From owner-software@net.bio.net Fri Mar 01 22:00:00 1996 Path: biosci!bcm.tmc.edu!cs.utexas.edu!howland.reston.ans.net!vixen.cso.uiuc.edu!uwm.edu!msunews!netnews.upenn.edu!cronkite.ocis.temple.edu!usenet From: Joel Sheffield Newsgroups: bionet.software Subject: Re: program for 3D reconstruction from cross sections Date: Sat, 02 Mar 1996 18:08:51 -0800 Organization: Temple University, Academic Computer Services Lines: 10 Message-ID: <3138FF33.5046@sgibio.chem.temple.edu> References: <1996Feb23.121732.46059@yogi.urz.unibas.ch> <313175C9.41C6@sgi.celgen.kuleuven.ac.be> NNTP-Posting-Host: zeos4.chem.temple.edu Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 2.0 (Win16; I) Przemko Tylzanowski wrote: > > Hi! > I am also looking for such a program but running on IRIX or Windows95. > If anyone knows something about it, please drop a note > PrzemkoThe main challenge of such a project is to be able to align the adjacent sections so that appropriate structures fall into the correct place. We have had some success using Image Volumes, which was sold by Minnesota Datametrics. It allows for alignment, and adjustment for distortion in the section. From owner-software@net.bio.net Fri Mar 01 22:00:00 1996 Path: biosci!bcm.tmc.edu!usenet From: Istvan Ladunga Newsgroups: bionet.software Subject: ANNOUNCEMENT: FASTA-SWAP searches against protein pattern databases Date: 2 Mar 1996 02:14:21 GMT Organization: Baylor College of Medicine, Houston, Tx Lines: 86 Message-ID: <4h8att$flp@gazette.bcm.tmc.edu> NNTP-Posting-Host: dot.imgen.bcm.tmc.edu Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 1.1N (X11; I; SunOS 5.3 sun4m) X-URL: news:bionet.software FASTA-SWAP and FASTA-PAT: Gene Function Identification by Searching Protein Queries against Pattern Databases For sequences unidentified by both BLAST and FASTA database searches, we have developed two new pattern tools called FASTA-SWAP and FASTA-PAT, that are modified versions of Bill Pearson's FASTA program. Here, unlike in profiles, we represent aligned positions as the presence or absence of amino acids. These tools are fundamentally different from the earlier FASTAPAT and BLASTPAT because we use our new binary representation, where each the one million possible aligned amino acid combinations are coded by a unique number. This code allows compact representation of any multiple alignment. Users can currently search 9 databases of multiple alignments: - EC, a database of multiple alignments of 15,000 sequences with known EC numbers (this is the database with the highest information content); - the Pattern Induced Multiple Alignment (PIMA) Pattern Database, a comprehensive multiple alignment database with 22,422 patterns as aligned using PIMA; - three EntrezClus10 databases, sequence clusters from the PIMA alignment databases with >= 10 sequences, aligned using PIMA, CLUSTALW or the MAP program; - PIR-ALN database; - BLOCKS database; - PRINTS database; and - FSSP, Families of Structurally Similar Proteins database. Searches can be performed using the Baylor College of Medicine (Houston, Texas) WWW Search Launcher: http://gc.bcm.tmc.edu:8088/search-launcher/launcher.html Searching a sequence against these database is performed using new log-odds scoring matrices (rapidly calculated "on the fly") utilizing the one million combinations. In contrast to standard scoring matrices like PAM or BLOSUM, these new pattern-based matrices distinguish between conserved and variable positions, increasing search sensitivity and selectivity. Generally we recommend the more precise but somewhat slower diagonal search + Smith-Waterman refinement as implemented in FASTA-SWAP. For queries longer than 1000 residues however, FASTA-PAT using hashing + Smith-Waterman refinement may be considerably faster. A more detailed description of these programs is available at the Baylor College of Medicine (Houston, Texas) WWW Search Launcher: http://dot.imgen.bcm.tmc.edu:9331/cgi-bin/seq-search/protein-search.pl Searching a sequence against these database is performed using new log-odds scoring matrices (rapidly calculated "on the fly") utilizing the one million combinations. In contrast to standard scoring matrices like PAM or BLOSUM, these new pattern-based matrices distinguish between conserved and variable positions, increasing search sensitivity and selectivity. Generally we recommend the more precise but somewhat slower diagonal search + Smith-Waterman refinement as implemented in FASTA-SWAP. For queries longer than 1000 residues however, FASTA-PAT using hashing + Smith-Waterman refinement may be considerably faster. A more detailed description of these programs is available at our WWW pages: http://dot.imgen.bcm.tmc.edu:9331/seq-search/Help/fastpat.html _________________________________________________________________________ Steve (Istvan) Ladunga, Brent A. Wiese, and Randall F. Smith Human Genome Center, Department of Molecular and Human Genetics and Department of Cell Biology, Baylor College of Medicine, Houston, TX 77030, USA istvanl@bcm.tmc.edu; Phone: (713) 798 8089, FAX: (713) 798 5386 _________________________________________________________________________ From owner-software@net.bio.net Sat Mar 02 22:00:00 1996 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!elroy.jpl.nasa.gov!swrinde!gatech!newsxfer2.itd.umich.edu!newsxfer.itd.umich.edu!gumby!newspump.wustl.edu!cerberus.wustl.edu!news From: Reece Kimball Hart Newsgroups: bionet.software Subject: Re: PDB-fileformat? Date: 02 Mar 1996 18:25:37 -0600 Organization: Biophysics & Biochemistry, Washington University, St. Louis, USA Lines: 16 Sender: reece@cupid.wustl.edu Message-ID: <82ivgn2fb3.fsf@cupid.wustl.edu> References: <4h2c2p$es3@gwdu19.gwdg.de> NNTP-Posting-Host: cupid.wustl.edu In-reply-to: amuelle3@gwdu19.gwdg.de's message of 28 Feb 1996 19:57:13 GMT X-Attribution: reece X-URL: To: amuelle3@gwdu19.gwdg.de (Arne Mueller ) X-Newsreader: Gnus v5.1 >>>>> AM == amuelle3@gwdu19.gwdg.de (Arne Mueller ) wrote >>>>> In bionet.software >>>>> On 28 Feb 1996 19:57:13 GMT >>>>> Re PDB-fileformat? AM> I'm looking for a description of the PDB-fileformat. Try http://www.pdb.bnl.gov/. Reece -- Reece Kimball Hart | email: reece@dasher.wustl.edu Biophysics & Biochemistry, Box 8231 | WWW: http://dasher.wustl.edu/~reece/ Washington Univ. School of Medicine | Phone: (314) 362-4198 (lab) -7183 (fax) St. Louis, Missouri 63110 (USA) | PGP public key available by finger & WWW From owner-software@net.bio.net Sat Mar 02 22:00:00 1996 Path: biosci!agate!howland.reston.ans.net!gatech!newsfeed.internetmci.com!news.zeitgeist.net!bdt.com!usenet From: "R. Scott Jokerst" Newsgroups: bionet.software Subject: Biological Data Transport info Date: Sat, 02 Mar 1996 16:45:39 -0800 Organization: Biological Data Transport Lines: 30 Message-ID: <3138EBB3.1E81@data-transport.com> Reply-To: scott_jokerst@data-transport.com NNTP-Posting-Host: jokerst.dial-up.bdt.com Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 2.0 (Macintosh; I; PPC) CC: "R. Scott Jokerst" I wanted to let you know about a service we offer to the life sciences community on the Web. Our site is emerging as a great source for links to bioinformatics resources, company products and services information, etc. We're becoming more comprehensive daily. Our growth has been quite rapid. We're at: http://www.data-transport.com The entire collection of product, services, and public information links integrated within our system may be found by searching at our site. This allows you to FOCUS on just the information you need, reducing the effort needed to find what you want. The site is exceptionally fast, and we have a track record of being up virtually all of the time. Everything we offer at the site works, (we do not post services under construction) and we have more coming soon. We are eager to receive feedback from you regarding how well the site serves you, and what you would like to see to help you be more productive. Thanks ahead of time. It's worth a look, Scott (P.S. I have cross posted to other lists, wanting to get the info out to you.) -- R. Scott Jokerst Biological Data Transport scott_jokerst@data-transport.com 510-648-8229 http://www.data-transport.com 510-648-8279 (FAX) From owner-software@net.bio.net Sat Mar 02 22:00:00 1996 Path: biosci!agate!usenet.kornet.nm.kr!xpat.postech.ac.kr!news.kreonet.re.kr!news.dacom.co.kr!nntp.coast.net!howland.reston.ans.net!ix.netcom.com!netnews From: lpfrank@ix.netcom.com(Lawrence P. Frank ) Newsgroups: bionet.software Subject: statistics Date: 3 Mar 1996 01:07:22 GMT Organization: Netcom Lines: 3 Message-ID: <4harca$di7@cloner2.ix.netcom.com> NNTP-Posting-Host: ftl-fl3-11.ix.netcom.com X-NETCOM-Date: Sat Mar 02 5:07:22 PM PST 1996 can someone give me an address where i can find a statistical program for quantitative (sd, var, t-test, correlation, etc.) and qualitative analysis (ranking tests)? tahnks From owner-software@net.bio.net Sat Mar 02 22:00:00 1996 Path: biosci!bcm.tmc.edu!cs.utexas.edu!howland.reston.ans.net!newsfeed.internetmci.com!in1.uu.net!istar.net!news1.vancouver.istar.net!news.vancouver.istar.net!van-bc!unixg.ubc.ca!news.bc.net!rover.ucs.ualberta.ca!bart-iivx.glaxo.med.ualberta.ca!user From: jel-4@bones.biochem.ualberta.ca (Brian Taylor) Newsgroups: bionet.software Subject: Help. HLA-D typing software required Date: Sun, 03 Mar 1996 15:34:14 +0000 Organization: University of Alberta Lines: 19 Message-ID: NNTP-Posting-Host: bart-iivx.glaxo.med.ualberta.ca X-Newsreader: Value-Added NewsWatcher 2.0b24.0+ Hi, I'm about to become innundated with sequence data from multiple MS patient's HLA-DQ, DR exon 2, and am trying to track down some type of software that might tell me the separate haplotypes present if a patients is heterozygous for these regions (which results in dichromatic peaks from flourescent sequencing chemistries at the position of heterozygosity). Any help or suggestions would be appreciated. yours truly, mike craig Mike Craig Medical Microbiology and Immunology University of Alberta wrk.492 088 home 439 5943 email address jel-18@bones.biochem.ualberta.ca (try 1st) or mac4@gpu.srv.ualberta.ca From owner-software@net.bio.net Sat Mar 02 22:00:00 1996 Path: biosci!bcm.tmc.edu!cs.utexas.edu!howland.reston.ans.net!vixen.cso.uiuc.edu!newsfeed.internetmci.com!in2.uu.net!istar.net!news1.vancouver.istar.net!news.vancouver.istar.net!uniserve!van-bc!unixg.ubc.ca!news.bc.net!rover.ucs.ualberta.ca!bart-iivx.glaxo.med.ualberta.ca!user From: jel-4@bones.biochem.ualberta.ca (Brian Taylor) Newsgroups: bionet.software Subject: Help. HLA-D typing software required Date: Sun, 03 Mar 1996 15:40:32 +0000 Organization: University of Alberta Lines: 19 Message-ID: NNTP-Posting-Host: bart-iivx.glaxo.med.ualberta.ca X-Newsreader: Value-Added NewsWatcher 2.0b24.0+ Hi, I'm about to become innundated with sequence data from multiple MS patient's HLA-DQ, DR exon 2, and am trying to track down some type of software that might tell me the separate haplotypes present if a patients is heterozygous for these regions (which results in dichromatic peaks from flourescent sequencing chemistries at the position of heterozygosity). Any help or suggestions would be appreciated. yours truly, mike craig Mike Craig Medical Microbiology and Immunology University of Alberta wrk.492 088 home 439 5943 email address jel-18@bones.biochem.ualberta.ca (try 1st) or mac4@gpu.srv.ualberta.ca From owner-software@net.bio.net Sat Mar 02 22:00:00 1996 Path: biosci!agate!newsxfer2.itd.umich.edu!chi-news.cic.net!news.math.psu.edu!psuvax1!uwm.edu!vixen.cso.uiuc.edu!howland.reston.ans.net!nntp.crl.com!a102013.sfo2.as.crl.com!user From: sunger@a.crl.com (Stefan Unger) Newsgroups: bionet.software Subject: Re: Simulation of blood flow software Date: 3 Mar 1996 17:08:28 GMT Organization: BioSoftware Marketing Lines: 20 Message-ID: References: NNTP-Posting-Host: a102013.sfo2.as.crl.com Check The Store at www.bio.com (Netscape needed). There are two inexpensive programs that might be useful, Cardiovascular Simulation does "live animals" simulation, while CARDIOLAB emphasizes drug effects. Hope this helps. In article , s.fish@swansea.ac.uk wrote: > I am trying to help a student about to embark on a project for which > she needs a computer simulation of blood flow through the human body, > preferably one which she can manipulate. I'm not sure if such software > exists but would be very grateful for any information. -- Stefan Unger, Ph.D. BioSoftware Marketing 4151 Middlefield Rd, Ste 109 Palo Alto, CA 94303-4743 Full technical software marketing services; Product Manager, Scientific Software, Bio Online Store at www.bio.com From owner-software@net.bio.net Sat Mar 02 22:00:00 1996 Path: biosci!daresbury!yama.mcc.ac.uk!peer-news.britain.eu.net!warwick!news.wlv.ac.uk!usenet From: Sue Wade Newsgroups: bionet.software Subject: STUDENT NEEDS CHEAP COPY OF SAGE STERLING Date: 3 Mar 1996 11:50:06 GMT Organization: University Student Lines: 4 Message-ID: <4hc11e$ki5@ccuh.wlv.ac.uk> NNTP-Posting-Host: novix.bilston.ac.uk Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 1.22 (Windows; I; 16bit) Degree student desperatley needs cheap Sage Sterling Accounts package! Thanks From owner-software@net.bio.net Sat Mar 02 22:00:00 1996 Path: biosci!daresbury!yama.mcc.ac.uk!rimmer.acs.bolton.ac.uk!AP2 From: ap2@bolton.ac.uk Newsgroups: bionet.software Subject: Predator/Prey Simulation Date: 3 Mar 1996 22:51:14 GMT Organization: Bolton Institute of H.E. Lines: 11 Message-ID: <4hd7p2$7ob@yama.mcc.ac.uk> Reply-To: ap2@bolton.ac.uk NNTP-Posting-Host: rimmer.acs.bolton.ac.uk Does anyone know of a decent predator/prey simulation for the PC? Please reply direct to me or place a message up here. Thanks A.Prowse AP2@bolton.ac.uk Biology Department Bolton Institute Bolton UK From owner-software@net.bio.net Sun Mar 03 22:00:00 1996 Path: biosci!rutgers!csn!news-1.csn.net!ub!dsinc!netnews.upenn.edu!Lehigh.EDU!Lehigh.EDU!not-for-mail From: mjb1@Lehigh.EDU Newsgroups: bionet.software Subject: decompression on PC Date: 4 Mar 1996 13:34:02 -0500 Lines: 12 Message-ID: <4hfd2q$1cnk@ns3-1.CC.Lehigh.EDU> NNTP-Posting-Host: ns3-1.cc.lehigh.edu Folks- Can anyone point me to a utility that will decompress a UNIX-compressed file on a PC--operating under either DOS or Windows 3.1? I want to be able to decompress some GenBank files. Thanks. -------------------------------------------------------------- Michael J. Behe Phone: 610-758-3474 Department of Biological Sciences FAX: 610-758-4004 Iacocca Hall #111 Secretary: 610-758-3680 Lehigh University e-mail: mjb1@Lehigh.edu Bethlehem, PA 18015 From owner-software@net.bio.net Sun Mar 03 22:00:00 1996 Path: biosci!agate!howland.reston.ans.net!vixen.cso.uiuc.edu!uwm.edu!caen!news.umass.edu!nic.umass.edu!wilde.oit.umass.edu!not-for-mail From: trickett@wilde.oit.umass.edu (Adam J. Trickett) Newsgroups: bionet.software Subject: Re: Predator/Prey Simulation Date: 4 Mar 1996 14:08:25 GMT Organization: University of Massachusetts, Amherst Lines: 18 Message-ID: <4hetgp$g4e@nic.umass.edu> References: <4hd7p2$7ob@yama.mcc.ac.uk> NNTP-Posting-Host: oitunix.oit.umass.edu X-Newsreader: TIN [UNIX 1.3 950824BETA PL0] ap2@bolton.ac.uk wrote: : Does anyone know of a decent predator/prey simulation for : the PC? Please reply direct to me or place a message up here. : Thanks Try Populus by Don Alsted. This is a DOS suite of population simulations, and is freeware. I've used it when I was at Leeds, but as I'm not there any longer I can't tell you the anonymous FTP site. I'm sure someone else on the network knows it. If I can remember it or find out I'll email it to you. -- Adam J Trickett | Voice +1 (413) 545-1037 | Insert your Entomology UMass | Fax +1 (413) 545-2115 | silly phrase Amherst MA 01003 USA | email trickett@ent.umass.edu | or comment http://www.leeds.ac.uk/genetics/resear/butlin/ | here! From owner-software@net.bio.net Sun Mar 03 22:00:00 1996 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!sol.ctr.columbia.edu!news.mindlink.net!van-bc!unixg.ubc.ca!news.bc.net!rover.ucs.ualberta.ca!news From: David Frederiksen Newsgroups: bionet.software Subject: Re: MolPhy-2.2 Date: Mon, 04 Mar 1996 08:40:58 -0700 Organization: University of Alberta, Edmonton, Canada Lines: 43 Message-ID: <313B0F0A.14F2@compusmart.ab.ca> References: <199602260312.MAA07430@pepsi3.bekkoame.or.jp> Reply-To: davidf@compusmart.ab.ca NNTP-Posting-Host: async15-1.remote.ualberta.ca Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 2.0 (Macintosh; I; PPC) Kiyoshi Gotow wrote: > Please try the following commands: > > -Ijei > -Ijew > -Iji > -Ijw > > The command "j" which tells the program to apply the JTT model is not > always necessary, since it is the default setting. > > You can read the .EXA file by "SimpleText" or any other text editor. > > Good luck! > > Kiyoshi Gotow, Ph.D. > Department of Human Life and Culture > Junior College, Seitoku University > gotow@vir.bekkoame.or.jp Hello Kiyoshi, Thank you very much for the advice. I was able to get the maximum likelihood trees to work. Although, the exhuastive search was a bad idea on my part, for it took almost 3 days to complete the search and I ran into a memory problem when it finished. I eventually used the quick option to complete my trees. Now that I have results I am having a little trouble interpreting the results. On most of my searches I was given more than one tree as the most likely tree. There were two numbers that preceeded each one. What do these numbers represent? I am hoping that they are probability measures so i can accept or reject one of the trees with reasons other than beacaused they fit the theory I want. Also, I have noticed that when you run the distance calculation, njdist, it gives you a distance matrix. This doesn't not appear to fully scale the trees that protml produces, unlike the phylip dnaml package. I am not all together familiar with the long hand statistical clustering analysis that is used to come up with these results and I am unable to scale my trees properly. Can you suggest anything for scaling the trees that are produced in protml? Thank You For Your Time David Frederiksen From owner-software@net.bio.net Sun Mar 03 22:00:00 1996 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!elroy.jpl.nasa.gov!swrinde!newsfeed.internetmci.com!newsxfer2.itd.umich.edu!uunet!in1.uu.net!tank.news.pipex.net!pipex!warwick!bham!usenet From: s.m.williams.bcm@bham.ac.uk (Steve) Newsgroups: bionet.software Subject: Re: rasmol2.6 Date: Mon, 04 Mar 1996 11:34:13 GMT Organization: The University of Birmingham, UK. Lines: 33 Message-ID: <4helhl$7t7@sun4.bham.ac.uk> References: <31287AC9.41C6@bioch.ox.ac.uk> <4gf3lg$pp5@rs18.hrz.th-darmstadt.de> NNTP-Posting-Host: bcs177.bham.ac.uk X-Newsreader: Forte Free Agent 1.0.82 martin@tutor.oc.chemie.th-darmstadt.de (Martin Kroeker) wrote: >Isabelle Phan (phan@bioch.ox.ac.uk) wrote: >: Dear Rasmol users, >: Has anyone managed to get the help tool in the menu bar work? I can't >: get it to display anything, neither on SGIs nor SUN-SPARCs running X11 >: under UNIX. >As far as i can tell from a look at the source code, the help menu is not >connected to anything in the current version. My guess is that this will >change if and when a directory browser will be added, as the basic widget >code should be similar for both. >Martin >-- I think the current version is still a beta. Their are a couple of help files that can be down loaded and viewed with notepad. Steve \\\\ \\\\(o o) 8(o o)(_)Ooo ###########################################ooO##(_)###Ooo############ # # # E-Mail: S.M.WILLIAMS.BCM@bham.ac.uk # # # # WWW: http://sun1.bham.ac.uk/s.m.williams.bcm/home_page.html # # WWW: http://sun1.bham.ac.uk/s.m.williams.bcm/que/que_club.html # # # # Fax: (44)0121-414-7366 # # # ##################################################################### From owner-software@net.bio.net Sun Mar 03 22:00:00 1996 Path: biosci!bcm.tmc.edu!!istvanl From: istvanl@bcm.tmc.edu (Istvan Ladunga) Newsgroups: bionet.software Subject: FASTA-SWAP searches of a protein sequence against pattern databases Date: 4 Mar 1996 18:54:20 GMT Organization: Baylor College of Medicine Lines: 83 Sender: istvanl@ (Istvan Ladunga) Distribution: world Message-ID: <4hfe8s$854@gazette.bcm.tmc.edu> NNTP-Posting-Host: dot.imgen.bcm.tmc.edu Keywords: pattern, sequence database search, FASTA, multiple alignment, protein FASTA-SWAP and FASTA-PAT: Gene Function Identification by Searching Protein Queries against Pattern Databases For sequences unidentified by both BLAST and FASTA database searches, we have developed two new pattern tools called FASTA-SWAP and FASTA-PAT, that are modified versions of Bill Pearson's FASTA program. Here, unlike in profiles, we represent aligned positions as the presence or absence of amino acids. These tools are fundamentally different from the earlier FASTAPAT and BLASTPAT because we use our new binary representation, where each the one million possible aligned amino acid combinations are coded by a unique number. This code allows compact representation of any multiple alignment. Users can currently search 9 databases of multiple alignments: - EC, a database of multiple alignments of 15,000 sequences with known EC numbers (this is the database with the highest information content); - the Pattern Induced Multiple Alignment (PIMA) Pattern Database, a comprehensive multiple alignment database with 22,422 patterns as aligned using PIMA; - three EntrezClus10 databases, sequence clusters from the PIMA alignment databases with >= 10 sequences, aligned using PIMA, CLUSTALW or the MAP program; - PIR-ALN database; - BLOCKS database; - PRINTS database; and - FSSP, Families of Structurally Similar Proteins database. Searches can be performed using the Baylor College of Medicine (Houston, Texas) WWW Search Launcher: http://gc.bcm.tmc.edu:8088/search-launcher/launcher.html Searching a sequence against these database is performed using new log-odds scoring matrices (rapidly calculated "on the fly") utilizing the one million combinations. In contrast to standard scoring matrices like PAM or BLOSUM, these new pattern-based matrices distinguish between conserved and variable positions, increasing search sensitivity and selectivity. Generally we recommend the more precise but somewhat slower diagonal search + Smith-Waterman refinement as implemented in FASTA-SWAP. For queries longer than 1000 residues however, FASTA-PAT using hashing + Smith-Waterman refinement may be considerably faster. Searching a sequence against these database is performed using new log-odds scoring matrices (rapidly calculated "on the fly") utilizing the one million combinations. In contrast to standard scoring matrices like PAM or BLOSUM, these new pattern-based matrices distinguish between conserved and variable positions, increasing search sensitivity and selectivity. Generally we recommend the more precise but somewhat slower diagonal search + Smith-Waterman refinement as implemented in FASTA-SWAP. For queries longer than 1000 residues however, FASTA-PAT using hashing + Smith-Waterman refinement may be considerably faster. A more detailed description of these programs is available at our WWW pages: http://dot.imgen.bcm.tmc.edu:9331/seq-search/Help/fastpat.html _________________________________________________________________________ Steve (Istvan) Ladunga, Brent A. Wiese, and Randall F. Smith Human Genome Center, Department of Molecular and Human Genetics and Department of Cell Biology, Baylor College of Medicine, Houston, TX 77030, USA istvanl@bcm.tmc.edu; Phone: (713) 798 8089, FAX: (713) 798 5386 _________________________________________________________________________ From owner-software@net.bio.net Sun Mar 03 22:00:00 1996 Path: biosci!agate!howland.reston.ans.net!tank.news.pipex.net!pipex!uunet!in2.uu.net!mozz.unh.edu!usenet From: "Jeffrey A. Messer" Newsgroups: bionet.software Subject: Re: curve-fit software? Date: Mon, 04 Mar 1996 07:36:48 -0500 Organization: Biochemistry Department - University of New Hampshire Lines: 30 Message-ID: <313AE3E0.5B65@christa.unh.edu> References: <9603012316.AA13595@phinet.sbphrd.com> NNTP-Posting-Host: unheq1.unh.edu Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 2.0 (Win16; I) To: "Michael L. Doyle" Michael L. Doyle wrote: > > I am in search of a user friendly software program for curve-fitting and > plotting. Would like to fit with MULTIPLE independent variables > simultaneously. Would also like to be able to define parts of complex > functions on separate lines. > > Any advice? Thanks much. Microcal Software's Origin is probably what you are looking for. It has a large number of pre-defined fitting functions. You can also enter your own fitting functions without much problem, although it is rather slow. The latest version that I have used is 4.0. It is a 16-bit Windows program and runs comfortably on a dx2-66 with 8mb. A 32-bit version is due out soon, this may improve the speed of the user-defined fitting functions. They probably have a web site, but here is the Letter Head: Microcal Software, Inc. One Roundhouse Plaza Northhampton, MA 01060 USA (800)969-7720 Tel (413) 586-2013 Fax (413) 585-0126 -- Jeff Messer Department of Biochemistry - UNH Biological Science Center 46 College Road Durham, NH 03824-3544 From owner-software@net.bio.net Sun Mar 03 22:00:00 1996 Path: biosci!daresbury!nntp-trd.UNINETT.no!newsfeed.sunet.se!news00.sunet.se!sunic!news.sprintlink.net!cs.utexas.edu!natinst.com!news-relay.us.dell.com!swrinde!sgigate.sgi.com!enews.sgi.com!decwrl!tribune.usask.ca!rover.ucs.ualberta.ca!news.ucalgary.ca!acs5.acs.ucalgary.ca!kyhui From: kyhui@acs5.acs.ucalgary.ca (Kwok Yin Hui) Newsgroups: bionet.software Subject: Re: curve-fit software? Date: 4 Mar 1996 21:29:53 GMT Organization: The University of Calgary Lines: 26 Message-ID: <4hfnch$evs@ds2.acs.ucalgary.ca> References: <9603012316.AA13595@phinet.sbphrd.com> <313AE3E0.5B65@christa.unh.edu> NNTP-Posting-Host: kyhui@acs5.acs.ucalgary.ca X-Newsreader: TIN [version 1.2 PL2] Jeffrey A. Messer (jamesser@christa.unh.edu) wrote: : Microcal Software's Origin is probably what you are looking for. It has a : large number of pre-defined fitting functions. You can also enter your own : fitting functions without much problem, although it is rather slow. The : latest version that I have used is 4.0. It is a 16-bit Windows program and : runs comfortably on a dx2-66 with 8mb. A 32-bit version is due out soon, this : may improve the speed of the user-defined fitting functions. They probably I've been using Origin 4.0 for several months already and have found that there are strange limitations on its usage. The main problem I've been having is that it will crash when I put several plots in a project. The programmers said that this limitation will be altered in their next version. Another limitation I found was in programming macros in scripts: macros seem to only take up to 5 arguements and won't work with more. As for the issue of fitting several indep variables "simultaneously", if you mean fitting a dep var with an average of several indep vars (which wouldn't make sense to me), then I don't think that it will do it with a simple button/menu item - a single indep. However, if by "simulaneously" you mean taking any dep var and fit it was several different indep vars one at a time and plot them all on the same graph, then this is no problem with Origin. I find that one of the strong points of Origin is it's script/macro features that allow you to save time when analysing data. KYH. From owner-software@net.bio.net Mon Mar 04 22:00:00 1996 Path: biosci!rutgers!csn!news-1.csn.net!ub!newsstand.cit.cornell.edu!news.tc.cornell.edu!news.cac.psu.edu!news.math.psu.edu!chi-news.cic.net!vixen.cso.uiuc.edu!newsfeed.internetmci.com!in2.uu.net!brighton.openmarket.com!decwrl!tribune.usask.ca!canopus.cc.umanitoba.ca!frist From: frist@cc.umanitoba.ca (Brian Fristensky) Newsgroups: bionet.software Subject: XYLEM Database Tools - Version 1.8.1 Date: 4 Mar 1996 23:48:34 GMT Organization: University of Manitoba, Winnipeg, Manitoba, Canada Lines: 143 Message-ID: <4hfvgi$if3@canopus.cc.umanitoba.ca> NNTP-Posting-Host: bova.cc.umanitoba.ca -------------------------------------------------------------------- # # # # # ###### # # XYLEM # # # # # # ## ## ## # # ##### # ## # Database ## # # # # # # # # # # # # Tools # # # ###### ###### # # Fristensky, B. (1993) Feature expressions: creating and manipulating sequence datasets. Nucl. Acids Res. 21:5997-6003. --------------------------------------------------------------------- March 4, 1996 XYLEM 1.8.1 is now available by anonymous FTP in directory 'psgendb' at ftp.cc.umanitoba.ca or by WWW from http://home.cc.umanitoba.ca/~psgendb/. XYLEM is a package of tools designed to exploit the Unix environment to enable the user to identify, extract and manipulate data from major databases such as GenBank and PIR. Fundamental to the power of these programs is the ability to perform operations on groups of sequences, represented by names or accession numbers which function as virtual database subsets. The most powerful program is FEATURES, which uses the GETOB parser to evaluate GenBank/EMBL/DDBJ Features Table expressions, thereby extract features (eg. mRNA, sig_peptide, intron) from lists of entries. Additional programs perform operations such as translation or randomization of datasets, and formatting of multiply-aligned sequences for publication. XYLEM is compatible with the Fristensky Sequence Analysis Package, and the Pearson FASTA programs, and can be used from within the Genetic Data Environment (GDE) of Steven Smith. --------------------------------------------------------------------- Current XYLEM Version: 1.8.1 March 1, 1996 1. Remote execution of FETCH and FINDKEY can now be done on multiple servers, chosen in rotation, from job to job. 2. FINDKEY and FETCH now allow an arbitrary number of files in the GenBank EST division (gbest1, gbest2, gbest3...) --------------------------------------------------------------------------- Version: 1.8 February 13, 1996 1. FEATURES has been upgraded to work with 8-character accession numbers. --------------------------------------------------------------------------- Version: 1.7 January 27, 1996 1. The Expressed Sequence Tag division of GenBank is now distributed in two files, gbest1.seq and gbest2.seq. fetch.csh, findkey.csh and gbupdate have been modified to be able to work with the EST division so that this change is transparent to the user. 2. FINDKEY and FETCH now call cpu-intensive programs (eg. SPLITDB, GETLOC) using 'nice', which decreases the impact of these programs on system performance. 