From owner-software@net.bio.net Wed Jul 01 23:00:00 1998 Path: biosci!MINDSPRING.COM!creditmedic From: creditmedic@MINDSPRING.COM Newsgroups: bionet.software Subject: Credit Medic Date: 2 Jul 1998 03:21:50 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 137 Sender: daemon@net.bio.net Distribution: world Message-ID: <199807021015.GAA07490@dewdrop2.mindspring.com> NNTP-Posting-Host: net.bio.net Dear Friend, DO YOU SUFFER FROM BAD CREDIT? DO YOU WISH YOU COULD START OVER WITH A CLEAN SLATE? Maybe you just want a better way to protect your privacy. Many of us never realized the long-term effect that bad credit has on our lives. In the computer age, many of these negative issues seem inescapable, and for good reason. Fortunately, Credit Medic will rescue you from your past negative credit and open the way to a new life in the credit world. By creating an entirely new credit file, you can obtain the credit you deserve. This powerful program will explain how you can create a new credit bureau file that will give you the opportunity for new credit. People lose their credit privileges for any number of reasons. In our society, it's very difficult to live without good credit. Regardless of your past credit history, this program will show you how to regain good credit. But you will get more than that. With good credit comes high self-esteem and self-worth. You will be better able to take care of yourself or your family and enjoy the things you deserve. Credit Medic will walk you through this process step by step. It will take some energy and focus on your part but the rewards will be well worth the effort. By creating a new credit file, the Government allows you a second chance at getting the credit you deserve. Thousands of people who have used this program have achieved success in releasing themselves from the exasperating stranglehold of bad credit and moved on to having outstanding credit. Understand that there is absolutely no reason for you to believe that it is impossible for you to release yourself from your past negative credit and move on to excellent credit! The process is very simple, but it is important to be dedicated and to follow through with all details. You must also be patient, some steps take longer than others. Don't be fooled into thinking that this is a miracle quick fix. This method will require some work on your part. What's important to realize is how the Government and the CRAs (Credit Reporting Agencies) identify you and list all of your past and present credit information. Credit Medic will show you how to apply for new credit identification. This creates a whole new credit identity, that runs parallel (but never crosses) your existing credit. This program doesn't require that you repair your old credit file, although it's a good idea for many obvious reasons. This is your decision to make. Credit Medic isn't loaded with fluff or filler material. Everything in this kit is important! You will find out about rights that you probably didn't know you had. Remember, you deserve good credit. Follow the program carefully, and you will be successful! Credit Medic will give you a second chance for credit. It will also be your last chance. You must understand that you only get ONE (1) second chance. If your credit is damaged again, Credit Medic cannot help you. Credit Medic is a PROVEN method that REALLY WORKS if you follow the steps described. Credit Medic DOES NOT do the work for you, but it DOES give you COMPLETE detailed instructions for building NEW credit. DON'T PROCRASTINATE! YOU DESERVE GOOD CREDIT! ORDER by June 10th and receive 50% off the regular price of $39.95. NOW ONLY $19.95 if your order is postmarked by July 10, 1998! Please print and fill out the following order form: ---------------------------------------------------------------------------- ATTN: Please type or print legibly to ensure proper