From owner-software@net.bio.net Mon Jan 01 22:00:00 1996 Path: biosci!bloom-beacon.mit.edu!newsfeed.internetmci.com!howland.reston.ans.net!tank.news.pipex.net!pipex!oleane!jussieu.fr!univ-lyon1.fr!news.imag.fr!news.ujf-grenoble.fr!news-merci.ujf-grenoble.fr!macjesior.imag.fr!user From: jean-claude.jesior@imag.fr (J.C. JESIOR) Newsgroups: bionet.software Subject: New PPC version of 'FoldIt'‹ a protein modelling freeware Date: 2 Jan 1996 13:39:10 GMT Organization: Institut Albert BONNIOT, CNRS Lines: 116 Message-ID: NNTP-Posting-Host: macjesior.imag.fr Mime-Version: 1.0 Content-Type: text/plain; charset="iso-8859-1" Content-Transfer-Encoding: 8bit ANNOUNCING THE NEW PPC VERSION OF 'FOLDIT (LIGHT)' v.4.1.1 a molecular modelling freeware for Macintosh computers. €€€€€€€€€€€€€€€€€€€€€ FREEWARE €€€€€€€€€€€€€€€€€€€€€ €€€€ First release of the PPC version €€€€ DOWNLOAD * Using a WWW browser 'FoldIt (light)' can be downloaded from the following address: ftp://ftp.imag.fr/pub/TIMC/FoldIt.html * Using 'Fetch', it can be downloaded directly from: ftp.imag.fr in the directory: pub/TIMC *********************************************************************** You'll find two versions of the application: * Download the 'FoldIt (light) FAT' version if you are using a Power Mac or a Macintosh equipped with a 68LC040 CPU. * Download the 'FoldIt (light) FPU' version if you are using a machine equipped with a 68030 CPU (+68881/82 coprocessor) or with a full 68040 CPU (not a 68LC040!) *********************************************************************** WHAT 'FOLDIT (LIGHT)' DOES? 'FoldIt (light)' is a molecular modelling program to visualize and manipulate proteins. 'FoldIt (light)' is an interactive program with a user friendly interface. The goal of this program was to build an integrated environment in which statistical analysis as well 3D observations could be realized on PDB files without having to transfer files or swap machines. Our major underlying research project is still to try to improve the folding prediction methods (hence the name 'FoldIt'). This is also the sole desactivated feature in this released version (hence the adjective '(light)'). 'FoldIt (light)' is intented to provide the possibility to analyze proteins up to 1600 residues in size, to visualize and manipulate them interactively. It can directly read any protein coordinate text file from the Brookhaven Protein Data Bank (PDB) (Bernstein et al., 1977) including hetero-atoms and water molecules. 'FoldIt (light)' has two main windows: a color image window to display the protein structure and a text window to record the result of all operations requested by the user. The protein structure can be manipulated easily in real time with the mouse, zoomed or observed in stereo. Structure movement can also occur stepwise for a more precise control. Animations can be created. Steric conflicts, disulfide bonds, hydrogen and ionic interactions can be located and displayed in the protein structure. These interactions are also reported in the text window. Atoms and residues can be tagged individually (or globally) and structural information can then be extracted. Portions of a structure can be read into memory or displayed. Two structures can be read at the same time in memory and can be overlapped automatically. The second structure can be manipulated independently of the first. Bonds can be rotated and atomic parameters can be changed. The sequential folding of a protein can be simulated. It is possible to create a protein de novo from the menu or by entering the sequence from the keyboard. Structures can then be manipulated locally or forced into helices. The application can process structures in the batch mode to extract a number of structural features: Ramachandran plots, SS-bond plots, H-bond plots. Statistics on atomic parameters are displayed as histograms. The content of image and text windows as well as histograms can be saved to disk. SOFTWARE ENVIRONMENT 'FoldIt (light)' can only work on Macintosh computers running under system 7.0 and higher. It has been developed with Symantec Think Pascal and includes 52000 lines of code. The application can run in the background which is convenient for lengthy statistical procedures. 'FoldIt (light)' does not support printing but can save the content of its text window (report of different operations and data analysis) and the content of the image window (result of graphic operations) in TEXT or PICT formats. These files can then be manipulated by other specialized applications and printed. HARDWARE ENVIRONMENT 'FoldIt (light) FAT' runs on any Macintosh computers. For those who are using Macintosh computers equipped with 68030 (+ coprocessor) or 68040 microprocessors (i.e. Macintosh SE30 to Quadras), a version requirring FPU is also included in the package ('FoldIt (light) FPU'). The application itself requires 879 KB - 1.9 MB of memory and 3.3 KB of additional memory for each read residue: this means that 660 KB of extra RAM are necessary to read a typical 200-residue protein. Color monitors are preferred to give a better depth perception but black & white monitors may also be used. DOCUMENTATION A manual is included as a stand alone document which can be printed. Several small size protein structures are included as example. Balloon help is supported. ****************************************************** FoldIt (light) freeware by Jean-Claude JÉSIOR/ CNRS, Grenoble, France e-mail: jean-claude.jesior@imag.fr Version 4.1.1 - Sunday, 24 December 1995 developed with Symantec Think Pascal. FAT version compiled with Metrowerks Code Warrior. ****************************************************** -- Jean-Claude JESIOR jean-claude.jesior@imag.fr From owner-software@net.bio.net Mon Jan 01 22:00:00 1996 Path: biosci!agate!howland.reston.ans.net!news.sprintlink.net!rain.fr!world-net!usenet From: mercure@worldnet.net (Yann) Newsgroups: bionet.software Subject: HELP !! I NEED C++ PLEASE Date: Fri, 29 Dec 1995 22:20:23 GMT Organization: World-Net information exchange, Internet provider. Lines: 22 Message-ID: <4c1pof$ggg@aldebaran.sct.fr> NNTP-Posting-Host: client142.sct.fr X-Newsreader: Forte Free Agent v0.55 I need C++ because I bought a book very expansive but my program (Borland Turbo C++ 1.1) can only execute 'C' program ! That's a big problem, I can't do anything !! :°- { Please, If you can send me a program which can execute 'C++' program, I would do all what you want !! !!!!! !!!!! !!!!!!!!!!!!!!! !!!! !!!!!!!!!!!!!!!! ! ! ! ! ! ! ! ! ! ! ! ! ! !!!!! ! !!!!!!!!!!!!! ! ! !!!!!!!!!!!!!!!! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !!!!! !!!!! !!!!!!!!!!!!!!! !!!!!!!!!!!!! ! ! ==================================== From owner-software@net.bio.net Mon Jan 01 22:00:00 1996 Path: biosci!bloom-beacon.mit.edu!newsfeed.internetmci.com!uwm.edu!msunews!netnews.upenn.edu!taurus.fccc.edu!mighty.facs.fccc.edu!user From: hardy@mighty.fccc.edu (Richard R. Hardy) Newsgroups: bionet.software Subject: Re: FACS/H-P -floppy-> Mac/PC driver? Date: Tue, 02 Jan 1996 13:10:05 -0500 Organization: I.C.R., Fox Chase Cancer Center Lines: 29 Message-ID: References: <30E584E8.456E@biomed.med.yale.edu> NNTP-Posting-Host: mighty.facs.fccc.edu X-Newsreader: Value-Added NewsWatcher 2.1d3+ In article <30E584E8.456E@biomed.med.yale.edu>, "David R. Johnson" wrote: >Dear Netters, > We have a flow cytometer that works very well (Becton-Dickenson >FACSort) connected to a Hewlett-Packard Computer that runs an >ancient OS and doesn't work very well. For example, only 80 files >can fit on a floppy, regardless of how small they are (1 parameter >analysis of 2000 cells is only a few Kb). > B-D sells a Mac system for the FACS, but it costs a bundle >($20k). > Does anyone have (or know of) a floppy driver that works on a DOS >machine (Windows 3.1) or, preferably, a Mac? This would allow >importation of FACS data into Excel, etc., and would stop the >proliferation of H-P formatted floppies around the lab. > >thanks in advance (also for any corrections if my understanding of >the solution is flawed!) >-Dave If you have the money, a permanent solution that would let you use a Mac for everything and dump that HP is to get the new-ish BD CellQuest upgrade. This is hardware/software that replaces the HP completely... Unfortunately, very pricey. ____________________________________________________________________________ Richard R. Hardy Member, Institute for Cancer Research Fox Chase Cancer Center Tel: (215) 728-2463 7701 Burholme Ave. FAX: (215) 728-2412 Philadelphia, PA 19111 E-MAIL: RR_HARDY@fccc.edu From owner-software@net.bio.net Mon Jan 01 22:00:00 1996 Path: biosci!biosci!not-for-mail From: tcnixon@ix.netcom.com (Thomas Nixon ) Newsgroups: bionet.cellbiol,bionet.immunology,bionet.microbiology,bionet.molbio.ageing,bionet.molbio.embldatabank,bionet.molbio.evolution,bionet.mycology,bionet.neuroscience,bionet.parasitology,bionet.population-bio,bionet.protista,bionet.software Subject: Points of interest Date: 2 Jan 1996 11:47:49 -0800 Organization: Netcom Lines: 16 Sender: biohelp@net.bio.net Distribution: world Message-ID: <4ca6qk$knt@ixnews3.ix.netcom.com> NNTP-Posting-Host: net.bio.net Xref: biosci bionet.cellbiol:3719 bionet.immunology:6776 bionet.microbiology:4387 bionet.molbio.ageing:2357 bionet.molbio.embldatabank:585 bionet.molbio.evolution:4054 bionet.mycology:3303 bionet.neuroscience:11885 bionet.parasitology:1300 bionet.population-bio:1725 bionet.protista:461 bionet.software:14322 Hello! I am a freelance writer working on a project concerning the academic research capabilities and assets of the internet. I am particularly interested in which sites/resources (WWW, Gopher, FTP, Lists, etc.) that regular users/researchers find most beneficial. I am seeking input from professors, teachers, researchers, students, and anyone else who has something to contribute. Please reply here, or preferably to: tcnixon@netcom.com Tom Nixon P.S. I apologize for the crossposting. This is the only time that this post will appear in this newsgroup. From owner-software@net.bio.net Mon Jan 01 22:00:00 1996 Path: biosci!ihnp4.ucsd.edu!swrinde!newsfeed.internetmci.com!in2.uu.net!newsfeed.pitt.edu!news.pgh.net!panda From: joshua dye Newsgroups: bionet.software Subject: WWW Date: 2 Jan 1996 13:34:18 GMT Organization: U of Iowa Panda System Lines: 4 Message-ID: <820590275-1-1004@dolphin.envirolink.org> Reply-To: jdye@envirolink.org NNTP-Posting-Host: dolphin.envirolink.org Keywords: WWW, world wide web, internet Hi, Is there a web browser for dos? vrman From owner-software@net.bio.net Mon Jan 01 22:00:00 1996 Path: biosci!agate!howland.reston.ans.net!tank.news.pipex.net!pipex!oleane!jussieu.fr!univ-lyon1.fr!news.imag.fr!ciril.fr!u-strasbg.fr!news From: jgaraud@faust.u-strasbg.fr (Jean-Claude GARAUD) Newsgroups: bionet.software Subject: Re: FACS/H-P -floppy-> Mac/PC driver? Date: Tue, 02 Jan 1996 14:14:17 GMT Organization: CRC - Universite Louis Pasteur - Strasbourg France Lines: 34 Message-ID: <4cbemt$plm@apopi.u-strasbg.fr> References: <30E584E8.456E@biomed.med.yale.edu> NNTP-Posting-Host: myrte.u-strasbg.fr X-Newsreader: Forte Free Agent 1.0.82 "David R. Johnson" wrote: >Dear Netters, > We have a flow cytometer that works very well (Becton-Dickenson >FACSort) connected to a Hewlett-Packard Computer that runs an >ancient OS and doesn't work very well. ..... > Does anyone have (or know of) a floppy driver that works on a DOS >machine (Windows 3.1) or, preferably, a Mac? This would allow >importation of FACS data into Excel, etc., .... BD sells "PC lysis", a program for PCs, almost identical to the Lysis program for the HP 9000 workstation. This program comes with the "HPreader" utility which allows to read HP-formatted diskettes on a PC. There are however two problems : 1 - PC lysis is very expensive. By the way, for a much better (and cheaper - it's free !) program, look at the excellent WinMDI by J. Trotter at http://facs.scripps.edu/software.html 2 - Both PC lysis and HPreader are copy-protected by the same key (a device on the parallel port). A real nuisance ! I believe it should be possible to buy the HPreader utility alone (it's not made by BD) but I haven't found where yet. JCG ______________________________________________ Jean-Claude GARAUD Institut de Chimie Biologique STRASBOURG, FRANCE ______________________________________________ From owner-software@net.bio.net Tue Jan 02 22:00:00 1996 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!newsfeed.internetmci.com!in2.uu.net!svc.portal.com!news1.best.com!shellx.best.com!shellx.best.com!not-for-mail From: jquinn@shellx.best.com (BIOCHEMISTRY.COM) Newsgroups: bionet.software Subject: Re: WWW Date: 2 Jan 1996 16:03:24 -0800 Organization: Best Internet Communications Lines: 8 Message-ID: <4cch4c$7oj@shellx.best.com> References: <820590275-1-1004@dolphin.envirolink.org> NNTP-Posting-Host: shellx.best.com X-Newsreader: TIN [version 1.2 PL2] I think that there is a version of lynx (the text browser) for dos; check the FAQ in the WWW newsgroup. joshua dye (jdye@envirolink.org) wrote: : Hi, Is there a web browser for dos? : vrman From owner-software@net.bio.net Tue Jan 02 22:00:00 1996 Path: biosci!daresbury!not-for-mail From: Newsgroups: bionet.software Subject: PAUP latest upgrade Date: 3 Jan 1996 09:23:16 -0000 Lines: 16 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <4cdhu4$g9d@mserv1.dl.ac.uk> Original-To: bio-soft@dl.ac.uk Dear Netters, I am looking for the latest upgrade of the software package: Phylogenetic Analysis Using Parsimony (PAUP) Can some one provide me the e-mail adress of the author who developped it; Dr. D.L.Swofford. Please respond to e-mail address: Henk.Pennings@petosluis.petosluis.unisource.nl Kind regards, Henk Pennings. From owner-software@net.bio.net Tue Jan 02 22:00:00 1996 Path: biosci!bcm.tmc.edu!cs.utexas.edu!howland.reston.ans.net!tank.news.pipex.net!pipex!oleane!in2p3.fr!univ-lyon1.fr!jussieu.fr!Newsmaster From: GURLIE Raphael Newsgroups: bionet.software Subject: Re: HELP !! I NEED C++ PLEASE Date: Wed, 03 Jan 1996 11:21:47 +0100 Organization: Universites Paris VI/Paris VII - France Lines: 3 Message-ID: <30EA58BB.41D@glenan.urbb.jussieu.fr> References: <4c1pof$ggg@aldebaran.sct.fr> NNTP-Posting-Host: glenan.urbb.jussieu.fr Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 2.0b4 (X11; I; HP-UX A.09.05 9000/712) Hi Yann, you can use g++ wich is gnu c++, and as it is under gnu licence you can get it free at any good ftp site. From owner-software@net.bio.net Tue Jan 02 22:00:00 1996 Path: biosci!yk.rim.or.jp!rago From: rago@yk.rim.or.jp (Etsuko Miyamoto) Newsgroups: bionet.software Subject: looking for Mac chemical software Date: 2 Jan 1996 23:48:51 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 30 Sender: daemon@net.bio.net Distribution: world Message-ID: <30EAB3F3.5AAB@yk.rim.or.jp> NNTP-Posting-Host: net.bio.net Dear Netter I synthesize compound of nucleotides and amino acids. And I'm = looking for Mac chemical software for drawing chemical = structure and displying 3D structure for my sybthesis products . My products are from monomer to origomer(about20mer). Let me = know available Mac software(free is better). Now I use ChemEdit($B&A(J-version.1989) and ISIS/DRAW1.2.1. = ChemEdit can disply 3D model from what I draw. But ChemEdit = don't have the element P, so I can't draw nucleotides. ISIS/DRAW = can draw anything I want but can't disply 3D structure. I also try = to use Rasmol2.5 for displying 3D structure from ISIS/DRAW = MolFILE. I can disply but only 2D model. Let me know chemical = software that I can draw anything I want and also disply 3D model. = Thank you for your kindness! Regards, Yokohama National Univ. Dept. of Material Science and Chemical Engineering. First degree of master course. Etsuko Miyamoto From owner-software@net.bio.net Tue Jan 02 22:00:00 1996 Path: biosci!ihnp4.ucsd.edu!swrinde!cs.utexas.edu!howland.reston.ans.net!usc!newshub.csu.net!deernisse.fullerton.edu!user From: DEernisse@fullerton.edu (Doug Eernisse) Newsgroups: bionet.software Subject: DNA Stacks - new version 1.1 available Date: Tue, 02 Jan 1996 22:29:52 -0800 Organization: CSUF Lines: 76 Message-ID: NNTP-Posting-Host: deernisse.fullerton.edu I have posted version 1.1 of a collection of HyperCard 2.x stacks for Macintosh computers called DNA Stacks. It is especially intended for displaying/editing multiple sequence alignments, performing data conversions or analyses, displaying rescalable gene maps of mitochondrial or chloroplast genomes, and displaying graphs of codon usage. For a description of version 1.0 see: Eernisse, D. J. 1992. DNA Translator and Aligner: HyperCard utilities to aid phylogenetic analysis of molecules. CABIOS 8: 177-184. For a description of the rather extensive feature enhancements added between versions 1.0 and 1.1, see the file "DNA Stacks Info" that comes with the package, or email me and I would be happy to send this file. The best way to get the most current version of DNA Stacks is from the author's home page: . Version 1.1 was also sent to the Incoming directory of the Indiana molecular biology archives I trust it will eventually be moved to The last update to this archive was version 1.0n6 in 8/94. The package has been considerably improved since then. Warning -- expect the package to be about 2 MB when expanded. Much of the increased size is due to the support of additional animal mitochondrial genomes. Now one can view gene maps and extract gene sequences from about 26 animal mtDNAs that have been completely sequenced. DNA Stacks also depends on any one of the following: 1) HyperCard 2.0 or greater (2.3 is PPC-native) 2) HyperCard Player 2.0 or greater (2.3 is PPC-native) 3) HyperStack Player 2.3 (sharewhare stand-alone) Actually, only the version at my Web site, which was slightly updated today, works with the newly available third option. Although I had only my first experience with it today, it seems quite fast. It might be worth trying if you have a PPC PowerMac but haven't yet updated to the current PPC-native HyperCard or HyperCard Player (v. 2.3). Many early PowerMacs came supplied with a non-native version 2.2 of HC Player. It should be at the usual archives, including this mirror site: gopher://wuarchive.wustl.edu:70/40/systems/mac/ umich.edu/hypercard/hypercardutil/hyperstackplayer2.3ppc.sit or .../hyperstackplayer2.3.sit for non-PPC version. but be sure to allocate lots of extra RAM to it before you open it (same goes for HyperCard or HyperCard Player). The DNA Stacks package is freeware for noncommercial use (see details in the About dialog). -- Doug Eernisse Dept. Biological Science MH282 California State University Fullerton, CA 92634 -- Doug Eernisse Dept. Biological Science MH282 California State University Fullerton, CA 92634 From owner-software@net.bio.net Tue Jan 02 22:00:00 1996 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!newsfeed.internetmci.com!sundog.tiac.net!schlegel.tiac.net!user From: schlegel@tiac.net (Lawrence Schlegel) Newsgroups: bionet.cellbiol,bionet.immunology,bionet.microbiology,bionet.molbio.ageing,bionet.molbio.embldatabank,bionet.molbio.evolution,bionet.mycology,bionet.neuroscience,bionet.parasitology,bionet.population-bio,bionet.protista,bionet.software Subject: Re: Points of interest Date: Tue, 02 Jan 1996 20:19:10 -0500 Organization: The Internet Access Company Lines: 32 Distribution: world Message-ID: References: <4ca6qk$knt@ixnews3.ix.netcom.com> NNTP-Posting-Host: schlegel.tiac.net Xref: biosci bionet.cellbiol:3723 bionet.immunology:6780 bionet.microbiology:4391 bionet.molbio.ageing:2360 bionet.molbio.embldatabank:586 bionet.molbio.evolution:4059 bionet.mycology:3305 bionet.neuroscience:11894 bionet.parasitology:1301 bionet.population-bio:1726 bionet.protista:462 bionet.software:14324 In article <4ca6qk$knt@ixnews3.ix.netcom.com>, tcnixon@ix.netcom.com (Thomas Nixon ) wrote: > Hello! > > I am a freelance writer working on a project concerning the > academic research capabilities and assets of the internet. I am > particularly interested in which sites/resources (WWW, Gopher, FTP, > Lists, etc.) that regular users/researchers find most beneficial. I am > seeking input from professors, teachers, researchers, students, and > anyone else who has something to contribute. > > Please reply here, or preferably to: tcnixon@netcom.com > > > Tom Nixon > > P.S. I apologize for the crossposting. This is the only time that > this post will appear in this newsgroup. I love the internet. There is so much out there. At school (Wesleyan University) and home I have access to the WWW, which is great. The amount of information available is amazing and very overwhelming. I just wish I knew more about it and how to access everything it has to offer. I did want to make a comment for your project, if it matters, and that is that it is great that several universities and colleges (actually most) offer relatively free (a low monthly cover fee) personal access and free general/campus-wide access. I believe this availability is definitely a significant factor to its widespread use and effectiveness at institutions of higher education. 'Just wanted to drop a quick note for a worthy project. I'd like to know what the results of your project are.:) sschlegel@wesleyan.edu From owner-software@net.bio.net Tue Jan 02 22:00:00 1996 Path: biosci!uni.edu!Darrell.Wiens From: Darrell.Wiens@uni.edu Newsgroups: bionet.software Subject: motion analysis software Date: 3 Jan 1996 09:03:22 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 4 Sender: daemon@net.bio.net Distribution: world Message-ID: <01HZKKPP4YM28WXG9I@uni.edu> NNTP-Posting-Host: net.bio.net I posted unothrodoxly, hope this gets through. I am interested in shopping for motion analysis software to use on cells in culture and on protozoans swimming around. Have seen DIAS, but nothing else so far. Any suggestions? Thanks, D. Wiens From owner-software@net.bio.net Tue Jan 02 22:00:00 1996 Path: biosci!agate!newsxfer2.itd.umich.edu!newsfeed.internetmci.com!chi-news.cic.net!news.math.psu.edu!ra.nrl.navy.mil!usenet From: rwadkins@cbmse.nrl.navy.mil (rmw) Newsgroups: bionet.software Subject: Re: looking for Mac chemical software Date: 3 Jan 1996 15:51:00 GMT Organization: His Own Little World Lines: 16 Sender: -Not-Authenticated-[3942] Distribution: world Message-ID: <4ce8l4$d1o@ra.nrl.navy.mil> References: <30EAB3F3.5AAB@yk.rim.or.jp> NNTP-Posting-Host: rmw-6900.nrl.navy.mil X-Posted-From: InterNews 1.0.1@rmw-6900.nrl.navy.mil Xdisclaimer: No attempt was made to authenticate the sender's name. In article <30EAB3F3.5AAB@yk.rim.or.jp> rago@yk.rim.or.jp (Etsuko Miyamoto) writes: > Dear Netter > > I synthesize compound of nucleotides and amino acids. And I'm = > > looking for Mac chemical software for drawing chemical = > > structure and displying 3D structure for my sybthesis products . ChemDraw and Chem3D, both of which are from Berkely Software. They have a website somewhere where you can get a demo. Try a search engine with "ChemDraw" as the keyword. --Randy From owner-software@net.bio.net Tue Jan 02 22:00:00 1996 Path: biosci!agate!howland.reston.ans.net!EU.net!peer-news.britain.eu.net!sunsite.doc.ic.ac.uk!hgmp.mrc.ac.uk!sknight From: sknight@hgmp.mrc.ac.uk (Dr. S.W. Knight) Newsgroups: bionet.software Subject: X-windows for Mac Date: 3 Jan 1996 14:30:04 GMT Organization: MRC Human Genome Resource Centre Lines: 6 Message-ID: <4ce3tc$qpp@mercury.hgmp.mrc.ac.uk> NNTP-Posting-Host: tin.hgmp.mrc.ac.uk I am looking for a source of X-windows for Macintosh in the UK, any suggestions ? Thanks Dr S.W.Knight (sknight@rpms.ac.uk) From owner-software@net.bio.net Tue Jan 02 22:00:00 1996 Path: biosci!agate!howland.reston.ans.net!newsfeed.internetmci.com!vixen.cso.uiuc.edu!phylo.life.uiuc.edu!scott From: scott@phylo.life.uiuc.edu (Scott Howard) Newsgroups: bionet.software Subject: Re: PAUP latest upgrade Date: 3 Jan 96 14:26:51 GMT Organization: University of Illinois at Urbana Lines: 1 Distribution: bionet Message-ID: References: <4cdhu4$g9d@mserv1.dl.ac.uk> NNTP-Posting-Host: phylo.life.uiuc.edu sales@sinauer.com From owner-software@net.bio.net Tue Jan 02 22:00:00 1996 Path: biosci!agate!howland.reston.ans.net!tank.news.pipex.net!pipex!peer-news.britain.eu.net!EU.net!Germany.EU.net!news.dfn.de!fu-berlin.de!news.belwue.de!News.Uni-Marburg.DE!news.th-darmstadt.de!uni-erlangen.de!winx03!wpxx02.toxi.uni-wuerzburg.de!not-for-mail From: krasel@wpxx02.toxi.uni-wuerzburg.de (Cornelius Krasel) Newsgroups: bionet.software Subject: Re: HELP !! I NEED C++ PLEASE Date: 3 Jan 1996 09:33:16 GMT Organization: Dept. of Pharmacology, U Wuerzburg Lines: 17 Message-ID: <4cdigs$ha7@winx03.informatik.uni-wuerzburg.de> References: <4c1pof$ggg@aldebaran.sct.fr> NNTP-Posting-Host: wpxx02.toxi.uni-wuerzburg.de X-Newsreader: TIN [UNIX 1.3 950824BETA PL0] Yann (mercure@worldnet.net) wrote: > I need C++ because I bought a book very expansive but my program > (Borland Turbo C++ 1.1) can only execute 'C' program ! That's a big > problem, I can't do anything !! :°- { Get g++ and have fun. (g++ is the C++ compiler of the free software foundation.) BTW, a compiler does not execute a program, it merely compiles it, i.e. it makes an executable binary from the source. If you ask for illegal copies of software ("warez"), get lost. --Cornelius. -- /* Cornelius Krasel, U Wuerzburg, Dept. of Pharmacology, Versbacher Str. 9 */ /* D-97078 Wuerzburg, Germany email: phak004@rzbox.uni-wuerzburg.de SP3 */ /* "Science is the game we play with God to find out what His rules are." */ From owner-software@net.bio.net Tue Jan 02 22:00:00 1996 Path: biosci!ns1.faseb.org!lamarck.sura.net!thorn.cc.usm.edu!pacific.st.usm.edu!rbateman From: rbateman@ocean.st.usm.edu (Robert Bateman) Newsgroups: bionet.software Subject: Personal Omiga Date: 3 Jan 1996 17:07:51 GMT Organization: University of Southern Mississippi Lines: 5 Message-ID: <4ced57$k5r@thorn.cc.usm.edu> NNTP-Posting-Host: ocean.st.usm.edu X-Newsreader: TIN [version 1.2 PL2] Can anyone tell me if the Personal Omiga version of PC Gene is any better than the last DOS version of PC Gene? Bob Bateman rbateman@wave.st.usm.edu From owner-software@net.bio.net Tue Jan 02 22:00:00 1996 Path: biosci!bcm.tmc.edu!cs.utexas.edu!howland.reston.ans.net!vixen.cso.uiuc.edu!news.ksu.ksu.edu!news.physics.uiowa.edu!cobra.uni.edu!wiens From: wiens@cobra.uni.edu Newsgroups: bionet.software Subject: motion analysis Message-ID: <1996Jan3.112331.51493@cobra.uni.edu> Date: 3 Jan 96 11:23:31 -0600 Organization: University of Northern Iowa Lines: 2 I am shopping for biological motion analysis software. Have seen only DIAS. Any other suggestions? Prefer Mac but consider PC. From owner-software@net.bio.net Tue Jan 02 22:00:00 1996 Path: biosci!PetoSluis.PETOSLUIS.unisource.nl!Henk.Pennings From: Henk.Pennings@PetoSluis.PETOSLUIS.unisource.nl Newsgroups: bionet.software Subject: PAUP latest upgrade Date: 3 Jan 1996 01:25:30 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 16 Sender: daemon@net.bio.net Distribution: world Message-ID: <"0102230931-PAUP.latest.upgrade.*"@MHS> NNTP-Posting-Host: net.bio.net Dear Netters, I am looking for the latest upgrade of the software package: Phylogenetic Analysis Using Parsimony (PAUP) Can some one provide me the e-mail adress of the author who developped it; Dr. D.L.Swofford. Please respond to e-mail address: Henk.Pennings@petosluis.petosluis.unisource.nl Kind regards, Henk Pennings. From owner-software@net.bio.net Tue Jan 02 22:00:00 1996 Path: biosci!agate!howland.reston.ans.net!newsfeed.internetmci.com!tank.news.pipex.net!pipex!sunsite.doc.ic.ac.uk!hgmp.mrc.ac.uk!gwilliam From: gwilliam@hgmp.mrc.ac.uk (Gary Williams) Newsgroups: bionet.software Subject: Re: X-windows for Mac Date: 3 Jan 1996 17:21:42 GMT Organization: UK HGMP Resource Centre Lines: 22 Message-ID: <4cedv6$2bn@mercury.hgmp.mrc.ac.uk> References: <4ce3tc$qpp@mercury.hgmp.mrc.ac.uk> NNTP-Posting-Host: gallium.hgmp.mrc.ac.uk In article <4ce3tc$qpp@mercury.hgmp.mrc.ac.uk>, Dr. S.W. Knight wrote: >I am looking for a source of X-windows for Macintosh in the UK, >any suggestions ? >Thanks > Dr S.W.Knight > (sknight@rpms.ac.uk) There are several X-Windows emulators for Macs. The one that I am aware of is 'MacX'. This is an Apple product, so you should contact your local authorised Apple dealer. The other product that I have heard of is 'eXodus', but I do not know who markets this. -- Gary Williams http://www.hgmp.mrc.ac.uk/ Email: G.Williams@hgmp.mrc.ac.uk Tel: +44 1223 494522 Computing Services Section, MRC HGMP Resource Centre, Hinxton Hall, Hinxton, Cambridge, CB10 1RQ, UK From owner-software@net.bio.net Wed Jan 03 22:00:00 1996 Path: biosci!agate!howland.reston.ans.net!news-e1a.megaweb.com!newstf01.news.aol.com!newsbf02.news.aol.com!not-for-mail From: mattdavids@aol.com (MattDavids) Newsgroups: bionet.software Subject: Re: motion analysis Date: 3 Jan 1996 19:27:40 -0500 Organization: America Online, Inc. (1-800-827-6364) Lines: 19 Sender: root@newsbf02.news.aol.com Message-ID: <4cf6ts$6av@newsbf02.news.aol.com> References: <1996Jan3.112331.51493@cobra.uni.edu> Reply-To: mattdavids@aol.com (MattDavids) NNTP-Posting-Host: newsbf02.mail.aol.com < I am shopping for biological motion analysis software. Have seen only DIAS. Any other suggestions? Prefer Mac but consider PC. > Optimas Corporation manufactures a general purpose image analysis software package called OPTIMAS. Included within OPTIMAS is a utility for motion analysis. OPTIMAS operates in either Windows 3.1 or Windows 95. If you are interested in receiving some detailed information and a demo disk on OPTIMAS, e-mail me with your physical mailing address (street, city, state, zip, etc. ). Best regards, Matt Davidson Sales Manager USA/Canada Optimas Corporation From owner-software@net.bio.net Wed Jan 03 22:00:00 1996 Path: biosci!ihnp4.ucsd.edu!swrinde!tank.news.pipex.net!pipex!peer-news.britain.eu.net!EU.net!Germany.EU.net!zib-berlin.de!uni-duisburg.de!news.rz.uni-duesseldorf.de!modem9.rz.uni-duesseldorf.de!kuepperf From: kuepperf@uni-duesseldorf.de (Uta Küpperfahrenberg) Newsgroups: bionet.software Subject: multivariate analysis Date: Thu, 4 Jan 1996 10:30:11 UNDEFINED Organization: Heinrich Heine Universitaet Duesseldorf Lines: 9 Message-ID: NNTP-Posting-Host: modem9.rz.uni-duesseldorf.de Keywords: TSA X-Newsreader: Trumpet for Windows [Version 1.0 Rev B final beta #1] Hello, I am looking for a program named TSA or TSAGRAPH for interpretion of ordination diagramms produced by canonical correspondance analysis. This two programs are used for Trend Surface Analysis, an extended graphical technique to explore the influence of environmental factor on the distribition of species. These programs are Shareware. If someone knows the site or adress or has heared about the programs, please send me a mail to: kuepperf@uni-duesseldorf.de thank you Robert From owner-software@net.bio.net Wed Jan 03 22:00:00 1996 