3. GETOB now recognizes GenBank NID lines. --------------------------------------------------------------------------- Version: 1.6 October 3, 1995 1. As of February 1996, GenBank and EMBL will begin assigning 8 character accession numbers to new entries. Old entries will retain their 6 character accession numbers. SPLITDB, FINDKEY, and UDS have been updated to comply with this change. All other programs should be unaffected. 2. uds.csh has been substantially revised. Previous versions would sometimes lose entries. 3. The file xylem/GDE/expfile.template has been updated with more accurate instructions for retrieval of sequences by expressions using the FEATURES program. 4. Documentation for FETCH, FINDKEY, GETOB, and SPLITDB has been updated. 5. Routines that automatically download GenBank and PIR by FTP (gbupdate and pirupdate) have been made a bit more reliable. 6. GETLOC has been updated to be able to use unsorted namefiles. 7. SPLITDB -c will compress leading blanks when creating .ano files. This saves ~ 9% of the space normally taken up by an annotation file. GETLOC and GETOB automatically uncompress these blanks, if they have been compressed. However, the .fnd file from FINDKEY will retrieve lines without uncompressing the blanks. The output is a little less elegant, but accomplishes the same thing. --------------------------------------------------------------------------- Version: 1.5 October 29, 1994 1. All XYLEM programs are now available as both the original Pascal source code as well as C code generated by p2c. The C code has been tested with the following compilers: compiler platform ------------------- cc Sun cc HP/UX gcc Sun gcc AIX 2. FETCH and FINDKEY can now access the STS division of GenBank, which was added with GenBank Release 85.0 The .GDEmenus entry for FINDKEY has been changed accordingly. 3. A bug has been fixed in FETCH that in some case would cause FETCH to fail when retrieving entries from VecBase. 4. The following modifications have been made to GETOB: 13 Oct 94 Initialize NUMN. Failure to initialize causes n's to be written to expression file for non-translated features. 13 Oct 94 MAXSEQ increased to 750,000 11 Sep 94 Added ability to handle single base_position as a location. 9 Sep 94 If codon_start=2,3, write n's to expression file, as is already done for outfile. 13 Apr 94 Literature citation in .msg file 2 Jan 94 add NCBI_GI field 25 Oct 93 Fixed bug in COMPLEMENT. Only complemented 3' most location in an expression of the form complement(join(L1,L2..Ln)) 5. PROT2NUC - new program, performs reverse translation of protein to DNA. =============================================================================== Brian Fristensky | Department of Plant Science | The optimist proclaims that we live in University of Manitoba | the best of all possible worlds. The Winnipeg, MB R3T 2N2 CANADA | pessimist fears that this is true. frist@cc.umanitoba.ca | Office phone: 204-474-6085 | James Branch Cabell (1879-1958) FAX: 204-261-5732 | http://home.cc.umanitoba.ca/~frist/ =============================================================================== From owner-software@net.bio.net Mon Mar 04 22:00:00 1996 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!newsfeed.internetmci.com!in2.uu.net!jaring.my!usenet From: carosch@pop.jaring.my (JustAsking) Newsgroups: bionet.software Subject: software for digitizers Date: Tue, 05 Mar 1996 20:34:35 GMT Organization: Unconfigured Lines: 25 Message-ID: <4hfrft$265@jaring.my> NNTP-Posting-Host: j12.brf10.jaring.my X-Newsreader: Forte Free Agent 1.0.82 I'm in a market research company. We have a requirement for a software that can work with a digitizer to do the following : We have a question type called line-scale with 2 extremes - eg. Excellent-------------------------------------------------------- Poor The respondent will mark on the line like this : Excellent ----------------------X--------------------------------Poor The software should be able to give the value of the length of the starting point to the ending point (the one marked by the respondent). The digitizer will be used to detect all these points. Minimum the software should be able to give the coordinates of the starting & ending point and allows for us to manipulate the scirpt to get the value. Appreciate if you can let me know if any software will be able to do this. Regards Rosalind From owner-software@net.bio.net Mon Mar 04 22:00:00 1996 Path: biosci!agate!howland.reston.ans.net!newsfeed.internetmci.com!usenet.eel.ufl.edu!cobia.gulf.net!willis.cis.uab.edu!news.lsu.edu!aurora.LaTech.edu!news.ttu.edu!newshost.lanl.gov!usenet From: Stefan Burde Newsgroups: bionet.software Subject: Re: Mac Gel Analysis Programs? Date: 29 Feb 1996 20:25:55 GMT Organization: Los Alamos National Laboratory Lines: 21 Message-ID: <4h524j$28u@newshost.lanl.gov> References: NNTP-Posting-Host: fish.lanl.gov Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 1.1N (Macintosh; I; 68K) To: peterseg@physlog-po.physlog.uiowa.edu X-URL: news:peterseg-2902961319180001@lender.physlog.uiowa.edu NIH Image is a multi-purpose image analysis package for Mac, and includes macros for electrophoresis gel analysis. It's available free from ftp://zippy.nimh.nih.gov/pub/nih-image/. Good Luck, Stefan /\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\ Stefan Burde Get out of the House!! Los Alamos National Laboratory __ \ / LS-5, M888 (*)\_\/ |_ Los Alamos, NM 87545 (*) /o Tel: 505.667.2780 ^ FAX: 505.665.3024 email: burde@lanl.gov www: http://fish.lanl.gov ________________________________________________________________________ From owner-software@net.bio.net Mon Mar 04 22:00:00 1996 Path: biosci!daresbury!bioftp.unibas.ch!infobiogen.fr!jussieu.fr!oleane!tank.news.pipex.net!pipex!newsfeed.internetmci.com!in1.uu.net!brighton.openmarket.com!decwrl!tribune.usask.ca!canopus.cc.umanitoba.ca!news From: "Paul C. Grimm MD" Newsgroups: bionet.software Subject: Mac/ Downloading into a window Date: 5 Mar 1996 16:16:22 GMT Organization: U. of Manitoba. Pediatric Nephrology Lines: 12 Message-ID: <4hhpcm$kh3@canopus.cc.umanitoba.ca> NNTP-Posting-Host: dyn3-245.cc.umanitoba.ca Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 1.12(Macintosh; I; 68K) X-URL: news:bionet.software#learn-0103960822530001@tench.microbiol.washington.edu Is there any shareware around that will capture text output scrolling into a window on a Mac? Our university library system uses a software package called OnLan Mac. Library searches are scrolled into a window. The 'print' command leads to many errors. I wish to capture the text file going to the window because it is error free. The shareware 'pictpocket' will capture a redrawn window but only the current contents. A library search would be extremely time consuming to take a 'shot' of every page. Any suggestions? Thakn you in advance Paul Grimm U of Manitoba. From owner-software@net.bio.net Mon Mar 04 22:00:00 1996 Path: biosci!bcm.tmc.edu!cs.utexas.edu!chi-news.cic.net!nntp.coast.net!howland.reston.ans.net!torn!newshost.uwo.ca!jkiernan.anatomy.uwo.ca!jkiernan From: jkiernan@julian.uwo.ca (J. A. Kiernan) Newsgroups: bionet.software Subject: Utilities for simple chemical calculations. New version. Date: Tue, 5 Mar 1996 14:34:43 GMT Organization: ITS, University of Western Ontario Lines: 65 Message-ID: NNTP-Posting-Host: jkiernan.anatomy.uwo.ca MOLWT Version 2.72 Updated utilities for chemical calculations Do you ever need to do a quick molecular weight calculation from a chemical formula, or want to know how many grams of Na2SO4.10H2O are in 100 ml of a 0.076M solution? You can use MW and SOLUTION, shareware programs, to get instant answers, even at the DOS command-line, and you can redirect the results to a printer or disk file. MOLWT272.ZIP contains utilities for simple chemical calculations There are already some excellent chemical calculation programs, including CHEMCALC and MOLARMAS. MOLWT is not as versatile as these, but it is much faster for what it does do, and it needs a lot less disk space. It will run on any computer that can use DOS. There isn't a Mac version. Color is used for emphasis, but the screens are legible on any kind of monitor. Available by anonymous ftp from: simtel.coast.net (and from other SimTel mirrors), in the /SimTel/msdos/chemstry directory: molwt272.zip (Note the spelling ^^^ of the directory name!) Also available from garbo.uwasa.fi in the /pc/science directory: molwt272.zip And from skynet.ul.ie in the /pub/science directory: molwt272.zip And from ftp.ebi.ac.uk in the pub/software/dos directory: molwt272.exe Dont forget to enter the "binary" command before downloading! The MOLWT272.ZIP archive contains 5 files: 1. MW.EXE calculates molecular weight from an entered chemical formula. Can be used at the DOS command line, or interactively. Use DOS redirection to send results to a comma-delimited ASCII file. You can build up a database of formulae and their moecular weights. 2. MW.DOC Explains what you do. (Gives more examples etc than the on-line help system of MW.EXE) 3. SOLUTION.EXE gives concentrations in various units in response to an entered formula and concentration. This new version is fully stand-alone, and does not use MW.EXE or make any temporary files. It can be used at the DOS command line, or interactively. DOS redirection sends (or appends) the results to an appropriately formatted text file. 4. SOLUTION.DOC Tells you all about it. (More detail than the self-documentation and help messages of SOLUTION.EXE) Note that DOS redirection of MW or SOLUTION does not prevent the display of results on the screen. These updated versions also have more unofficial symbol-like abbreviations (for radicals etc.) than the earlier shareware releases. They no longer end with messages asking you to pay. (The incentive to register is now the provision of extra utilities for those who pay.) 5. MOLWT.EXE is a self-executing documentation file, which can be read on screen or printed in whole or part. It tells you about the MW and SOLUTION programs, and also about some of the additional utility programs that are sent to users who pay the small "registration" fee. Comments and suggestions John A. Kiernan welcome! Department of Anatomy Univ. of Western Ontario LONDON, Canada N6A 5C1 e-mail: kiernan@uwo.ca From owner-software@net.bio.net Mon Mar 04 22:00:00 1996 Path: biosci!ns1.faseb.org!lamarck.sura.net!ra.nrl.navy.mil!news.math.psu.edu!chi-news.cic.net!newsfeed.internetmci.com!tank.news.pipex.net!pipex!dispatch.news.demon.net!demon!kovcomp.demon.co.uk From: Warren Kovach Newsgroups: bionet.software Subject: Re: Predator/Prey Simulation Date: Tue, 05 Mar 1996 10:28:12 +0000 Organization: Kovach Computing Services Lines: 22 Message-ID: References: <4hd7p2$7ob@yama.mcc.ac.uk> Reply-To: WarrenK@kovcomp.demon.co.uk NNTP-Posting-Host: kovcomp.demon.co.uk X-NNTP-Posting-Host: kovcomp.demon.co.uk X-Newsreader: Virtual Access by Ashmount Research Ltd, http://www.ashmount.com In article <4hd7p2$7ob@yama.mcc.ac.uk> on 3 Mar 1996 22:51:14 GMT ap2@bolton.ac.uk wrote: > > Does anyone know of a decent predator/prey simulation for > the PC? Please reply direct to me or place a message up here. > Thanks > > A.Prowse You might try my shareware program Wa-Tor for Windows. It's a simple predator/prey simulation based on a random model. You can get it from my web pages (URL below). Cheers, -- Dr. Warren L. Kovach Internet: WarrenK@kovcomp.demon.co.uk Kovach Computing Services tel./fax: +44-(0)1248-450414 85 Nant-y-Felin, Pentraeth, Anglesey CompuServe: 100016,2265 Wales LL75 8UY U.K. WWW: http://www.compulink.co.uk/~kovcomp/ From owner-software@net.bio.net Mon Mar 04 22:00:00 1996 Path: biosci!bcm.tmc.edu!news.tamu.edu!news From: mary@bio.tamu.edu (Mary ) Newsgroups: bionet.software Subject: Searching for DNA binding sites Date: 4 Mar 1996 23:37:12 GMT Organization: Texas A&M University Lines: 6 Sender: -Not-Authenticated-[7767] Message-ID: <4hfur8$fv@news.tamu.edu> NNTP-Posting-Host: adams-centris660av.tamu.edu X-Posted-From: InterNews 1.1@adams-centris660av.tamu.edu Xdisclaimer: No attempt was made to authenticate the sender's name. I would like to look for patterns/homologies within a 50 kb contiguous DNA sequence. I am looking for hints regarding a putative binding site. I don't have a very good idea what the site is but I can make some guesses. Can anyone tell me the best program for this purpose? Mary Fernandes From owner-software@net.bio.net Mon Mar 04 22:00:00 1996 Path: biosci!daresbury!bioftp.unibas.ch!news.vub.ac.be!news.belnet.be!news.rediris.es!scsing.switch.ch!swsbe6.switch.ch!swidir.switch.ch!nntp.coast.net!howland.reston.ans.net!vixen.cso.uiuc.edu!newsfeed.internetmci.com!news.intersurf.net!multiverse!ragnarok.oar.net!malgudi.oar.net!hyperion.wright.edu!news.wright.edu!nova.wright.edu!aarment From: aarment@nova.wright.edu (The doctor is IN.) Newsgroups: bionet.software Subject: software for finding DNA minor grooves? Date: 5 Mar 96 12:02:49 EST Organization: Wright State University Lines: 5 Message-ID: <1996Mar5.120249@nova.wright.edu> NNTP-Posting-Host: nova.wright.edu I am looking for software which will allow for searching a DNA sequence for major and minor grooves. Anything out there in public domain for either VAX/VMS or PC ???? Please send responses to aarment@desire.wright.edu Thanks! From owner-software@net.bio.net Mon Mar 04 22:00:00 1996 Path: biosci!ns1.faseb.org!lamarck.sura.net!newsfeed.internetmci.com!howland.reston.ans.net!nntp.coast.net!zombie.ncsc.mil!admaix.sunydutchess.edu!ub!dsinc!netnews.upenn.edu!shubinlab.sas.upenn.edu!user From: mbalsai@mail.sas.upenn.edu (Mike Balsai) Newsgroups: bionet.software Subject: Chemical symbol font(s) Date: Tue, 05 Mar 1996 19:14:41 +0000 Organization: UoP Lines: 5 Message-ID: NNTP-Posting-Host: shubinlab.sas.upenn.edu Does anyone know of font(s) that can be use to represent chemical symbology (especially organic and biochemical formulas)? For