delivery. Name______________________________________________________ E-mail Address (Required for E-Mail Delivery--U.S. Postal Delivery $5.95 extra) __________________________________________________________ Address __________________________________________________________ __________________________________________________________ __________________________________________________________ Phone #______________________ PLEASE CHECK ONE: _____ E-Mail Delivery _____ U.S. Mail $_19.95_ CREDIT MEDIC SECRETS (If postmarked by 7/10/98) $_______ Sales Tax (CA residents add 8.25%) $_FREE_ E-Mail Delivery (you must include an e-mail address which accepts large attachments) $__5.95_ Postal Delivery (Only add this amount if you want Credit Medic delivered by U.S. Mail) $_______ Order Total PAYMENT BY (US FUNDS only!): ___ Personal/Business Check ___ Money Order ___ Cashier's Check PREFERRED FORMAT (Please check one or more of the following): ___ ASCII ___ Microsoft Word ___ Zipped *If none of these three formats are acceptable, please order for delivery by U.S. Mail. You must include the additional $5.95 shipping & handling fee. The complete kit will be mailed in printed form. **If you're ordering from outside the USA, only a Money Order in US Dollars will be accepted. No postal delivery is available outside the USA, so you must include your E-Mail address accurately and legibly. If you do not currently have an E-Mail address, please get permission to use a friend's. -------------------------------------------------------------------------------------- Please make payable to -> BWZ Publications and send to: Credit Medic 21755 Ventura Blvd. Suite 455 Woodland Hills, CA 91367 USA From owner-software@net.bio.net Wed Jul 01 23:00:00 1998 Path: biosci!agate!nntp-out.monmouth.com!newspeer.monmouth.com!uni-erlangen.de!fu-berlin.de!news.uni-stuttgart.de!news.belwue.de!news.uni-mannheim.de!news From: Eckart Bindewald Newsgroups: bionet.software Subject: BABEL and torlist Date: Thu, 02 Jul 1998 14:10:35 +0200 Organization: Rechenzentrum Uni Mannheim Lines: 15 Message-ID: <359B78BB.BB70840B@mp-sun1.informatik.uni-mannheim.de> NNTP-Posting-Host: mp-pc25.informatik.uni-mannheim.de Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Trace: news.uni-mannheim.de 899381399 12230 (none) 134.155.65.132 X-Complaints-To: newsmaster@news.uni-mannheim.de X-Mailer: Mozilla 4.0 [en] (WinNT; I) X-Priority: 3 (Normal) Hello! I am trying to convert a protein pdb file into a list of its torsion angles. The program "babel" version 1.6 supports an output format "torlist". Who has experience with that format? Where is it defined? I expect "torlist" to be a list of torsion angles of a molecule. But the results are differenct than the torsion anlges computed with procheck. Who can help? Thanks, Eckart Bindewald From owner-software@net.bio.net Wed Jul 01 23:00:00 1998 Path: biosci!bloom-beacon.mit.edu!news.kodak.com!news-nysernet-16.sprintlink.net!news.sprintlink.net!128.122.253.90!newsfeed.nyu.edu!peerfeed.ncal.verio.net!nntp.ni.net!not-for-mail From: "Name" Newsgroups: alt.comp.software.easter-eggs,alt.comp.software.financial,alt.comp.software.tools,alt.fan.dean-stark.software.tester,alt.geo-software,alt.med.software,alt.video.dvd.software,at.tuwien.software,bionet.software,bionet.software.acedb,bionet.softwar Subject: Free Copy Of NetObjects Fusion 2.0.2 at http://iisventura.com Date: Wed, 1 Jul 1998 23:03:31 -0700 Organization: Network Intensive Lines: 6 Message-ID: <6nf7tn$n5a$1@nnrp1.ni.net> NNTP-Posting-Host: port094.vta.fishnet.net X-Newsreader: Microsoft Outlook Express 4.72.2106.4 X-MimeOLE: Produced By Microsoft MimeOLE V4.72.2106.4 Xref: biosci bionet.software:21355 bionet.software.acedb:1840 get a free copy of NetObjects Fusion 2.0.2 at: http://iisventura.com From owner-software@net.bio.net Wed Jul 01 