ac.za!news From: root@biochem.up.ac.za (Fourie Joubert) Newsgroups: bionet.software Subject: DNA Workbench for X-windows Date: 3 Nov 1994 14:18:38 GMT Organization: University of Pretoria Lines: 17 Message-ID: <39arfu$dol@inet.up.ac.za> Reply-To: fourie@ccnet.up.ac.za NNTP-Posting-Host: biochem.up.ac.za Hi I saw in TIBS that a X-windows version for DNA Workbench is available... Does anyone know where I can find this? Thanks! --- Fourie Joubert Department of Biochemistry University of Pretoria fourie@ccnet.up.ac.za http://sungtiger.ee.up.ac.za/biodocs +27-12-420-2011 From owner-software@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!agate!howland.reston.ans.net!xlink.net!news.urz.uni-heidelberg.de!cbb From: cbb@convex.phazc.uni-heidelberg.de (Christopher Blencowe) Newsgroups: bionet.software Subject: Re: 3D homology modelling on WWW? Date: 3 Nov 1994 13:51:30 GMT Organization: University of Heidelberg, Germany Lines: 14 Distribution: world Message-ID: <39apt2$ehc@sun0.urz.uni-heidelberg.de> References: <3989dn$q29@sun2.ruf.uni-freiburg.de> NNTP-Posting-Host: iris.phazc.uni-heidelberg.de X-Newsreader: TIN [version 1.2 PL2] Clemens Vonrhein (vonrhein@bio5.chemie.uni-freiburg.de) wrote: : In article , seow@unixg.ubc.ca (Kah-Tong, Seow) writes: : |> Does anyone know if there is any WWW site to access program for either 3D : |> homology modelling program or program which allow a search of PDB database : |> for 3D homology to a query 3D protein. Thanks in advance. : |> : |> Kah-Tong, Seow : |> West East Centre : |> Univ of British Columbia : |> Vancouver : |> seow@unixg.ubc.ca : There is something like swiss-model at http://expasy.hcuge.csh. Maybe some people tried also, thsi should be http://expasy.hcuge.ch From owner-software@net.bio.net Wed Nov 02 22:00:00 1994 Newsgroups: bionet.software Path: biosci!rutgers!gatech!howland.reston.ans.net!EU.net!uknet!bcc.ac.uk!martin From: martin@bsm.bioc.ucl.ac.uk (Andrew Martin) Subject: Re: Antibody 3D Modeling Message-ID: <1994Nov3.113245.29976@ucl.ac.uk> Date: Thu, 3 Nov 1994 11:32:45 GMT References: <9410280638.AA09746@yl05hp.tb.noda.sut.ac.jp> Organization: University College London X-Newsreader: TIN [version 1.2 PL2] Lines: 42 Hiroyoshi Ohba (ohba@YL05HP.TB.NODA.SUT.AC.JP) wrote: : HELLO Netters; : Is there any software which assembles three-dimesional structure of : antibody Fab? Now, I am not familier with structural biology but like to : analyse the effect of molecular modification of antibody. I have tried AbM : of Oxford Molecular Ltd which has been developed by Prof. Tony Rees's Lab. : It works on the stand-alone Silicon Graphics and HP workstations. In my : case on assembling human Fab from its amino-acid sequence, enormous time : (days) was required for caliculation. Would you suggest quicker softwares : on faster machines, or software employing other argorisms? All of your : comments are welcomed. Hi Hiroyoshi, I'm the original author of the academic version of the AbM package while I was working in Tony's lab. in Oxford before he moved to Bath. Andrew Henry's comments are all pretty valid; you can make a crude model quickly, but you have to make a trade-off between time and quality of the model. With longer loops once will always have problems, whatever method is employed; the structural database is not really saturated for loops longer than about 7 amino acids while conformational search methods take *really* long times for longer loops (a full conf. search of a 17 residue loop would take around 250000 years on something like an Indy!!!) AbM therefore makes a tradeoff of using the database to build most of the loop, but reconstructing a small section (by default the middle of the loop, but you can choose) which yo think is most likely to be involved in antigen interactions or surrounding a mutation site. I really don't think there is a better way of doing things at present, but I'm working on it!! Andrew -- **************************************************************************** Dr. Andrew C.R. Martin, University College London & SciTech Software INTERNET: martin@bsm.bioc.ucl.ac.uk Tel: (Work) +44(0)71 387 7050 X3284 JANET: martin@uk.ac.ucl.bioc.bsm (Home) +44(0)372 275775 **************************************************************************** From owner-software@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!agate!howland.reston.ans.net!gatech!newsxfer.itd.umich.edu!news.itd.umich.edu!jddecker From: jddecker@umich.edu (Jim Decker) Newsgroups: bionet.software Subject: Soliciting comments on Sequence Analysis Software Date: 3 Nov 1994 14:52:04 GMT Organization: univ. mich. Lines: 9 Sender: jddecker@gamera.rs.itd.umich.edu. Message-ID: <39atek$hlf@lastactionhero.rs.itd.umich.edu> NNTP-Posting-Host: dent-226-97.dentistry.umich.edu X-Posted-From: InterNews 1.0@lastactionhero.rs.itd.umich.edu. I am soliciting comments on sequence analysis software that is personal computer based. We are currently using GCG on the vax and find it quite cumbersome and overall difficult to use. I have sent away for a thirty day trial of the Intelligenetics PC/Gene. I can use either a MAC or Dos-Windows format. Thanks for your help. James D. Decker University of Michigan From owner-software@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!rutgers!gatech!howland.reston.ans.net!pipex!lyra.csx.cam.ac.uk!nntp-serv.cam.ac.uk!pmr From: pmr@staffa.sanger.ac.uk (Peter Rice) Newsgroups: bionet.software.gcg,bionet.software,bionet.molbio.embldatabank Subject: Re: E. coli Database Collection --> GCG format Date: 03 Nov 1994 09:45:14 GMT Organization: University of Cambridge, England Lines: 24 Distribution: world Message-ID: References: <398sqb$79b@emory.mathcs.emory.edu> NNTP-Posting-Host: staffa.sanger.ac.uk In-reply-to: bcresas@bimcore.emory.edu's message of 2 Nov 1994 20:28:59 GMT Xref: biosci bionet.software.gcg:802 bionet.software:9901 bionet.molbio.embldatabank:385 In article <398sqb$79b@emory.mathcs.emory.edu> bcresas@bimcore.emory.edu (Scott Sammons) writes: > Has anyone successfully reformatted the ECD data into GCG formatted databases. > The program embltogcg core dumps when I try it with one of the ECD .dat > files. As I am involved in both ECD and EGCG, I will try to put something into EGCG 8.0 when it is ready. I take it you are referring to the very latest (new format) ECD here. Do you mean the genorf.dat file or the contigs/*.dna files (which are closer to EMBL format and have more sequence data)? Beware though - E.coli sequencing is now going so well that ECD has a contig (and more to follow) over the 350k mark, which will give some problems with GCG. Another option would be to use a script (or Perl) to reformat into enough of an "EMBL" format for EMBLtoGCG to accept it. -- ------------------------------------------------------------------------ Peter Rice | Informatics Division E-mail: pmr@sanger.ac.uk | The Sanger Centre Tel: (44) 1223 494967 | Hinxton Hall, Hinxton, Fax: (44) 1223 494919 | Cambs, CB10 1RQ URL: http://www.sanger.ac.uk/~pmr | England From owner-software@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!bloom-beacon.mit.edu!gatech!newsxfer.itd.umich.edu!caen!spool.mu.edu!mnemosyne.cs.du.edu!nyx.cs.du.edu!not-for-mail From: mhollowa@nyx.cs.du.edu (Michael Holloway) Newsgroups: bionet.general,bionet.software Subject: Importance of computer communications in research? Date: 2 Nov 1994 21:49:21 -0700 Organization: University of Denver, Dept. of Math & Comp. Sci. Lines: 34 Message-ID: <399q4h$bj8@nyx.cs.du.edu> NNTP-Posting-Host: nyx.cs.du.edu Xref: biosci bionet.general:11846 bionet.software:9900 Your input would be greatly appreciated. I'd like to conduct an informal survey of the bionet community to gauge the extent to which end users have access to the net and graphical interfaces for net tools. I hope to use the response as evidence that greater emphasis needs to be placed on end user access at my institution, which is not BTW the University of Denver. I have to telnet here in order to use a half way decent newsreader. My institution's concern over security necessitates using an old miniVax as a fire wall and allowing the use of only VMS text based software. Those who can afford it are allowed to shell out $10,000 for an X-terminal for use with the Vax. A VMS proxy server, whose performance with various kinds of client/servers is unknown to us, is mentioned as a solution for some indeterminant time in the future. Does your institution give you the opportunity to directly access your gateway, with or without a proxy server, and thereby make use of communications software that you can run from your own machine, Mosaic for instance? Do you currently have to log into a remote system? Do you feel text based tools under VMS are sufficient for making full use of computer communications for molecular biology? Do you find newsgroup access, conferring with your collegues remotely, to be useful? Do you think that a VMS newsreader should be as good as anything else? How important do you think a graphical interface is for using the tools available now and in the future? Does the convenience have an impact on how you use computer communications? If the topic is of general interest I'll summarize and post any responses I