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!newsfeed.internetmci.com!tank.news.pipex.net!pipex!oleane!in2p3.fr!swidir.switch.ch!scsing.switch.ch!news.rccn.net!gnu.mat.uc.pt!ciunix.uc.pt!uhg From: uhg@ciunix.uc.pt (Hugo Miguel Costa) Newsgroups: bionet.software Subject: Anonimous phonecalls Date: 4 Jan 1996 17:02:15 GMT Organization: Dep. de Matematica da Univ. de Coimbra Lines: 1 Message-ID: <4ch16n$oct@gnu.mat.uc.pt> NNTP-Posting-Host: ciunix.uc.pt X-Newsreader: TIN [version 1.2 PL2] From owner-software@net.bio.net Wed Jan 03 22:00:00 1996 Path: biosci!agate!newsxfer2.itd.umich.edu!newsfeed.internetmci.com!tank.news.pipex.net!pipex!oleane!in2p3.fr!swidir.switch.ch!swsbe6.switch.ch!scsing.switch.ch!news.belwue.de!news.dfn.de!uni-muenster.de!pbio16.uni-muenster.de!user From: tiedtke@vnwz00.uni-muenster.de (Uwe Baumert) Newsgroups: bionet.software Subject: Biology/molecular biology programs for Linux Date: 4 Jan 1996 15:28:11 GMT Organization: University of Muenster Lines: 20 Message-ID: NNTP-Posting-Host: pbio16.uni-muenster.de Hi, I'm looking for programs (molecular biology, phylogeny etc) that run with Linux. I'm particular interested in treetool and shadybox. I know of the Linux-port of GDE 2.0, pima compiles with Linux out of the box (Linux 1.2.13, gcc 2.7.0, ELF; Slackware 3.0/S.u.S.e Linux) With kind regards, Uwe Baumert -- Uwe Baumert Institute for General Zoology and Genetics University of Muenster Tel.: +49 251 834675 Schlossplatz 5 Fax: +49 251 834723 D-48149 Muenster, Germany e-mail: baumert@uni-muenster.de From owner-software@net.bio.net Wed Jan 03 22:00:00 1996 Path: biosci!agate!newsxfer2.itd.umich.edu!newsfeed.internetmci.com!tank.news.pipex.net!pipex!warwick!bham!bhamcs!news.ox.ac.uk!news From: "Simon M. Brocklehurst" Newsgroups: bionet.software Subject: ANNOUNCE: NAOMI version upgrade Date: Thu, 04 Jan 1996 15:07:19 +0000 Organization: University of Oxford Lines: 76 Message-ID: <30EBED27.FF6D5DF@bioch.ox.ac.uk> NNTP-Posting-Host: nmrv.ocms.ox.ac.uk Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 2.0b4 (X11; I; SunOS 4.1.3_U1 sun4m) NAOMI - Version Upgrade Announcement (Please note, NAOMI is provided at zero charge for academic use) (e-mail contact smb@bioch.ox.ac.uk) _____________________________________________________________________________ The computer program NAOMI Version 2.3b is available as of now from the NAOMI Web site at: http://www.ocms.ox.ac.uk/~smb/Software/N_details/naomi.html or via anonymous ftp ftp://nmrz.ocms.ox.ac.uk/pub/smb/naomi i.e. at nmrz.ocms.ox.ac.uk in directory pub/smb/naomi/ Users of versions older than 2.10 will need new license keys to allow the upgrade to work (please contact the author in this case). _____________________________________________________________________________ Upgrade features : Side-chain manipulations now include hydrogen atoms where appropriate. This makes for more seamless integration with X-PLOR (e.g. for molecular dynamics simulations, energy minimization, NMR structure calculation etc after manipulation of protein structures using NAOMI). _____________________________________________________________________________ What is NAOMI? NAOMI is an easy-to-use, state-of-the-art computer program which is aimed at both specialist and non-specialist researchers who make use of three-dimensional structures of proteins in their work. It has hundreds of users Worldwide. Some facilities offered by the program for working with structure include: automatic 'key' residue identification automatic hydrophobic core/packing analysis automatic hydrogen bonds main-chain and side-chain identification (including high quality energy calculations) automatic secondary structure (helix, strand and turn) classification using fuzzy logic automatic supersecondary structure classification (beta-hairpin loops) conformational parameters: phi,psi,chi1,chi2,chi3,chi4,chi5 etc solvent accessibility (both absolute and percentage) calculations automatic identification of disulphide bonds, salt bridges, chain-breaks side-chain modelling and manipulation applying symmetry operators automatic structure repair (building in missing atoms) NMR structure refinement module interfaces to graphics programs (MOLSCRIPT (and thus Raster3D), INSIGHT, QUANTA to allow automatic preparation of figures More details are available on the Web site. NB NAOMI currently works only on Silicon Graphics workstations running IRIX 5.* _____________________________________________________________________________ | | ,_ o Simon M. Brocklehurst, | / //\, Oxford Centre for Molecular Sciences, Department of Biochemistry, | \>> | University of Oxford, Oxford, UK. | \\, E-mail: smb@bioch.ox.ac.uk | WWW: http://www.ocms.ox.ac.uk/~smb/ |____________________________________________________________________________ From owner-software@net.bio.net Wed Jan 03 22:00:00 1996 Path: biosci!agate!newsxfer2.itd.umich.edu!newsfeed.internetmci.com!in1.uu.net!usc!newshub.csu.net!nic-nac.CSU.net!csun.edu!hbcsc388 From: hbcsc388@csun.edu (eric schonning) Newsgroups: alt.msdos.programmer,bionet.software,comp.infosystems,comp.object,comp.org.acm,comp.org.ieee,comp.os.msdos.programmer,comp.os.ms-windows.programmer,comp.os.ms-windows.programmer.misc,comp.sources.testers Subject: Re: Year 2000 Solutions Conference Followup-To: alt.msdos.programmer,bionet.software,comp.infosystems,comp.object,comp.org.acm,comp.org.ieee,comp.os.msdos.programmer,comp.os.ms-windows.programmer,comp.os.ms-windows.programmer.misc,comp.sources.testers Date: 4 Jan 1996 06:34:43 GMT Organization: California State University, Northridge Lines: 16 Distribution: world Message-ID: <4cfse3$8ju@dewey.csun.edu> References: <30D9E2EC.4C48@mindlink.bc.ca> NNTP-Posting-Host: louie.csun.edu Xref: biosci bionet.software:14342 comp.infosystems:5976 comp.object:33615 comp.org.acm:2908 comp.org.ieee:2786 comp.os.msdos.programmer:49619 comp.os.ms-windows.programmer.misc:80386 comp.sources.testers:561 Emerick Rogul (emerick@csa.bu.edu) wrote: > :: Existing software which represents Year as a two-digit field, > :: probably will not correctly handle the Year 2000, when 00 becomes > :: greater than 99. > : Actually, 00 "will become" (or IS) *less* than 99 last time I checked. :) > Yes, it was badly worded. The problem is that 1999 < 2000, whereas > 00 < 99. So, two-digit year representations are going to be in a lot > of trouble... That would almost be an interesting prank to play on someone; change the date on their computer to 2000 and see what programs crash. most people never check their computers date so it may go unnoticed for quite a while, or at least drive them crazy for a while... From owner-software@net.bio.net Wed Jan 03 22:00:00 1996 Path: biosci!ihnp4.ucsd.edu!swrinde!newsfeed.internetmci.com!news.sesqui.net!uuneo.neosoft.com!usenet From: Bruce Sylvester Newsgroups: bionet.software Subject: Looking for automatic file transfer software at night. Date: 4 Jan 1996 10:20:08 GMT Organization: NeoSoft Internet Services +1 713 968 5800 Lines: 15 Message-ID: <4cg9ko$q7g@uuneo.neosoft.com> NNTP-Posting-Host: scooter-slip-eb.neosoft.com Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 1.22 (Windows; I; 16bit) To: blkbart@neosoft.com I need software to automatically transfer a data file at night from several stores to a central location. This needs to be a DOS program. I could probably do it myself but don't have the time and would not prefer to re-invent that "wheel". I am sure it has been done many times before. It would have to deal with issues concerning 50-100 stores all transfering a file that would probably take 10-15 minutes per transfer so some type of scheduling would be required. If it worked well I would want to incorporate it into my DOS application that I produce and sell to Formal wear stores. Please respond to Bruce Sylvester at blkbart@neosoft.com Thanks From owner-software@net.bio.net Wed Jan 03 22:00:00 1996 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!newsfeed.internetmci.com!howland.reston.ans.net!torn!newshost.uwo.ca!jkiernan.anatomy.uwo.ca!jkiernan From: jkiernan@julian.uwo.ca (J. A. Kiernan) Newsgroups: bionet.software Subject: MOLWT ver 2.72 Chemical calculation utilities, updated release Date: Thu, 4 Jan 1996 19:34:58 GMT Organization: ITS, University of Western Ontario Lines: 60 Message-ID: NNTP-Posting-Host: jkiernan.anatomy.uwo.ca MOLWT Version 2.72 Updated utilities for chemical calculations Do you ever need to do a quick molecular weight calculation from a chemical formula, or want to know how many grams of Na2SO4.10H2O are in 100 ml of a 0.076M solution? You can use MOLWT, a new shareware program, to get instant answers, even at the DOS command-line, and you can redirect the results to a printer or disk file. MOLWT272.ZIP contains utilities for simple chemical calculations There are already some excellent chemical calculation programs, including CHEMCALC and MOLARMAS. MOLWT is not as versatile as these, but it is much faster for what it does do, and it needs a lot less disk space. It will run on any computer that can use DOS. There isn't a Mac version. Color is used for emphasis, but the screens are legible on any kind of monitor. Available by anonymous ftp from simtel.coast.net and from SimTel mirrors, in the /SimTel/msdos/chemstry directory. The file is molwt272.zip. (Note spelling of the directory name!) Also available from garbo.uwasa.fi in the /pc/science directory, as molwt272.zip. Dont forget to enter the "binary" command before downloading! The MOLWT23.ZIP archive contains 5 files: 1. MW.EXE calculates molecular weight from an entered chemical formula. Can be used at the DOS command line, or interactively. Use DOS redirection to send results to a comma-delimited ASCII file. You can build up a database of formulae and their moecular weights. 2. MW.DOC Explains what you do. (Gives more examples etc than the on-line help system of MW.EXE) 3. SOLUTION.EXE gives concentrations in various units in response to an entered formula and concentration. This new version is fully stand-alone, and does not use MW.EXE or make any temporary files. It can be used at the DOS command line, or interactively. DOS redirection sends (or appends) the results to an appropriately formatted text file. 4. SOLUTION.DOC Tells you all about it. (More detail than the self-documentation and help messages of SOLUTION.EXE) Note that DOS redirection of MW or SOLUTION does not prevent the display of results on the screen. These updated versions also have more unofficial symbol-like abbreviations (for radicals etc.) than the earlier shareware releases. They no longer end with messages asking you to pay. The incentive is now the provision of extra utilities for "registered" users. 5. MOLWT.EXE is a self-executing documentation file, which can be read on screen or printed in whole or part. It tells you about the MW and SOLUTION programs, and also about some of the additional utility programs that are sent to users who pay the small "registration" fee. Comments and suggestions John A. Kiernan welcome! Department of Anatomy Univ. of Western Ontario LONDON, Canada N6A 5C1 e-mail: kiernan@uwo.ca From owner-software@net.bio.net Wed Jan 03 22:00:00 1996 Path: biosci!BTBSOFTWARE.COM!bactbob From: bactbob@BTBSOFTWARE.COM Newsgroups: bionet.software Subject: Free Rabies Software Date: 4 Jan 1996 12:39:27 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 6 Sender: daemon@net.bio.net Distribution: world Message-ID: <199601042037.PAA07499@dub-mail-svc-1.compuserve.com> NNTP-Posting-Host: net.bio.net Free Rabies software for labs testing animal and human brains for Rabies antigen. (Demo, full featured, expires 1-1-97) Please send request and your lab affiliation via email Bob Freeman BtB Software From owner-software@net.bio.net Wed Jan 03 22:00:00 1996 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!newsfeed.internetmci.com!in2.uu.net!news.wavenet.com!usenet From: PROFSOFT Newsgroups: bionet.software Subject: PROFESSIONAL MEDICAL SOFTWARE Date: 4 Jan 1996 22:05:43 GMT Organization: The Wave Network Lines: 5 Message-ID: <4chivn$6ca@news.wavenet.com> NNTP-Posting-Host: am1-239.atmnet.com We are a company that sells PROFESSIONAL MEDICAL AND SCIENTIFIC SOFTWARE to professionals,scientists and educators. Please visit PROFSOFT PUBLISHING at http:chelsea.ios.com/~profs19 for a partial listing of our software.You can also contact us for more information about your software needs. From owner-software@net.bio.net Wed Jan 03 22:00:00 1996 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!newsfeed.internetmci.com!vixen.cso.uiuc.edu!newsrelay.iastate.edu!news.iastate.edu!usenet From: tosak@iastate.edu (Tosak Seelanan) Newsgroups: bionet.software Subject: Re: X-windows for Mac Date: 3 Jan 1996 23:49:05 GMT Organization: Iowa State University, Ames, Iowa (USA) Lines: 33 Message-ID: <4cf4lh$gn7@news.iastate.edu> References: <4ce3tc$qpp@mercury.hgmp.mrc.ac.uk> <4cedv6$2bn@mercury.hgmp.mrc.ac.uk> NNTP-Posting-Host: buchanan09.res.iastate.edu Mime-Version: 1.0 Content-Type: Text/Plain; charset=US-ASCII X-Newsreader: WinVN 0.99.7 You can find it at White Pine Software, http://www.wpine.com Good luck, In article <4cedv6$2bn@mercury.hgmp.mrc.ac.uk>, gwilliam@hgmp.mrc.ac.uk says... > >In article <4ce3tc$qpp@mercury.hgmp.mrc.ac.uk>, >Dr. S.W. Knight wrote: >>I am looking for a source of X-windows for Macintosh in the UK, >>any suggestions ? >>Thanks >> Dr S.W.Knight >> (sknight@rpms.ac.uk) > >There are several X-Windows emulators for Macs. >The one that I am aware of is 'MacX'. >This is an Apple product, so you should contact your local authorised >Apple dealer. > >The other product that I have heard of is 'eXodus', but I do not know >who markets this. > > >-- >Gary Williams http://www.hgmp.mrc.ac.uk/ >Email: G.Williams@hgmp.mrc.ac.uk Tel: +44 1223 494522 >Computing Services Section, MRC HGMP Resource Centre, >Hinxton Hall, Hinxton, Cambridge, CB10 1RQ, UK From owner-software@net.bio.net Wed Jan 03 22:00:00 1996 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!newsfeed.internetmci.com!howland.reston.ans.net!paladin.american.edu!news.jhu.edu!NewsWatcher!user From: Neil.Clarke@qmail.bs.jhu.edu (Neil Clarke) Newsgroups: bionet.molbio.proteins,bionet.software Subject: WWW seq alignment site with "jumbling" test of significance? Date: 4 Jan 1996 19:49:08 GMT Organization: Johns Hopkins Lines: 12 Message-ID: NNTP-Posting-Host: 128.220.138.64 Xref: biosci bionet.molbio.proteins:6626 bionet.software:14347 Anyone know of a WWW site that does an alignment between two protein sequences with the option of rerunning the alignement using a randomized ("jumbled") sequence? as a test of significance? Having just given a lecture on sequence analysis during which I extolled the virtues of the Web, I was surprised to find that I couldn't find a good old-fashioned Needleman-Wunsch type program out there. Lots of local homology search algorithms and dynamic programming algorithms for database searching, but no 'optimal' sequence alignment stuff. Help, please! -- Neil Clarke neil.clarke@qmail.bs.jhu.edu From owner-software@net.bio.net Thu Jan 04 22:00:00 1996 Path: biosci!ALCOR.BMS.COM!krystek From: krystek@ALCOR.BMS.COM (Stanley Krystek) Newsgroups: bionet.software Subject: software to map protease digest sites Date: 4 Jan 1996 20:30:24 -0800 Organization: Bristol-Myers Squibb Pharmaceutical Research Institute Lines: 14 Sender: daemon@net.bio.net Distribution: world Message-ID: <4ch1ft$c4a@synapse.bms.com> NNTP-Posting-Host: net.bio.net I am looking for software to map protease digest sites. Can someone