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!news-peer.gip.net!news-raspail.gip.net!news.gsl.net!gip.net!rain.fr!pressimage!news.planete.net!news1.isdnet.net!usenet From: Walter Van Hecke Newsgroups: sci.stat.consult,sci.stat.math,sci.stat.edu,bionet.software Subject: St@tServ Statistical Archive Date: Fri, 03 Jul 1998 00:41:23 +0200 Organization: St@tServ Lines: 29 Message-ID: <359C0C93.48FE@statserv.com> Reply-To: walter.vanhecke@statserv.com NNTP-Posting-Host: tcparis1-90.hol.fr Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 3.0 (Win95; I) CC: walter.vanhecke@statserv.com Hello, St@tServ (http://www.statserv.com) was launched in January and we received almost 20000 visits since then, with over 600 people who registered to receive the St@tServ news. We would like to thank everybody for the very useful comments and suggestions that have been sent to us. We are proud to announce new sections in St@tServ, and especially the bookstore section that has received a warm welcome from the many visitors of St@tServ. We would like to develop the "jobs" section and we encourage you to submit offers and applications to us. We usually publish them within 48 hours. We are increasing the quality of the site and the number of features little by little because St@tServ is not our main activity, but we have many plans for the second part of the year, and be sure this is a really alive archive. We wish you all some excellent statistics, Walter Van Hecke --------------------------------------------- Walter Van Hecke, contributor to St@tServ Walter.Vanhecke@statserv.com http://www.statserv.com From owner-software@net.bio.net Thu Jul 02 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!news.bbnplanet.com!newsfeed.wli.net!feed2.news.erols.com!erols!netnews.com!news-peer.sprintlink.net!news-backup-east.sprintlink.net!news.sprintlink.net!128.218.95.22!itssrv1.ucsf.edu!macmac-2.ucsf.edu!user From: bpmurray*STUFFER*@socrates.ucsf.edu (Bernard Murray) Newsgroups: bionet.software Subject: Re: BABEL and torlist Date: Thu, 02 Jul 1998 20:02:22 -0700 Organization: University of California, San Francisco Lines: 36 Message-ID: References: <359B78BB.BB70840B@mp-sun1.informatik.uni-mannheim.de> NNTP-Posting-Host: macmac-2.ucsf.edu In article <359B78BB.BB70840B@mp-sun1.informatik.uni-mannheim.de>, Eckart Bindewald wrote: > Hello! > > I am trying to convert a protein pdb file into a list of its torsion > angles. > The program "babel" version 1.6 supports an output format "torlist". Who > has experience with that format? Where is it defined? > I expect "torlist" to be a list of torsion angles of a molecule. But the > results are differenct than the torsion anlges computed with procheck. > Who can help? > > Thanks, > Eckart Bindewald I am sorry I am not familiar with this version of Babel but if you want more opinions on torsions... I am not sure what platform you are using but if you have access to a C compiler you can download, compile and run Andrew Martin's "torsions" program; ftp://bsmcha1.biochem.ucl.ac.uk/pub/martin/torsions.c I don't have access to my Linux box at the moment but I also seem to remember that Stride (from the Argos lab) will also provide this information (as will DSSP). There are probably also web servers which allow you to run any of these programs (? Brookhaven, ExPasy). Maybe this will help, Bernard -- Bernard Murray, PhD Dept. Cell. Mol. Pharmacol., UCSF, San Francisco, USA From owner-software@net.bio.net Thu Jul 02 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!news-feed.inet.tele.dk!bofh.vszbr.cz!masternews.telia.net!News.Amsterdam.UnisourceCS!news.wxs.nl!not-for-mail From: "Frank Voorburg" Newsgroups: bionet.software Subject: New: "Feaser Ftp". Download Now! Date: Sat, 4 Jul 1998 00:42:12 +0200 Organization: World Access Lines: 28 Message-ID: <6njmh6$4hv3@reader3.wxs.nl> NNTP-Posting-Host: 195.121.74.171 X-Newsreader: Microsoft Outlook Express 4.71.1712.3 X-MimeOLE: Produced By Microsoft MimeOLE