receive via e-mail. Thanks, Mike Holloway mike.holloway@stjude.org From owner-software@net.bio.net Wed Nov 02 22:00:00 1994 Newsgroups: bionet.software Path: biosci!rutgers!gatech!howland.reston.ans.net!usc!crash!rcdana From: rcdana@crash.cts.com (Richard Dana) Subject: Database wanted plants/pictures Organization: CTS Network Services (CTSNET), San Diego, CA Date: Thu, 3 Nov 1994 02:39:23 GMT Message-ID: X-Newsreader: TIN [version 1.2 PL2] Sender: news@crash.cts.com (news subsystem) Nntp-Posting-Host: crash.cts.com Lines: 6 I am trying to put together a database of information on plants and pictures of each plant. What should I do? Richard Dana From owner-software@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!rutgers!gatech!usenet.ins.cwru.edu!meds38936.BIOC.CWRU.Edu!samols From: samols@biochemistry.cwru.edu (David Samols) Newsgroups: bionet.software Subject: Transcription cis-element database? Date: Thu, 3 Nov 1994 03:49:02 GMT Organization: CWRU Department of Biochemistry Lines: 2 Message-ID: NNTP-Posting-Host: meds38936.bioc.cwru.edu Keywords: transcription X-Newsreader: Trumpet for Windows [Version 1.0 Rev B] We are looking for a on-line data base to search possible cis-elements in our promoter sequence. Where can we send our sequence to? From owner-software@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!agate!auxin.hip.berkeley.edu!user From: tjyeh@soda.CSUA.berkeley.edu (Raymond Yeh) Newsgroups: bionet.software Subject: More of DNA Sequence programs Date: Wed, 02 Nov 1994 19:01:06 -0800 Organization: UC Berkeley Lines: 9 Message-ID: NNTP-Posting-Host: auxin.hip.berkeley.edu Does anyone out there use DNA sequece programs like GeneWorks, MacDnasis, MacVector, GeneJockeyII, etc.? I would really like people's opinions on these programs, as my lab is looking into buying one of these programs. Any help would be greatly appreciated. Thanks, Raymond Yeh tjyeh@soda.csua.berkeley.edu From owner-software@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!agate!news.ucdavis.edu!library.ucla.edu!news.mic.ucla.edu!hodgkin.mbi.ucla.edu!arne From: arne@hodgkin.mbi.ucla.edu (Arne Elofsson) Newsgroups: bionet.software Subject: Re: 3D homology modelling on WWW? Date: 3 Nov 1994 01:24:21 GMT Organization: OrgFreeware Lines: 25 Distribution: world Message-ID: <399e45$dgl@news.mic.ucla.edu> References: <3989dn$q29@sun2.ruf.uni-freiburg.de> Reply-To: arne@hodgkin.mbi.ucla.edu (Arne Elofsson) NNTP-Posting-Host: hodgkin.mbi.ucla.edu Some of my favourites: Gopher server at Stanford gopher://genome-gopher.stanford.edu/11/topic/structural and of course: The NIH Molecular Modeling Home Page http://www.nih.gov/molecular_modeling/mmhome.html arne -- ****************************************************************************** ** From: Arne Elofsson ** ** Fax: +1-(310)-206-3914 or Fax: +1-(310)-206-7286 ** ** Tel: +1-(310)-825-1402 ** ** ** ** Email: arne@hodgkin.mbi.ucla.edu (arne@uclaue.mbi.ucla.edu) ** ** ** ** Adress: Molecular Biology Institute Home: 1370 Veteran #311 ** ** 405 Hilgard Avenue, UCLA Los Angeles ** ** Los Angeles CA 90024 ** ** 90024-1570 California USA ** ** USA Tel: +1-(310)-268-8006 ** ****************************************************************************** From owner-software@net.bio.net Wed Nov 02 22:00:00 1994 Newsgroups: bionet.software Path: biosci!agate!dog.ee.lbl.gov!news.cs.utah.edu!emba-news.uvm.edu!brianf From: brianf@med.uvm.edu (Brian Foley) Subject: Re: Software for comparing sequence homology from GenBank server? Message-ID: <1994Nov2.220357.1622@emba.uvm.edu> Sender: news@emba.uvm.edu Organization: EMBA Computer Facility, University of Vermont X-Newsreader: TIN [version 1.2 PL1] References: Date: Wed, 2 Nov 1994 22:03:57 GMT Lines: 32 Jason L. Buberel (jbuberel@uiuc.edu) wrote: : Could someone please let me know if there is a simple (straighforward) way : to ask GenBank (or a similar service) to compare sequence homology for me : if I give it the names of several related genes (or same gene between : different species). We are trying to find conserved areas among the : cytochrome enzyme genes. We have played with the GenBank web site, If you have a WWW browser, you should find out more about ENTREZ. The ENTREZ service is now available on the web: http://www.ncbi.nlm.nih.gov/Search/Entrez/index.html You have to register your machine (IP address) to get full function from Netwrok-ENTREZ or WWW-ENTREZ, but once you do, you will have a world of info at your fingertips. ENTREZ has not only gene and protein sequences, but also a large subset of medline (articles pertaining to genes and proteins are there, clinical trials and such are not). ENTREZ also has a VERY POWERFUL "neighboring" function. NCBI has already compared every sequence to every other one, so if you select a gene, protein or medline abstract and click the "neighbors" button, ENTREZ will show you the other genes, proteins or abstracts that are most similar to the one you selected. -- ******************************************************************** * Brian Foley * If we knew what we were doing * * Molecular Genetics Dept. * it wouldn't be called research * * University of Vermont * * ******************************************************************** From owner-software@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!rutgers!gatech!howland.reston.ans.net!torn!news.ccs.queensu.ca!qucdn!graethes Organization: Queen's University at Kingston Date: Wed, 2 Nov 1994 14:24:21 EST From: Message-ID: <94306.142421GRAETHES@QUCDN.QueensU.CA> Newsgroups: bionet.software Subject: Referance Manager and Word 6.0 Lines: 3 I'm thinking of buying Referance Manager 6.0 for DOS, but I need to know how well it works with Word for Windows 6.0. I don't want to save the document as a Word 2.0 file, because I lose some of my formatting. From owner-software@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!agate!darkstar.UCSC.EDU!pellinore!rafael From: rafael@cse.ucsc.edu (David Konerding) Newsgroups: bionet.software.gcg,bionet.software,bionet.molbio.embldatabank Subject: Re: E. coli Database Collection --> GCG format Followup-To: bionet.software.gcg,bionet.software,bionet.molbio.embldatabank Date: 3 Nov 1994 21:14:47 GMT Organization: UC Santa Cruz CIS/CE Lines: 38 Distribution: world Message-ID: <39bjs7$t3p@darkstar.UCSC.EDU> References: <398sqb$79b@emory.mathcs.emory.edu> NNTP-Posting-Host: pellinore.cse.ucsc.edu X-Newsreader: TIN [version 1.2 PL2] Xref: biosci bionet.software.gcg:805 bionet.software:9916 bionet.molbio.embldatabank:387 Peter Rice (pmr@staffa.sanger.ac.uk) wrote: : In article <398sqb$79b@emory.mathcs.emory.edu> bcresas@bimcore.emory.edu (Scott Sammons) writes: : > Has anyone successfully reformatted the ECD data into GCG formatted databases. : > The program embltogcg core dumps when I try it with one of the ECD .dat : > files. : As I am involved in both ECD and EGCG, I will try to put something into EGCG 8.0 : when it is ready. I take it you are referring to the very latest (new format) : ECD here. Do you mean the genorf.dat file or the contigs/*.dna files (which are : closer to EMBL format and have more sequence data)? : Beware though - E.coli sequencing is now going so well that ECD has a contig (and : more to follow) over the 350k mark, which will give some problems with GCG. : Another option would be to use a script (or Perl) to reformat into enough of an : "EMBL" format for EMBLtoGCG to accept it. Hmm. Can anybody give me a pointer to where I can find the ECD? I am writing a thesis which regards computational methods for finding genes in prokaryotic DNA, and any database more complete than EcoSeq6 would be great. Thanks. : -- : ------------------------------------------------------------------------ : Peter Rice | Informatics Division : E-mail: pmr@sanger.ac.uk | The Sanger Centre : Tel: (44) 1223 494967 | Hinxton Hall, Hinxton, : Fax: (44) 1223 494919 | Cambs, CB10 1RQ : URL: http://www.sanger.ac.uk/~pmr | England -- -- O~_ ------------- David Konerding (University of California, Santa Cruz) c/ /' ------- rafael@cse.ucsc.edu ( ) \( ) --- rafael@cats.ucsc.edu From owner-software@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!rutgers!gatech!howland.reston.ans.net!pipex!lyra.csx.cam.ac.uk!sunsite.doc.ic.ac.uk!charlie.lif.icnet.uk!morpheus.lif.icnet.uk!user From: mike@bison.lif.icnet.uk (Mike Mitchell) Newsgroups: bionet.software Subject: Re: *** Q: WHAT KIND OF PEOPLE ON THE NET ? Date: Thu, 03 Nov 1994 20:15:53 +0100 Organization: Imperial Cancer Research Fund Lines: 52 Message-ID: References: <39b2eu$9ql@anemone.saclay.cea.fr> NNTP-Posting-Host: morpheus.lif.icnet.uk In article <39b2eu$9ql@anemone.saclay.cea.fr>, cisitm@albert.cad.cea.fr (Pierre Didierjean) wrote: > I'd like to know what kind of people i find on the net. > > Students, Commercials, Adminitrations, Scientifics or what ?? > > Is anybody knows that or have statistical results ? > > > What are YOU doing in life ? > > I am a system administrator. > > > Thanks for the answers and sorry for my english ..... > > > > Bye > > > +-----------------------------------------------------------------------------+ > | Pierre DIDIERJEAN | > | | > | Administrateur Systeme UNIX | > | Cisi, Aix-en-Provence | > | France | > +-----------------------------------------------------------------------------+ > | email : cisitm@albert.cad.cea.fr | > +-----------------------------------------------------------------------------+ The sort of people who post a stupid message to every newsgroup available! -- * ***************************************************************** * *Michael Mitchell *"All I know about babies is that you * *User Support * are not supposed to put them into * *Molecular Biology Software * washing machines. Makes the colours * *Imperial Cancer Research Fund* run, presumably." * *+44 (0)71 269 3115 * Tom Holt - Here Comes The Sun - 1994* * ***************************************************************** * From owner-software@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!galaxy.ucr.edu!ihnp4.ucsd.edu!news.service.uci.edu!buggus.mmg.uci.edu!user From: mangalam@uci.edu (Harry Mangalam) Newsgroups: bionet.software Subject: Re: transcription element database Date: Thu, 03 Nov 1994 13:16:24 -0800 Organization: Microbiology and Molecular Genetics, UC Irvine Lines: 35 Message-ID: References: NNTP-Posting-Host: buggus.mmg.uci.edu In article , samols@biochemistry.cwru.edu (David Samols) wrote: > We are looking for a on-line database where we can search binding motifs of > transcription factors for our promoter sequence. Can anyone suggest such a > server to which we can send our sequence? It's not an online system, per se, but you can grab the Transcription factor database from ncbi (see related posting, same newsgroup) and compare your sequence with it using Dan Prestridge's SignalScan (versions for PC and Unix, the latter better supported, I believe). You can get in touch with him at: Dan S. Prestridge, Ph.D. E-mail: DANP@MOLBIO.UMN.EDU Director Telephone: (612) 625-3744 Molecular Biology Computing Center (MBCC) Fax: (612) 625-5780 Department of Biochemistry University of Minnesota 1479 Gortner Ave. St. Paul, MN 55108 Cheers harry If you're desperate, you can email me you sequence, tell me what organism db you'd like it searched against and I'll email you the output. -- Harry J Mangalam, Microbiology and Molecular Genetics, College of Medicine, UC Irvine, Irvine, CA, 92717, (714) 856-4824, fax (714) 856 8598, --- That which does not kill me, makes me grouchier --- http://hornet.mmg.uci.edu/~hjm/hjm.html Computational Biology..SGI..Woodworking..Bicycling..Linux..WWW From owner-software@net.bio.net Wed Nov 02 22:00:00 1994 Newsgroups: bionet.software Path: biosci!ns1.faseb.org!darwin.sura.net!lhc!gold!epstein From: epstein@gold.nlm.nih.gov (Jonathan Epstein) Subject: Re: Software for comparing sequence homology from GenBank server? Message-ID: <1994Nov3.170903.20765@nlm.nih.gov> Sender: news@nlm.nih.gov Organization: National Library of Medicine X-Newsreader: TIN [version 1.2 PL2] References: <1994Nov2.220357.1622@emba.uvm.edu> Date: Thu, 3 Nov 94 17:09:03 GMT Lines: 89 Viraj Master (vam2@midway.uchicago.edu) wrote: > Sorry if this is a FAQ, but *how* does one go about registering one's > machine to get full function from Entrez? > Thanks > Viraj > -- > Viraj Master > Dept. of Organismal Biology and Anatomy > University of Chicago An invitation follows below. Your site may already be registered, so you (or anyone else) can try to download the software and see whether it works. If it works, you're registered, otherwise you'll see a message asking you to write to net-info@ncbi.nlm.nih.gov. Please do read the referenced README file below before contacting NCBI ... thanks. - Jonathan Jonathan Epstein epstein@ncbi.nlm.nih.gov National Center for Biotechnology Information Phone: (301)496-2475 National Library of Medicine Building 38A, Room 8N805 National Institutes of Health 8600 Rockville Pike Bethesda, MD 20894 -------------------------- begin invitation ------------------------------- You are invited to register to use "Network Entrez", a networked version of the Entrez molecular sequence retrieval system which has formerly been available only by subscription as a CD-ROM based package. For those of you who may be unaware, Entrez is an application program for browsing an interlinked set of several databases: a molecular sequence subset of MEDLINE; all of GenBank, EMBL, DDBJ, PIR, SWISS-PROT, PDB; and more. Entrez is now available in a network client-server arrangement, with the databases residing at the NCBI and accessible by users at distant locations over the worldwide Internet. Network Entrez client programs are currently available for the following computer platforms: o Macintosh (MacTCP) o MS Windows (WinSock 1.1 compatible) o Sun SparcStations (SunOS and Solaris) o SGI IRIX o DEC Alpha running OSF/1 o DEC Ultrix o DEC VMS (Multinet/TGV, Wollongong, and UCX) Network Entrez software may be obtained via anonymous ftp from ncbi.nlm.nih.gov (130.14.25.1) in the /entrez/network directory. There is a README file in the same directory, which should be read before attempting installation and use. Registration (see below) must be performed before the software will operate correctly, and direct Internet access is an absolute requirement to using Network Entrez on any computer (e.g., mere e-mail access through services such as BITNET is insufficient). On the plus side, no CD-ROM equipment nor significant local hard disk storage is required to install or use Network Entrez; more data is accessible through the network service than off the Entrez CD-ROMs; database updates do not incur the delays associated with CD-ROM production and distribution; and there are presently no subscription fees to using the network service. Administrators: if any users in your organization are interested in using Network Entrez, please send the following information to: net-info@ncbi.nlm.nih.gov. o your name, affiliation, electronic and postal mail addresses, and telephone number o a list of the dotted-decimal IP (Internet Protocol) addresses of whatever computers Network Entrez will be installed upon at your site. For convenience, if all computers in a particular subnet may need access to the program, the entire subnet may be indicated using the notation x.y.z.* (e.g., 130.14.20.*). Installation of Network Entrez client software may be performed at your convenience. Bug reports, questions, and comments about the program should be sent to the same net-info@ncbi.nlm.nih.gov address. Occasionally administrators can expect to receive e-mail directing them to download an updated version of Network Entrez. We apologize in advance that administrators at participating institutions may receive update notices for platforms other than those actually in use at their site, however we do expect this to occur infrequently. -------------------------- end invitation ------------------------------- From owner-software@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!daresbury!not-for-mail From: Edgar Wingender Newsgroups: bionet.software Subject: Re: transcription element database Date: 3 Nov 1994 17:06:29 -0000 Lines: 37 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <39b5al$iis@mserv1.dl.ac.uk> Original-To: bio-software (Receipt Notification Requested) (Non Receipt Notification Requested) In article <1994Nov3.102010.6681@reks.uia.ac.be> (Przemko) wrote: |In article samols@biochemistry.cwru. |edu (David Samols) writes: |>We are looking for a on-line database where we can search binding motifs of |>transcription factors for our promoter sequence. Can anyone suggest such a |>server to which we can send our sequence? | |Hi! |We would be also very interested. Indeed, a kind of PROSITE but |for transcription factors would be great. Something that would |look at my DNA sequence and propose some binding site for |transcriptional factors... I recently announced our database TRANSFAC which also includes a set of consensus sites in its SITES table, mainly based upon the Faisst & Meyer compilation in NAR 20, 3-26 (1992). The consensus sites can be identified through their ID ($cons) or by the word "consensus" in the description field (DE). Try the ftp site ftp.gbf-braunschweig.de (IP 193.175.244.2). Hope this helps. Edgar Wingender. ------------------------------------------------------------------------------ _/_/_/_/ _/ _/ Dr. Edgar Wingender _/ _/ _/ _/ GBF - Dept. of Genome Analysis _/_/_/ _/ _/ _/ _/ Mascheroder Weg 1 _/ _/ _/ _/ _/ D-38124 Braunschweig _/_/_/_/_/ _/ _/ Germany e-mail ewi@venus.gbf-braunschweig.d400.de tel +49-531-6181-427 fax +49-531-6181-202 From owner-software@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!bloom-beacon.mit.edu!grapevine.lcs.mit.edu!uhog.mit.edu!europa.eng.gtefsd.com!howland.reston.ans.net!EU.net!dkuug!news.uni-c.dk!inet!hartwell From: hartwell@inet.uni-c.dk (Michael Hartwell) Newsgroups: bionet.software Subject: MR scan animation Date: Sat, 29 Oct 1994 0:49:42 GMT Organization: News Server at UNI-C, Danish Computing Centre for Research and Education. Lines: 4 Distribution: world Message-ID: <7833917825877@inet.uni-c.dk> NNTP-Posting-Host: inet.uni-c.dk Is anyone intersted in a FLI animation containing 120 frames of magnetic resonance brain scan (healthy patient)? I'll upload it for anyone interested. Rgds. Mike Hartwell Nielsen From owner-software@net.bio.net Wed Nov 02 22:00:00 1994 Newsgroups: bionet.software.gcg,bionet.software,bionet.molbio.embldatabank Path: biosci!rutgers!gatech!howland.reston.ans.net!news.sprintlink.net!EU.net!sun4nl!sci.kun.nl!jackl From: jackl@sci.kun.nl (Jack Leunissen) Subject: Re: E. coli Database Collection --> GCG format Message-ID: Sender: news@sci.kun.nl (News owner) Nntp-Posting-Host: wn2.sci.kun.nl Organization: University of Nijmegen, The Netherlands References: <398sqb$79b@emory.mathcs.emory.edu> Date: Thu, 3 Nov 1994 21:57:55 GMT Lines: 17 Xref: biosci bionet.software.gcg:807 bionet.software:9921 bionet.molbio.embldatabank:389 In <398sqb$79b@emory.mathcs.emory.edu> bcresas@bimcore.emory.edu (Scott Sammons) writes: >Has anyone successfully reformatted the ECD data into GCG formatted databases. >The program embltogcg core dumps when I try it with one of the ECD .dat >files. You might try my program "embl2nbrf", which reformats EMBL-formatted data into NBRF (=PIR) format. GCG handles this, provided you change the format identifier in the .header file from GCG into NBRF. You can find the program at "ftp.caos.kun.nl", via anonymous FTP, in the directory "pub/molbio/embl2nbrf". Best regards, Jack Leunissen CAOS/CAMM Center From owner-software@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!rutgers!gatech!howland.reston.ans.net!europa.eng.gtefsd.com!library.ucla.edu!news.mic.ucla.edu!steve3.mbi.ucla.edu!visick From: Jon Visick Newsgroups: bionet.software Subject: Re: EndNote 2.0 Price? Date: 3 Nov 1994 23:12:52 GMT Organization: UCLA Lines: 6 Distribution: world Message-ID: <39bqpk$ppn@news.mic.ucla.edu> References: <9411021234.AA27784@leucine.c.dna.affrc.go.jp> NNTP-Posting-Host: steve3.mbi.ucla.edu X-UserAgent: Nuntius v1.1.2 X-XXMessage-ID: X-XXDate: Thu, 3 Nov 94 16:16:31 GMT Akira Kihara writes: >Today, I have received the up-grade information >for EndNote Plus 2.0 (Mac) from my version 1.3.... Exciting news...has anyone heard about an upgrade for DOS? Or have info. about features? From owner-software@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!rutgers!gatech!howland.reston.ans.net!europa.eng.gtefsd.com!library.ucla.edu!news.mic.ucla.edu!steve3.mbi.ucla.edu!visick From: Jon Visick Newsgroups: bionet.software Subject: Molecule-drawing shareware for DOS? Date: 3 Nov 1994 23:10:39 GMT Organization: UCLA Lines: 11 Distribution: world Message-ID: <39bqlg$ppn@news.mic.ucla.edu> NNTP-Posting-Host: steve3.mbi.ucla.edu X-UserAgent: Nuntius v1.1.2 X-XXMessage-ID: X-XXDate: Thu, 3 Nov 94 16:14:17 GMT I'm looking for a shareware program to draw biochemical molecules for DOS (*not* Windoze!). Not a 3D modeling program (there are lots of these!) but a simple drawing program which can do the bond angles, put in N's and O's, etc. If anyone knows of something like Chem-Draw, but in shareware, I'd be grateful. Jon Visick visick@ewald.mbi.ucla.edu From owner-software@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!rutgers!gatech!howland.reston.ans.net!pipex!lyra.csx.cam.ac.uk!nntp-serv.cam.ac.uk!pmr From: pmr@staffa.sanger.ac.uk (Peter Rice) Newsgroups: bionet.software.gcg,bionet.software,bionet.molbio.embldatabank Subject: Re: E. coli Database Collection --> GCG format Followup-To: bionet.software.gcg,bionet.software,bionet.molbio.embldatabank Date: 03 Nov 1994 22:44:38 GMT Organization: University of Cambridge, England Lines: 29 Distribution: world Message-ID: References: <398sqb$79b@emory.mathcs.emory.edu> <39bjs7$t3p@darkstar.UCSC.EDU> NNTP-Posting-Host: staffa.sanger.ac.uk In-reply-to: rafael@cse.ucsc.edu's message of 3 Nov 1994 21:14:47 GMT Xref: biosci bionet.software.gcg:806 bionet.software:9918 bionet.molbio.embldatabank:388 In article <39bjs7$t3p@darkstar.UCSC.EDU> rafael@cse.ucsc.edu (David Konerding) writes: > Peter Rice (pmr@staffa.sanger.ac.uk) wrote: > : In article <398sqb$79b@emory.mathcs.emory.edu> bcresas@bimcore.emory.edu (Scott Sammons) writes: > : > Has anyone successfully reformatted the ECD data into GCG formatted databases. > : > The program embltogcg core dumps when I try it with one of the ECD .dat > : > files. > > : As I am involved in both ECD and EGCG, I will try to put something into EGCG 8.0 > : when it is ready. I take it you are referring to the very latest (new format) > : ECD here. Do you mean the genorf.dat file or the contigs/*.dna files (which are > : closer to EMBL format and have more sequence data)? > > Hmm. Can anybody give me a pointer to where I can find the ECD? I am writing > a thesis which regards computational methods for finding genes in prokaryotic > DNA, and any database more complete than EcoSeq6 would be great. The latest ECD is available from ftp.ebi.ac.uk in directory pub/databases/ecdc (note the extra c at the end :-) The new format is described in: Kroeger et al. (1994); Nucleic Acids Research 22:3450-3455. The contigs directory has the non-redundant contiguous sequences from E.coli K-12. -- ------------------------------------------------------------------------ Peter Rice | Informatics Division E-mail: pmr@sanger.ac.uk | The Sanger Centre Tel: (44) 1223 494967 | Hinxton Hall, Hinxton, Fax: (44) 1223 494919 | Cambs, CB10 1RQ URL: http://www.sanger.ac.uk/~pmr | England From owner-software@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!rutgers!gatech!howland.reston.ans.net!news.sprintlink.net!news.clark.net!arsoftwa From: arsoftwa@clark.net (west@arsoftware.arclch.com) Newsgroups: bionet.software Subject: ANNOUNCE-No More Unwanted Recompiles Date: 3 Nov 1994 21:42:23 GMT Organization: Clark Internet Services, Inc., Ellicott City, MD USA Lines: 73 Message-ID: <39blfv$cod@clarknet.clark.net> NNTP-Posting-Host: clark.net Mime-Version: 1.0 Content-Type: TEXT/PLAIN; charset=ISO-8859-1 Content-Transfer-Encoding: 8bit X-Newsreader: TIN [version 1.2 PL2] ARC++, Version 2.0 Eliminates Unnecessary Recompilations -- Increases Productivity Up To 15% C and C++ Users Now Have Control Landover, MD -- ARSoftware announced today the release of ARC++, Version 2.0, the first C/C++ development tool that improves productivity by eliminating the unnecessary recompilations that result from header file editing. This single feature gives the user virtual control over one of the most time consuming C and C++ requirements, but Version 2.0 also provides over 30 extensions that further streamline program development, including: exportable classes that eliminate the need for header files; and intelligent macros that provide encapsulated code generation. ARC++ is easy to integrate with existing software development systems and dramatically increases productivity while reducing delays and frustration. ARC++ provides immediate benefits for ongoing development projects. With a few minor adjustments to the existing Make or Project files, ARC++ automatically analyzes if a header file change affects previously compiled modules and alters the Make process accordingly, giving the user virtual control over recompiles. Eliminating unwanted recompiles is especially beneficial when a coding task involves complex class libraries. Exportable classes and packages in ARC++ produce cleaner, more readable and easier to maintain code by eliminating user-written header files, allowing integrated class definitions, and modularizing the development of function libraries. ARC++'s intelligent macro capability reduces coding time by automatically analyzing class definitions; they can loop, branch, and access the parse tree/symbol table to generate code based on previous declarations. Defined within C++'s block structure, these macros are capable of being inherited (unlike C preprocessor macros). Callback macros in multiple base classes ensure that every derived class has the appropriate support code generated, making it unnecessary to hand code. Some of the many time-saving extensions include: Overloaded enumerators - Bound function pointers - Fully prototyped Vararg functions - Automatic functions - Arrays with bounds - Modify detection - User-defined operators - Combination operators - User-defined modifiers - Hidden arguments. "ARC++ provides the technology, features and extensions users need to quickly become more productive. The leaner, more workable code eliminates a lot of the frustrating delays and breaks in concentration that are so costly and time consuming. In very little time, many of the routine tasks performed by senior personnel can be performed by others, allowing the more experienced personnel to perform on a higher, more efficient level. ARC++ will also make it easier for the novice to learn the C and C++ language," stated S.P.S. Anand, President and CEO of ARSoftware. Pricing Introductory pricing for ARC++ is $129 (list $249) for DOS and Macintosh, and $199 (list $340) for Unix. Pricing includes 60 days of free technical support and a 60-day money back guarantee. Upgrade pricing for existing users is $29 for DOS and Macintosh, and $39 for Unix. _________________________________________________ | George West - west@arsoftware.arclch.com | | ARSoftware - www homepage: http://arsoftware.arclch.com | From owner-software@net.bio.net Wed Nov 02 22:00:00 1994 Newsgroups: bionet.software Path: biosci!agate!howland.reston.ans.net!EU.net!ub4b!idefix.CS.kuleuven.ac.be!reks.uia.ac.be!news From: przemko@reks.uia.ac.be (Przemko) Subject: Re: transcription element database Message-ID: <1994Nov3.102010.6681@reks.uia.ac.be> Keywords: transcription Sender: news@reks.uia.ac.be (USENET News System) Organization: University of Antwerp X-Newsreader: Date: Thu, 3 Nov 1994 10:20:10 GMT Lines: 15 In article samols@biochemistry.cwru.edu (David Samols) writes: >We are looking for a on-line database where we can search binding motifs of >transcription factors for our promoter sequence. Can anyone suggest such a >server to which we can send our sequence? Hi! We would be also very interested. Indeed, a kind of PROSITE but for transcription factors would be great. Something that would look at my DNA sequence and propose some binding site for transcriptional factors... Please, post answers to the net Przemko From owner-software@net.bio.net Thu Nov 03 22:00:00 1994 Path: biosci!SPRCORE.BIH.HARVARD.EDU!jackman From: jackman@SPRCORE.BIH.HARVARD.EDU ("robert w. Jackman") Newsgroups: bionet.software Subject: transcription sites Date: 3 Nov 1994 22:43:07 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 18 Sender: daemon@net.bio.net Distribution: world Message-ID: <9411040643.AA15444@sprcore.bih.harvard.edu> NNTP-Posting-Host: net.bio.net Has anyone been able to access the Transfac database (or any other transcription factor data base) using MacPattern? If so, could you provide a brief outline of what you did? Bob ------------------------------------------------------------------ Robert W. Jackman * Beth Israel Hospital/ Pathology,Research North * 99 Brookline Avenue RN280B * Boston, Massachusetts 02215 * * jackman@sprcore.bih.harvard.edu * * fax (617) 735-3591 * phone (617) 735-3578 * ------------------------------------------------------------------ From owner-software@net.bio.net Thu Nov 03 22:00:00 1994 Newsgroups: bionet.software Path: biosci!rutgers!princeton!berthaw.princeton.edu!micky From: micky@berthaw.princeton.edu (Michael West) Subject: Windows DNA analysis program Message-ID: <1994Nov3.172414.1906@Princeton.EDU> Originator: news@hedgehog.Princeton.EDU Sender: news@Princeton.EDU (USENET News System) Nntp-Posting-Host: berthaw.princeton.edu Organization: Princeton University Date: Thu, 3 Nov 1994 17:24:14 GMT Lines: 7 I am looking for a windows program that will do DNA analysis (restriction mapping, base composition, etc..) I am using DNA strider on a MAC right now but I would like something that runs under windows. Anyone know of any program like this? Michael micky@berthaw.princeton.edu From owner-software@net.bio.net Thu Nov 03 22:00:00 1994 Newsgroups: bionet.software Path: biosci!rutgers!gatech!news.Gsu.EDU!news-feed-1.peachnet.edu!news.duke.edu!solaris.cc.vt.edu!uunet!news.unr.edu!equinox.unr.edu!malc From: malc@equinox.unr.edu (Malcolm L. Carlock) Subject: Unix-based biological software vs. DOS/Windows-based? Message-ID: Sender: usenet@news.unr.edu Organization: Campus Computing Services, University of Nevada, Reno Date: Fri, 4 Nov 1994 00:28:57 GMT Lines: 36 I am seeking recommendations for Unix-based (preferably on an Intel platform) biological software that will allow us at least in some degree to migrate away from the purely DOS/Windows and Mac based software we're mainly using now. I know about Unix/X-based Entrez and some other packages, but am also seeking viable Unix-based replacements for PCGENE, OLIGO, and the COMOS Confocal microscope management package, among others. Good public-domain packages are of interest as well as commercial packages. Having gone through yet another particuarly nightmarish instance of the perennial DOS/Windows carousel of crashed Windows, viruses, shortages of DOS memory etc., the severe productivity and support problems that are inherent in Windows/DOS are making a move to Unix in this area look even better than it has in the past. The Unix systems in wide use elsewhere in our campus generally stay up and running for weeks and months at a time, with their users getting to do actual work most of the time and not have to deal constantly with the various silly DOS/Windows instabilities. Our campus has on-site Unix sysadmin support, so Unix administration support is not an issue for us. We will of course be checking into various products from this end, but any recommendations, information, cautionary tales etc. along these lines would be greatly appreciated. Please email any responses and I will summarize to the net. Thanks, Malcolm -- Malcolm L. Carlock --Internet: malc@unr.edu --Voice: 702-784-4637 --UUCP: unr!malc --Fax: 702-784-4050 --BITNET: malc@equinox --USMail: University of Nevada, Reno/EB 102F/MS #180/Reno, NV 89557 From owner-software@net.bio.net Thu Nov 03 22:00:00 1994 Path: biosci!rutgers!gatech!newsxfer.itd.umich.edu!news.itd.umich.edu!news.itd.umich.edu!not-for-mail From: brecher@terminator.rs.itd.umich.edu (Jonathan Brecher) Newsgroups: bionet.software,sci.edu,sci.chem,sci.chem.electrochem,sci.chem.organomet Subject: Re: Want shareware "ChemDraw-like" program for Mac Date: 3 Nov 1994 19:21:31 -0500 Organization: Cambridge Scientific Computing, Inc. Lines: 37 Sender: jsb@camsci.com Message-ID: <39buqb$mgc@terminator.rs.itd.umich.edu> References: <397mps$3g0@freenet3.scri.fsu.edu> <39avlg$cq2@nof.abdn.ac.uk> Reply-To: info@camsci.com NNTP-Posting-Host: terminator.rs.itd.umich.edu Xref: biosci bionet.software:9923 sci.edu:3470 sci.chem:18860 sci.chem.electrochem:603 sci.chem.organomet:509 In article <39avlg$cq2@nof.abdn.ac.uk>, u02dg wrote: >: Is there a Windows version or related package ftpable anywhere? > >I think there's one available called hyperchem (there's a copy of it in our >department) but I'm not sure if it's shareware or not. Hyperchem is commercial software, published by Hypercube (info@hyper.com). It is not really comparable to ChemDraw in that it does not do 2-dimensional structure drawing, only 3-dimensional modeling (but it does modeling VERY well). >How about one for X-windows? Preferably which will dump out PostScript format >images for inclusion to other documents (e.g. FrameMaker/LaTeX). Without trying to beat a dead horse, let me just say, "ChemDraw does this." With all this discussion about a "ChemDraw-like" program, is there some problem perceived with the original ChemDraw that everyone is trying to find an alternative? I certainly can't begrudge anyone their personal preferences, but if anyone knows of any problems with ChemDraw, then by all means TELL us, so that we can fix them. ChemDraw has grown over the last eight years primarily as a result of customer input, and if we are not meeting your needs as well as we can, please let us know! Back to the original question, there are demos of CS ChemDraw for SGI and Sun machines running X-windows (and Macs and Windows machines, too) available by anonymous ftp from ftp.camsci.com. They will also shortly be available by WWW at http://www.camsci.com (most of the domos are already linked into our Web server). I hope this information is helpful. Jonathan Brecher Cambridge Scientific Computing, Inc. jsb@camsci.com Do I really need a disclaimer? From owner-software@net.bio.net Thu Nov 03 22:00:00 1994 Path: biosci!agate!howland.reston.ans.net!pipex!oleane!jussieu.fr!univ-lyon1.fr!swidir.switch.ch!scsing.switch.ch!elna.ethz.ch!inf.ethz.ch!not-for-mail From: cbrg@inf.ethz.ch (CompBioResGrp) Newsgroups: bionet.general,bionet.software Subject: WWW peptide and nucleotide analysis server of CBRG at ETHZ Date: 4 Nov 1994 14:58:52 +0100 Organization: Dept. Informatik, Swiss Federal Institute of Technology Lines: 25 Message-ID: <39dems$39s@vinci.inf.ethz.ch> NNTP-Posting-Host: vinci.inf.ethz.ch Xref: biosci bionet.general:11862 bionet.software:9934 WWW peptide and nucleotide analysis server of CBRG at ETHZ ---------------------------------------------------------- All computing services accessible by e-mail are now also accessible from WWW: - PepPepSearch Exhaustive search of SwissProt for a similar protein on a massively parallel machine (MasPar) by complete dynamic programming. - NuclPepSearch Exhaustive search of SwissProt for a protein being encoded by a similar nucleotide sequence by complete dynamic programming. - AllAll Phylogenetic trees, multiple alignments, surface/interior prediction etc. of a set of proteins. - MassSearch Search SwissProt or EMBL by protein fragment masses. - AllAllDB Query the all-against-all database of SwissProt. - Darwin Access the Darwin Computational Biochemistry Tool directly. Interactive forms and examples make the formatting of queries easier. Replies are sent back directly or by e-mail. Furthermore, the server offers more complete documentation on the services and references. Try URL http://cbrg.inf.ethz.ch/ From owner-software@net.bio.net Thu Nov 03 22:00:00 1994 Path: biosci!agate!howland.reston.ans.net!pipex!uknet!daresbury!not-for-mail From: Newsgroups: bionet.software Subject: Gopher for OSF/1 Date: 4 Nov 1994 09:54:40 -0000 Lines: 26 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <39d0d0$7cj@mserv1.dl.ac.uk> Original-To: bio-software@dl.ac.uk Dear Gurus, - I'm just trying to install Gopher (client) on my new Alpha OSF/1 machine. - I downloaded the last Unix version (gopher2.1alpha) from U. Minnesota - I modified the files Makefile.config and conf.h as