suggest any software or programs available that provide a list of enzyme cleavage sites. thanks stan -- Stan Krystek Bristol-Myers Squibb krystek@alcor.bms.com From owner-software@net.bio.net Thu Jan 04 22:00:00 1996 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!newsfeed.internetmci.com!in1.uu.net!zib-berlin.de!fu-berlin.de!news.dfn.de!gs.dfn.de!uni-erlangen.de!winx03!wpxx02.toxi.uni-wuerzburg.de!not-for-mail From: krasel@wpxx02.toxi.uni-wuerzburg.de (Cornelius Krasel) Newsgroups: bionet.molbio.proteins,bionet.software Subject: Re: WWW seq alignment site with "jumbling" test of significance? Followup-To: bionet.molbio.proteins,bionet.software Date: 5 Jan 1996 09:08:31 GMT Organization: Dept. of Pharmacology, U Wuerzburg Lines: 14 Message-ID: <4cipqf$n0d@winx03.informatik.uni-wuerzburg.de> References: NNTP-Posting-Host: wpxx02.toxi.uni-wuerzburg.de X-Newsreader: TIN [UNIX 1.3 950824BETA PL0] Xref: biosci bionet.molbio.proteins:6631 bionet.software:14352 Neil Clarke (Neil.Clarke@qmail.bs.jhu.edu) wrote: > Anyone know of a WWW site that does an alignment between two protein > sequences with the option of rerunning the alignement using a randomized > ("jumbled") sequence? as a test of significance? I don't know of a web site, but I use Bill Pearson's FASTA package for this (compiled it myself on a Linux box). Works perfectly well. --Cornelius. -- /* Cornelius Krasel, U Wuerzburg, Dept. of Pharmacology, Versbacher Str. 9 */ /* D-97078 Wuerzburg, Germany email: phak004@rzbox.uni-wuerzburg.de SP3 */ /* "Science is the game we play with God to find out what His rules are." */ From owner-software@net.bio.net Thu Jan 04 22:00:00 1996 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!newsfeed.internetmci.com!in2.uu.net!li.net!usenet From: teach@li.net (Parisi) Newsgroups: bionet.software Subject: Publisher Seeks Software or Multimedia Titles Date: 5 Jan 1996 04:31:58 GMT Organization: LI Net (Long Island Network) Lines: 20 Message-ID: <4ci9ju$l0s@linet02.li.net> NNTP-Posting-Host: lisuser60.li.net Mime-Version: 1.0 Content-Type: Text/Plain; charset=US-ASCII X-Newsreader: WinVN 0.99.6 Dear Authors, Arrowhead Enterprises is currently looking for software or multimedia titles for distribution. We have helped many new and seasoned authors get their work published. We are most interested in finished products. However, we would consider financing a work in progress. We aren't looking for any high budget projects. If you are interested please send me a demo, or several screen captures. A brief overview of what your project is all about would also be helpful. I will personally evaluate each submission and return your work within a reasonable time and include my feeback. Thanks, teach@li.net Distribution Manager From owner-software@net.bio.net Thu Jan 04 22:00:00 1996 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!newsfeed.internetmci.com!newsxfer2.itd.umich.edu!newsxfer.itd.umich.edu!news.itd.umich.edu!terminator.rs.itd.umich.edu!brecher From: brecher@terminator.rs.itd.umich.edu (Jonathan Brecher) Newsgroups: bionet.software Subject: Re: looking for Mac chemical software Date: 4 Jan 1996 00:34:46 GMT Organization: CambridgeSoft Corporation Lines: 14 Sender: jsb@camsoft.com Message-ID: <4cf7b7$r6j@lastactionhero.rs.itd.umich.edu> References: <30EAB3F3.5AAB@yk.rim.or.jp> <4ce8l4$d1o@ra.nrl.navy.mil> Reply-To: jsb@camsoft.com NNTP-Posting-Host: terminator.rs.itd.umich.edu rmw wrote: >ChemDraw and Chem3D, both of which are from Berkely Software. >They have a website somewhere where you can get a demo. >Try a search engine with "ChemDraw" as the keyword. Gee, last I checked, we make ChemDraw and Chem3D. That's what our developers think, anyway... Try http://www.camsoft.com for product information and demos, including an online searchable chemical database. Jonathan Brecher CambridgeSoft Corporation jsb@camsoft.com From owner-software@net.bio.net Thu Jan 04 22:00:00 1996 From: tkennedy@worldweb.net (Kennedy) Newsgroups: bionet.software Subject: Digital Darwinism Date: Fri, 05 Jan 1996 21:40:50 GMT X-Newsreader: Forte Free Agent 1.0.82 NNTP-Posting-Host: line110.worldweb.net Message-ID: <30ed9c72.0@murphy.worldweb.net> Lines: 5 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!elroy.jpl.nasa.gov!swrinde!howland.reston.ans.net!tank.news.pipex.net!pipex!news.sprintlink.net!murphy.worldweb.net! I would like to know if anybody has and articles, info, or software pertaining to Digital Darwinism. A FTP or WWW address would be greatly appreciated. Thank You. From owner-software@net.bio.net Thu Jan 04 22:00:00 1996 Newsgroups: bionet.molbio.proteins,bionet.software Path: biosci!ihnp4.ucsd.edu!swrinde!newsfeed.internetmci.com!in2.uu.net!EU.net!peer-news.britain.eu.net!liv!news From: bates@liv.ac.uk (Andy Bates) Subject: DOS/Windows sequence software? Message-ID: X-Posted-From: InterNews 1.0.5@bates.bioc.liv.ac.uk Sender: bates@mailspool.liv.ac.uk Nntp-Posting-Host: bates.bioc.liv.ac.uk Organization: University of Liverpool X-Authenticated: bates on POP host mailspool.liv.ac.uk Date: Fri, 5 Jan 1996 10:19:49 GMT Lines: 27 Xref: biosci bionet.molbio.proteins:6632 bionet.software:14353 Sorry if this is a common request. I'm looking for some software to help teach students the delights of DNA (and protein) sequence analysis. It needs to be: 1. DOS/Windows 2. free 3. able to find restriction sites and search for short strings with mismatches/gaps 4. able to find ORFs and translate them 5. hopefully able to give some details of the hypothetical proteins, e.g. mol wt., amino acid composition. We currently use a simple menu-based DOS program call 'Mount & Conrad', which does all these things, but is not very colourful or flashy. I'm afraid this is a case where style may need to outweigh substance to some extent!! Any thoughts? Thanks a lot, Andy Bates. ____________________________________________________________ Dr. Andrew D. Bates Tel: (+44) (0)151 794 4322 Department of Biochemistry Fax: (+44) (0)151 794 4349 University of Liverpool Email: bates@liv.ac.uk PO Box 147 Liverpool L69 3BX, UK From owner-software@net.bio.net Thu Jan 04 22:00:00 1996 Path: biosci!bloom-beacon.mit.edu!newsfeed.internetmci.com!in1.uu.net!zib-berlin.de!fu-berlin.de!news.dfn.de!uni-muenster.de!news From: Torsten Boerchers Newsgroups: bionet.molbio.proteins,bionet.software Subject: Re: WWW seq alignment site with "jumbling" test of significance? Date: 5 Jan 1996 18:37:23 GMT Organization: ICB Lines: 21 Message-ID: <4cjr53$vak@majestix.uni-muenster.de> References: NNTP-Posting-Host: arnheim.uni-muenster.de Mime-Version: 1.0 Content-Type: text/plain; charset=iso-8859-1 Content-Transfer-Encoding: 8bit X-Mailer: Mozilla 1.1N (Windows; I; 16bit) To: Neil.Clarke@qmail.bs.jhu.edu Xref: biosci bionet.molbio.proteins:6637 bionet.software:14354 I haven´t tried this place yet, since I always use the GCG package but I think this web-site should be what you´re looking for http://genome.eerie.fr/fasta/align-query.html Good luck Torsten ------------------------------------------------------------------------/ Torsten Boerchers / _/ _/_/_/ _/_/_/ Institute of Chemical- and Biochemical Sensor/ _/ _/ _/ _/ Research (Molecular Biology Group) / _/ _/ _/_/_/ Mendelstr 7, D-48149 Muenster, Germany / _/ _/ _/ _/ Fax: +49-251-980 2890 Phone: +49-251-980 2880/ _/ _/_/_/ _/_/_/_/ E-Mail: borcher@uni-muenster.de / -----------------------------------------------------------------/ From owner-software@net.bio.net Fri Jan 05 22:00:00 1996 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!newsfeed.internetmci.com!in2.uu.net!mercury.near.net!news.ner.bbnplanet.net!das-news2.harvard.edu!fas-news.harvard.edu!lipid!robison From: robison@lipid.harvard.edu (Keith Robison) Newsgroups: bionet.software Subject: Re: Digital Darwinism Date: 6 Jan 1996 03:02:37 GMT Organization: Harvard University, Cambridge, Massachusetts Lines: 22 Message-ID: <4ckood$8ji@decaxp.harvard.edu> References: <30ed9c72.0@murphy.worldweb.net> NNTP-Posting-Host: lipid.harvard.edu X-Newsreader: TIN [version 1.2 PL2] Kennedy (tkennedy@worldweb.net) wrote: : I would like to know if anybody has and articles, info, or software : pertaining to Digital Darwinism. A FTP or WWW address would : be greatly appreciated. Thank You. There are a number of sites devoted to artificial life research. Also, Tierra is a popular computer simulation of darwinian evolution. You can jump to sites on both with http://golgi.harvard.edu/htbin/biopages?artifical+life|tierra Enjoy! Keith Robison Harvard University Department of Cellular and Developmental Biology Department of Genetics / HHMI robison@mito.harvard.edu From owner-software@net.bio.net Fri Jan 05 22:00:00 1996 Path: biosci!bcm.tmc.edu!cs.utexas.edu!howland.reston.ans.net!nntp.coast.net!harbinger.cc.monash.edu.au!newshost.anu.edu.au!newsmaster From: Barry Brook Newsgroups: bionet.software Subject: Population Viability Analysis (PVA) data needed Date: 6 Jan 1996 04:47:29 GMT Organization: Australian National University Lines: 43 Message-ID: <4ckut1$gaa@manuel.anu.edu.au> NNTP-Posting-Host: 150.203.92.16 Dear All, We are currently looking for good life history data on small populations of vertebrate species. The data is intended to be used as input for a number of Population Viability Analysis (PVA) software packages, so the data should preferrably include information on the species mortality, fecundity, lifespan etc. and on the number of individuals in the population. The data need not come from an endangered species. However, the population must be small and isolated, or have gone through a bottleneck. The population may now be extinct, or may have recovered to a stable size, with or without human intervention. A long term monitoring of the population would be very useful. The idea is to use this data to retrospectively test the predictive accuracy of PVA software. To best achieve this, the data should be comprehensive. Examples of the sort of population data we are looking for include that for: - Lord Howe Island Woodhen - Northern Hairy-nosed Wombat - Chatnam Island Robin - Black-footed ferret - European Bison If you know of any other data sets that may be useful, in the literature or elsewhere, we would greatly appreciate your suggestions. Contact either: E-mail: bbrook@mso.anu.edu.au (Barry Brook) or rfrankha@rna.bio.mq.edu.au (Richard Frankham) Post: A/Prof Richard Frankham School of Biological Sciences Macquarie University NSW 2109 Australia Phone: (02) 850-8186 Fax: (02) 850-8245 International: +61 2 850.... Please leave your contact details so we may get back to you. Alternatively, post to this newsgroup. Look forward to hearing from you soon. Regards, Barry Brook. Richard Frankham. From owner-software@net.bio.net Sat Jan 06 22:00:00 1996 Path: biosci!agate!newsxfer2.itd.umich.edu!newsfeed.internetmci.com!in1.uu.net!nico.bway.net!news From: Thomas Weber Newsgroups: bionet.software Subject: Re: software to map protease digest sites Date: 7 Jan 1996 14:53:05 GMT Organization: bway.net, part of Outernet, Inc. in New York City Lines: 7 Message-ID: <4comoh$ruc@nico.bway.net> References: <4ch1ft$c4a@synapse.bms.com> NNTP-Posting-Host: dial45.bway.net Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 1.1N (Macintosh; I; 68K) To: krystek@ALCOR.BMS.COM X-URL: news:4ch1ft$c4a@synapse.bms.com Hi there, the GCG package which usually runs on a VAX or Unix platform has this capability Thomas From owner-software@net.bio.net Sat Jan 06 22:00:00 1996 Path: biosci!ns1.faseb.org!lamarck.sura.net!newsfeed.internetmci.com!vixen.cso.uiuc.edu!usenet.ucs.indiana.edu!sunflower.bio.indiana.edu!gilbertd From: gilbertd@sunflower.bio.indiana.edu (Don Gilbert) Newsgroups: bionet.molbio.proteins,bionet.software Subject: Re: DOS/Windows sequence software? Date: 7 Jan 1996 02:09:16 GMT Organization: Biology, Indiana University - Bloomington Lines: 18 Message-ID: <4cna0c$nrc@usenet.ucs.indiana.edu> References: NNTP-Posting-Host: sunflower.bio.indiana.edu Xref: biosci bionet.molbio.proteins:6643 bionet.software:14359 seqpup covers all but #5 of your points, I believe. Find it at ftp://iubio.bio.indiana.edu/molbio/seqpup/ There should be a significant update out in the next couple of weeks. In article , Andy Bates wrote: >help teach students the delights of DNA (and protein) sequence >analysis. It needs to be: > >1. DOS/Windows >2. free >3. able to find restriction sites and search for short strings with >mismatches/gaps >4. able to find ORFs and translate them >5. hopefully able to give some details of the hypothetical proteins, >e.g. mol wt., amino acid composition. -- -- d.gilbert--biocomputing--indiana u--bloomington--gilbertd@bio.indiana.edu From owner-software@net.bio.net Sat Jan 06 22:00:00 1996 Path: biosci!agate!newsxfer2.itd.umich.edu!newsfeed.internetmci.com!in1.uu.net!zib-berlin.de!fu-berlin.de!news.dfn.de!gs.dfn.de!uni-erlangen.de!winx03!wpxx02.toxi.uni-wuerzburg.de!not-for-mail From: krasel@wpxx02.toxi.uni-wuerzburg.de (Cornelius Krasel) Newsgroups: bionet.software Subject: Re: Mailing from a C program Date: 7 Jan 1996 15:20:20 GMT Organization: University of Wuerzburg, Germany Lines: 22 Message-ID: <4coobk$pe6@winx03.informatik.uni-wuerzburg.de> References: <30EFCEDF.41C6@molbiol.ox.ac.uk> NNTP-Posting-Host: wpxx02.toxi.uni-wuerzburg.de X-Newsreader: TIN [UNIX 1.3 950824BETA PL0] Ewan Birney (birney@molbiol.ox.ac.uk) wrote: > Unfortunately the call > > system("mail joe.bloggs@nowhere < filename") doesn't work as > the redirect fails This is surprising since the following program works correctly on Linux 1.2.13 (i.e. it delivers the file ~/.login to phak004@rzbox.uni-wuerzburg.de using "test" as a subject): void main() { system("/bin/mail -s test phak004@rzbox.uni-wuerzburg.de < ~/.login"); } Maybe your system call works differently? --Cornelius. -- /* Cornelius Krasel, U Wuerzburg, Dept. of Pharmacology, Versbacher Str. 9 */ /* D-97078 Wuerzburg, Germany email: phak004@rzbox.uni-wuerzburg.de SP3 */ /* "Science is the game we play with God to find out what His rules are." */ From owner-software@net.bio.net Sat Jan 06 22:00:00 1996 Path: biosci!agate!howland.reston.ans.net!cs.utexas.edu!newshost.convex.com!news.onramp.net!usenet From: Tom Becker Newsgroups: alt.msdos.programmer,bionet.software,comp.infosystems,comp.object,comp.org.acm,comp.org.ieee,comp.os.msdos.programmer,comp.os.ms-windows.programmer,comp.os.ms-windows.programmer.misc,comp.sources.testers Subject: Re: Year 2000 Solutions Conference Date: Sun, 07 Jan 1996 16:48:50 -0800 Organization: Air System Technologies, Dallas Lines: 28 Message-ID: <30F069F2.42CE@rightime.com> References: <30D9E2EC.4C48@mindlink.bc.ca> <4cfse3$8ju@dewey.csun.edu> NNTP-Posting-Host: lbj47.onramp.net Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 2.0b4a (Win16; I) To: eric schonning Xref: biosci bionet.software:14363 comp.infosystems:5999 comp.object:33705 comp.org.acm:2914 comp.org.ieee:2791 comp.os.msdos.programmer:49817 comp.os.ms-windows.programmer.misc:80607 comp.sources.testers:562 "... an interesting prank ..." If it hasn't been mentioned before, you might want to take a look at www.year2000.com to see what serious concern there is about the upcoming problem with two-digit years in computer applications and hardware. It won't be necessary to play any pranks; some discussions anticipate infrastructure failure in the worst scenario. The Social Security Administration has estimated that it might cost $50 BILLION to correct their millions of lines of code that rely on two-digit year calculations over the next few years! Although DOS itself (and Windows) will make the 1999-2000 year transition, the PC is not immune to the problem since the CMOS RTC (the hardware clock) only keeps a two-digit year; the century is not maintained by hardware, so it will go from 1999 to 1900. The next boot will produce a DOS system date of January 4, 1980. Many of your PC applications will catastrophically fail. Year2000.EXE, a free fix for the PC hardware year 2000 flaw, is available at the URL below. Tom --... ...