the Macintosh, of course. :-) Mike Balsai (use my e-mail address please) From owner-software@net.bio.net Mon Mar 04 22:00:00 1996 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!elroy.jpl.nasa.gov!swrinde!newsfeed.internetmci.com!in1.uu.net!van-bc!unixg.ubc.ca!news From: lance@neuro.pharmacology.ubc.ca (Lance Corey) Newsgroups: bionet.software Subject: Re: Free [Ca2++] in buffers Date: Tue, 05 Mar 1996 22:57:32 GMT Organization: University of British Columbia Lines: 28 Message-ID: <4hih16$e3o@nntp.ucs.ubc.ca> References: <4hhpcm$kh3@canopus.cc.umanitoba.ca> Reply-To: lance@neuro.pharmacology.ubc.ca NNTP-Posting-Host: alpha.pharmacology.ubc.ca X-Newsreader: Forte Free Agent 1.0.82 Write a note to cpatton@leland.stanford.edu. He wrote the program Max Chealator. From Jaume Canaves wrote: > Does anybody know (or have) a program to calculate the concentration >of free calcium in a solution that contains one or several kinds >of calcium-binding molecules (EGTA, proteins, etc)?. I have seen a README >file that describes such a program in several ftp locations, but I have >been unable to locate either the executable program or the source code. >Any insight about such program or any other options will be very welcome... >Thanks! > >--------------------------------------------------------------------------- > Jaume M. Canaves i Vives _ EVOLUTION ___ > UCSD - Biology (0366) /_\ Y TAKES (0,0) > 9500 Gilman Dr. 7 // \\ ( ) N O < . > > La Jolla, California 92093 \\_// \\_// PRISONERS --"-"-- >---------------------------------------------------------------------------- Lance Corey Also searching for the family names B A L L, B O W E N, B R A Y, C O R E Y, H U M P H R I E S, H U M P H R E Y, I V E S, R E A D From owner-software@net.bio.net Mon Mar 04 22:00:00 1996 Path: biosci!BACATA.USC.UNAL.EDU.CO!agarcia From: agarcia@BACATA.USC.UNAL.EDU.CO (Alexander Garcia) Newsgroups: bionet.software Subject: internet yellow pages? Date: 5 Mar 1996 14:38:38 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 5 Sender: daemon@net.bio.net Distribution: world Message-ID: NNTP-Posting-Host: net.bio.net is there any kind of Internet yellow pages for health sciences? I sow something on the net, but I do not remember where, it was about the second edition of a book, and they had the fi first edition available and free on the Internet, does any of you know something about it? thanks a lot. bye. From owner-software@net.bio.net Mon Mar 04 22:00:00 1996 Path: biosci!daresbury!bioftp.unibas.ch!infobiogen.fr!jussieu.fr!oleane!tank.news.pipex.net!pipex!swrinde!newsfeed.internetmci.com!in2.uu.net!brighton.openmarket.com!decwrl!tribune.usask.ca!canopus.cc.umanitoba.ca!frist From: frist@cc.umanitoba.ca (Brian Fristensky) Newsgroups: bionet.software Subject: XYLEM Database Tools - User Survey Date: 4 Mar 1996 23:51:26 GMT Organization: University of Manitoba, Winnipeg, Manitoba, Canada Lines: 105 Message-ID: <4hfvlu$ifm@canopus.cc.umanitoba.ca> NNTP-Posting-Host: bova.cc.umanitoba.ca -------------------------------------------------------------------- # # # # # ###### # # XYLEM # # # # # # ## ## ## # # ##### # ## # Database ## # # # # # # # # # # # # Tools # # # ###### ###### # # Fristensky, B. (1993) Feature expressions: creating and manipulating sequence datasets. Nucl. Acids Res. 21:5997-6003. --------------------------------------------------------------------- March 4, 1996 U S E R S U R V E Y I encourage XYLEM users to spend a few minutes filling out the attached survey to help me in planning future implementations of XYLEM. ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Name: Mailing Address: Phone: Electronic Mail Address: ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 1. PLATFORM [ ]Sun [ ]IBM/AIX [ ]HP9000 [ ]Other (specify): If you have compiled XYLEM locally, which compiler have you used? 2. USAGE [ ] personal [ ] multiuser [ ] check if you administer multiuser version of XYLEM for other users 3. How do you run XYLEM? [ ] commmand line [ ] GDE [ ] other front end (specify): 4. Which programs have you used? [ ] FETCH [ ] FINDKEY [ ] FEATURES [ ] SPLITDB [ ] REFORM [ ] RIBOSOME [ ] SHUFFLE [ ] UDS [ ] PROT2NUC [ ] DBSTAT Only check these if you have run them independently on the command line (ie. not called from FETCH, FEATURES or FINDKEY) [ ] GETLOC [ ] GETOB [ ] IDENTIFY 5. Do you use FETCH and FINDKEY [ ] with a XYLEM-formatted version of GenBank? [ ] with a XYLEM-formatted version of PIR? [ ] to manage personal database subsets? 6. Do you use FEATURES to call another sequence retrieval program besides FETCH? [ ] yes [ ] no If yes, which program is called? 7. Are you using the remote execution capabilities of FETCH & FINDKEY? [ ] yes [ ] no 8. What aspects of XYLEM do you most like? 9. What aspects of XYLEM are most troublesome? 10. What additional capabilities would you like to see in XYLEM? 11. Other comments Please send your completed form to: frist@cc.umanitoba.ca =============================================================================== Brian Fristensky | Department of Plant Science | The optimist proclaims that we live in University of Manitoba | the best of all possible worlds. The Winnipeg, MB R3T 2N2 CANADA | pessimist fears that this is true. frist@cc.umanitoba.ca | Office phone: 204-474-6085 | James Branch Cabell (1879-1958) FAX: 204-261-5732 | http://home.cc.umanitoba.ca/~frist/ =============================================================================== From owner-software@net.bio.net Mon Mar 04 22:00:00 1996 Path: biosci!bcm.tmc.edu!pendragon!news.msfc.nasa.gov!elroy.jpl.nasa.gov!swrinde!howland.reston.ans.net!nntp.coast.net!fu-berlin.de!cs.tu-berlin.de!uni-erlangen.de!winx03!wpxx02.toxi.uni-wuerzburg.de!not-for-mail From: krasel@wpxx02.toxi.uni-wuerzburg.de (Cornelius Krasel) Newsgroups: bionet.software Subject: Re: decompression on PC Date: 5 Mar 1996 18:52:04 GMT Organization: University of Wuerzburg, Germany Lines: 17 Message-ID: <4hi2gk$tdg@winx03.informatik.uni-wuerzburg.de> References: <4hfd2q$1cnk@ns3-1.CC.Lehigh.EDU> NNTP-Posting-Host: wpxx02.toxi.uni-wuerzburg.de X-Newsreader: TIN [UNIX 1.3 950824BETA PL0] mjb1@Lehigh.EDU wrote: > Can anyone point me to a utility that will decompress a UNIX-compressed > file on a PC--operating under either DOS or Windows 3.1? I want to be able to > decompress some GenBank files. Thanks. Look at your nearest SimTel mirror for files called /msdos/compress/comp430d.zip /msdos/compress/comp430s.zip /msdos/compress/decomp2.zip --Cornelius. -- /* Cornelius Krasel, U Wuerzburg, Dept. of Pharmacology, Versbacher Str. 9 */ /* D-97078 Wuerzburg, Germany email: phak004@rzbox.uni-wuerzburg.de SP3 */ /* "Science is the game we play with God to find out what His rules are." */ From owner-software@net.bio.net Mon Mar 04 22:00:00 1996 Path: biosci!ihnp4.ucsd.edu!sdcc12.ucsd.edu!jeeves.ucsd.edu!jcanaves From: From Jaume Canaves Newsgroups: bionet.software Subject: Free [Ca2++] in buffers Date: Tue, 5 Mar 1996 12:30:03 -0800 Organization: University of California, San Diego Lines: 19 Message-ID: References: <4hhpcm$kh3@canopus.cc.umanitoba.ca> NNTP-Posting-Host: jeeves.ucsd.edu Mime-Version: 1.0 Content-Type: TEXT/PLAIN; charset=US-ASCII In-Reply-To: <4hhpcm$kh3@canopus.cc.umanitoba.ca> Hi! Does anybody know (or have) a program to calculate the concentration of free calcium in a solution that contains one or several kinds of calcium-binding molecules (EGTA, proteins, etc)?. I have seen a README file that describes such a program in several ftp locations, but I have been unable to locate either the executable program or the source code. Any insight about such program or any other options will be very welcome... Thanks! --------------------------------------------------------------------------- Jaume M. Canaves i Vives _ EVOLUTION ___ UCSD - Biology (0366) /_\ Y TAKES (0,0) 9500 Gilman Dr. 7 // \\ ( ) N O < . > La Jolla, California 92093 \\_// \\_// PRISONERS --"-"-- ---------------------------------------------------------------------------- From owner-software@net.bio.net Mon Mar 04 22:00:00 1996 Path: biosci!hgmp.mrc.ac.uk!glee From: glee@hgmp.mrc.ac.uk (Mr. G Lee) Newsgroups: bionet.software Subject: QUADRA 650 Date: 4 Mar 1996 21:43:05 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 4 Sender: daemon@net.bio.net Distribution: world Message-ID: <4hf6pp$ptj@mserv1.dl.ac.uk> NNTP-Posting-Host: net.bio.net Our lab is looking to purchase a 2nd hand quadra 650 for use with a perkin elmer 373 sequencer, if any one knows where it is posible to get one i would be much appreciative if you could pass on the information , or if you ha contact me. at glee@hgmp.mrc.ac.uk From owner-software@net.bio.net Mon Mar 04 22:00:00 1996 Path: biosci!bcm.tmc.edu!pendragon!news.msfc.nasa.gov!elroy.jpl.nasa.gov!swrinde!howland.reston.ans.net!surfnet.nl!sun4nl!uva.nl!amc!ka2-05.amc.uva.nl!user From: a337ard@horus.sara.nl (ard jonker) Newsgroups: bionet.software Subject: Re: curve-fit software? Date: Tue, 05 Mar 1996 19:38:41 +0100 Organization: University of Amsterdam (fac. med.) Lines: 26 Message-ID: References: <9603012316.AA13595@phinet.sbphrd.com> <313AE3E0.5B65@christa.unh.edu> <4hfnch$evs@ds2.acs.ucalgary.ca> NNTP-Posting-Host: ka2-05.amc.uva.nl In article <4hfnch$evs@ds2.acs.ucalgary.ca>, kyhui@acs5.acs.ucalgary.ca (Kwok Yin Hui) wrote: > Jeffrey A. Messer (jamesser@christa.unh.edu) wrote: > > : Microcal Software's Origin is probably what you are looking for. It has a > : large number of pre-defined fitting functions. You can also enter your own > : fitting functions without much problem, although it is rather slow. The > : latest version that I have used is 4.0. It is a 16-bit Windows program and > : runs comfortably on a dx2-66 with 8mb. A 32-bit version is due out soon, this > : may improve the speed of the user-defined fitting functions. They probably > > I've been using Origin 4.0 for several months already and have found that > there are strange limitations on its usage. The main problem I've been > having is that it will crash when I put several plots in a project. The > programmers said that this limitation will be altered in their next > version. While waiting for the updates, you might have a try with mac curve fit, shareware by Kevin Raner. That (current v1.2.2) does multiple simultaneous fits of any function you throw at it. A function can have up to 8 arguments and you can specify the function by just typing it in the function window. As it sais: _mac_ curve fit. Requires system 7 and runs happily with 512 KB of free memory. ard From owner-software@net.bio.net Mon Mar 04 22:00:00 1996 Path: biosci!sloc.net!cweiser From: cweiser@sloc.net (Craig Weiser) Newsgroups: bionet.software Subject: protein prediction and Computers Date: 4 Mar 1996 21:47:38 -0800 Organization: Student Lines: 3 Sender: daemon@net.bio.net Distribution: world Message-ID: NNTP-Posting-Host: net.bio.net Does anyone know a good secondary structure predictor, which can run on the machintosh? From owner-software@net.bio.net Tue Mar 05 22:00:00 1996 Path: biosci!agate!howland.reston.ans.net!nntp.coast.net!zombie.ncsc.mil!cs.umd.edu!haven.umd.edu!purdue!mozo.cc.purdue.edu!biomac7i.bio.purdue.edu!user From: pmeunier@bilbo.bio.purdue.edu (Pascal Meunier) Newsgroups: bionet.software Subject: [Ann] Mac freeware for photosynthesis Date: Tue, 05 Mar 1996 19:27:12 -0500 Organization: Purdue University Lines: 24 Message-ID: NNTP-Posting-Host: biomac7i.bio.purdue.edu X-Newsreader: Yet Another NewsWatcher 2.0.3b0 At http://bilbo.bio.purdue.edu/~pmeunier/download.html you will find: -Chlorophyll 1.0.1 (154K): An implementation of a few chlorophyll (and phycobilisome) determination methods for cyanobacteria, algae and higher plants. It speeds up routine calculations and reminds you of the correct wavelengths depending on the solvent you use for the extraction. -S-States 1.0 (121K): This program simulates the water-splitting mechanism of PSII (the S-state mechanism). The results are the amplitudes of oxygen yields under flashing light. Two models are available: the Kok model extended to a 6-step mechanism, and my photoactivation model (accepted for publication in Photosynthesis Research). They are unlikely to be useful to you unless you are working with plants or in the general area of photosynthesis. Regards, Pascal Meunier From owner-software@net.bio.net Tue Mar 05 22:00:00 1996 Path: biosci!CS.Arizona.EDU!news.Arizona.EDU!ennfs.eas.asu.edu!gatech!newsfeed.internetmci.com!in2.uu.net!mozz.unh.edu!usenet From: "Jeffrey A. Messer" Newsgroups: bionet.software Subject: Re: protein prediction and Computers Date: Tue, 05 Mar 1996 16:28:22 -0500 Organization: Biochemistry Department - University of New Hampshire Lines: 24 Message-ID: <313CB1F6.38A6@christa.unh.edu> References: NNTP-Posting-Host: unheq1.unh.edu Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 2.0 (Win16; I) To: Craig Weiser Craig Weiser wrote: > > Does anyone know a good secondary structure predictor, which can run on > the machintosh? I don't know of a program that can do this on a mac, but the following URL has links to many secondary structure prediction pages that let you enter a amino acid sequence and return the conforamtional prediction to you via e-mail. http://dot.imgen.bcm.tmc.edu:9331/seq-search/struc-predict.html These programs are running on MainFrames that can probably do the calculations and return the results via e-mail quicker than a mac could do it locally. I also came across a site that would return the secondary structure prediction in a .pdb file wich you can view with RasMol or the like. Unfortunately I don't remember the URL. Does anyone have any more info on this site? -- Jeff Messer Department of Biochemistry - UNH Biological Science Center 46 College Road Durham, NH 03824-3544 From owner-software@net.bio.net Tue Mar 05 22:00:00 1996 Path: biosci!daresbury!yama.mcc.ac.uk!peer-news.britain.eu.net!warwick!bham!bhamcs!news.ox.ac.uk!oxpath!rhubner From: rhubner@molbiol.ox.ac.uk Newsgroups: bionet.software Subject: adapter design and duplex energy values (comp)... Date: 5 Mar 96 10:59:57 GMT Organization: Oxford University Molecular Biology Data Centre Lines: 33 Message-ID: <1996Mar5.105957@molbiol.ox.ac.uk> NNTP-Posting-Host: ania.path.ox.ac.uk hello friends ;-) I'm in the process of designing an oligonucleotide pair to get an adapter with 4bp-overhangs on each end... I have a designed a couple of oligos with the desired ends and got kcal/mol values for each 13-mer from primer analysis software... There is a stable dimer of 6 bp (plus one base further another single base match) with -10.3 kcal/mol and because one overhang is for NotI RE the GGCC 3'-dimer has also a high value of -9.3 kcal/mol... In order to get an idea about the value for the desired 9 bp dimer I used the program FoldRNA in GCG with the seq written from 5' -> 3' and a stretch of "N" inserted