indicated - I launched make ... and got an error at the link step because of unresolved references: Gtxt, Gcatd, Gtxlocale, Gtxopen - however, as far as I can see, these routines are in Locale.c Did anybody experienced the same problem? Maybe a small bug in Makefile? Thank you, Jean-Loup --------------------------------------------------------------------- Jean-Loup Risler Tel: (33 1) 69 82 31 34 CNRS Fax: (33 1) 69 07 49 73 Centre de Genetique Moleculaire Email: risler@cgmvax.cgm.cnrs-gif.fr 91198 Gif sur Yvette Cedex France --------------------------------------------------------------------- From owner-software@net.bio.net Thu Nov 03 22:00:00 1994 Path: biosci!agate!spool.mu.edu!howland.reston.ans.net!pipex!cityscape.co.uk!usenet From: ae76@cityscape.co.uk (ae76) Newsgroups: bionet.software Subject: Re: Referance Manager and Word 6.0 Date: 4 Nov 1994 10:40:27 GMT Organization: IP-GOLD User Lines: 10 Message-ID: <39d32r$sr9@ns.cityscape.co.uk> References: <94306.142421GRAETHES@QUCDN.QueensU.CA> NNTP-Posting-Host: ac071.du.pipex.com X-Newsreader: WinVN 0.91.6 >I'm thinking of buying Referance Manager 6.0 for DOS, but I need to know >how well it works with Word for Windows 6.0 ************************************************************************ You would need RefMan for Windows v 6.0 - it's the only version of Refman that is fully compatible with Word 6 and it works fine! Geraint Jones Bilaney Consultants Ltd (RIS' European agents) From owner-software@net.bio.net Thu Nov 03 22:00:00 1994 Newsgroups: bionet.software Path: biosci!agate!howland.reston.ans.net!pipex!sunsite.doc.ic.ac.uk!hgmp.mrc.ac.uk!daresbury!bioftp.unibas.ch!doelz From: doelz@comp.bioz.unibas.ch (Reinhard Doelz) Subject: Re: ANNOUNCE-No More Unwanted Recompiles Message-ID: <1994Nov4.065800.8843@comp.bioz.unibas.ch> Organization: EMBnet Switzerland [Basel] X-Newsreader: TIN [version 1.2 PL2] References: <39blfv$cod@clarknet.clark.net> Date: Fri, 4 Nov 1994 06:58:00 GMT Lines: 21 west@arsoftware.arclch.com (arsoftwa@clark.net) wrote: [advertisement deleted] : Pricing [availability info deleted] : _________________________________________________ : | George West - west@arsoftware.arclch.com | : | ARSoftware - www homepage: http://arsoftware.arclch.com | I would prefer announcements like such as a four-liner with less commercial background, and some emphasis on biology. Sure it is useful to know what is out there but advertisements like this one don't really fit the Charter of this group in my view. Regards Reinhard -- R.Doelz Klingelbergstr.70| Tel. x41 61 267 2247 Fax x41 61 267 2078| Biocomputing CH 4056 Basel| electronic Mail doelz@ubaclu.unibas.ch| Biozentrum der Universitaet Basel|-------------- Switzerland ---------------| EMBnet Switzerland:info@ch.embnet.org From owner-software@net.bio.net Thu Nov 03 22:00:00 1994 Newsgroups: bionet.software,sci.edu,sci.chem,sci.chem.electrochem,sci.chem.organomet Path: biosci!agate!howland.reston.ans.net!pipex!sunic!news.lth.se!news.lu.se!usx120.maxlab.lu.se!user From: mancini@fysik.uu.se (Derrick C. Mancini) Subject: Re: Want shareware "ChemDraw-like" program for Mac Message-ID: Sender: news@nomina.lu.se (USENET News System) Nntp-Posting-Host: usx120.maxlab.lu.se Organization: MAX-Lab, Lunds Universitet References: <397mps$3g0@freenet3.scri.fsu.edu> <39avlg$cq2@nof.abdn.ac.uk> <39buqb$mgc@terminator.rs.itd.umich.edu> Date: Fri, 4 Nov 1994 10:42:45 GMT Lines: 14 Xref: biosci bionet.software:9929 sci.edu:3474 sci.chem:18876 sci.chem.electrochem:606 sci.chem.organomet:511 In article <39buqb$mgc@terminator.rs.itd.umich.edu>, info@camsci.com wrote: > With all this discussion about a "ChemDraw-like" program, is there some > problem perceived with the original ChemDraw that everyone is trying to > find an alternative? I certainly can't begrudge anyone their personal > preferences, but if anyone knows of any problems with ChemDraw, then by > all means TELL us, so that we can fix them. ChemDraw has grown over the last > eight years primarily as a result of customer input, and if we are not meeting > your needs as well as we can, please let us know! Uh, sure, Jonathan. Price! I thought that was obvious. Where you have money in the budget for it, no problem. But if you are an educational user, and have to fork out of your own pocket, it is another matter. The XRAYMAN From owner-software@net.bio.net Thu Nov 03 22:00:00 1994 Newsgroups: bionet.software,sci.edu,sci.chem,sci.chem.electrochem,sci.chem.organomet Path: biosci!agate!howland.reston.ans.net!cs.utexas.edu!utnut!nott!cunews!szikopou From: szikopou@superior.carleton.ca (Steven Zikopoulos) Subject: Re: Want shareware "ChemDraw-like" program for Mac Message-ID: Sender: news@cunews.carleton.ca (News Administrator) Organization: Carleton University References: <397mps$3g0@freenet3.scri.fsu.edu> <39avlg$cq2@nof.abdn.ac.uk> <39buqb$mgc@terminator.rs.itd.umich.edu> Date: Fri, 4 Nov 1994 06:16:45 GMT Lines: 31 Xref: biosci bionet.software:9928 sci.edu:3473 sci.chem:18872 sci.chem.electrochem:604 sci.chem.organomet:510 In <39buqb$mgc@terminator.rs.itd.umich.edu> brecher@terminator.rs.itd.umich.edu (Jonathan Brecher) writes: [...] >problem perceived with the original ChemDraw that everyone is trying to >find an alternative? I certainly can't begrudge anyone their personal >preferences, but if anyone knows of any problems with ChemDraw, then by >all means TELL us, so that we can fix them. ChemDraw has grown over the last >eight years primarily as a result of customer input, and if we are not meeting >your needs as well as we can, please let us know! >Back to the original question, there are demos of CS ChemDraw for SGI and >Sun machines running X-windows (and Macs and Windows machines, too) available >by anonymous ftp from ftp.camsci.com. They will also shortly be available by >WWW at http://www.camsci.com (most of the domos are already linked into our >Web server). the original poster wanted an application that drew 2D molecular representations on a Mac platform. i suggested chem-edit (freeware (1989) by NAB Gray). >I hope this information is helpful. >Jonathan Brecher >Cambridge Scientific Computing, Inc. >jsb@camsci.com >Do I really need a disclaimer? -- Steven Zikopoulos From owner-software@net.bio.net Thu Nov 03 22:00:00 1994 Path: biosci!rutgers!gatech!willis.cis.uab.edu!maze.dpo.uab.edu!uabdpo.dpo.uab.edu!CBA0031 From: CBA0031@uabdpo.dpo.uab.edu Newsgroups: bionet.software Subject: Editor for cDNA sequence publication Date: Fri, 04 Nov 94 15:45:15 CDT Organization: University of Alabama at Birmingham Lines: 9 Message-ID: <17064DD8CS86.CBA0031@uabdpo.dpo.uab.edu> NNTP-Posting-Host: uabdpo.dpo.uab.edu Hi: Can anybody give me some information about the software that can be used to edit cDNA sequence for publication ? Where is the FTP site ? Thanks in advance rongrong From owner-software@net.bio.net Thu Nov 03 22:00:00 1994 Newsgroups: bionet.software Path: biosci!rutgers!gatech!howland.reston.ans.net!EU.net!ub4b!idefix.CS.kuleuven.ac.be!reks.uia.ac.be!derijkp From: derijkp@reks.uia.ac.be (Peter.DeRijk) Subject: Multiple alignment editor for X-Windows tkDCSE 3.3 available Message-ID: <1994Nov4.223913.2502@reks.uia.ac.be> Organization: U.I.A. X-Newsreader: Tin 1.1 PL5 Date: Fri, 4 Nov 1994 22:39:13 GMT Lines: 200 DCSE v3.3 for X-Windows ----------------------- I have made a homepage for DCSE on our WWW server http://www-rrna.uia.ac.be/~peter/dcse/index.html). You can look there for more info. What is DCSE v3 (tkDCSE) ------------------------ DCSE (Dedicated Comparative Sequence Editor) is a multiple alignment editor. It can be used to edit protein, DNA or RNA alignments. The structure of the molecules can be incorporated in the alignment. It is written in C, and it uses dynamic memory for most things. This means you can almost edit any size of alignment with it. It offers lots of features such as color display of characters and structure, automatic alignment relative to sequences already aligned with others, sequence grouping, sequence or pattern searching, marker system, checking of incorporated RNA structure, on-line hypertext help, macros, and a lot more. This new version of DCSE has an easy to use, yet flexible and programmable X-windows interface provided by the Tcl/Tk language. A complete on-line hypertext help system is provided. Although DCSE v3 is compatible with version 2 of DCSE, its implementation is completely different. The core of DCSE is implemented as an object which can be controlled by giving commands to it from the Tcl language, an easy to learn, yet flexible, interpreted language. The interface is written as a Tcl program. This way the program can be easily customized, and batch jobs are even possible. This approach has several advantages: - the user can adapt the interface of DCSE completely to his own liking. - It is easy to create macros or programs wich extend DCSE. - external programs can also be controlled in Tcl, and seamlessly integerated. - Tcl/Tk exists for a great variety of computers, so porting should be simplified. Convers is a complementary program to DCSE which does things like converting between different file-formats. The new version has been written a set of commandline programs, which are controlled by