-- http://rampages.onramp.net/~gtbecker Air System Technologies Inc, Dallas BBS: (500)673-4625 Vox: (500)448-9660 Accurate time: (500)346-TIME [1200E71] From owner-software@net.bio.net Sat Jan 06 22:00:00 1996 Path: biosci!agate!newsxfer2.itd.umich.edu!newsfeed.internetmci.com!tank.news.pipex.net!pipex!peer-news.britain.eu.net!warwick!bham!bhamcs!news.ox.ac.uk!news From: Ewan Birney Newsgroups: bionet.software Subject: Mailing from a C program Date: Sun, 07 Jan 1996 13:47:11 +0000 Organization: Oxford University Lines: 18 Message-ID: <30EFCEDF.41C6@molbiol.ox.ac.uk> NNTP-Posting-Host: nmrd.ocms.ox.ac.uk Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 2.0b4 (X11; I; IRIX 5.3 IP22) hi Does any C and UNIX gurus out there know the best way to mail a file from inside a C program. Unfortunately the call system("mail joe.bloggs@nowhere < filename") doesn't work as the redirect fails I could use perl/csh to wrap around the mail but that is a bit of a pain. There is probably some really slick way - any pointers? thanks ewan From owner-software@net.bio.net Sat Jan 06 22:00:00 1996 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!newsfeed.internetmci.com!in2.uu.net!news.cais.net!news.iac.net!usenet From: Newsgroups: bionet.cellbiol,bionet.immunology,bionet.microbiology,bionet.molbio.ageing,bionet.molbio.embldatabank,bionet.molbio.evolution,bionet.mycology,bionet.neuroscience,bionet.parasitology,bionet.population-bio,bionet.protista,bionet.software Subject: Help please!!!!! Date: 7 Jan 1996 23:00:47 GMT Organization: Internet Access Cincinnati 513-887-8877 Lines: 18 Message-ID: <4cpjav$abe@cheyenne.iac.net> References: <4ca6qk$knt@ixnews3.ix.netcom.com> NNTP-Posting-Host: ip043013.iac.net Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 1.12(Macintosh; I; PPC) X-URL: news:schlegel-0201962019100001@schlegel.tiac.net Xref: biosci bionet.cellbiol:3742 bionet.immunology:6850 bionet.microbiology:4437 bionet.molbio.ageing:2370 bionet.molbio.embldatabank:588 bionet.molbio.evolution:4065 bionet.mycology:3325 bionet.neuroscience:11974 bionet.parasitology:1316 bionet.population-bio:1730 bionet.protista:464 bionet.software:14364 My friend needs the scientific classifications of these organisms: ticks bamboo pandorina fusarium pseudomonas He needs the complete classifications, from kingdom to species. It is rather last minute and will be very much appreciated. Sorry for the inconvenience. Please direct information to: birsen.kaya@uc.edu Thank you very much!!!! From owner-software@net.bio.net Sun Jan 07 22:00:00 1996 Path: biosci!IBCCF.BIOF.UFRJ.BR!MOZART From: MOZART@IBCCF.BIOF.UFRJ.BR ("Mozart de Azevedo Marins") Newsgroups: bionet.software Subject: C compiler Date: 8 Jan 1996 01:24:59 -0800 Organization: UFRJ - Instituto de Biofisica CCF Lines: 5 Sender: daemon@net.bio.net Distribution: world Message-ID: <8E80237CA2@ibccf.biof.ufrj.br> NNTP-Posting-Host: net.bio.net Hi there, I need a program do compile an EMBL decoder (UUD.C), how can I get this ? Does anybody knows ? I've tried through the web, but ostly I can't reach de host...is it possible by e-mail ? Thanx From owner-software@net.bio.net Sun Jan 07 22:00:00 1996 Path: biosci!agate!howland.reston.ans.net!newsfeed.internetmci.com!EU.net!Norway.EU.net!nntp.uio.no!nac.no!ifi.uio.no!news.sics.se!newsfeed.sunet.se!news01.sunet.se!sunic!news99.sunet.se!news.chalmers.se!doc16.mvd.chalmers.se!firo From: firo@mvd.chalmers.se (Filip Rosengren) Newsgroups: bionet.software Subject: Re: PROFESSIONAL MEDICAL SOFTWARE Date: 8 Jan 1996 07:32:40 GMT Organization: School of Mechanical Engineering, Chalmers University of Technology Lines: 21 Message-ID: <4cqhao$o9d@nyheter.chalmers.se> References: <4chivn$6ca@news.wavenet.com> NNTP-Posting-Host: doc16.mvd.chalmers.se X-Newsreader: TIN [version 1.2 PL2] PROFSOFT (profs19@wavenet.com) wrote: : We are a company that sells PROFESSIONAL MEDICAL AND SCIENTIFIC : SOFTWARE to professionals,scientists and educators. Please visit : PROFSOFT PUBLISHING at http:chelsea.ios.com/~profs19 for a : partial listing of our software.You can also contact us for more : information about your software needs. -- Hmmm, that should probably be: http://chelsea.ios.com/~profs19 //Filip --------------------------------------------------------------- Filip Rosengren M.Sc. | Tel: +46 (0)31 772 13 78 Machine and Vehicle Design | Fax: +46 (0)31 772 13 75 Chalmers University of Technology | Sekr: +46 (0)31 772 13 60 S-412 92 Göteborg, Sweden | Email: firo@mvd.chalmers.se --------------------------------------------------------------- From owner-software@net.bio.net Sun Jan 07 22:00:00 1996 Path: biosci!agate!news.ucdavis.edu!library.ucla.edu!newsfeed.internetmci.com!howland.reston.ans.net!quagga.ru.ac.za!inet.up.ac.za!crimson!fourie From: fourie@crimson (Fourie Joubert) Newsgroups: bionet.software Subject: Frame Grabbers for Gel Processing? Date: 8 Jan 1996 09:11:55 GMT Organization: University of Pretoria Lines: 18 Message-ID: <4cqn4r$n72@inet.up.ac.za> Reply-To: fourie@scientia.up.ac.za NNTP-Posting-Host: crimson.up.ac.za X-Newsreader: TIN [version 1.2 PL2] Hi I am currently using our PowerMac AV card for grabbing UV gel images, but the quality is not really up to scratch (grainy, etc.). I'd be interested in some recommendations for framegrabber cards that are suitable for this kind of work. (Is the Scion LG much better than the Mac AV?). Any help would be appreciated.... -- Fourie Joubert Department of Biochemistry University of Pretoria fourie@scientia.up.ac.za http://suntiger.ee.up.ac.za/biodocs/home.html +27-12-420-2011 From owner-software@net.bio.net Sun Jan 07 22:00:00 1996 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!newsfeed.internetmci.com!news.bctel.net!kryten.awinc.com!uucp105!bryan.webster From: bryan.webster@pcc.awinc.com (Bryan Webster) Newsgroups: bionet.software Subject: Re: Current Protocols Date: Mon, 8 Jan 1996 14:28:11 GMT Message-ID: <960108150019139@pcc.awinc.com> Organization: Peace Country Computers Distribution: world References: Lines: 8 -> From: niclas.cedervi@cbt.ki.se (Niclas Cedervi) -> Subject: Current Protocols -> -> We are interested in Current protocols from John Wiley and Sons but -> I am just not able to reach them. Does anyone know the correct phone -> and fax numbers? Could you find this info by telephoning a bookstore or your local library? From owner-software@net.bio.net Sun Jan 07 22:00:00 1996 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!elroy.jpl.nasa.gov!lll-winken.llnl.gov!overload.lbl.gov!bks From: bks@s27w007.pswfs.gov (Bradley K. Sherman) Newsgroups: bionet.molbio.recombination,bionet.software Subject: Syd, a program to synthesize genome linkage data Date: 8 Jan 1996 22:03:39 GMT Organization: Dendrome, A Genome Database for Forest Trees Lines: 35 Distribution: world Message-ID: <4cs4br$b1k@overload.lbl.gov> NNTP-Posting-Host: s27w007.pswfs.gov Xref: biosci bionet.molbio.recombination:84 bionet.software:14376 Software and details: http://s27w007.pswfs.gov/syd Syd simulates crossings in a 3 generation pedigree of 4 grandparents, 2 parents, 1-500 progeny. It outputs a data file which can be used as input --with some adjustments-- for standard linkage mapping programs. Here's the abstract prepared for Plant Genome IV: Syd simulates the genetics involved in a three-generation outbred pedigree with codominant alleles and produces a synthetic data file which can be analyzed with conventional linkage software. The simulation can be parameterized using a configuration file that allows control over chromosome number, population size, loci per chromosome, chiasmatic frequency, and allelic distribution in simulated crosses. The data can be produced with phase known or unknown. Multiple pedigrees of the same species can be created and the data sampled and resampled. Syd allows hypotheses about preparation of laboratory data for linkage analysis to be tested in a controlled manner. Consider this a ``beta'' release. Syd is written in C and has compiled and run under SunOS and AIX; it should work on other Unix-like systems. --bks -- Bradley K. Sherman | Institute of Forest Genetics bks@s27w007.pswfs.gov | P.O. Box 245 510-559-6437 FAX:510-559-6440 | Berkeley, CA 94701 USA Dendrome Project From owner-software@net.bio.net Sun Jan 07 22:00:00 1996 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!newsfeed.internetmci.com!miwok!news.zeitgeist.net!ico.net!pacbell.com!amdahl.com!amd!netcomsv!uu4news.netcom.com!netcomsv!uu3news.netcom.com!ix.netcom.com!netnews From: fjfisher@ix.netcom.com(Fred Fisher) Newsgroups: bionet.software Subject: Legal Exposure Article Date: 7 Jan 1996 22:34:56 GMT Organization: Netcom Lines: 399 Message-ID: <4cphqg$pb4@cloner3.netcom.com> NNTP-Posting-Host: lax-ca23-13.ix.netcom.com X-NETCOM-Date: Sun Jan 07 2:34:56 PM PST 1996 Insuring Legal Exposures facing the Software Industry by Frederick J. Fisher, J.D. 310/320-8291, Compuserve 71342,3137, fjfisher@ix.netcom.com It is no surprise the software and technology revolution often finds support obsolete as quickly as the development of new technology. With the explosion of Internet usage and services together with hardware advances, it is equally no surprise that insurance mechanisms to transfer risk of loss is also tardy in relation to need. Traditionally, software developers and computer consultants could insure their exposure to lawsuits by purchasing a "consultants' professional liability policy and/or a product liability insurance policy. Both of these products have been readily available for quite some time. However, in view of the fast paced development of new technologies and services, these insurance products may no longer protect all of one's exposures. New exposures exist due to increased use of BBS's and online services, product distribution through that medium and Internet security issues. In view of these rapidly developing medium, insurance products too will have to adapt. This article will explore some of these new exposures and provide a recipe to review and enhance one's insurance portfolio. However, nothing will replace sound risk management advice from one's insurance broker and legal counsel. Exposures Facing the Traditional Computer Consultants Traditional consultants provided software and hardware advice to a client for fee. The software recommended may have been "off the shelf" or customized provided by the consultants own programming staff. Hardware too may have been recommended and installed. Insurance mechanism to transfer risk of economic loss suffered by a client exists for these types of services, and is readily available and affordable. This comes in two forms, Consultants Professional liability and product liability. The Consultants E & O form covers loss arising from an error in rendering advice and service. If a wrong product is recommended or does not work, the E & O policy is supposed to provide the means to compensate the damaged party. As is usually the case, most insurers providing this protection exclude from coverage claims that arise from copyright, patent or other intellectual property right invasions. However, this is not always the case, some insurers provide limited copyright coverage. Although the failure of hardware to perform as recommended by the consultant is often excluded, this exclusion is limited only to the failure of the hardware itself such as a hard disk failure, or motherboard burnout. This is different from a situation where the hardware operates properly but is not sufficient for the purpose intended. In the former example, any resultant economic loss from hardware failures may, however, be protected by a product liability policy if the consultant is also the vendor and /or installer. New Exposures facing the Consultant Internet interest has spawned a new industry in the form of consultants who do everything from assisting in the design of a World Wide Web Home page to actually being the provider of the gateway. In other words, they also operate the server that provides the Web's site. In view of these added services, new liability exposures exist and were recently heightened by the recent Prodigy Iitigation. When providing a Web page for a clients, these new exposures may include libel slander, advertising liability, media liability and security issues. Security liability can arise from misuse of E-mail to credit card misuse. Further complicating the issue is the fact that both the consultant and the client face exposures from outsiders accessing the Web page. This is in addition to the traditional liability facing the consultant for duties owed the client. Traditional insurance products do exist that can transfer these risks as well, but not yet available in a single package. Theses include traditional media liability insurance policies, advertising legal liability, and products liability if goods are also being sold through the client's web page. Patent infringement, and copyright infringement coverage may also be warranted. Although these stand alone policies are not yet packaged into one, they soon will be in view of what will be demanded by the market forces at play as consulting services expand. The Traditional Software Publisher The product and property right exposures facing software publishers have been well defined with insurance products available to cover known hazards. Although there may be a dearth of legal precedent giving rise to high profile cases, such as the Lotus-Borland litigation, liability insurance products do exist that adequately address the common hazards. These hazards include product liability, and intellectual property right exposures such as copyright and patent exposures. From the standpoint of traditional software publisher, little has changed in their exposures, irrespective of appellate decisions that may or may not impose liability. This is no different for the mass consumer publisher of word processing applications or the specialized provider of limited use vertical market applications. However, Internet distribution of software or Internet "rental of applications" via stripped down dumb terminals now in development may alter the standard hazard ushering in an all new liability arena. For instance, in the authorized distribution of software via Internet stores, the wrong choice of a distributer may expose the publisher to vicarious liability for Credit card misuse in view of the current uncertainty of security. One way of dealing with this exposure it to properly apply common risk management techniques such as indemnity agreements with the vendor and to require a vendors additional insured endorsement to the vendors liability policy. More alarming however, is the rental issue. Some hardware manufacturer are developing dumb terminals under the theory that many applications can be run online eliminating the current requirement that the user have a fully loaded system and have installed software to run it. This new product may give rise to a whole new industry whereby software is "rented