V4.71.1712.3 **************************************************************************** ******************** Dear newsgroup users, There is a new Ftp program available on the Internet. It's called Feaser Ftp and has the nicest interface I have ever seen in an Ftp program. Check it out! Download: http://www.feaser.com/software/feaser.zip Website: http://www.feaser.com Greetings, Frank Voorburg (frank@feaser.com) **************************************************************************** ******************** Short Description: Feaser makes it possible to transfer files between a local computer and a remote computer. It is the perfect tool for webpage designers. Besides all the basic transfer operations other Ftp clients offer, it also has a nice interface and tons of extra options. **************************************************************************** ******************** From owner-software@net.bio.net Thu Jul 02 23:00:00 1998 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!ais.net!jamie!newsfeed.wli.net!uunet!in3.uu.net!newsfeed.attap.net!mango.singnet.com.sg!dahlia.singnet.com.sg!mawar.singnet.com.sg!not-for-mail From: "HELPLESS" Newsgroups: alt.business.home.pc,bionet.software,bionet.software.acedb,bionet.software.contrib,bionet.software.gcg,bionet.software.pc,sg.singnet.help Subject: Pls help!!! Date: 3 Jul 1998 13:11:05 GMT Organization: Singapore Telecommunications Ltd Lines: 30 Message-ID: <01bda683$f55a3be0$c8a215a5@tlktffgb> NNTP-Posting-Host: qtns02010.singnet.com.sg X-Newsreader: Microsoft Internet News 4.70.1155 Xref: biosci bionet.software:21360 bionet.software.acedb:1841 bionet.software.gcg:3190 I have approached so many people for the following requirements, however my luck is in vain. I hope you can provide me the lead. We are looking for software that allow the following features: (A) Broadcast - email - grouping, unlimited folders - receiver will not see the (broadcasted list) ;others email add. in the message. (B) LAN-Network support alerting A software that can detect amendment made to data files and Alert ALL stations. Please advice. Please excuse me for I am poor in explaining the above, should you allow me to ring you or you would like to reach me for better understanding, pls. call me at 7492263 (ext 32). Thank you. From owner-software@net.bio.net Fri Jul 03 23:00:00 1998 Path: biosci!GAEBYOK.WONKWANG.AC.KR!skpark From: skpark@GAEBYOK.WONKWANG.AC.KR ("Park, Seung Kyu") Newsgroups: bionet.software Subject: functional expression web site Date: 3 Jul 1998 23:42:37 -0700 Organization: Won Kwang Univ. Lines: 15 Sender: daemon@net.bio.net Distribution: world Message-ID: <359DCD82.E7ABE451@gaebyok.wonkwang.ac.kr> Reply-To: skpark@gaebyok.wonkwang.ac.kr NNTP-Posting-Host: net.bio.net dear everyone: I am looking for the site of functional expression in yeast. Any information would be appreciated. Thanks. -- Park, Seung Kyu, M. Sc. mailto:skpark@gaebyok.wonkwang.ac.kr http://210.112.141.58/ Tel : +82-653-850-6768(lab), +82-653-831-0473(APT) Dept. Parasitol., Won Kwang Univ., 344-2, Sinyong-dong, Iksan-si, Chunbuk, 570-749, Korea. From owner-software@net.bio.net Sat Jul 04 23:00:00 1998 Path: biosci!rutgers!rockyd.rockefeller.edu!newsfeed.nyu.edu!peerfeed.ncal.verio.net!nntp.ni.net!not-for-mail From: "Name" Newsgroups: alt.comp.software.easter-eggs,alt.comp.software.financial,alt.comp.software.tools,alt.fan.dean-stark.software.tester,alt.geo-software,alt.med.software,alt.video.dvd.software,at.tuwien.software,bionet.software,bionet.software.acedb,bionet.softwar Subject: Free Copy Of NetObjects Fusion 2.0.2 at http://iisventura.com Date: Sun, 5 Jul 1998 00:04:31 -0700 Organization: Network Intensive Lines: 8 Message-ID: <6nn8ke$fon$1@nnrp1.ni.net> NNTP-Posting-Host: port065.vta.fishnet.net X-Newsreader: Microsoft Outlook Express 4.72.2106.4 X-MimeOLE: Produced By Microsoft MimeOLE V4.72.2106.4 Xref: biosci