a Tcl/Tk interface. What is new in v3.3 ------------------- Here are all (except those I forgot to write down) changes to the previous version of DCSE. On of the main differences is the use of shared objects and dynamic loading. This is the reason that this will not run on Irix 4.0.5; You will need Irix 5.2. INTERNALS - extensions to Tcl are handled completely differently: - main executable is an adapted wish (tcl/tk) with dynamic loading extension: - C-extensions can be dynamically loaded when needed by the extinit command. - desc is also a dynamcially loadable extension. - only the environment variable TCL_LIBROOT should be set. All extension libraries and code are found in the directory tkdcse_home/lib (to which TCL_LIBROOT should point). - updated several extensions: - expect 5.9 - Tix 3.6c - incr Tcl 1.5 - tclX 7.3b - blt 1.7 - added some freebee extensions (I don't use them (yet)) - Wigwam 1.5b - moreButtons 1.2 - table 0.1 - made adding external functions a tiny bit easier - extraL as a seperate extension library: adds list manipulation commands such as lfind, lsub, lcor, lload, lfile, lmanip, lmath. - added man/mann to help_path: You can now eg. type 'help button' in wish to get help on the button widget (after you have typed a 'descinit'). PROGRAM - added new alignment options: - Myers-Miller algorithm (uses much less memory). - added '1 to many' alignment - made the intro screen smaller - windows are the first time positioned by the user. A file is kept (per user) which stores the last used positions for windows. The last used position will be used the following times. - selection of sequence lines to be loaded from file is faster. and the selection box shows the number of currently selected sequences. - iconised windows show a nice bitmap - added the possibility of using a cutoff value when copying o's - added the noinsert option to the import function (also a change in syntax). - added constraints to entries, numerical entries also got control buttons - added load and save options to tkconvers sequence line selection box. BUG FIXES - output from protein alignments was not correct - embref sometimes wrote wrong sequence after using arrow keys - locked lines were not adapted after remove or create lines - macros are now loaded at startup - bug in save secondary fixed - list of sequences in tkconvers - forced recalculation of display after create consensus/empty line and after (un)grouping Getting the package ------------------- You can get the package by anonymous ftp to www-rrna.uia.ac.be. It is under the directory pub/dcse. You can also get the distribution via WWW from the DCSE home page on the following URL http://www-rrna.uia.ac.be/~peter/dcse/index.html Installing the package ---------------------- If you already have tkdcse installed you should first remove the old version. It might be best though to keep it for a while to see if everything works ok in the new version. You can do this by going to the directory you put tkdcse_home in and doing: mv tkdcse_home oldtkdcse_home (if you don't care, you can do 'rm -r tkdcse_home' to just remove the older version.) Uncompress and untar the distribution in a suitable directory. This will produce a directory called tkdcse_home. Go into that directory, and start the program install. Then follow directions. zcat tkdcse-sgi-3.3.tar.Z | tar xf - cd tkdcse_home ./install The install program will give you more info on what to do to install DCSE. The programs can be started by typing 'tkdcse' or 'tkconvers' in a shell window. Bugs ---- If you are having problems with the program contact me. I will do my best to get it fixed. Please report any bugs you have found. If possible, state your machine's hardware and software configurations. Sending me a full description of the circumstances in which the bug occurs, possibly with the data it happened on, will help me tracking down a bug. If you have any suggestions, you can also make them to me. Citation -------- A paper has been written about DCSE and this is submitted to and accepted by CABIOS. If you have used the program to obtain results in a paper you've written, please cite the following reference: Peter De Rijk and Rupert De Wachter DCSE v2.54, an interactive tool for sequence alignment and secondary structure research. Comput. Applic. Biosci. Reprints of articles in which DCSE is mentioned would be welcomed. How to contact me ----------------- I will do my best to reply as fast as I can to any problems, etc. However, unfortunately the development of DCSE is not my only task, which is why my response might not be always as fast as you would like (although I get a very good average). Peter De Rijk University of Antwerp (UIA) Department of Biochemistry Universiteitsplein 1 B-2610 Antwerp tel.: 32-03-820.23.16 fax: 32-03-820.22.48 E-mail: derijkp@reks.uia.ac.be Legalities ---------- DCSE is Copyright Peter De Rijk, University of Antwerp (UIA), 1993 You may give this application to anyone, via any medium, so long as it is delivered with ALL the supplied files and UNALTERED, and it is not supplied on a disc you are charging for (except for media and postage costs). I maintain copyright on all the material supplied and reserve the right to amend these conditions in cases where I deem misuse. Disclaimer This application is supplied free to everyone 'as is', I do not give any guarantee that it is free of bugs, or supply any warranty about its suitability for use. No liability will be accepted for any damage to or loss of data as a result of using this application. However, if there are any problems with it and you notify me of them, I will probably do my best to rectify them. From owner-software@net.bio.net Thu Nov 03 22:00:00 1994 Path: biosci!agate!howland.reston.ans.net!gatech!newsxfer.itd.umich.edu!news.itd.umich.edu!news.itd.umich.edu!not-for-mail From: brecher@terminator.rs.itd.umich.edu (Jonathan Brecher) Newsgroups: bionet.software,sci.edu,sci.chem,sci.chem.electrochem,sci.chem.organomet Subject: Re: Want shareware "ChemDraw-like" program for Mac Date: 4 Nov 1994 09:39:23 -0500 Organization: Cambridge Scientific Computing, Inc. Lines: 27 Sender: jsb@camsci.com Message-ID: <39dh2r$333@terminator.rs.itd.umich.edu> References: <39avlg$cq2@nof.abdn.ac.uk> <39buqb$mgc@terminator.rs.itd.umich.edu> Reply-To: info@camsci.com NNTP-Posting-Host: terminator.rs.itd.umich.edu Xref: biosci bionet.software:9935 sci.edu:3477 sci.chem:18887 sci.chem.electrochem:608 sci.chem.organomet:512 Derrick C. Mancini wrote: >In article <39buqb$mgc@terminator.rs.itd.umich.edu>, info@camsci.com wrote: >> With all this discussion about a "ChemDraw-like" program, is there some >> problem perceived with the original ChemDraw that everyone is trying to >> find an alternative? I certainly can't begrudge anyone their personal >> preferences, but if anyone knows of any problems with ChemDraw, then by >> all means TELL us, so that we can fix them. ChemDraw has grown over the >> last eight years primarily as a result of customer input, and if we are >> not meeting your needs as well as we can, please let us know! >Uh, sure, Jonathan. Price! I thought that was obvious. Where you have money >in the budget for it, no problem. But if you are an educational user, and >have to fork out of your own pocket, it is another matter. I still don't understand. Our standard student price for ChemDraw is $49 ($79 international). This really isn't more than many shareware fees. Our non-student educational price for ChemDraw is $149 ($199 international), which isn't that much either. Is this the only problem? Confused, Jonathan Brecher Cambridge Scientific Computing, Inc. jsb@camsci.com From owner-software@net.bio.net Thu Nov 03 22:00:00 1994 Path: biosci!agate!howland.reston.ans.net!pipex!sunic!trane.uninett.no!daresbury!not-for-mail From: kulmburg@sun1.ukl.uni-freiburg.de (Peter Kulmburg) Newsgroups: bionet.software Subject: HTML-Editors? Date: 4 Nov 1994 16:08:52 -0000 Lines: 15 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <39dmak$s7m@mserv1.dl.ac.uk> X-Sender: kulmburg@skl1.ukl.uni-freiburg.de Original-To: bio-software@dl.ac.uk Dear collegues, I will have to write documents for homepages on www-servers. I am working on a Mac and I am interested in html-editors. I know that they exist but I do not know what exactly they do and, more important, I do not know where to find one on the net. Could you please help me with some hints? Thank you very much! Yours Peter Peter KULMBURG (193.196.226.110 MacName: ktl110.ukl.uni-freiburg.de) home: Tel./Fax:+49 761 808439 work: Tel.:+49 761 270/7195 Fax:/7177 From owner-software@net.bio.net Thu Nov 03 22:00:00 1994 Path: biosci!rutgers!gatech!newsxfer.itd.umich.edu!news.itd.umich.edu!jddecker From: jddecker@umich.edu (Jim Decker) Newsgroups: bionet.software Subject: Sequence Analysis Software Date: 4 Nov 1994 01:51:52 GMT Organization: univ. mich. Lines: 8 Sender: jddecker@gamera.rs.itd.umich.edu. Message-ID: <39c43o$p8v@lastactionhero.rs.itd.umich.edu> NNTP-Posting-Host: dent-226-97.dentistry.umich.edu X-Posted-From: InterNews 1.0@lastactionhero.rs.itd.umich.edu. I am soliciting comments on sequence analysis software that can be ran on a personal computer, either MAC or DOS-Windows. I am going