by the minute/hour" or some other temporary licensing rental mechanism. Not only is the security issue re-triggered, but software "glitches, or bugs" may also give rise to new liability exposures. Insurance products may not yet address the challenges that these new services suggest. Internet Providers and Shell Companies Traditional exposures face those engaged in providing Internet access either through direct ISDN access, or with one's own .com or .org address. The same might be said of those organizations that rent or lease monthly access through shell accounts. The recent CompuServe and Prodigy suits have certainly caused some alarm amongst sponsors of News Groups, Discussion and List services. However, again, traditional insurance products for advertising and Media Liability certainly provide most of the protections that may be needed. However, to a Corporate sponsor engaging the services of a consultant to aid in the development and distribution of a client's World Wide Page, the exposures facing the Client and Consultant changes dramatically with the simple addition of this single opportunity. For instance, a software consultant may be engaged by a client to provide a database application for a client. Whether a simple mailing list management program or a sophisticated inventory control program, the liability of the consultant for a non-performing application is a well know hazard protected by a standard EDP consultant's Professional liability policy. However, if the consultant is also engaged to author and provide a World wide Web page for the clients, and to add the page to the Consultants own URL address as an additional service, this singular service raises several new hazards not yet fully addressed by the insurance industry. These include Media/Advertising Liability, Professional Liability, and security issues. Producer Liability in the form of traditional Broadcaster functions may also be involved. It should be obvious to the reader that liabilities can be greatly expanded by the simple addition of a new service in view of rapidly expanding technology and service. In view of this, one's insurance Broker or risk management department should be kept constantly in the product and service development loop. By doing so, it may be possible to have the appropriate coverages in place before you find you may need them. Why is this Imporant Technology and computer systems are dominating the everyday lifestyle of Businesses, households, and the people who use them. Over 700 new World Wide Web sites are registered every day with no let up in sight. Faster too is the explosion in insurance opportunity and with it, new and ever evolving liability. More important, development of Insurance products to deal with this ever exploding opportunity are not keeping pace with either the d emand or specific need. Recent high profiled lawsuits as reported in the general media have contributed to the expected conservative approach the insurance industry has taken to the explosion in technological advances, bo th theoretical and real. Bulletin Board Exposures One of the fastest growing areas of liability and technological advancement is in the area of Consumer area Bulletin boards and the Internet. Companies providing these services, such as CompuServe, Prodigy, and Netcom hav e learned that in providing cutting edge services, cutting edge liability follows. Unlike telephone system providers that are nothing more than common carriers of information without "monitoring" what is being communicated, such BBS providers are learning that their potential liabilities are gr owing as fast as the technological advances they provide. Consider the Prodigy litigation. A New York State judge ruled that an allegedly libelous e-mail message posted by a user about an Investment Firm engaged in "criminal conduct". Prodigy took the position that they should not be held responsible for the messages posted by a user, as Prodigy was nothing more than a "Common Carrier", much like a telephone company who is not liable for the content of conversations taking place on their lines. Unfortunately for Prodigy, this position found no support. The Judge rule d that Prodigy could be found libel for the content of messages posted on their system because Prodigy "monitored" the content of the postings in order to satisfy themselves that users were following the terms and conditi ons such as "content guidelines" required of users in order to use the Prodigy system. The Court found that since Prodigy was exorcizing editorial control, they were not a "common Carrier" like the Phone Company. Instead, the court ruled, they were acting like a publisher, and could be found responsible for the content of the messages they monitored (or had the right to monitor). One of the key factual findings in the case was the factProdigy touted itself as a superior service because of its "editorial control". Obviously, in view of the volume of daily posting, Prodigy could not monitor all such messages. However, in reserving the right to do so, they ended up becoming a "publisher " rather than being a "common carrier". Not pu blicized is the fact many such messages on these services, including the Internet , may remain available for years in which Continued "re-publication" of a libelous messagemay create continued and repeated liability. More disturbing are the International consequences of e-mail and discussion group postings. What might be considered Free Speech in the United States may violate laws of other countries. China and Singapore have already "tightened" controls over Internet usage in their countries and Germany has most recently ordered CompuServe to cut off access to 200 discussion groups found to be obscene or against political laws regarding the Nazi's. Policing such groups and being able to allow access in one country and not another becomes another difficult task for the Internet sponsor and may actually stymie growth in what otherwise is a fast expanding and developi ng balloon of opportunity. When one considers such "worldwide" exposures, suddenly it becomes important to realize that most Insurance products do not offer worldwide protection, leading to more issues to resolve. These may include the issue as to where the "law was violated", in the country where the "effect" or damage occurred, or in the country where the offending message or posting originated ? Regulatory Violations In another decision, Virgin Airways found that Internet advertising provided no protections from Department of Transportation rules regarding misleading or false advertising. The DOT took theposition that an advertisement placed anywhere, the Internet included" was subject to their rules and regulations and fined Virgin $14,000 for the violation. America Online also was involved in a Federal Trade Commission case involving an "advertiser" who claimed he could repair one's credit history by purchasing an $89 shareware program available for downloading from an AOL file library. Such a holding could render BBS providers liable for the actions of con-men sell ing products or services only to be found later they were ripping off consumers instead. Imagine the Liability to be imposed had Alan Teale survived long enough to sell phony insurance over the Net. Such exposures liken such online providers of software to a retailer who also distributes "defective" products. Certainly special, "product liability coverage" may become necessary as more and more retailers" use such a provider to distribut e product. The Computer BBS provider may become another layer of product provider "in the stream of commerce" and thus become a product liability defendant. A recent case of Internet exposure involved Netcom, an Internet Shell Provider. The Church of Scientology sued alleging that copyrighted material was distributed by a user using the Netcom system. The court ruled that Net com could be found libel if proven that they knew such infringement was taking place". Questions of fact such as these becomes an expensive proposition in view of the fact that getting in front of a jury can cost hundred of thousands of dollars even if the jury finds no infringement. Liability in these areas can best be summarized by listing out what has transpired to date, especially in those instances where "content or control" is monitored or controlled: Publishing or making available material that infringes on another copyright Infringing on another trademark, or confusing the public about the source of a good or service Disclosing a trade secret Distributing defamatory statements Violating rights to privacy Product Liability as a product distributer Regardless of the liabilities imposed by law, the shear volume of Internet activity and file transfer makes provider risk management a gargantuan task. No doubt the legal development and insurer response to the challenge may end up being as fast as the technological development. Bio of Frederick J. Fisher Frederick J. Fisher , J.D. is currently the principal of Frederick John Fisher, Insurance Broker. He is also president of Surplus Risk Services, Inc and The Fisher Associates Adjusters with offices in Southern California. For the past 20 years, Mr. Fisher has actively been involved in manny activities including underwriting, adjustment, investigation, and resolution of Professional Liability Claims. During his entire career, these Claims involved Claims-made Insurance policies. Mr. Fisher has lectured extensively on professional liability loss control, and authored over 30 articles in trade journals and periodicals. He is the author of BROKER BEWARE, Selling Real Estate within the Law. This book provides a loss control program for Realtors. He is the designer of a program to conduct on site pre-underwriting risk management assessments of a clients' professional liability exposures onbehalf of Insurance Producers , Real Estate professionals and Lawyers. In 1993, he was elected to the PLUS Board of Trustees. In 1994, he was elected Secretary-Treasurer and a member of the Executive Committee and re-elected to this position in 1995. He is Chairman of the Finance and Budget Committee. He previously had be en member of the PLUS Education Committee, and was Co-Chair of the National Membership Committee. He is the Senior Technical Advisor for The Professional Liability Manual, published by the International Risk Management Institute. This manual is required reading by candidates for the RPLU profesional designation sponsored by The Professional Liability Underwriting Society (PLUS). He testifies regularly as an expert witness in cases dealing with the duties and obligations of professionals as well as on coverage and claims-made issues. He is currently a member of the PLUS Southern California Steering Committee, and the PLUS Peer Review Committee responsible for overseeing course material for the Registered Professional Liability Underwriter (RPLU) desig nation. Mr. Fisher can be reached at 310/320-8291, Compuserve 71342,3137, Internet-FJFisher@ix.netcom.com From owner-software@net.bio.net Sun Jan 07 22:00:00 1996 Path: biosci!biosci!not-for-mail From: Davison@UH.EDU (Dan Davison) Newsgroups: bionet.molbio.proteins,bionet.software.gcg,bionet.software Subject: PIR Release 47 available for FTP, Gopher access Date: 8 Jan 1996 12:07:46 -0800 Organization: University of Houston Lines: 38 Sender: daemon@net.bio.net Distribution: bionet Message-ID: <4crcb5$mfo@masala.cc.uh.edu> NNTP-Posting-Host: net.bio.net Xref: biosci bionet.molbio.proteins:6650 bionet.software.gcg:1548 bionet.software:14373 PIR RELEASE 47 available The UH Gene-Server files have been updated with release 47 of the PIR. Anonymous ftp for the ascii and vms_lzw version is available on ftp.bchs.uh.edu in pub/gene-server/pir/pir_rel47/vms_lzw or pub/gene-server/pir/pir_47/ascii. Login as "anonymous" and send your e-mail address as the password. The conversion of files into the format needed for GCG is complete and the files are in .../pir/pir_rel47/vms directory. The UH PIR Gopher server is also updated with the PIR 47 files. Point your gopher to gopher.bchs.uh.edu, select "Fast PIR Lookup" The gopher now includes files from the NRL-3D database. The NRL_3D database did not change between release 46 and release 47. GOPHER LINK INFORMATION Name=PIR Archive, University of Houston Type=1 Port=70 Path= Host=gopher.bchs.uh.edu URL Form: gopher://gopher.bchs.uh.edu dan davison davison@uh.edu -- dr. dan davison/dept. of biochemical and biophysical sciences/univ. of Houston/4800 Calhoun/Houston,TX 77204-5934/davison@uh.edu/DAVISON@UHOU Disclaimer: As always, I speak only for myself, and, usually, only to myself. From owner-software@net.bio.net Sun Jan 07 22:00:00 1996 Path: biosci!agate!overload.lbl.gov!news.emf.net!gatech!newsfeed.internetmci.com!tank.news.pipex.net!pipex!oleane!in2p3.fr!swidir.switch.ch!swsbe6.switch.ch!scsing.switch.ch!news.belwue.de!news.dfn.de!gs.dfn.de!uni-erlangen.de!winx03!wpxx02.toxi.uni-wuerzburg.de!not-for-mail From: krasel@wpxx02.toxi.uni-wuerzburg.de (Cornelius Krasel) Newsgroups: bionet.software Subject: Re: C compiler Date: 8 Jan 1996 15:47:26 GMT Organization: University of Wuerzburg, Germany Lines: 20 Distribution: world Message-ID: <4creae$vd9@winx03.informatik.uni-wuerzburg.de> References: <8E80237CA2@ibccf.biof.ufrj.br> NNTP-Posting-Host: wpxx02.toxi.uni-wuerzburg.de X-Newsreader: TIN [UNIX 1.3 950824BETA PL0] Mozart de Azevedo Marins (MOZART@IBCCF.BIOF.UFRJ.BR) wrote: > I need a program do compile an EMBL decoder (UUD.C), how > can I get this ? Does anybody knows ? What you need is a C compiler. Unfortunately you do not tell us what kind of system you run. GCC (the C compiler of the FSF) is available for many, but not all platforms. An easier possibility for you would be to get a precompiled version of uud via anonymous ftp, provided you have it (you should, since you have WWW access). Again, to help you further, we would have to know which kind of system you are running on. Hope that helps a bit further, --Cornelius. -- /* Cornelius Krasel, U Wuerzburg, Dept. of Pharmacology, Versbacher Str. 9 */ /* D-97078 Wuerzburg, Germany email: phak004@rzbox.uni-wuerzburg.de SP3 */ /* "Science is the game we play with God to find out what His rules are." */ From owner-software@net.bio.net Sun Jan 07 22:00:00 1996 Path: biosci!PUBLIC.BTA.NET.CN!wfchen From: wfchen@PUBLIC.BTA.NET.CN (user 3046) Newsgroups: bionet.software Subject: (none) Date: 8 Jan 1996 03:22:11 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 48 Sender: daemon@net.bio.net Distribution: world Message-ID: <199601081120.TAA02140@public.bta.net.cn> NNTP-Posting-Host: net.bio.net mRNA Strucrure Prediction Internet-Service Dear Experts: Please permit me to ask a naive question. We are just probing into the area of structural biology from the field of molecular immunology! We want to know the 2nd especially 3rd mRNA structure from our mRNA sequence. Computer modelling is just enough! The result is very meaningful to us! The OBSTACLE we are facing: our computer is not power enough. ARE THERE any e-mail server on the Internet to do that just as 'PredictProtein@EMBL-Heidelberg.DE'? OR, SHOULD YOU permit me use your mainframe to do this computation (I send you the seq. via e-mail)? I deem it a great honor to receive your early reply. Please reply personally to wfchen@public.bta.net.cn =-=-=-=-=-=-=-=-=-=-=-=-=- MANY THANKS! -=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-= Simon M. Lin Department of Immunology Phone: +86 10 593 4831 (24 hrs) Beijing Medical University CHINA "Not quite the third world" =-=-=-=-==-=-=-=-=-=-="Computer + Molecular Biology = Discovery !" -=-=-=-= From owner-software@net.bio.net Sun Jan 07 22:00:00 1996 Path: biosci!agate!news.ucdavis.edu!library.ucla.edu!newsfeed.internetmci.com!in2.uu.net!EU.net!Norway.EU.net!nntp.uio.no!nac.no!ifi.uio.no!news.sics.se!newsfeed.sunet.se!news01.sunet.se!sunic!news99.sunet.se!news.funet.fi!news.csc.fi!usenet From: "Heikki LehvŠslaiho" Newsgroups: bionet.cellbiol,bionet.immunology,bionet.microbiology,bionet.molbio.ageing,bionet.molbio.embldatabank,bionet.molbio.evolution,bionet.mycology,bionet.neuroscience,bionet.parasitology,bionet.population-bio,bionet.protista,bionet.software Subject: Re: Help please!!!!! (taxonomy) Date: 8 Jan 1996 09:23:00 GMT Organization: CSC - Center for Scientific Computing Lines: 106 Message-ID: <4cqnpk$bv0@ankka.csc.fi> References: <4ca6qk$knt@ixnews3.ix.netcom.com> <4cpjav$abe@cheyenne.iac.net> NNTP-Posting-Host: siru.csc.fi Mime-Version: 1.0 Content-Type: text/plain; charset=iso-8859-1 Content-Transfer-Encoding: 8bit X-Mailer: Mozilla 1.12(Macintosh; I; PPC) To: birsen.kaya@uc.edu,Heikki.Lehvaslaiho@csc.fi X-URL: news:4cpjav$abe@cheyenne.iac.net Xref: biosci bionet.cellbiol:3745 bionet.immunology:6855 bionet.microbiology:4443 bionet.molbio.ageing:2371 bionet.molbio.embldatabank:589 bionet.molbio.evolution:4068 bionet.mycology:3326 bionet.neuroscience:11986 bionet.parasitology:1317 bionet.population-bio:1733 bionet.protista:465 bionet.software:14369 >My friend needs the scientific classifications of these organisms: > >ticks >bamboo >pandorina >fusarium >pseudomonas > >He needs the complete classifications, from kingdom to species. It is >rather last minute and will be very much appreciated. Sorry for the >inconvenience. Taxonomy is a rather controversial science. Moreover, not all everything is available in net. There are three good ways of finding taxonomical information. 