bionet.software:21365 bionet.software.acedb:1844 get a free copy of NetObjects Fusion 2.0.2 at: http://iisventura.com From owner-software@net.bio.net Sat Jul 04 23:00:00 1998 Path: biosci!agate!nntp-out.monmouth.com!newspeer.monmouth.com!netnews.com!howland.erols.net!spring.edu.tw!news.nctu.edu.tw!newsfeed.nthu.edu.tw!news.nthu.edu.tw!nthuls From: mjhsieh.bbs@bbs.life.nthu.edu.tw (Á©sèû) Newsgroups: bionet.software Subject: Re: BABEL and torlist Date: 05 Jul 1998 21:23:40 GMT Organization: ²MµØ¥Í©R¬ì¾Ç BBS Lines: 22 Message-ID: <3PN3KT$sO_@bbs.life.nthu.edu.tw> NNTP-Posting-Host: bbs.life.nthu.edu.tw X-Filename: bn.software/M.899673821.A ==> Eckart Bindewald , ¬ÝªO: bn.software wrote: : I am trying to convert a protein pdb file into a list of its torsion : angles. : The program "babel" version 1.6 supports an output format "torlist". Who : has experience with that format? Where is it defined? : I expect "torlist" to be a list of torsion angles of a molecule. But the : results are differenct than the torsion anlges computed with procheck. : Who can help? after check the result of babel and torsions.c, they give the same data in phi/psi/omega angle (because torsions.c gives only phi/psi/omega angle) babel will give any possible torsion in the residue without any linebreak. I am trying to write a program convert torsion to pdb, did anybody write it before? -- Á©sèû,¥xÆW°ê¥ß²MµØ¤j¾Ç¥Í©R¬ì¾Ç¨t | Francis M.J. Hsieh,Life Science,NTHU,TWN mjhsieh@life.nthu.edu.tw | Life Science BBS: bbs.life.nthu.edu.tw. -- ¡° Origin: ¥Í©R¬ì¾Ç BBS ¡» From: mjhsieh.life.nth From owner-software@net.bio.net Sun Jul 05 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!howland.erols.net!surfnet.nl!ruu.nl!not-for-mail From: "Jurgen F. Doreleijers" Newsgroups: bionet.software Subject: Re: Wanted program for superimposing peptides/proteins Date: Mon, 06 Jul 1998 16:30:23 +0100 Organization: NMR spectroscopy; Utrecht University; The Netherlands Lines: 13 Message-ID: <35A0ED8F.15FB@nmr.chem.uu.nl> References: <6npvdm$cbn@mserv1.dl.ac.uk> NNTP-Posting-Host: mule.chem.uu.nl Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 3.01 (X11; I; IRIX 5.3 IP22) To: Sangeeta Sawant Dear Sangeeta, Try MOLMOL: There is a nice way to run it in batch as well. http://www.mol.biol.ethz.ch/wuthrich/software/molmol Hope it helps, Jurgen -- Drs Jurgen F. Doreleijers NMR spectroscopy, Utrecht University, The Netherlands mailto:jurgen@nmr.chem.uu.nl http://www-nmr.chem.uu.nl/~jurgen From owner-software@net.bio.net Sun Jul 05 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!news-peer.gip.net!news.gsl.net!gip.net!newspeer.monmouth.com!nntp2.dejanews.com!nnrp1.dejanews.com!not-for-mail From: winkelhake@aol.com Newsgroups: bionet.software Subject: Re: articles listing software Date: Mon, 06 Jul 1998 09:31:32 GMT Organization: Deja News - The Leader in Internet Discussion Lines: 26 Message-ID: <6nq5hk$jv7$1@nnrp1.dejanews.com> References: <35961819.0@news.ip.pt> NNTP-Posting-Host: 152.167.111.209 X-Article-Creation-Date: Mon Jul 06 09:31:32 1998 GMT X-Http-User-Agent: Mozilla/2.0 (compatible; MSIE 3.02; Update a; AK; Windows 95) In article <35961819.0@news.ip.pt>, "PC" wrote: > > I'm looking for database software that allows to insert data about > scientific articles (name, author, date, abstract, etc.) and search for > keywords in such articles. > > I thank in advance any help provided. > > Pedro Cardoso > pcardoso@iname.com > http://aracnis.home.ml.org > http://arrabida.home.ml.org > > Dear Pedro have a look at http://members.aol.com/winkelhake/bgraph.html which is the homepage of Bibliographica, a program I wrote, which serves as a literature database and reference manager Best regards, Olaf Winkelhake -----== Posted via Deja News, The Leader in Internet Discussion ==----- http://www.dejanews.com/rg_mkgrp.xp Create Your Own Free Member Forum From owner-software@net.bio.net Sun Jul 05 