to demo-ing PC-Gene from Intelligenetics for 30 days in about a week. Please E-mail me at "jddecker@umich.edu" if you have something for me. Thank you for your time. James Decker University of Michigan Medical Center From owner-software@net.bio.net Fri Nov 04 22:00:00 1994 Path: biosci!agate!spool.mu.edu!howland.reston.ans.net!vixen.cso.uiuc.edu!newsrelay.iastate.edu!news.iastate.edu!jfw From: jfw@iastate.edu (Jonathan F Wendel) Newsgroups: bionet.software Subject: DNA analysis software Date: 5 Nov 1994 03:25:11 GMT Organization: Iowa State University, Ames, Iowa (USA) Lines: 10 Message-ID: <39etun$e0t@news.iastate.edu> NNTP-Posting-Host: las2.iastate.edu I am interested in opinions regarding utility of various DNA sequence manipulation and analysis programs for both Mac and Windows platforms. I am interested in flexibility and value, so please include prices if known. Finally, how does one obtain DNA Strider and what is its cost? Thanks. -- Jonathan F Wendel Department of Botany, Iowa State University Ames, Iowa 50011 Email: JFW@IASTATE.EDU Phone: (515) 294-7172 From owner-software@net.bio.net Fri Nov 04 22:00:00 1994 Path: biosci!agate!howland.reston.ans.net!xlink.net!news.ppp.de!clipper!columbus!ulfe From: ulfe@columbus.clipper.de (Ulf Eversberg) Date: 01 Nov 94 08:25:38 Newsgroups: bionet.software Subject: dicer-slicer Message-ID: <0cc_9411050959@clipper.de> X-FTN-To: MedMult Organization: Clipper WorkShop BBS - Your Shareware Source Lines: 6 I am measuring the redoxpotential in marine sediments (tidalflats) with a multielectrode system. The result is a datafield of 365 points in a sediment block of 30*30*30 cm. Dicer is great to find structures in this block. Ulf Eversberg Bremerhaven/Germany 2:241/200.24 ulfe@columbus.clipper.de ulfe@fishtwn2.han.de From owner-software@net.bio.net Fri Nov 04 22:00:00 1994 Path: biosci!agate!howland.reston.ans.net!vixen.cso.uiuc.edu!news.uoregon.edu!netnews.nwnet.net!owl.csrv.uidaho.edu!xslip09.csrv.uidaho.edu!user From: tims@uidaho.edu (Tim Steffens) Newsgroups: bionet.software Subject: Re: EndNote 2.0 Price? Date: Sat, 05 Nov 1994 07:43:14 -1200 Organization: University of Idaho Lines: 27 Distribution: world Message-ID: References: <9411021234.AA27784@leucine.c.dna.affrc.go.jp> NNTP-Posting-Host: xslip09.csrv.uidaho.edu In article <9411021234.AA27784@leucine.c.dna.affrc.go.jp>, akihara@FUJIMI.HOSEI.AC.JP (Akira Kihara) wrote: > Now a days, it is getting expensive to keep software fresh, > since the up-grade costs too much, in some case. > > Today, I have received the up-grade information for EndNote Plus 2.0 > (Mac) from my version 1.3. The Japanese "authorized" dealer > bill us $200 (20,000 yen)! > > I am thinking that I have better to buy the up-grade or even new one from > other country. Since I do not want to consume time for getting more money. > > Could you please let me know the up-grade price in US or else where. > I paid $99 plus some amount for shipping and handling. This includes EndLink 2.0 and the new plug-in module for Word 6.0 when it becomes available. I believe it is worth the upgrade :). You may want to contact Niles and Assoc. directly, check the manual or AOL. Good Luck! -- Tim Steffens | "What next!?" Lab. Matrls. Super. | Dept. MMBB, U. of ID | e-mail: tims@uidaho.edu (208) 885-8953 | Sturff@aol.com From owner-software@net.bio.net Fri Nov 04 22:00:00 1994 Path: biosci!news.Stanford.EDU!rutgers!netnews.upenn.edu!mail2.sas.upenn.edu!alavizad From: alavizad@mail2.sas.upenn.edu (Seyed A Alavizadeh) Newsgroups: bionet.software Subject: Help on BLAST searches Date: 5 Nov 1994 19:18:20 GMT Organization: University of Pennsylvania Lines: 13 Message-ID: <39glps$5u9@netnews.upenn.edu> NNTP-Posting-Host: mail2.sas.upenn.edu X-Newsreader: TIN [version 1.2 PL2-upenn1.1] im doing a presentation on DNA sequencing and its uses and i was hoping to give a description of database searches. ive used BLAST before in my research, but unfortunately i never really understood what was going on. id appreciate it if someone out there could provide me with a short summary (their own or a reference which contains one or an FTP site) of the BLAST algorithm and the numbers that are returned with a search (score, expect, etc.) in language that your typical first year mol bio grad student with little background in statistics could understand. ive looked back through some of the references, but i found them just as confusing. id really appreciate any response. john darling ps. the presentation is on tuesday... From owner-software@net.bio.net Fri Nov 04 22:00:00 1994 Path: biosci!agate!spool.mu.edu!howland.reston.ans.net!cs.utexas.edu!geraldo.cc.utexas.edu!UTXVM.CC.UTEXAS.EDU!PSHS533 From: PSHS533@UTXVM.CC.UTEXAS.EDU Newsgroups: bionet.software Subject: shareware for EEG Date: Sat, 05 Nov 94 10:40:34 CDT Organization: The University of Texas at Austin Lines: 6 Message-ID: <170659622.PSHS533@UTXVM.CC.UTEXAS.EDU> NNTP-Posting-Host: utxvm.cc.utexas.edu I am seeking shareware that will allow me to turn a PC into an oscilloscope for recording EEG data. I have a program for the Mac, but the only digitizer I can scrounge is for the PC... Sondra Bland sbland@mail.utexas.edu From owner-software@net.bio.net Sat Nov 05 22:00:00 1994 Path: biosci!agate!howland.reston.ans.net!news2.near.net!das-news2.harvard.edu!fas-news.harvard.edu!husc.harvard.edu!fas!robison1 From: robison1@fas.harvard.edu (Keith Robison) Newsgroups: bionet.software Subject: Re: Help on BLAST searches Date: 6 Nov 1994 19:06:54 GMT Organization: Harvard University, Cambridge, Massachusetts Lines: 36 Message-ID: <39j9ge$nlk@scunix2.harvard.edu> References: <39glps$5u9@netnews.upenn.edu> NNTP-Posting-Host: fas.harvard.edu There are a growing number of sequence analysis tutorials on the Web. Mine is at http://twod.med.harvard.edu/seqanal/ It is far from perfect, but it does reference the other two I know about (which are in many ways superior). It also contains references to other articles & books of interest. In reference to BLAST, the algorithm can crudely be described as: 1) For each sequence of k residues in the query ("k-tuple"), generate a list of all the k-tuples which could be the nucleus of a significant alignment 2) Search the query for these k-tuples In BLAST, this is done using a comp sci contraption called a Deterministic Finite State Automaton (DFA). In brief, a DFA is roughly analogous to a identification key for the set of k-tuples (such as the sort of key you might use to identify a living organism). 3) At each matched k-tuple, extend the alignment until further extensions do not improve the score At all stages, BLAST is using a simple table (substitution matrix) to score the alignment of the query against the database sequence. Keith Robison Harvard University Department of Cellular and Developmental Biology Department of Genetics / HHMI krobison@nucleus.harvard.edu From owner-software@net.bio.net Sat Nov 05 22:00:00 1994 Path: biosci!agate!spool.mu.edu!uwm.edu!msuinfo!news From: 22473mgr@msu.edu (Uwe Rossbach) Newsgroups: bionet.software Subject: Re: HTML-Editors? Date: 6 Nov 1994 20:53:03 GMT Organization: MSU Lines: 22 Message-ID: <39jfnf$rbp@msuinfo.cl.msu.edu> References: <39dmak$s7m@mserv1.dl.ac.uk> NNTP-Posting-Host: fdb310.prl.msu.edu X-Newsreader: WinVN 0.90.6 In article <39dmak$s7m@mserv1.dl.ac.uk>, kulmburg@sun1.ukl.uni-freiburg.de (Peter Kulmburg) says: > >Dear collegues, > >I will have to write documents for homepages on www-servers. I am working >on a Mac and I am interested in html-editors. I know that they exist but I >do not know what exactly they do and, more important, I do not know where >to find one on the net. > >Could you please help me with some hints? Thank you very much! > >Yours Peter > >Peter KULMBURG (193.196.226.110 MacName: ktl110.ukl.uni-freiburg.de) >home: Tel./Fax:+49 761 808439 work: Tel.:+49 761 270/7195 Fax:/7177 > > try the www& html developer's Jump Station at: oneworld.wa.com/htmldev/devpage/dev-page.html a real nice tool page. From owner-software@net.bio.net Sat Nov 05 22:00:00 1994 Path: biosci!ARTSCI.WUSTL.EDU!mpion From: mpion@ARTSCI.WUSTL.EDU (Martin Pion) Newsgroups: bionet.software Subject: help Date: 6 Nov 1994 13:37:10 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 3 Sender: daemon@net.bio.net Distribution: world Message-ID: <9411062135.AA00554@mango.wustl.edu> NNTP-Posting-Host: net.bio.net  From owner-software@net.bio.net Sun Nov 06 22:00:00 1994 Path: biosci!agate!blanket.mitre.org!think.com!mbcrr!schmidt From: schmidt@mbcrr.dfci.harvard.edu (Bill Schmidt) Newsgroups: bionet.software Subject: Gopher/WWW Servers Announcement Date: 7 Nov 1994 14:43:31 GMT Organization: Dana-Farber Cancer Institute Lines: 124 Distribution: world Message-ID: <39lefdINN6dp@early-bird.think.com> NNTP-Posting-Host: mbcrr.harvard.edu Originator: schmidt@mbcrr The BioMolecular Engineering Research Center & Molecular Biology Computer Research Resource at Boston University (collectively referred to here as BMERC) announces the availability of its Gopher and World Wide Web (WWW) servers. * The URL for the BMERC WWW server Home Page is: http://bmerc-www.bu.edu/ * The gopher server can be accessed at the address given immediately below. NOTE that the gopher