1. Tree of Life =============== http://phylogeny.arizona.edu/ A very good idea but needs a lot more work to cover more taxons. 2. NCBI Taxonomy Browser ======================== http://www3.ncbi.nlm.nih.gov/Taxonomy/Taxonomy/taxonomyhome.html The fastest way of finding the complete, hierarcial taxonomy. This taxonomy is from molecular biologists point of view. Classical taxonomists no doubt disagree in many cases. SRS (Sequence Retireval System) =============================== http://cypress.csc.fi:8001/srs/srsc SRS is the most powerful tool for browsing sequence databases. There are more than 15 servers world wide. SRS is developed st EMBL (http://www.embl-heidelberg.de:80/srs/srsc). If you check my server (or any other European servers), you will notice that the wording of the taxon hierarchy differs slightly in the European sequence database EMBL from that in US (GenBank). All the best, -Heikki Here are the classifications I found : ticks ===== http://www3.ncbi.nlm.nih.gov/htbin-post/Taxonomy/wgetorg?id=6935&lvl=3 Eukaryotae; mitochondrial eukaryotes; Metazoa; Arthropoda; Chelicerata; Arachnida; Acari; Parasitiformes, Argasidae (soft ticks) | xodidae (hard ticks) bamboo, Bambusa sp. =================== http://www3.ncbi.nlm.nih.gov/htbin-post/Taxonomy/wgetorg?id=4581&lvl=0 Eukaryotae; mitochondrial eukaryotes; Viridiplantae; Charophyta/Embryophyta group; Embryophyta; Magnoliophyta; Liliopsida; Poales; Poaceae pandorina ========= http://www3.ncbi.nlm.nih.gov/htbin-post/Taxonomy/wgetorg?id=33098&lvl=0 Eukaryotae; mitochondrial eukaryotes; Viridiplantae; Chlorophyta; Chlorophyceae; Volvocales; Volvocaceae Fusarium sp. ============ http://www3.ncbi.nlm.nih.gov/htbin-post/Taxonomy/wgetorg?id=5506&lvl=0 Eukaryotae; mitochondrial eukaryotes; Eumycota; Ascomycota; Euascomycetes; Pyrenomycetes; Hypocreales; Hypocreaceae; mitosporic Hypocreaceae OC Eukaryota; Plantae; Thallobionta; Eumycota; Ascomycotina; OC Pyrenomycetes; Hypocreales; Hypocreaceae. Pseudomonas sp. =============== http://www3.ncbi.nlm.nih.gov/htbin-post/Taxonomy/wgetorg?id=286&lvl=0 Eubacteria; Proteobacteria; gamma subdivision OC Prokaryota; Bacteria; Gracilicutes; Scotobacteria; OC Aerobic rods and cocci; Pseudomonadaceae. ______ _/ _/____________________________________________________ _/ _/ _/ _/ _/ Heikki Lehväslaiho _/_/_/_/_/ CSC Scientific Computing _/ _/ _/ Tietotie 6, P.O. Box 405, FIN-02101 Espoo FINLAND _/ _/ _/ Phone: +358 0 457 2076 FAX: +358 0 457 2302 _/ The Finnish EMBnet node __ _/_/_/_/_/________________________________________________________ From owner-software@net.bio.net Sun Jan 07 22:00:00 1996 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!elroy.jpl.nasa.gov!nntp1.jpl.nasa.gov!nntp-server.caltech.edu!seqaxp.bio.caltech.edu!MATHOG From: mathog@seqaxp.bio.caltech.edu Newsgroups: bionet.software Subject: Re: Free Rabies Software Date: 8 Jan 1996 20:48:43 GMT Organization: Biology Division, Caltech, Pasadena CA 91125 Lines: 13 Distribution: world Message-ID: <4crvvb$ag1@gap.cco.caltech.edu> References: <199601042037.PAA07499@dub-mail-svc-1.compuserve.com> Reply-To: mathog@seqaxp.bio.caltech.edu NNTP-Posting-Host: seqaxp.bio.caltech.edu In article <199601042037.PAA07499@dub-mail-svc-1.compuserve.com>, bactbob@BTBSOFTWARE.COM writes: > >Free Rabies software for labs testing animal and human brains for Rabies >antigen. Ok, I'll bite, what does "Rabies software" do, make the computer foam at the mouse and then die? ;-) Later, David Mathog mathog@seqaxp.bio.caltech.edu Manager, sequence analysis facility, biology division, Caltech From owner-software@net.bio.net Mon Jan 08 22:00:00 1996 Path: biosci!INTERSERV.COM!rm From: rm@INTERSERV.COM Newsgroups: bionet.software Subject: taxonomy of software in biotechnoloy Date: 9 Jan 1996 05:34:24 -0800 Organization: InterServ News Service Lines: 4 Sender: daemon@net.bio.net Distribution: world Message-ID: <4cs6bv$j7h@lore.interserv.net> Reply-To: lore!Richard.Morris@uunet.uu.net NNTP-Posting-Host: net.bio.net Keywords: biology, software, taxonomy, R&D, production I am seeking an overview of software in biology, specifically in the area of R&D and production. My aim is to develop a taxonomy of SW applications in a life sciences R&D or production environment. Please help. Thanks Richard rm@interserv.com From owner-software@net.bio.net Mon Jan 08 22:00:00 1996 Path: biosci!CS.Arizona.EDU!news.Arizona.EDU!hamblin.math.byu.edu!sol.ctr.columbia.edu!news.msfc.nasa.gov!newsfeed.internetmci.com!EU.net!Belgium.EU.net!chaos.kulnet.kuleuven.ac.be!usenet From: Przemko Tylzanowski Newsgroups: bionet.software Subject: A complex blast output sequence retrieval... Date: Tue, 09 Jan 1996 09:00:53 +0000 Organization: K.U.Leuven Lines: 31 Message-ID: <30F22EC5.41C6@sgi.celgen.kuleuven.ac.be> NNTP-Posting-Host: sgi.celgen.kuleuven.ac.be Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 2.0b2 (X11; I; IRIX 5.3 IP12) Hi! Ther are a few programs that will allow for a more human analysis of blast output than blast itself. Unfortunately none of them (to my knowledge) would deal with the following problem. I have a cDNA that, because is differentially spliced, has two ORFs. So, to make my life easy (or so I thought) I searched databases using tblastx. I got very nice local matches (blastp or blastn would not find them) and decided to retrieve the sequences for more careful comparisons (pileup, phylip etc.). Here comes the problem(s): The blast output- unlike fasta- gives you only the matched part so if my query has some gaps, I will get more than one alignement per sequence. Since I have about 30 good hits, each of them give >1 local alignement, That would not be so bad but tblastx dynamically translates database sequences. Since most of my hits are against ESTs wich do not exist in GenPep, altough I get the protein alignement on the screen, I cannot retrieve the sequences per se (unless I copy and paste which is doable but highly unpleasant). So, the question is- is there a software that would allow me to take out of the blast alignement the matches as independent sequences (no need to go back to the databse and retrieve the original sequence). Then I could use them as any other sequences in pileup, clustalw etc. Thanks Przemko Tylzanowski Ph.D. Celgen phone:32-16-34-59-28 University of Leuven or:32-16-34-59-16 Herestraat 49 fax:32-16-34-59-33 3000 Leuven e-mail:przemko@sgi.celgen.kuleuven.ac.besgi 5% Przemko From owner-software@net.bio.net Mon Jan 08 22:00:00 1996 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!newsfeed.internetmci.com!vixen.cso.uiuc.edu!prairienet.org!mxu From: mxu@prairienet.org (Mavis (Xiangmei) Xu) Newsgroups: bionet.software Subject: PC for sale Date: 9 Jan 1996 02:04:53 GMT Organization: University of Illinois at Urbana Lines: 13 Message-ID: <4csig5$q07@vixen.cso.uiuc.edu> NNTP-Posting-Host: firefly.prairienet.org PC for sale: * 486 DLC-40 * 170MB, 4MB RAM, Color monitor * fax/modem * tons of software * $600.00 * email to: ptan@prairienet.org or call: (217)356-4216 -- Mavis Xu 1778 Valley Rd Champaign, IL61820 (217)356-4216 From owner-software@net.bio.net Mon Jan 08 22:00:00 1996 Newsgroups: bionet.software Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!newsfeed.internetmci.com!swrinde!tank.news.pipex.net!pipex!sunsite.doc.ic.ac.uk!hgmp.mrc.ac.uk!ebi.ac.uk!news From: "Matteo R. diTommaso" Subject: Re: taxonomy of software in biotechnoloy Sender: news@ebi.ac.uk (Mr news) Message-ID: Date: Tue, 9 Jan 1996 21:52:48 GMT To: rm@interserv.com Lines: 14 Content-Type: TEXT/PLAIN; charset=US-ASCII References: <4cs6bv$j7h@lore.interserv.net> Mime-Version: 1.0 Organization: European Bioinformatics Institute X-Newsreader: NEWTNews & Chameleon -- TCP/IP for MS Windows from NetManage In article <4cs6bv$j7h@lore.interserv.net>, writes: #I am seeking an overview of software in biology, specifically in the area of #R&D and production. My aim is to #develop a taxonomy of SW applications in a life sciences R&D or production #environment. Please help. #Thanks Richard rm@interserv.com Try The BioCompanion at http://www.ch.embnet.org/jam/jam.html and BioCatalog at http://www.ebi.ac.uk/biocat/biocat.html M.diTommaso ditommaso@ebi.ac.uk From owner-software@net.bio.net Mon Jan 08 22:00:00 1996 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!elroy.jpl.nasa.gov!swrinde!newsfeed.internetmci.com!in2.uu.net!van-bc!unixg.ubc.ca!news From: Tony Fu Newsgroups: bionet.software Subject: Macromolecular Crystal Packing in Virtual Reality Date: 9 Jan 1996 23:04:26 GMT Organization: University of British Columbia Lines: 29 Message-ID: <4cus9q$7eb@nntp.ucs.ubc.ca> NNTP-Posting-Host: xray1.chem.ubc.ca Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 1.1N (X11; I; IRIX 5.3 IP20) X-URL: news:bionet.software Dear folks, We would like to announce our WWW server on Macromolecular Crystal Packing in Virtual Reality at http://laue.biochem.ubc.ca:8080/cgi-bin/ssis/banff/xpack.html It allows easy 3D visualization of PDB crystal packing in real time. All you needed is a VRML browser and a PDB file accessible by URL (ftp or http). Have fun! Tony -- =================================================================== Tai Y. Fu (Tony) ................................ Department of Biochemistry & Molecular Biology Protein Engineering Network of Centres of Excellence University of British Columbia 2146 Health Sciences Mall, Vancouver BC, CANADA V6T 1Z3. tel: (604)-822-5007 fax: (604)-822-5227 email: tony@laue.biochem.ubc.ca http://laue.biochem.ubc.ca:8080/tony.html =================================================================== From owner-software@net.bio.net Mon Jan 08 22:00:00 1996 Newsgroups: bionet.software Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!newsfeed.internetmci.com!in2.uu.net!EU.net!peer-news.britain.eu.net!sunsite.doc.ic.ac.uk!hgmp.mrc.ac.uk!ebi.ac.uk!bshomer From: bshomer@ebi.ac.uk (Benny Shomer) Subject: Re: C compiler Sender: news@ebi.ac.uk (Mr news) Message-ID: Date: Mon, 8 Jan 1996 14:01:42 GMT References: <8E80237CA2@ibccf.biof.ufrj.br> Organization: EBI - European Bioinformatics Institute X-Newsreader: TIN [version 1.2 PL2] Lines: 64 Mozart de Azevedo Marins (MOZART@IBCCF.BIOF.UFRJ.BR) wrote: : Hi there, : I need a program do compile an EMBL decoder (UUD.C), how : can I get this ? Does anybody knows ? I've tried through the web, but : ostly I can't reach de host...is it possible by e-mail ? : Thanx You haven't mentioned for which type of computer/OS you need this. For PC's and Mac's you can easily get a binary version through the net. e.g.: for PC: ------- extract34.zip (from OAK.Oakland.edu under /SimTel/win3/encode/extract34.zip) wncod261.zip (from OAK.Oakland.edu under /SimTel/win3/encode/wncod261.zip) for Macintosh: -------------- uu-undo-10.hqx (from sumex-aim.stanford.edu under /info-mac/cmp/uu-undo-10.hqx) stuu.hqx (from sumex-aim.stanford.edu under /info-mac/comm/_Utilities/cmp/stuu.hqx) On large systems (e.g. Unix, SGI etc.) there will allways be a C compiler available and in most cases there will also be compiled version of UUdecode. BTW, it isn't an "EMBL decoder", but a general usage decoder for the UUE format (which is used by EMBL-EBI as well... :). I hope this helps, Benny. -- <<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> Doing PCR? Have you got some good, working primers??? Visit the PCR primers database at http://www.ebi.ac.uk/primers_home.html and make your donation. If you don't have access to WWW, just write to primers@ebi.ac.uk <<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Benny Shomer External Biological Liaison Officer, EMBL outstation - The EBI, Hinxton Hall, Hinxton,Cambridge CB10 1RQ, UK Tel: +44-223-494437 Fax: +44-223-494468 Email: bshomer@EBI.ac.uk http://www.ebi.ac.uk/ebi_docs/staff/benny.html ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ From owner-software@net.bio.net Mon Jan 08 22:00:00 1996 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!newsfeed.internetmci.com!info.ucla.edu!library.ucla.edu!news.ucdavis.edu!reqf-107.ucdavis.edu!tmiyano From: tmiyano@mikuni.com (Takashi Miyano) Newsgroups: bionet.software Subject: NeuroLab v1.2 DEMO Available Followup-To: bionet.software Date: Tue, 09 Jan 1996 10:53:19 +0100 Organization: Mikuni Berkeley R&D Corp. Lines: 50 Distribution: bionet Message-ID: NNTP-Posting-Host: reqf-107.ucdavis.edu Mikuni Berkeley R&D Corp. announces the release of NeuroLab v1.2 for Windows. The library that aids the understanding, designing and simulation of neural networks systems on the Macintosh is now available for Windows 3.X, Win 95 and Win NT. DEMO packages (Win, Mac) are now available for download from: ftp://ftp.mikuni.com/pub/neurolab Software information is also available for WWW surfing: http://www.mikuni.com/neurolab NeuroLab is a neural network library for Extend (a graphical icon-based simulation program). NeuroLab allows users to construct their own flexible and complicated artificial neural networks by simply clicking, dragging and connecting iconic blocks. The parameters of networks such as neuron number, back propagation methods, and learning rates can be changed interactively in the dialog box of each functional block. Implemented networks are: Hopfield (full and sparse connection) Perceptron Competitive (supervised/unsupervised) Recurrent Context Feature map (1D, 2D) Counter propagation, Boltzmann machine Single/multi-layer feed-forward neural networks. NeuroLabÕs graphical simulation assists users in their understanding of the structure and