in between... I had seen something like this in a Biotechniques article a few years ago where 10 NNNNNNNNNN had been used to make a circular [RNA] molecule to check out for primer dimers... The obtained value was -12.3 kcal/mol... however, the value increases when I reduce the number of Ns and is for instance -13.6 kcal/mol if 6 are inserted instead of 10... if 50 Ns are inserted it can be about -9 kcal/mol... and if no Ns are inserted [ hence 4 base overhang loops directly back onto stem!] I read -12.0 kcal/mol... Well, now I don't know which [if any] of those approximations I can accept... and I would be indeed very grateful, if somebody could let me know how I could calculate a suitable value... I suspect that during slow cooling of the heated oli mixture the designed molecule should perform properly even if a slight risk remains for those +6 bp stretches versus the "full-length" 9 bp duplex with 4-base overhangs... Thank you very much for any insights - I highly appreciate! Have a nice time, Roland From owner-software@net.bio.net Tue Mar 05 22:00:00 1996 Path: biosci!ns1.faseb.org!lamarck.sura.net!ra.nrl.navy.mil!news.math.psu.edu!chi-news.cic.net!vixen.cso.uiuc.edu!newsfeed.internetmci.com!in1.uu.net!nntp.inet.fi!news.funet.fi!news.helsinki.fi!myntti!stenberg From: stenberg@cc.Helsinki.FI (Dag Stenberg) Newsgroups: bionet.software Subject: HPLC analysis software Date: 6 Mar 1996 18:20:25 GMT Organization: University of Helsinki Lines: 26 Message-ID: <4hkl19$k3a@oravannahka.Helsinki.FI> NNTP-Posting-Host: myntti.helsinki.fi Mime-Version: 1.0 Content-Type: text/plain; charset=ISO-8859-1 Content-Transfer-Encoding: 8bit X-Newsreader: TIN [version 1.2 PL0] We are equipped with a 1-channel Merck-Hitachi integrator for HPLC analysis, and would like to change to computer recording and analysis. However, we are not well funded. We do not need instrument control, thus $5000-$6000 for a setup that can control all the different pumps in the world are unnecessarily expensive. I have seen analysis software for about $3000 including an AD board. Several AD boards lie unused around my lab. So my question is: can anybody point me to a program which can record, store to disk, analyze for peaks (by cursor control if necessary) and calculate data from 2 to 4 channels from one or two instruments, using a standard AD board like DT2801, PCL7815 or similar? Dag Stenberg ------------------------------------------------------------------ Dag Stenberg MD PhD stenberg@cc.helsinki.fi Institute of Biomedicine tel: int.+358-0-1918532 Department of Physiology fax: int.+358-0-1918681 P.O.Box 9 (Siltavuorenpenger 20 J) tlx: 1002125 finuh sf FIN-00014 University of Helsinki,Finland X.400: /C=FI/A=FUMAIL/P=INET/O=HELSINKI/OU=CC/S=STENBERG/ ------------------------------------------------------------------ From owner-software@net.bio.net Tue Mar 05 22:00:00 1996 Path: biosci!data-transport.com!scott_jokerst From: scott_jokerst@data-transport.com (R. Scott Jokerst) Newsgroups: bionet.software Subject: Re: internet yellow pages? Date: 5 Mar 1996 22:32:59 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 26 Sender: daemon@net.bio.net Distribution: world Message-ID: NNTP-Posting-Host: net.bio.net Hello Alexander, Try Biological Data Transport, at http://www.data-transport.com If you like the site, please recommend it to your friends and to the list. Since I am affiliated with the service, BIOSCI guidelines prefer me to avoid announcing the service to the list. Good luck, Scott ************** At 2:38 PM 3/5/96, Alexander Garcia wrote: >is there any kind of Internet yellow pages for health sciences? I sow >something on the net, but I do not remember where, it was about the >second edition of a book, and they had the fi first edition available and >free on the Internet, does any of you know something about it? thanks a >lot. bye. ---> R. Scott Jokerst scott_jokerst@data-transport.com ---> ---> Biological Data Transport http://www.data-transport.com ---> ---> 510-648-8229 510-648-8279 (FAX) ---> From owner-software@net.bio.net Tue Mar 05 22:00:00 1996 Path: biosci!agate!newsxfer2.itd.umich.edu!newsfeed.internetmci.com!swrinde!howland.reston.ans.net!surfnet.nl!sun4nl!uva.nl!amc!ka2-05.amc.uva.nl!user From: a337ard@horus.sara.nl (ard jonker) Newsgroups: bionet.software Subject: Re: software for digitizers Date: Wed, 06 Mar 1996 15:27:06 +0100 Organization: University of Amsterdam (fac. med.) Lines: 39 Message-ID: References: <4hfrft$265@jaring.my> NNTP-Posting-Host: ka2-05.amc.uva.nl It might sound like a panacee and it might be a bit of overkill, but NIH-Image can do this I believe, with just the mouse. If you explicidly want to use a digitiser, as long as it is a macintosh digitiser, you can use the digitiser as mouse and start reading this message again. NIH can do macro programming alike Pascal,and is specialised in image processing (length, area, perimeter etc) so this should be a piece of cake. It is freely available from zippy.nimh.nih.gov in the pub/image directory it runs on a macintosh with system 7 or better ard In article <4hfrft$265@jaring.my>, carosch@pop.jaring.my (JustAsking) wrote: > I'm in a market research company. We have a requirement for a > software that can work with a digitizer to do the following : > > We have a question type called line-scale with 2 extremes - eg. > > Excellent-------------------------------------------------------- Poor > > The respondent will mark on the line like this : > > Excellent ----------------------X--------------------------------Poor > > > The software should be able to give the value of the length of the > starting point to the ending point (the one marked by the respondent). > The digitizer will be used to detect all these points. Minimum the > software should be able to give the coordinates of the starting & > ending point and allows for us to manipulate the scirpt to get the > value. > > Appreciate if you can let me know if any software will be able to do > this. > > Regards > Rosalind From owner-software@net.bio.net Tue Mar 05 22:00:00 1996 Path: biosci!CS.Arizona.EDU!noao!ennfs.eas.asu.edu!gatech!newsfeed.internetmci.com!howland.reston.ans.net!nntp.coast.net!fu-berlin.de!news.dfn.de!news.gwdg.de!news From: "Jan T. Kim" Newsgroups: bionet.software Subject: Wanted: Simple alignment software for education Date: Wed, 06 Mar 1996 16:47:23 +0100 Organization: Max-Planck-Inst. fuer Zuechtungsforschung, Koeln Lines: 24 Message-ID: <313DB38B.41C6@mpiz-koeln.mpg.de> NNTP-Posting-Host: violet.mpiz-koeln.mpg.de Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 2.0 (X11; I; OSF1 V3.0 alpha) Dear all, I am looking for alignment programs for educational purposes. The software should not be too sophisticated and loaded with features. Rather, we look for programs that produce an alignment out of two input sequences in a way which is as transparent to the user as possible, i.e. the scoring matrix should be made clear etc. It would be ideal if the program produced some sort of display of the process of constructing the path matrix, tracking the path etc. I have looked at my favorite ftp servers for molbio software, but it seems that they specialize in software for research rather than for teaching. I'd appreciate any info. Many thanx in advance. Kind regards, Jan T. Kim -- +- Jan Kim -- X.400: S=kim;OU=violet;O=mpiz-koeln;P=mpg;C=de -----+ | Internet: kim@mpiz-koeln.mpg.de | | WWW: http://www.mpiz-koeln.mpg.de/~kim/kim.html | *-----=< hierarchical systems are for files, not for humans >=-----* From owner-software@net.bio.net Tue Mar 05 22:00:00 1996 Path: biosci!rutgers!gatech!newsfeed.internetmci.com!howland.reston.ans.net!ix.netcom.com!netnews From: lmarsgo@ix.netcom.com(LEONARD MARSHALL) Newsgroups: Sci.image.processing,bionet.software Subject: Instant Video Database has many applications for capturing live images Date: 6 Mar 1996 06:02:13 GMT Organization: Netcom Lines: 45 Message-ID: <4hj9p5$mvc@cloner3.netcom.com> NNTP-Posting-Host: lax-ca24-07.ix.netcom.com X-NETCOM-Date: Tue Mar 05 10:02:13 PM PST 1996 Subject: Need testers for new video database software for frame grabbers & digital cam If your are interested it making it easier and faster to capture images please give us your possible apllications VIDEO DATABASE REPLACES INSTANT CAMERAS Marshall Optical Systems, Culver City, CA. Is introducing: Snap & Pop(tm) a Video Database that allows pictures from a live video camera to be snapped directly into database text records without having to save file names or minipulate the image.... Just Focus - Snap and the picture becomes a perminate record in the data base. RETAILERS, DISTRIBUTORS, MANUFACTURERS can now catalog their whole quality control operation, inventory or engineering designs with high quality photos without any cost for film or prints.------Slide shows or catalogs can be made from the database by just using a search of the required items and selecting a user defined form. Equipment required: 486 PC with 4 mb ram, vesa driver, frame grabber or digital serial port camera. Demo discs will be availble for manufacturers of digital cameras, computers and frame grabbers that wish to bundle the product. The underlying technology is using a client/server database developed by Bob Byers (JPL, AshtonTate)& Gary Balesin (JPL, Supercalc). They are currently developing large scale applications for archiving documents and photos for industrial and government applications. Pricing: 149.00 Software Only 299.00 Frame grabber with Snap & Pop for any NTSC camera 349.00 WinCAM 640 X480 color Digital Camera w Snap & Pop Contact Nathan Mordukhay Lmarsgo@ix.netcom.com Marshall Optical Systems is a division of Marshall Electronics Inc. From owner-software@net.bio.net Tue Mar 05 22:00:00 1996 Path: biosci!daresbury!bioftp.unibas.ch!news.vub.ac.be!usenet From: FAHMY Thierry Newsgroups: bionet.software Subject: slSTAT software Date: 6 Mar 1996 19:32:05 GMT Organization: Brussels Free Universities VUB/ULB Lines: 13 Message-ID: <4hkp7l$dou@rc1.vub.ac.be> NNTP-Posting-Host: gmma-pc6.ulb.ac.be Mime-Version: 1.0 Content-Type: text/plain; charset=iso-8859-1 Content-Transfer-Encoding: 8bit X-Mailer: Mozilla 1.22 (Windows; I; 16bit) Bonjour, Un mot très rapide pour vous signaler l'existence d'un nouveau logiciel de statistiques destiné aux étudiants et aux professionnels. Ce logiciel fonctionne avec Excel5.0. voir le site http://seine.inapg.inra.fr/~fahmy pour plus de renseignements T.F From owner-software@net.bio.net Tue Mar 05 22:00:00 1996 Path: biosci!daresbury!nntp-trd.UNINETT.no!nntp.uio.no!news.cais.net!nntp.coast.net!howland.reston.ans.net!usc!usenet From: Newsgroups: bionet.software,bionet.software.gcg Subject: CEPH Genotype software Date: 6 Mar 1996 20:41:13 GMT Organization: USC, LA Lines: 13 Sender: svincent@chup.usc.edu Message-ID: <4hkt99$cni@usc.edu> NNTP-Posting-Host: chup.usc.edu Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: quoted-printable X-Mailer: Mozilla 1.1N (Macintosh; I; PPC) X-URL: news:bionet.software Xref: biosci bionet.software:14896 bionet.software.gcg:1691 Hello. I am using the CEPH UIS and database software for genptypes on for the IBM PC.=01 I am trying to find out if there is a method by which I could find out the sex specific lod scores. The lod scores generated by the software are not. If anyone is using this software, and has information on this, I would certainly appreciate some help. Thanks Vince (sysadm@molbio.usc.edu) From owner-software@net.bio.net Tue Mar 05 22:00:00 1996 Path: biosci!ns1.faseb.org!lamarck.sura.net!ra.nrl.navy.mil!news.math.psu.edu!chi-news.cic.net!nntp.coast.net!howland.reston.ans.net!surfnet.nl!swsbe6.switch.ch!scsing.switch.ch!news.rediris.es!sanson.dit.upm.es!news.ucm.es!eucmax!alues104 Newsgroups: bionet.software Subject: Tai Pan virus Message-ID: <1996Mar6.140305@eucmax> From: alues104@eucmax.sim.ucm.es Date: 6 Mar 96 14:03:05 GMT Organization: Universidad Complutense de Madrid Nntp-Posting-Host: eucmax.sim.ucm.es Lines: 4 Do you know Tai Pan virus? What effects does it has in the computer? From owner-software@net.bio.net Wed Mar 06 22:00:00 1996 Path: biosci!ihnp4.ucsd.edu!munnari.OZ.AU!news.mel.connect.com.au!news.syd.connect.com.au!cafu.fl.net.au!leo.fl.net.au!user From: leo@adi.com.au (Leo Possajennikov) Newsgroups: bionet.software Subject: Re: Mac/ Downloading into a window Date: Thu, 07 Mar 1996 22:15:40 +1100 Organization: ADInstruments Lines: 45 Message-ID: References: <4hhpcm$kh3@canopus.cc.umanitoba.ca> NNTP-Posting-Host: leo.fl.net.au In article <4hhpcm$kh3@canopus.cc.umanitoba.ca>, "Paul C. Grimm MD" wrote: > Is there any shareware around that will capture text output scrolling into a window on a > Mac? > Our university library system uses a software package called OnLan Mac. Library > searches are scrolled into a window. The 'print' command leads to many errors. I wish to > capture the text file going to the window because it is error free. The shareware > 'pictpocket' will capture a redrawn window but only the current contents. A library > search would be extremely time consuming to take a 'shot' of every page. > Any suggestions? You can try Print2Pict shareware ($10). From 'ReadMe' file: : This is version 3.4 of Print2Pict. It is a printer driver that previews and saves printed pages to PICT files or the :clipboard. [snip] : - Use of extensions to add new functionality: Print to MacPaint file, Print to PICS format, Print to text format, :and Print to whatever you dream of if you can write C or Pascal. [snip] : All available Print2Pict extensions are listed as well. You must find with this copy of Print2Pict: : - Text File: Extracts the text from the pages and writes to a text file. : - Print to PICS: Creates a PICS file. : - PostCard: Creates a standalone application from your document. : - Print to Paint: Creates MacPaint files. : - Print to Scrap: Creates ScrapBook files. : - Remote: Sends the pictures to remote applications. : - Pixmap: Creates a PICT file containing a pixmap. [snip] : Mail to : mab@ecmwf.co.uk You can find it on any Mac archive or mail to author. Leo Possajennikov, Analyst/Programmer, ADInstruments http://www.fl.net.au/~leo From owner-software@net.bio.net Wed Mar 06 22:00:00 1996 Newsgroups: bionet.software Path: biosci!CS.Arizona.EDU!noao!ennfs.eas.asu.edu!gatech!news.jsums.edu!news2.cais.net!news.cais.net!chi-news.cic.net!newsfeed.internetmci.com!newsfeeder.gi.net!news.mid.net!sbctri.tri.sbc.com!newspump.wustl.edu!news.cellbio.wustl.edu!not-for-mail From: eddy@wol.wustl.edu (Sean Eddy) Subject: Re: Wanted: Simple alignment software for education Sender: eddy@wol.wustl.edu Message-ID: Date: 07 Mar 1996 07:08:38 -0600 References: <313DB38B.41C6@mpiz-koeln.mpg.de> In-reply-to: "Jan T. Kim"'s message of Wed, 06 Mar 1996 16:47:23 +0100 Organization: Washington University School of Medicine X-Newsreader: Gnus v5.1 Lines: 