components of neural networks and makes NeuroLab an ideal tool for educational and presentational purposes. NeuroLab includes ready- to-modify examples in the following fields: Image processing (recognition, restoration) Data classification Future prediction (signal, stock price) Adaptive control (Robot, nonlinear plant) Dynamics identification (forward/inverse dynamics) Optimization Content addressable memory For questions, comments and additional information, contact: Mikuni Berkeley R & D Corp. 4000 Lakeside Dr. Richmond, CA 94806-1936 USA TEL: 510-222-9880, FAX: 510-222-9884 neurolab-info@mikuni.com From owner-software@net.bio.net Mon Jan 08 22:00:00 1996 Path: biosci!IRCM.UMontreal.CA!duhaimj From: duhaimj@IRCM.UMontreal.CA ("SI-Johanne Duhaime") Newsgroups: bionet.software Subject: Gene Runner Date: 9 Jan 1996 09:49:00 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 12 Sender: daemon@net.bio.net Distribution: world Message-ID: <960109124640.ZM6374@SI05.IRCM.UMontreal.CA> NNTP-Posting-Host: net.bio.net Bonjour I am looking for information about the software Gene Runner. Is there anyone knowing the phone number of the company that makes it (Hasting is the name I think). Thank you. -- Johanne Duhaime IRCM Duhaimj@ircm.umontreal.ca From owner-software@net.bio.net Mon Jan 08 22:00:00 1996 Path: biosci!bcm.tmc.edu!pendragon!news.msfc.nasa.gov!newsfeed.internetmci.com!in1.uu.net!news.palantir.com!news.IntNet.net!news From: jas@.IntNet.net Newsgroups: bionet.software Subject: Seeking Phoenix ROM BIOS update Date: 5 Jan 1996 01:21:46 GMT Organization: Intelligence Network Online, Inc. Lines: 4 Message-ID: <4chufa$c85@mercury.IntNet.net> NNTP-Posting-Host: pm-clw-5-33.intnet.net X-Newsreader: AIR News 3.X (SPRY, Inc.) I need to upgrade from my Phoenix 386 ROM BIOS 1.10 014 to a newer version. Anyone know where I can find one? Jerry From owner-software@net.bio.net Mon Jan 08 22:00:00 1996 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!newsfeed.internetmci.com!howland.reston.ans.net!Germany.EU.net!Dortmund.Germany.EU.net!gsf.de!news From: Kerstin Quandt Newsgroups: bionet.software Subject: New software to detect consensus matches Date: 9 Jan 1996 09:02:17 GMT Organization: GSF Forschungszentrum fuer Umwelt und Gesundheit mbH Lines: 32 Message-ID: <4ctaup$40e@cony.gsf.de> NNTP-Posting-Host: primus.gsf.de Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 1.1N (X11; I; HP-UX A.09.04 9000/887) X-URL: news:bionet.software We would like to announce the availability of a new software tool for the detection of consensus matches in DNA sequences called MatInspector. MatInspector is a program that uses a large library of predefined matrix descriptions of transcription factor binding sites to locate matches in nucleotide sequences of unlimited length. It assigns a quality rating to matches and thus allows a quality- based filtering and selection of matches. (see Quandt, K., Frech, K., Karas, H., Wingender, E., Werner, T.: MatInd and MatInspector - New fast and versatile tools for detection of consensus matches in nucleotide sequence data Nucleic Acids Research 23, pp. 4878-4884 (1995)). The library of protein binding sites contains more than 200 entries and is based on the TRANSFAC database (the new release 2.5 is accessible via http://transfac.gbf-braunschweig.de). The software and the library are available for UNIX, PC and MAC at ftp://ariane.gsf.de/pub/ You can also use interactively MatInspector on the WWW at http://transfac.gbf-braunschweig.de or http://www.gsf.de./biodv/matinspector.html Here the sequences to be analyzed can directly be submitted (copy and paste), individual or groups of matrices from the library can be selected and the resulting output can be saved for further processing. From owner-software@net.bio.net Tue Jan 09 22:00:00 1996 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!newsfeed.internetmci.com!howland.reston.ans.net!nntp.crl.com!usenet From: gwrust@a.crl.com (gwrust) Newsgroups: bionet.software Subject: Need Quick Books Compatable software - HELP! Date: 10 Jan 1996 01:03:01 GMT Organization: crl Lines: 4 Message-ID: <4cv385$2s6@nntp.crl.com> NNTP-Posting-Host: a105019.sfo5.as.crl.com X-Posted-From: InterNews 1.0.8@a105019.sfo5.as.crl.com X-Authenticated: gwrust on POP host a.crl.com We are looking for software compatable with Intuit Quick Books that will provide 1.) Order entry, 2.) Back order tracking and release 3.) Custom Reports. If anyone can help please email your suggestions. Thanks! From owner-software@net.bio.net Tue Jan 09 22:00:00 1996 Newsgroups: bionet.software Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!newsfeed.internetmci.com!news.pe.net!news.corpcomm.net!newspeak.ultratech.net!worldlinx.com!wchat.on.ca!news From: toper@wchat.on.ca (Brian Topolinsky) Subject: help Content-Type: Text/Plain; charset=US-ASCII Organization: WorldChat / The Online Source, Burlington Ontario. Date: Wed, 10 Jan 1996 05:01:05 GMT Message-ID: Mime-Version: 1.0 X-Newsreader: WinVN 0.99.7 X-Nntp-Posting-Host: g7-p11.wchat.on.ca Sender: news@wchat.on.ca (News Owner) Lines: 2 help From owner-software@net.bio.net Tue Jan 09 22:00:00 1996 Path: biosci!bcm.tmc.edu!pendragon!news.msfc.nasa.gov!newsfeed.internetmci.com!in1.uu.net!nctuccca.edu.tw!netnews.ntu.edu.tw!news From: hwpeng@ibms.sinica.edu.tw (Hsien-wei Peng) Newsgroups: bionet.software Subject: PCR primers design Date: 10 Jan 1996 09:01:44 GMT Organization: Inst. of Biomedical Science, Acad. Sinica, Taiwan Lines: 8 Message-ID: <4cvv9o$89r@netnews.ntu.edu.tw> NNTP-Posting-Host: @140.109.42.15 Mime-Version: 1.0 Content-Type: Text/Plain; charset=US-ASCII X-Newsreader: WinVN 0.99.6 Dear Netters, I am searching for a software for PCR primers design which works on windows (3.1 or 95) or DOS. I would like a free one, but information about other commercial products are also welcome. Thank for your answering in advance. H.-W. Peng From owner-software@net.bio.net Tue Jan 09 22:00:00 1996 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!newsfeed.internetmci.com!in1.uu.net!zib-berlin.de!fu-berlin.de!news.dfn.de!news.gwdg.de!amuelle3 From: amuelle3@gwdu19.gwdg.de (Arne Mueller ) Newsgroups: bionet.software Subject: ChemSoftware for linux? Date: 9 Jan 1996 21:36:40 GMT Organization: GWDG, Goettingen Lines: 17 Message-ID: <4cun58$a1m@gwdu19.gwdg.de> NNTP-Posting-Host: gwdu08-fddi.gwdg.de X-Newsreader: TIN [version 1.1 PL8] Hello, I'm using Linux and try to find a free software for drawing chemical structure-formulas. It may be a program with a graphical interface under X11 but it also can be a LateX-macro or something else. I used an older verson of XYM-TeX or ChewmTeX but these macros are very complicate to use. If you know a program for drawing structure-formulas under linux please send me an email. Thank you for help, Arne From owner-software@net.bio.net Tue Jan 09 22:00:00 1996 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!newsfeed.internetmci.com!in2.uu.net!news.ner.bbnplanet.net!das-news2.harvard.edu!oitnews.harvard.edu!news.dfci.harvard.edu!usenet From: "Matthew P. Frosch, M.D., Ph.D." Newsgroups: bionet.software Subject: Pedrigree drawing software for Mac Date: 10 Jan 1996 14:03:30 GMT Organization: Brigham and Women's Hospital Lines: 10 Message-ID: <4d0gvi$ovh@cisunix1.dfci.harvard.edu> NNTP-Posting-Host: 134.174.88.158 Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 1.1N (Macintosh; I; 68K) X-URL: news:bionet.software I am looking for software which will allow me to easily draw pedigrees for a mouse colony on a Mac. I know trhat I can do it freehand with a variety of graphics package, but I am looking for a program which will layout the tree in a standard manner (using established symbols, labeling conventions, etc.). TIA, Matthew From owner-software@net.bio.net Tue Jan 09 22:00:00 1996 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!newsfeed.internetmci.com!info.ucla.edu!nnrp.info.ucla.edu!usenet From: komaromi@ucla.edu (Dan Komaromi) Newsgroups: bionet.cellbiol,bionet.immunology,bionet.microbiology,bionet.molbio.ageing,bionet.molbio.embldatabank,bionet.molbio.evolution,bionet.mycology,bionet.neuroscience,bionet.parasitology,bionet.population-bio,bionet.protista,bionet.software Subject: Re: Points of interest Date: Wed, 10 Jan 1996 22:26:53 GMT Organization: University of California, Los Angeles Lines: 16 Message-ID: <4d1eff$13au@saba.info.ucla.edu> References: <4ca6qk$knt@ixnews3.ix.netcom.com> NNTP-Posting-Host: ts32-12.wla.ts.ucla.edu X-Newsreader: Forte Free Agent 1.0.82 Xref: biosci bionet.cellbiol:3770 bionet.immunology:6918 bionet.microbiology:4472 bionet.molbio.ageing:2381 bionet.molbio.embldatabank:591 bionet.molbio.evolution:4075 bionet.mycology:3345 bionet.neuroscience:12029 bionet.parasitology:1328 bionet.population-bio:1742 bionet.protista:468 bionet.software:14404 Try the UCLA Neuroscience Undergraduate Society homepage (address listed below). Dan ___________________________ Email: komaromi@ucla.edu Phone: (310) 312-0570 10969 Rochester Avenue #202 Westwood, CA 90024 ___________________________ President, UCLA Neuroscience Undergraduate Society http://www.mednet.ucla.edu/dept/bri/NUS/welcome.htm Newsgroup: ucla.org.neurosci.undergrad.society From owner-software@net.bio.net Tue Jan 09 22:00:00 1996 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!newsfeed.internetmci.com!tank.news.pipex.net!pipex!oleane!in2p3.fr!swidir.switch.ch!scsing.switch.ch!news.belwue.de!fu-berlin.de!news.dfn.de!gs.dfn.de!uni-erlangen.de!lrz-muenchen.de!wap4.zi.biologie.uni-muenchen.de!salger From: salger@wap4.zi.biologie.uni-muenchen.de (Klaus Salger) Newsgroups: bionet.software Subject: Re: Gene Runner Date: 10 Jan 1996 18:12:58 GMT Organization: Leibniz-Rechenzentrum, Muenchen (Germany) Lines: 41 Distribution: world Message-ID: <4d0vja$a5v@sparcserver.lrz-muenchen.de> References: <960109124640.ZM6374@SI05.IRCM.UMontreal.CA> NNTP-Posting-Host: wap4.zi.biologie.uni-muenchen.de X-Newsreader: TIN [version 1.2 PL2] SI-Johanne Duhaime (duhaimj@IRCM.UMontreal.CA) wrote: : Bonjour : I am looking for information about the software Gene Runner. Is there : anyone knowing the phone number of the company that makes it (Hasting is : the name I think). : Thank you. : -- : Johanne Duhaime : IRCM : Duhaimj@ircm.umontreal.ca Johanne, this is the address of Hastings Software: Hastings Software Inc. PO Box 567, Hastings on Hudson, NY, 107106 USA Voice: (914) 969-0855 Fax: (914) 376-4433 email: hasoft@biotechnet.com If you are interested in a demo version of Gene Runner, there is one on the IUBio server. Cheers Klaus -- Klaus Salger phone : +49 (0)89 5902 -502 Zoologisches Institut FAX : -450 AG MacWilliams e-mail: salger@zi.biologie.uni-muenchen.de Luisenstr. 14 80333 Muenchen Germany bio-links: http://www.zi.biologie.uni-muenchen.de/~salger/salger.html From owner-software@net.bio.net Tue Jan 09 22:00:00 1996 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!newsfeed.internetmci.com!uwm.edu!msunews!netnews.upenn.edu!mail.med.upenn.edu!wellsg From: wellsg@mail.med.upenn.edu (Gregg B Wells) Newsgroups: bionet.molbio.proteins,bionet.software Subject: Re: WWW seq alignment site with "jumbling" test of significance? Followup-To: bionet.molbio.proteins,bionet.software Date: 10 Jan 1996 03:13:36 GMT Organization: University of Pennsylvania Lines: 55 Message-ID: <4cvat0$mf9@netnews.upenn.edu> References: NNTP-Posting-Host: mail.med.upenn.edu X-Newsreader: TIN [version 1.2 PL2-upenn1.1] Xref: biosci bionet.molbio.proteins:6661 bionet.software:14393 Neil Clarke (Neil.Clarke@qmail.bs.jhu.edu) wrote: : Anyone know of a WWW site that does an alignment between two protein : sequences with the option of rerunning the alignement using a randomized : ("jumbled") sequence? as a test of significance? Having just given a : lecture on sequence analysis during which I extolled the virtues of the : Web, I was surprised to find that I couldn't find a good old-fashioned : Needleman-Wunsch type program out there. Lots of local homology search : algorithms and dynamic programming algorithms for database searching, but : no 'optimal' sequence alignment stuff. Help, please! _______________________________________________________________________ The Smith-Waterman algorithm can be used at the GenQuest site from Oak Ridge National Laboratory for searching protein and DNA sequences. Here is the email address for more information: ---------------------------------- GENQUEST E-MAIL SERVER USER MANUAL ---------------------------------- GenQuest can be accessed by sending e-mail to: Q@ornl.gov Messages to GENQUEST begin with a set of keywords which specify the options to be used in the search. Two key words are mandatory: TYPE and SEQ. The remainder are optional or have default settings. GENQUEST is case insensitive. EXAMPLE of a typical query: TYPE DNA6 TARGET SwissProt METHOD SW -g 13 MATRIX PAM120 SCORE 50 ALIGN 20 SEQ ATCTATCGTCGAGCTGGTGTCTGTGCTAGTCCACAGACAGHCTCGCTATATATGCT CGTTTTAAAGCTCGTATATATGCTCTCGCTAGTCCGATCGATGCTCGATCGCTAGTA TCGTATGATTCTTG END This example translates the given DNA sequence in 6 frames and searches SwissProt, using Smith-Waterman with gap penalty of 13, PAM120 matrix, and showing top 50 matches and top 20 alignments. Gregg Wells Department of Pathology University of Pennsylvania Philadelphia, Pennsylvania USA email: wells@athens.dental.upenn.edu From owner-software@net.bio.net Tue Jan 09 22:00:00 1996 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!newsfeed.internetmci.com!vixen.cso.uiuc.edu!howland.reston.ans.net!news.cac.psu.edu!news.math.psu.edu!ra.nrl.navy.mil!usenet From: rwadkins@cbmse.nrl.navy.mil (rmw) Newsgroups: bionet.software Subject: Re: looking for Mac chemical software Date: 10 Jan 1996 14:10:50 GMT Organization: Naval Research Laboratory Lines: 16 Sender: -Not-Authenticated-[6745] Message-ID: <4d0hda$hmn@ra.nrl.navy.mil> References: <30EAB3F3.5AAB@yk.rim.or.jp> <4ce8l4$d1o@ra.nrl.navy.mil> <4cf7b7$r6j@lastactionhero.rs.itd.umich.edu> NNTP-Posting-Host: esp2076.nrl.navy.mil X-Posted-From: InterNews 1.0.1@esp2076.nrl.navy.mil Xdisclaimer: No attempt was made to authenticate the sender's name. In article <4cf7b7$r6j@lastactionhero.rs.itd.umich.edu> brecher@terminator.rs.itd.umich.edu (Jonathan Brecher) (at Cambridge Software) writes: > rmw wrote: > >ChemDraw and Chem3D, both of which are from Berkely Software. > >They have a website somewhere where you can get a demo. > >Try a search engine with "ChemDraw" as the keyword. > > Gee, last I checked, we make ChemDraw and Chem3D. That's what our developers > think, anyway... Sorry. Too many antihistimines. It won't happen again. Great products, BTW. --Randy From owner-software@net.bio.net Tue Jan 09 22:00:00 1996 Path: biosci!daresbury!not-for-mail From: lisa@ipvgbe.igbe.pv.cnr.it (Antonella Lisa) Newsgroups: bionet.software Subject: Biosys Date: 10 Jan 1996 15:38:21 -0000 Lines: 17 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <4d0mhd$6i9@mserv1.dl.ac.uk> X-Sender: lisa@ipvgbe.igbe.pv.cnr.it (Unverified) Original-To: bio-soft@dl.ac.uk I am looking for a version of Biosys which can run on a Microvax 3400 (VMS operating system). At the moment I have a copy running on IBM but the source program cannot be compiled on the DEC machine. I thank for any help Best regards Antonella Lisa Antonella Lisa tel 382 - 546359 Istituto di Genetica Biochimica fax 382 - 422286 ed Evoluzionistica e-mail lisa@ipvgbe.igbe.pv.cnr.it Consiglio Nazionale dele Ricerche Via Abbiategrasso, 207 27100 Pavia ITALY From owner-software@net.bio.net