25 In article <313DB38B.41C6@mpiz-koeln.mpg.de> "Jan T. Kim" writes: >I am looking for alignment programs for educational purposes. The >software should not be too sophisticated and loaded with features. >Rather, we look for programs that produce an alignment out of two >input sequences in a way which is as transparent to the user as >possible, i.e. the scoring matrix should be made clear etc. It would >be ideal if the program produced some sort of display of the process >of constructing the path matrix, tracking the path etc. I've got a radical suggestion for you. We're teaching a computational biology course at Washington University, and we've run across the same problem -- how to get people to understand dynamic programming. We tried to do it the hard way by asking people to do some small DP matrices by hand. Tedious as hell. A grad student in my group managed to automate the whole thing for himself in an Excel spreadsheet with a small amount of work. His spreadsheet became a DP matrix, automatically updating when you change a sequence position or your scoring system (he used a simple scoring matrix for identities/mismatches). It doesn't do the traceback, though. If you have any Excel-savvy folks around, you might consider this. It's a hack but it's quick, easy, and informative. -- - Sean Eddy - Dept. of Genetics, Washington University School of Medicine - eddy@genetics.wustl.edu From owner-software@net.bio.net Wed Mar 06 22:00:00 1996 Path: biosci!ns1.faseb.org!lamarck.sura.net!newsfeed.internetmci.com!news.msfc.nasa.gov!elroy.jpl.nasa.gov!lll-winken.llnl.gov!osi-east2.es.net!oracle.pnl.gov!bbs.pnl.gov!wh_reid.pnl.gov!user From: wh_reid@ccmail.pnl.gov (William H. Reid) Newsgroups: bionet.software Subject: Re: QUADRA 650 Date: 6 Mar 1996 15:52:33 GMT Organization: Ecology, Environmental Technology, Battelle, PNNL Lines: 17 Distribution: world Message-ID: References: <4hf6pp$ptj@mserv1.dl.ac.uk> NNTP-Posting-Host: wh_reid.pnl.gov In article <4hf6pp$ptj@mserv1.dl.ac.uk>, glee@hgmp.mrc.ac.uk (Mr. G Lee) wrote: > Our lab is looking to purchase a 2nd hand quadra 650 for use with a perkin elmer 373 sequencer, if any one knows where it is posible to get one i would be much appreciative if you could pass on the information , or if you ha > contact me. > at glee@hgmp.mrc.ac.uk There is a huge used Mac store in the Boston (MA, USA) area. I don't have a ref at hand, but can get it from a friend. Bill -- William H. Reid, Sr. Res. Sci. Environmental Technology, K6-84 Battelle, Pacific Northwest National Laboratory Richland, WA 99352-0999 USA From owner-software@net.bio.net Wed Mar 06 22:00:00 1996 Path: biosci!CS.Arizona.EDU!noao!ennfs.eas.asu.edu!gatech!usenet.eel.ufl.edu!news-feed-1.peachnet.edu!hobbes.cc.uga.edu!news From: russell@dogwood.botany.uga.edu (Russell L. Malmberg) Newsgroups: bionet.software Subject: Re: HPLC analysis software Date: 7 Mar 1996 13:23:54 GMT Organization: Botany Department, University of Georgia Lines: 63 Distribution: world Message-ID: <4hmo1a$c4a@hobbes.cc.uga.edu> References: <4hkl19$k3a@oravannahka.Helsinki.FI> Reply-To: russell@dogwood.botany.uga.edu NNTP-Posting-Host: twopaths.botany.uga.edu X-Newsreader: News for Windows NT X1.0-72 I don't know if this will do all that you require, but I have found LabTech Notebook to be a useful software package for my HPLC. They have different software packages ranging in price from US $100 to $1500. I have only used their software to record and integrate peaks, I haven't yet tried to control my setup, although I know some of their software does allow DA control. They have a web address at: http://www.labtech.com/ and an e-mail address at: sales@labtech.com I obtained my software bundled with my AD board, which I purchased from a US company "ComputerBoards", phone: US-508-261-1123, or fax: US 508-261-1094 ComputerBoards sells a range of AD boards, including ISA to PCI, varying in cost from about US $150 to $800. They seem to be quite a good buy. I started using a "Computerboard" AD board and LabTech software when the integrator that came with my Beckman HPLC broke, and the price to fix or replace it was about 10 fold higher than inserting this board and software on one of my lab computers. Hope this is helpful. Russell Malmberg russell@dogwood.botany.uga.edu ============================================ In article <4hkl19$k3a@oravannahka.Helsinki.FI> stenberg@cc.Helsinki.FI (Dag Stenberg) wrote: > We are equipped with a 1-channel Merck-Hitachi integrator for HPLC > analysis, and would like to change to computer recording and analysis. > > However, we are not well funded. We do not need instrument control, thus > $5000-$6000 for a setup that can control all the different pumps in the > world are unnecessarily expensive. > > I have seen analysis software for about $3000 including an AD board. > Several AD boards lie unused around my lab. So my question is: can > anybody point me to a program which can record, store to disk, analyze > for peaks (by cursor control if necessary) and calculate data from > 2 to 4 channels from one or two instruments, using a standard AD board > like DT2801, PCL7815 or similar? > > Dag Stenberg > ------------------------------------------------------------------ > Dag Stenberg MD PhD stenberg@cc.helsinki.fi > Institute of Biomedicine tel: int.+358-0-1918532 > Department of Physiology fax: int.+358-0-1918681 > P.O.Box 9 (Siltavuorenpenger 20 J) tlx: 1002125 finuh sf > FIN-00014 University of Helsinki,Finland > X.400: /C=FI/A=FUMAIL/P=INET/O=HELSINKI/OU=CC/S=STENBERG/ > ------------------------------------------------------------------ > > Russell L. Malmberg russell@dogwood.botany.uga.edu From owner-software@net.bio.net Wed Mar 06 22:00:00 1996 Path: biosci!VIR.BEKKOAME.OR.JP!gotow From: gotow@VIR.BEKKOAME.OR.JP (Kiyoshi Gotow) Newsgroups: bionet.software Subject: Re: MolPhy-2.2 Date: 6 Mar 1996 19:58:23 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 31 Sender: daemon@net.bio.net Distribution: world Message-ID: <199603070355.MAA25804@pepsi3.bekkoame.or.jp> NNTP-Posting-Host: net.bio.net At 8:40 96.3.4 -0700, David Frederiksen wrote: > Now that I have results I am having a little trouble interpreting the >results. On most of my searches I was given more than one tree as the >most likely tree. There were two numbers that preceeded each one. What >do these numbers represent? I am hoping that they are probability >measures so i can accept or reject one of the trees with reasons other >than beacaused they fit the theory I want. > Also, I have noticed that when you run the distance calculation, >njdist, it gives you a distance matrix. This doesn't not appear to >fully scale the trees that protml produces, unlike the phylip dnaml >package. I am not all together familiar with the long hand statistical >clustering analysis that is used to come up with these results and I am >unable to scale my trees properly. Can you suggest anything for scaling >the trees that are produced in protml? > >Thank You For Your Time >David Frederiksen I think we had better continue our communication not on the mailing list but by private mail, since the question you asked is so deeply related to the interpretation of the results. Although I am afraid that I can not be of further help, please e-mail the results you got to me if you agree with me. Kiyoshi Gotow, Ph.D. Department of Human Life and Culture Seitoku University gotow@vir.bekkoame.or.jp From owner-software@net.bio.net Wed Mar 06 22:00:00 1996 Path: biosci!CS.Arizona.EDU!noao!ennfs.eas.asu.edu!gatech!gt-news!cc.gatech.edu!cssun.mathcs.emory.edu!swrinde!howland.reston.ans.net!surfnet.nl!sun4nl!uva.nl!amc!ka2-05.amc.uva.nl!user From: a337ard@horus.sara.nl (ard jonker) Newsgroups: Sci.image.processing,bionet.software Subject: Re: Instant Video Database has many applications for capturing live images Date: Thu, 07 Mar 1996 16:21:09 +0100 Organization: University of Amsterdam (fac. med.) Lines: 18 Message-ID: References: <4hj9p5$mvc@cloner3.netcom.com> NNTP-Posting-Host: ka2-05.amc.uva.nl I would say this is a commercial. This is not the place nor the way to advertise. If you feel the irrisistable need to flood the internet and the bionet newsgroups in particular with advertisements, please refrain to a short announcement like commercial: at http://www.oursite.country you will find info on our new commercial product xyz. Especially having the commercial posted twice under different Subject headings suggests that you act deliberately and that it is not a slip of the keyboard. correct me if I'm wrong. ard In article <4hj9p5$mvc@cloner3.netcom.com>, lmarsgo@ix.netcom.com(LEONARD MARSHALL) wrote: --commercial plug removed--- From owner-software@net.bio.net Wed Mar 06 22:00:00 1996 Path: biosci!agate!newsxfer2.itd.umich.edu!chi-news.cic.net!news1.io.org!van-bc!unixg.ubc.ca!news.bc.net!uvaix3e1.comp.UVic.CA!news!cupton From: cupton@uvic.ca ( Chris Upton) Newsgroups: bionet.software Subject: SGI version of GDE (IRIX 5.3) Followup-To: bionet.software Date: Thu, 7 Mar 96 18:03:51 GMT Organization: University of Victoria Lines: 17 Message-ID: NNTP-Posting-Host: hermes.bioc.uvic.ca X-Newsreader: VersaTerm Link v1.1.3 Hi, I'm looking for a recent version of GDE to run on a SGI.... I'm running IRIX 5.3. Thanks, Chris ------------------------------------------------------------------------------ Chris Upton Assistant Professor **new email: cupton@uvic.ca ** Biochemistry & Microbiology -------------------------------- University of Victoria (604)721-6507 PO Box 3055, Victoria (604)721-8855 fax BC, Canada V8W 3P6 From owner-software@net.bio.net Wed Mar 06 22:00:00 1996 Path: biosci!agate!howland.reston.ans.net!tank.news.pipex.net!pipex!sunsite.doc.ic.ac.uk!news.cc.ic.ac.uk!usenet From: Mark Pallen Newsgroups: bionet.software Subject: Programs that search for antisense peptides?? Date: 7 Mar 1996 15:32:03 GMT Organization: Imperial College, London, UK Lines: 27 Message-ID: <4hmvhj$grg@oban.cc.ic.ac.uk> NNTP-Posting-Host: mpm1.bc.ic.ac.uk Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 1.12(Macintosh; I; 68K) X-URL: news:bionet.software A colleague of mine, Spiros Servos, has asked me to post this enquiry on his behalf. He wants to know if anyone knows of any software that searches for anti-sense peptide sequences either in a single protein sequence or in an entire database. He has heard of a program called ANTIS, but does not know where to find it. Please email him with any info you might have on this subject on: s.servos@ic.ac.uk. Thanks Mark ******************************************************** Dr Mark Pallen, Senior Lecturer in Medical Microbiology, St Bartholomew's Hospital Medical College, London, EC1A 7BE currently on a Research Leave Fellowship at Imperial College Rm 502, Dept of Biochem, Imperial College, London, SW7 2AY email:m.pallen@ic.ac.uk WWW: http://www.qmw.ac.uk/~rhbm001/mpallen.html phone: day ++44(0)1715945254, eves ++44(0)1815057937, FAX ++44(0)1715945255 ******************************************************** "My country is the world and my religion is to do good..." Thomas Paine ******************************************************** From owner-software@net.bio.net Thu Mar 07 22:00:00 1996 Path: biosci!ihnp4.ucsd.edu!sdcc12.ucsd.edu!jeeves.ucsd.edu!jcanaves From: From Jaume Canaves Newsgroups: bionet.software Subject: Sense-Antisense Sequence ID Date: Thu, 7 Mar 1996 17:39:12 -0800 Organization: University of California, San Diego Lines: 14 Message-ID: NNTP-Posting-Host: jeeves.ucsd.edu Mime-Version: 1.0 Content-Type: TEXT/PLAIN; charset=US-ASCII I'm interested in any program (available platforms are Sun, SiGraph, Mac and PC) that can identify sense-antisense sequences in one protein or between two proteins. Does anybody know if there's any public domain or shareware program capable of doing that? ThankS! --------------------------------------------------------------------------- Jaume M. Canaves i Vives _ EVOLUTION ___ UCSD - Biology (0366) /_\ Y TAKES (0,0) 9500 Gilman Dr. 7 // \\ ( ) N O < . > La Jolla, California 92093 \\_// \\_// PRISONERS --"-"-- ---------------------------------------------------------------------------- From owner-software@net.bio.net Thu Mar 07 22:00:00 1996 Path: biosci!bcm.tmc.edu!cs.utexas.edu!howland.reston.ans.net!nntp.coast.net!swidir.switch.ch!in2p3.fr!univ-lyon1.fr!pasteur.fr!jussieu.fr!news-rocq.inria.fr!irisa.fr!news.univ-rennes1.fr!news.univ-brest.fr!ifremer.fr!news From: Bertrand COLLET Newsgroups: bionet.software Subject: REAP Date: 7 Mar 1996 12:54:36 GMT Organization: IFREMER Lines: 6 Message-ID: <4hmmac$95l@ys.ifremer.fr> NNTP-Posting-Host: select.ifremer.fr Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 1.1N (Windows; I; 16bit) We are looking a Restriction Enzyme Software for PC (windows or DOS) called Restriction Enzyme Analysis Package. Is anybody know where we can get it. Thanks From owner-software@net.bio.net Thu Mar 07 22:00:00 1996 Path: biosci!bcm.tmc.edu!cs.utexas.edu!howland.reston.ans.net!nntp.coast.net!swidir.switch.ch!in2p3.fr!univ-lyon1.fr!pasteur.fr!jussieu.fr!news-rocq.inria.fr!irisa.fr!news.univ-rennes1.fr!news.univ-brest.fr!ifremer.fr!news From: Bertrand COLLET Newsgroups: bionet.software Subject: REAP Date: 7 Mar 1996 15:02:22 GMT Organization: IFREMER Lines: 9 Message-ID: <4hmtpu$bpo@ys.ifremer.fr> NNTP-Posting-Host: select.ifremer.fr Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 1.1N (Windows; I; 16bit) Hi all, I'm looking for a Restriction analysis software for PC (DOS or Windows) or for MacIntosh called REAP program (Restriction Enzyme Analysis Package). Is anybody has information about where I can get it and about its price. Many Thanks. From owner-software@net.bio.net Thu Mar 07 22:00:00 1996 Path: biosci!biosci!not-for-mail From: Eugene A Kapp <100277.2367@CompuServe.COM> Newsgroups: bionet.molbio.proteins,bionet.software Subject: Isoelectric Point calculations Date: 7 Mar 1996 22:31:35 -0800 Organization: MicroMass Lines: 11 Sender: daemon@net.bio.net Distribution: world Message-ID: <4hmra1$c71$1@mhadf.production.compuserve.com> NNTP-Posting-Host: net.bio.net Xref: biosci bionet.molbio.proteins:7273 bionet.software:14911 I have found that the predicted pI calculations from two WWW sites differ by approximately 0.4 for a given protein sequence. Expasy (http://expasy.hcuge.ch/ch2d/pi_tool.html) and the genome sequencing site at (http://genome1.bio.bnl.gov/bbq.html) are therefore using slightly different pKR values. Could someone suggest the correct pKR values or add some light to the situation. Many thanks. From owner-software@net.bio.net Thu Mar 07 22:00:00 1996 Path: biosci!agate!howland.reston.ans.net!gatech!newsfeed.internetmci.com!news.sprintlink.net!news.unicomp.net!ns1.unicomp.net!microbiol.org!sysop Subject: Wanted: Simple alignment software for education Newsgroups: bionet.software From: sysop@microbiol.org Date: Thu, 07 Mar 96 18:21:06 EST Message-ID: <8295-279974101@microbiol.org> Organization: Microbiol BBS 817-557-0330 Lines: 34 KI>Dear all, KI>I am looking for alignment programs for educational purposes. The KI>software should not be too sophisticated and loaded with features. ===Some deleted ==== KI>Kind regards, Jan T. Kim KI>-- KI> +- Jan Kim -- X.400: S=kim;OU=violet;O=mpiz-koeln;P=mpg;C=de -----+ KI> | Internet: kim@mpiz-koeln.mpg.de | KI> | WWW: http://www.mpiz-koeln.mpg.de/~kim/kim.html | KI> *-----=< hierarchical systems are for files, not for humans >=-----* Jan, Look to the "Molecular Biology" library in The Microbiology BBS. A listing is found from http://www.microbiol.org/microbbs. Let me know if you find something you like. Scott Sutton sutton@microbiol.org The Microbiology BBS http://www.microbiol.org/microbbs (USA) 817-557-0330 (N/8/1) -- The Microbiology BBS 817-557-0330 (USA) info@microbiol.org http://www.microbiol.org/microbbs Dedicated to the biologist in industry, academics, and private practice. From owner-software@net.bio.net Thu Mar 07 22:00:00 1996 Path: biosci!bloom-beacon.mit.edu!spool.mu.edu!usenet.eel.ufl.edu!newsfeed.internetmci.com!chi-news.cic.net!nntp.coast.net!howland.reston.ans.net!usc!newshub.csu.net!csulb.edu!drivel.ics.uci.edu!news.service.uci.edu!buggus.mmg.uci.edu!user From: mangalam@uci.edu (Harry Mangalam) Newsgroups: bionet.software Subject: Re: Searching for DNA binding sites Date: Thu, 07 Mar 1996 17:26:42 -0800 Organization: Microbiology and Molecular Genetics, UC Irvine Lines: 37 Message-ID: References: <4hfur8$fv@news.tamu.edu> NNTP-Posting-Host: buggus.mmg.uci.edu In article <4hfur8$fv@news.tamu.edu>, mary@bio.tamu.edu (Mary ) wrote: > I would like to look for patterns/homologies within a 50 kb contiguous > DNA sequence. I am looking for hints regarding a putative binding site. > I don't have a very good idea what the site is but I can make some > guesses. Can anyone tell me the best program for this purpose? > > Mary Fernandes If by this you mean that you're looking for degenerate binding sites for a family of transcription factors or other DNA binding proteins, you could use Dan Prestridge's signalscan (which matches DNA sequence to the transfac or transcription factor database): To get the latest version, anon. ftp to biosci.cbs.umn.edu, to directory pub/sigscan/pc or pub/sigscan/unix. If you need installation instuctions or help, send Email to danp@biosci.cbs.umn.edu. or the GCG program FINDPATTERNS which you can use to describe ambiguous binding sites, or even Wu and Manber's 'agrep' (a variation on the unix utility 'grep') which does very much the same thing (and is free): ftp://ftp.cs.arizona.edu/agrep/agrep-2.04.tar.Z "Wu and Manber, "Fast Text Searching with Errors", Technical report #91-11, Department of Computer Science, University of Arizona, June 1991." If not, I don't understand your question. Cheers Harry -- Harry J Mangalam, Microbiology and Molecular Genetics, UC Irvine, Irvine, CA, 92717, (714) 824-4824, fax (714) 824 8598 http://hornet.mmg.uci.edu/~hjm/hjm.html Computational Biology..SGI..Woodworking..Bicycling..Linux..WWW From owner-software@net.bio.net Thu Mar 07 22:00:00 1996 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!elroy.jpl.nasa.gov!swrinde!gatech!newsxfer2.itd.umich.edu!chi-news.cic.net!nntp.coast.net!howland.reston.ans.net!usc!newshub.csu.net!csulb.edu!drivel.ics.uci.edu!news.service.uci.edu!buggus.mmg.uci.edu!user From: mangalam@uci.edu (Harry Mangalam) Newsgroups: bionet.software Subject: Re: software for finding DNA minor grooves? Date: Thu, 07 Mar 1996 17:13:02 -0800 Organization: Microbiology and Molecular Genetics, UC Irvine Lines: 16 Message-ID: References: <1996Mar5.120249@nova.wright.edu> NNTP-Posting-Host: buggus.mmg.uci.edu > I am looking for software which will allow for searching a DNA sequence > for major and minor grooves. Anything out there in public domain for either > VAX/VMS or PC ???? Please send responses to aarment@desire.wright.edu I believe that most DNA forms have both major and minor grooves. Perhaps you mean something more complicated? Cheers harry -- Harry J Mangalam, Microbiology and Molecular Genetics, UC Irvine, Irvine, CA, 92717, (714) 824-4824, fax (714) 824 8598 http://hornet.mmg.uci.edu/~hjm/hjm.html Computational Biology..SGI..Woodworking..Bicycling..Linux..WWW From owner-software@net.bio.net Thu Mar 07 22:00:00 1996 Path: biosci!daresbury!nntp-trd.UNINETT.no!nntp.uio.no!news.cais.net!chi-news.cic.net!newsspool.doit.wisc.edu!news.doit.wisc.edu!martinlab From: klenchin@macc.wisc.edu (Dima Klenchin) Newsgroups: bionet.molbio.proteins,bionet.software Subject: Re: Isoelectric Point calculations Date: Fri, 08 Mar 96 19:09:38 GMT Organization: UW-Madison Lines: 21 Message-ID: <4hq0li$a4o_003@biochem.wisc.edu> References: <4hmra1$c71$1@mhadf.production.compuserve.com> NNTP-Posting-Host: martinlab.biochem.wisc.edu X-Newsreader: News Xpress Version 1.0 Beta #4 Xref: biosci bionet.molbio.proteins:7283 bionet.software:14919 In article <4hmra1$c71$1@mhadf.production.compuserve.com>, Eugene A Kapp <100277.2367@CompuServe.COM> wrote: ->I have found that the predicted pI calculations from two WWW ->sites differ by approximately 0.4 for a given protein sequence. ->Expasy (http://expasy.hcuge.ch/ch2d/pi_tool.html) and the genome ->sequencing site at (http://genome1.bio.bnl.gov/bbq.html) are ->therefore using slightly different pKR values. -> ->Could someone suggest the correct pKR values or add some light to ->the situation. -> ->Many thanks. Very simple. Ignore both. Predicted pI values are meaningless because they treat all AA as if the protein were random coil. It could be OK for small proteins and sometimes is OK with some proteins. Real pI of the folded protein could be entirely different. So, IMHO, 0.4 unit is not a big deal of difference. - Dima From owner-software@net.bio.net Thu Mar 07 22:00:00 1996 Path: biosci!lhc.nlm.nih.gov!corin!madden From: madden@corin.nlm.nih.gov (Tom Madden) Newsgroups: bionet.software Subject: Changes to the BLAST Databases Date: 8 Mar 1996 19:19:44 GMT Organization: National Library of Medicine Lines: 271 Message-ID: <4hq18g$red@lhc.nlm.nih.gov> NNTP-Posting-Host: 130.14.25.41 X-Newsreader: TIN [version 1.2 PL2] Changes to the BLAST Databases March 8, 1996 This announcement describes a reorganization of the databases available for BLAST searches at the National Center for Biotechnology Information (NCBI). The same sequence data will be available for searching but will be organized for more efficient searching and will be better synchronized with the Entrez databases. The major differences will be the elimination of EST and STS sequences from the 'nr' (non-redundant database) and the introduction of a database ('month') containing only the sequences added over the past 30 days. Another change is a new definition line for protein sequences. WWW Blast and E-mail Blast users will switch to the new set of databases beginning March 11, 1996. Since most users search 'nr', the change should be minimal since the database name will stay the same, but EST and STS sequences will not be searched. For users of Network Blast, a new client (Blast2) is being introduced that will not only search the new set of databases, but also provide a better interface for post-processing search results. Blast2 represents the future direction of the Blast service and users of the existing Blast software, known as the 'Experimental' Blast service are encouraged to upgrade to Blast2. However, the existing 'Experimental' Blast clients will be able to operate with the new databases. (See Appendix 3 for technical details). Blast2 clients are available now for FTP and users of the 'Experimental' Blast clients are able to use the new databases now. Beginning March 11, 1996, the old databases will no longer be available and both the Experimental and Blast2 clients will use the new databases. These changes are described further below in the following topics: * New databases * Sequence identifiers * The Blast2 service * A new Entrez-based e-mail server * Databases on the FTP site Comments about these changes are welcome, please send them to blast-help@ncbi.nlm.nih.gov. For information about other NCBI services, send e-mail to: info@ncbi.nlm.nih.gov =========================================================================== New Databases: Presently both the old and the new databases are available. The old databases will be available until March 11, 1996, at which time only the new databases will be available. The new databases are now searchable with the Network version of Blast (see Appendix 3). New nucleotide databases: nr Non-redundant GenBank+EMBL+DDBJ+PDB sequences (but no EST's or STS's) est Non-redundant Database of GenBank+EMBL+DDBJ EST Division sts Non-redundant Database of GenBank+EMBL+DDBJ STS Division pdb PDB nucleotide sequences vector Vector subset of GenBank mito Database of mitochondrial sequences, Rel. 1.0, July 1995 kabat Kabat Sequences of Nucleic Acid of Immunological Interest epd Eukaryotic Promotor Database alu Select Alu Repeats from REPBASE month All new or revised GenBank+EMBL+DDBJ+PDB sequences released in the last 30 days New protein databases: nr Non-redundant GenBank CDS translations+PDB+SwissProt+PIR pdb PDB protein sequences spdb Non-redundant SwissProt+PDB sequences kabat Kabat Sequences of Proteins of Immunological Interest alu Translations of Select Alu Repeats from REPBASE month All new or revised GenBank CDS translation+PDB+SwissProt+PIR sequences released in the last 30 days swissprot SwissProt sequences =========================================================================== Sequence identifiers for the new databases: The one-line descriptions for GenBank conceptual translations will change. The present descriptions describe the conceptual translation of a CDS in terms of the GenBank flatfile, but do not reliably point to a specific CDS if the order or number of CDS features changes. An example is: "gp|U04987|SIU04987_4 env gene product [Simian immunodef..."; "SIU04987_4" indicates that this protein is the fourth CDS on the entry with the accession U04987. Changes to the GenBank entry can change the order and number of CDS features. Therefore, in order to identify the specific protein sequence NCBI is now assigning a stable identifier, called a 'gi' for all sequences. A "gi" is a unique integer that changes when the sequence changes. It does not change, however, if only the features or references of an entry are updated. The new format for protein sequences will contain the identifer 'gi' followed by the 'gi number': "gi|451623 (U04987) env [Simian immunodeficiency..." Although the accession number of the translated nucleotide sequence will appear in the header line (U04987 in the example above), retrieval by 'gi number' is the only reliable method to locate the correct translated DNA sequence. The new e-mail retriever (see below) or Entrez may be used to retrieve sequences identified by "gi". An exhaustive list of sequence identifiers used in these new databases is provided in Appendix 1. Additional examples of definition lines are provided in Appendix 2. =========================================================================== The Blast2 service: Blast2 is the newest version of the BLAST client software and represents the foundation for NCBI's future development of the BLAST service. The Blast2 service permits BLAST searches with a number of different clients for different platforms, available on the NCBI FTP site. These clients can be obtained by FTP'ing to ncbi.nlm.nih.gov (login as anonymous and cd to blast/network/blast2). In contrast to the present BLAST service (designated "experimental"), these clients communicate with the BLAST server through a structured interface, allowing BLAST to interface better with other programs, e.g., post-processing programs. The blast2 service already uses the new databases. Although Blast2 is expected to eventually replace the 'experimental' Blast clients, NCBI will continue to support the 'experimental' Blast client for the near future. =========================================================================== New Entrez-based e-mail retrieve server ("QUERY"): QUERY uses the Entrez Query Engine to obtain data. Entrez can retrieve data by domain (i.e., nucleotide or protein) rather than by source database. QUERY can retrieve entries by "gi" (see above) and is synchronized with the new BLAST databases. To receive documentation about this service, send an email to "query@ncbi.nlm.nih.gov". The body of the message should consist of the word "help" (without quotes). =========================================================================== Databases on the FTP site All the databases listed above are available as FASTA files from the NCBI FTP site (ncbi.nlm.nih.gov). These FASTA files are not necessary to perform BLAST searches using the BLAST clients discussed here. They are only needed if one wishes to run the actual BLAST search engines in-house, rather than sending BLAST queries to the NCBI. To obtain these files, FTP to ncbi.nlm.nih.gov, login as anonymous and cd to "blast/db". These files are compressed and should be FTP'ed in binary mode. A FASTA file ("genpept.fsa") containing all the proteins in the GenBank release will also be available from the NCBI FTP site, in the directory "genbank". The one-line headers in this FASTA file have the same format as those presented in Appendix 1. Daily updates to this file are gpcu.fsa, in the directory "genbank/daily". These files serves as replacements for "genpept.fasta" and "gpcu.fasta", which will be discontinued on March 25, 1996. =========================================================================== Appendix 1: Sequence Identifier Syntax The syntax of sequence header lines used by the NCBI BLAST server depends on the database from which each sequence was obtained. The table below lists the identifiers for the databases from which the sequences were derived. Database Name Identifier Syntax ============================ ======================== GenBank gb|accession|locus EMBL Data Library emb|accession|locus DDBJ, DNA Database of Japan dbj|accession|locus NBRF PIR pir||entry Protein Research Foundation prf||name SWISS-PROT sp|accession|entry name Brookhaven Protein Data Bank pdb|entry|chain Kabat's Sequences of Immuno... gnl|kabat|identifier Patents pat|country|number GenInfo Backbone Id bbs|number For example, an identifier might be "gb|M73307|AGMA13GT", where the "gb" tag indicates that the identifier refers to a GenBank sequence, "M73307" is its GenBank ACCESSION, and "AGMA13GT" is the GenBank LOCUS. "gi" identifiers are being assigned by NCBI for all sequences contained within NCBI's sequence databases. The 'gi' identifier provides a uniform and stable naming convention whereby a specific sequence is assigned its unique gi identifier. If a nucleotide or protein sequence changes, however, a new gi identifier is assigned, even if the accession number of the record remains unchanged. Thus gi identifiers provide a mechanism for identifying the exact sequence that was used or retrieved in a given search. For searches of the nr protein database where the sequences are derived from conceptual translations of sequences from the nucleotide databases the following syntax is used: gi|gi_identifier An example would be: gi|451623 (U04987) env [Simian immunodeficiency..." where '451623' is the gi identifier and the 'U04987' is the accession number of the nucleotide sequence from which it was derived. Users are encouraged to use the '-gi' option for Blast output which will produce a header line with the gi identifer concatenated with the database identifier of the database from which it was derived, for example, from a nucleotide database: gi|176485|gb|M73307|AGMA13GT And similarly for protein databases: gi|129295|sp|P01013|OVAX_CHICK Appendix 2: Examples of sequence header lines in Blast output: Protein: gi|808969 (V00383) reading frame [Gallus gallus] 641 4.6e-99 2 gi|763101 (V00387) seventh exon [Gallus gallus] 690 2.6e-90 1 (note: gi numbers used for GenBank translated sequences; other protein sequences are designated according to database of origin, e.g., Swiss-Prot, PDB, PRF). sp|P01013|OVAX_CHICK GENE X PROTEIN (OVALBUMIN-RELATED). ... 1191 3.0e-159 1 sp|P01014|OVAY_CHICK GENE Y PROTEIN (OVALBUMIN-RELATED). ... 949 2.7e-126 1 pdb|1OVA|A Ovalbumin (Egg Albumin) >pdb|1OVA|B ... 645 1.3e-99 2 prf||0705172A ovalbumin [Gallus gallus] 645 1.3e-99 2 Nucleotide: gb|U37104|APU37104 Aethia pusilla cytochrome b gene, mi... 1672 1.2e-133 1 gb|U37087|ACU37087 Aethia cristatella cytochrome b gene... 1627 5.7e-133 2 emb|F19596|HSPD04201 H.sapiens mitochondrial EST sequence... 997 3.9e-77 1 emb|F19081|HSPD03679 H.sapiens mitochondrial EST sequence... 939 2.8e-72 1 gb|L44587|CALMTCYBF Callithrix emiliae (clones CEM 1, CE... 785 4.0e-59 1 gb|L44588|CALMTCYBFA Callithrix jacchus (clones CJA1, CJA... 695 1.5e-51 1 Appendix 3: Technical details The new databases may be searched using the existing ('experimental') client that connects to a different port than the default. The 'experimental' server normally connects to port 5555 (service is "blast"). The new databases are available by connecting to port 5559 (service is "xblast"). 'Experimental' clients for UNIX, using "xblast", are available from the NCBI FTP site under "blast/network/experimental/unix". Blast2 clients search only the new databases and are available now on the NCBI FTP site in blast/network/blast2. From owner-software@net.bio.net Thu Mar 07 22:00:00 1996 Path: biosci!biosci!not-for-mail From: mangalam@uci.edu (Harry Mangalam) Newsgroups: bionet.software Subject: ANNOUNCE: tacg - Restriction Enzyme analysis tool for unix Date: 7 Mar 1996 22:24:58 -0800 Organization: Microbiology and Molecular Genetics, UC Irvine Lines: 266 Sender: daemon@net.bio.net Distribution: world Message-ID: NNTP-Posting-Host: net.bio.net tacg a program for the restriction enzyme analysis of DNA Release 1.33 by Harry Mangalam, UC Irvine (mangalam@uci.edu, 714 824 4824) # This posting is to announce the availability of 'tacg', a command line tool for the restriction enzyme analysis of DNA for unix-like operating systems. Binaries currently exist for IRIX (5.3), SunOS (5.3), OSF/1 (V3.0/347), and Linux(1.2.8); others will be made available as I find systems on which to compile them, or as others contribute binaries. # For the impatient, here's an example of how to use it: tail +44 seq.file | tacg -n 6 -o 5 -F 2 -l ladder.map -w 90 >seq.file.map Translation: chop off the top 44 lines of seq.file and pipe the resulting sequence to tacg, returning info on all 6+ cutters (-n 6) that generate 5' overlaps (-o 5), giving me the sorted fragment sizes of those enz's that match (-F 2) and a ladder map (-l ladder.map), along with the default linear restriction map w/ 1 letter, 1 frame translation and write the output 90 characters wide (-w 90) to a file called seq.file.map # If you're interested in using it, you can get it via anonymous ftp at: ftp://mamba.bio.uci.edu/pub/tacg # The source code is freely available for instructional and nonprofit purposes, although since it is presently in beta release, I would suggest that anyone contemplating incorporating it would wait for the next release while more bugs are shaken out. Assuming it's used a fair bit, I'd like to have a chance to change it based on responses, document it more extensively and neaten it up before general release. # This is citation-ware. If you use it, please allow it to spit back about 100 bytes of data so I can analyze its use and spread. You can check the source code (especially udping.xx.c) to see what it does and if it still makes you uneasy, you can disable it from the command-line or recompilation. # The design criteria were: 1) Simplicity. It requires only 3 files - the executable, the restriction enzyme database file (rebase.data), and the codon usage file (codon.prefs). The 2 data files are ascii text and can be edited and modified by the user, if required. It was designed along the same lines as other small unix utilities - a tool that does a small set of things, does them reasonably well and can be chained to other utilities or used in conjuction with them to extract the information you need without too much fuss. The output of this program uses only alphanumeric characters so that all of its output can be viewed on a vanilla vt100-like terminal, although you can do more useful things if you're using an X display. For instance, some of the output can best be viewed using very small fonts or in multiple columns on a page, generated by feeding the output to a postscript conversion package (lptops, enscript, nenscript, genscript, etc). 2) High Portability The program is written in vanilla ANSI C, with no arcane ifdefs. It compiles with few complaints on SGI's IRIX (5.3) with cc, Sparcs running SunOS (5.3) with cc and gcc, DEC Alphas running OSF1 (v3.0) with cc, and *especially* Linux (1.2.8) with gcc. 3) Speed and Capacity The program uses a hashtable-lookup of the restriction enzyme recognition sites (generated on the fly) so that only about half of the sequence is checked any further than the initial hash. Depending on what kind of output you request and the i/o of the machine (output is by far the most time-consuming part of the program), the program processes: Speed* Hardware OS Compiler, flags ~14-150Kb/s i486/66/ISA Linux 1.2.8 gcc -O2 ~16-80Kb/s Sparc 4/?MHz SunOS 5.3 gcc -O ~25-130Kb/s early DEC Alpha OSF/1 gcc -O2 ~23-260Kb/s R4000/100 Indigo2 IRIX 5.3 cc -O2 -mips2 ~94-700Kb/s R4400/200 Indigo2 IRIX 5.3 cc -O2 -mips2 It also uses dynamic memory allocation so that while there are a few hard-coded limitations (in output format), it easily handles sequences into the millions of bases. 4) Usability Inspired by Christian Marck's elegant DNA Strider, I used a similiar output format, changing a few things I didn't like, adding a few things I wanted. The Feature Set: a) produces linear restriction maps. The map shows EXACT cutting position (not just the start of the recognition sequence - minor nitpick with Strider and other programs), with same-page translation (ditto) in 1/3/6 frames in 1 or 3 letter codes. tested up to more than a million bases. ie: ============================================================================ MspI HpaII Sau96I AvaII RsrII BstUI FokI MaeII EcoRV \ \ \ \ \ \ 13981 agcggtccggctgtcgcggatgaatatgaccagccaacgtccgatatcacgaaggataaa 14040 tcgccaggccgacagcgcctacttatactggtcggttgcaggctatagtgcttcctattt ^ * ^ * ^ * ^ * ^ * ^ * S G P A V A D E Y D Q P T S D I T K D K ============================================================================ b) filters enzymes inclusively by: - magnitude of recognition sequence (tgca=4, tgyrca=5, tgcnnngca=6, etc) - overlap of resulting ends (5', 3', blunt) - minimum, maximum times they cut the sequence b) handles linear/circular topologies, subsequences c) produces Summaries of cuts: ============================================================================ Restriction Enzymes that DO NOT CUT in this sequence: BbeI EheI FseI KasI NarI NheI NotI PacI PaeR7I SalI SfiI SpeI SwaI XhoI Total Number of Cuts per Restriction Enzyme: AatII 5 BsiYI 130 EcoNI 5 MluI 7 SalI 0 AccI 5 BsmI 30 EcoO109I 2 MmeI 8 SapI 7 AflII 2 BsmAI 26 EcoRI 3 MnlI 184 SauI 1 AflIII 13 Bsp120I 1 EcoRII 49 MscI 17 Sau96I 61 AgeI 12 Bsp1286I 26 EcoRV 14 MseI 106 ScaI 4 AluI 89 BspEI 22 EheI 0 MspI 278 ScrFI 145 ============================================================================ - Tables of cutting sites. ie: (for enzymes that pass the filtering options) ============================================================================ ** Cut Sites by Restriction Enzyme ** AatII G_ACGT'C - 5 cut(s) 5110 9399 11248 14979 29041 AccI GT'mk_AC - 5 cut(s) 2192 15262 18836 19475 31303 AflII C'TTAA_G - 2 cut(s) 6541 12619 AflIII A'CryG_T - 13 cut(s) 459 629 5549 11282 15373 17792 18285 19997 20953 22221 24134 24169 26529 ============================================================================ - Tables of fragment sizes (unsorted, sorted or both) ie: ============================================================================ ** SORTED Fragment Sizes by Restriction Enzyme ** AatII G_ACGT'C - 5 Fragment(s) 1849 3449 3731 4289 5110 14062 AccI GT'mk_AC - 5 Fragment(s) 639 1187 2192 3574 11828 13070 AflII C'TTAA_G - 2 Fragment(s) 6078 6541 19871 AflIII A'CryG_T - 13 Fragment(s) 35 170 459 493 956 1268 1712 1913 2360 2419 4091 4920 5733 5961 ============================================================================ - Ladder map, with 5', 3' blunt cutters indicated (\, /, |) ============================================================================ Ladder Map of Restriction Enzyme Cut Sites: 10000 20000 30000 40000 : : : : AccI ---\-----\----------------------------------------------\-------- AceIII ---------------------------\---------------\---------------\---\- AciI ----\--\\2-\2--\--2-\\-2\--\\-\\-\\-\--\-\-\----2\--\--\-\-\-\--- AflII --\--\--\\\\-----------------\\\-----------\\------\------------- : : : : AflIII --------------\-----------\------------\------\\\2--------------- AhdI -------/--------------------------------------------------------- AluI |3355323833353|43284|44-|45|324|54252-3426|2|22|52543|42323522|22 AlwI -2\--\2---3----2-----------------\\-\22-2\--\\\\-\---2--\-\-----2 : : : : ============================================================================ - A summary map (a la Strider) of enzymes that cut less than 2 times (altho this may be changed to be length-sensitive) ============================================================================ Summary of Enzymes that cut ** 2 ** times or less: XhoI@5733 Pfl1108I@4774 PvuI@22499 PshAI@29823 DrdI@2598 NarI@27578 BssSI@4941 BsiEI@22499 BssSI@38186 AhdI@5113 BsaHI@27578 BsmBI@37969 | ||| | | | | --------------------------------------------------------------------------- : : : : : 10000 20000 30000 40000 50000 ============================================================================ - A pseudo gel format that shows how different digests would look if run on a gel. Currently, it uses a straight log10() approximation, but a suggestion was made to use an additional transformation to mimic different percentages of agarose/polyacryamide. It uses the same representation as the ladder map, with single fragments represented as '|', multiple fragments that cannot be resolved as a digit showing how many map to that space ============================================================================ Pseudo-Gel Map of Digestions: *Maximum* Cuts: 50 100 1000 . . . . . . . . . . AccI AceIII AciI | ||| | | | 2||| 2| 2 | ||| AflII || | | | | . . . . . . . . . . AflIII | || | AhdI AlwI 7 || | || || | | | 2 | 2 Alw26I | ============================================================================ d) Other options: - extract subsequences from the input sequence (and make circular/linear) - translations with linear restriction map in 1, 3, or 6 frames, with 1 or 3 letter codes - Choose which of several codon preferences to use - 'Write/don't write' most of the options - User-settable printing widths to ~200 characters 5) The Odd one: It was also designed to track it's own use and spread - something in which I'm also interested. To that end, the binaries have been compiled with code that spits a small amount of data back to me at each usage, telling me the IP number of the hosting machine, the UID of person using it, the cpu type and OS it was run on, what flags were used in calling it, and the number of bases processed. It does not return host or domain names, user names, or actual sequence. The exact data that is returned is shown on stderr (usually the screen) each time. Cheers Harry -- Harry J Mangalam, Microbiology and Molecular Genetics, UC Irvine, Irvine, CA, 92717, (714) 824-4824, fax (714) 824 8598 http://hornet.mmg.uci.edu/~hjm/hjm.html Computational Biology..SGI..Woodworking..Bicycling..Linux..WWW From owner-software@net.bio.net Thu Mar 07 22:00:00 1996 Path: biosci!CS.Arizona.EDU!noao!ennfs.eas.asu.edu!gatech!newsfeed.internetmci.com!in1.uu.net!world!coopnews.coop.net!news.frontier.net!news From: Steve Schacht Newsgroups: bionet.software Subject: Re: home health software Date: Fri, 08 Mar 1996 09:17:41 +0000 Organization: Intelitool, Inc. Lines: 24 Message-ID: <313FFB35.5C19@frontier.net> References: <4hpc95$q90@reader2.ix.netcom.com> NNTP-Posting-Host: dro-1-5.frontier.net Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 2.0 (Macintosh; I; PPC) To: Libby Snitzer Libby Snitzer wrote: > > I am looking for medical reference software for home/family use. I > have heard of a product called Grateful Med...does anyone know who > publishes this software? Also, do you have any other recommendations? > Please respond by email to lib@ix.netcom.com. I really appreaciate it! > > Thanks! > Libby Grateful Med is not exactly a reference program. It's a specialized communications application that allows you to connect to the NLM (National Library of Medicine) computer to perform searches of current scientific literature. You are charged for NLM computer connect time. It sounds like you're looking for something more like the Mayo Clinic CD-ROM or another such family medical reference CD. Check with any of the CD-ROM or computer catalog mail order companies. One such company is Educorp at (800) 843-9497. They can send a catalog to you. Hope this helps. -Steve S. From owner-software@net.bio.net Thu Mar 07 22:00:00 1996 Path: biosci!CS.Arizona.EDU!noao!ennfs.eas.asu.edu!gatech!newsfeed.internetmci.com!howland.reston.ans.net!ix.netcom.com!netnews From: lib@ix.net