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!news-peer.gip.net!news.gsl.net!gip.net!howland.erols.net!newsfeed.nacamar.de!wuff.mayn.de!news.ruhrgebiet.individual.net!news-koe1.dfn.de!uni-muenster.de!pbio16.uni-muenster.de!user From: "Uwe Baumert" Newsgroups: bionet.software Subject: W3 interface to search SwissPROT with two or more peptide sequences at once Date: Mon, 06 Jul 1998 14:41:01 +0200 Organization: University of Muenster Lines: 23 Sender: "Uwe Baumert" Message-ID: NNTP-Posting-Host: pbio16.uni-muenster.de Hi, I'm looking for an W3 interface to SwissPROT that allows us to search with two or more peptide sequences (12-18 aa). The peptides derived from trypsin digestions. Additional information that can be provided are pI and MW of the undigested protein. All on-line tools I looked so far (starting with the Tools page at expasy) need at least one sequence and/or pI and/or MW and/or several MS/MS or MALDI data entries and/or sequence tags. Since the genome of "our working object" is not subject of a genome project, we can only look for homology. Each peptide alone gives several hits (about 60 % homology) using FASTA but no hits using BLAST. Thank you in advance, Uwe Baumert -- Institut für Allgemeine Zoologie und Genetik Westf. Wilhelms-Universität Schloßplatz 5 Fax : +49 251 83-24723 D-48149 Münster, Germany Tel.: +49 251 83-24675 From owner-software@net.bio.net Sun Jul 05 23:00:00 1998 Path: biosci!NBRF.GEORGETOWN.EDU!MARZEC From: MARZEC@NBRF.GEORGETOWN.EDU ("Christopher R. Marzec") Newsgroups: bionet.software Subject: PIR-International Protein Sequence Database Release 57.00 available Date: 5 Jul 1998 21:26:39 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 19 Sender: daemon@net.bio.net Distribution: world Message-ID: <01IZ26ZBBE3M9356RT@NBRF.Georgetown.Edu> NNTP-Posting-Host: net.bio.net The PIR-International Protein Sequence Database Release 57.00 is available. Release 57.00, June 30, 1998, of the PSD is available via the World Wide Web at URL www-nbrf.georgetown.edu/pir. For download, the database is available via the NBRF/PIR ANONYMOUS FTP server at IP address NBRF.Georgetown.Edu in directory "[ANONYMOUS.PIR]." See file [ANONYMOUS.PIR]000README. for more information. Regards, Christopher R. Marzec Database Manager PIR-International Protein Sequence Database National Biomedical Research Foundation Washington, DC 20007 MARZEC@NBRF.Georgetown.Edu voice: (202) 687-2121 fax: (202) 687-1662 From owner-software@net.bio.net Sun Jul 05 23:00:00 1998 Path: biosci!rutgers!rockyd.rockefeller.edu!news-nysernet-5.sprintlink.net!news-dc-2.sprintlink.net!news-east.sprintlink.net!news-peer.sprintlink.net!news.sprintlink.net!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!portc02.blue.aol.com!audrey01.news.aol.com!not-for-mail From: mosh1977@aol.com (MOSH1977) Newsgroups: bionet.software Subject: WINDOWS 95/98 only 40$ Lines: 11 Message-ID: <1998070603292300.XAA26498@ladder01.news.aol.com> NNTP-Posting-Host: ladder01.news.aol.com X-Admin: news@aol.com Date: 6 Jul 1998 03:29:22 GMT Organization: AOL Canada http://www.aol.ca ARE YOUR TIRED OF PAYING BIG MONEY FOR SOFTWARE?? I COULD HELP YOU!!!! WINDOWS 95/98 FOR 40$ PLUS S&H ... (DEPENDS ON AREA) SOME CHARGES MAY APPLY. PLEASE E-MAIL ME WITH YOUR ORDER OR ANY QUESTIONS YOU MAY HAVE( ALL CD'S ARE COPIES) SATISFACTION GUARANTEED!! FEEL FREE TO E-MAIL IF YOU HAVE ANY QUESTIONS ORDER AT: MOSH1977@AOL.COM MOSH1977@AOL.COM MOSH1977@AOL.COM MOSH1977@AOL.COM From owner-software@net.bio.net Sun Jul 05 23:00:00 1998 Path: biosci!agate!news-spur1.maxwell.syr.edu!news.maxwell.syr.edu!nntp.news.xara.net!xara.net!server5.netnews.ja.net!daresbury!not-for-mail From: Sangeeta Sawant Newsgroups: bionet.software Subject: Wanted program for superimposing peptides/proteins Date: 6 Jul 1998 08:47:02 +0100 Lines: 18 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <6npvdm$cbn@mserv1.dl.ac.uk> Original-To: bio-software@dl.ac.uk Hi all! I would like to know if there is any software/program (preferably shareware/public-domain) which allows to superimpose several protein/peptide conformations onto one (say, template confo.) in a batch mode. The program may be for either IRIX or OS2 (DEC-ALPHA) or SOLARIS or LINUX or DOS (No Mac-OS please). Any help will be appreciated. Thanks in advance. Sangeeta +++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ + Mrs. Sangeeta Sawant + + Research Fellow email : sangeeta@bioinfo.ernet.in + + Bioinformatics Centre phone : +91-212-355039 + + University of Pune fax : +91-212-350087 + + Ganeshkhind + + Pune - 411007 + + India. + +++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ From owner-software@net.bio.net Sun Jul 05 23:00:00 1998 Path: biosci!agate!newsgate.duke.edu!usenet From: Michael J Morales Newsgroups: bionet.software Subject: Visual Blast II Date: Mon, 06 Jul 1998 12:17:17 -0400 Organization: Duke University, Durham, NC, USA Lines: 10 Message-ID: <35A0F88D.2F2413D4@acpub.duke.edu> NNTP-Posting-Host: async249-66.async.duke.edu Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 4.04 [en] (Win95; U) X-Corel-MessageType: EMail Greetings, I'm trying to locate a copy of Visual Blast II. The WEB address I have got, www.lrncp.jussieu.fr/~durand, no longer seems to be active. Also, E-mail to durand@lrncp. jussieu.fr gets bounced back. Anyone have any ideas? Thank you, Mike Morales From owner-software@net.bio.net Sun Jul 05 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!cpk-news-feed4.bbnplanet.com!cpk-news-feed1.bbnplanet.com!news.bbnplanet.com!icet.net.nih.gov!news From: Jonathan Epstein Newsgroups: bionet.software Subject: Re: W3 interface to search SwissPROT with two or more peptide sequences at once Date: Mon, 06 Jul 1998 11:23:23 -0400 Organization: National Institutes of Health Lines: 32 Message-ID: <35A0EBEB.442D53FF@nih.gov> References: NNTP-Posting-Host: 137.187.221.54 Mime-Version: 1.0 Content-Type: text/plain; charset=iso-8859-1 Content-Transfer-Encoding: 8bit X-Mailer: Mozilla 4.05 [en] (Win95; I) To: Uwe Baumert I'm not sure if this will help you, but you may want to try ProteinProspector, since you are working with trypsin digests: http://prospector.ucsf.edu/ - Jonathan Uwe Baumert wrote: > > Hi, > > I'm looking for an W3 interface to SwissPROT that allows us to search with > two or more peptide sequences (12-18 aa). The peptides derived from > trypsin digestions. Additional information that can be provided are pI and > MW of the undigested protein. All on-line tools I looked so far (starting > with the Tools page at expasy) need at least one sequence and/or pI and/or > MW and/or several MS/MS or MALDI data entries and/or sequence tags. Since > the genome of "our working object" is not subject of a genome project, we > can only look for homology. > > Each peptide alone gives several hits (about 60 % homology) using FASTA > but no hits using BLAST. > > Thank you in advance, > > Uwe Baumert > > -- > Institut für Allgemeine Zoologie und Genetik > Westf. Wilhelms-Universität > Schloßplatz 5 Fax : +49 251 83-24723 > D-48149 Münster, Germany Tel.: +49 251 83-24675 From owner-software@net.bio.net Sun Jul 05 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!newsxfer3.itd.umich.edu!news.eecs.umich.edu!news.bu.edu!not-for-mail From: Robert Negm Newsgroups: bionet.software Subject: StrainMan Date: Mon, 06 Jul 1998 16:08:06 -0400 Organization: Caesar Software, LLC Lines: 29 Message-ID: <35A12EA5.5DED87F3@caesarsoftware.com> References: <358E9E1C.D565F93C@caesarsoftware.com> <3597C96A.99EED156@caesarsoftware.com> Reply-To: negm@caesarsoftware.com NNTP-Posting-Host: mac031.hematol.bmc.org Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii; x-mac-type="54455854"; x-mac-creator="4D4F5353" Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 4.04 (Macintosh; I; PPC) To: "Richard P. Grant" Dear Richard, We will send you a copy of StrainMan for Windows or Macintosh on CD-ROM by traditional mail. Thank you for your interest in StrainMan. Please let me know if you have any questions regarding StrainMan. The staff at Caesar Software are dedicated to making the best microbial database ever developed. Sincerely, Robert Negm, PhD Scientific Advisor, Caesar Software, LLC negm@caesarsoftware.com http://www.caesarsoftware.com Richard P. Grant wrote: > Hi, > > It's actually the Mac version I want, it's the proxy which is NT . . . > > And sending a file that size will /really/ mess up MS Exchange server > under NT (ouch!). > > Richard > From owner-software@net.bio.net Mon Jul 06 23:00:00 1998 Newsgroups: bionet.general,bionet.software Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!ix.netcom.com!sjeffers From: sjeffers@netcom.com (Sandy Jeffers) Subject: Interesting survey Message-ID: Organization: Netcom On-Line Services Date: Tue, 7 Jul 1998 06:20:15 GMT Lines: 15 Sender: sjeffers@netcom9.netcom.com Xref: biosci bionet.general:30358 bionet.software:21377 All, Here's a pointer to an interesting survey on the future of computer systems in biology/ computational chemistry: http://www.markettools.com/projects/jason/survey.pl You even get a $10 gift certificate for use at CDNow (online music store) if you participate. Let me know what you think. Regards, Sandy From owner-software@net.bio.net Mon Jul 06 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!howland.erols.net!woodstock.news.demon.net!demon!news.demon.co.uk!demon!mail2news.demon.co.uk!not-for-mail From: amartin@stagleys.demon.co.uk (Andrew Martin) Newsgroups: bionet.software Subject: Re: BABEL and torlist Date: Mon, 6 Jul 1998 18:33:51 GMT Organization: Private Address Message-ID: References: <359B78BB.BB70840B@mp-sun1.informatik.uni-mannheim.de> X-Trace: mail2news.demon.co.uk 899784937 mail2news:18758 mail2news mail2news.demon.co.uk X-Complaints-To: abuse@demon.net X-Mail2News-Path: news.demon.net!post-11.mail.demon.net!post.mail.demon.net![194.222.20.72]!stagleys.demon.co.uk X-Newsreader: TIN [version 1.2 PL2] Lines: 42 Bernard Murray (bpmurray*STUFFER*@socrates.ucsf.edu) wrote: : In article <359B78BB.BB70840B@mp-sun1.informatik.uni-mannheim.de>, Eckart : Bindewald wrote: : > Hello! : > : > I am trying to convert a protein pdb file into a list of its torsion : > angles. : > The program "babel" version 1.6 supports an output format "torlist". Who : > has experience with that format? Where is it defined? : > I expect "torlist" to be a list of torsion angles of a molecule. But the : > results are differenct than the torsion anlges computed with procheck. : > Who can help? : > : > Thanks, : > Eckart Bindewald : I am sorry I am not familiar with this version of Babel but if you : want more opinions on torsions... : I am not sure what platform you are using but if you have access : to a C compiler you can download, compile and run Andrew Martin's : "torsions" program; : ftp://bsmcha1.biochem.ucl.ac.uk/pub/martin/torsions.c Thanks for the recommendation (I was going to do so myself, but you've done it for me :-) However, I would prefer that people download via my web page: http://www.biochem.ucl.ac.uk/~martin/programs/ This just takes you through a simple registration process so I can keep people informed of updates and keep a rough count of the number of users. Best wishes, Andrew Martin From owner-software@net.bio.net Mon Jul 06 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!news-peer.gip.net!news.gsl.net!gip.net!news-peer.sprintlink.net!news.sprintlink.net!vixen.cso.uiuc.edu!dhardy From: dhardy@students.uiuc.edu (david joseph hardy) Newsgroups: bionet.software Subject: NAMD (parallel molecular dynamics) 1.5 beta 6 available Date: 7 Jul 1998 22:38:20 GMT Organization: University of Illinois at Urbana-Champaign Lines: 83 Message-ID: <6nu80s$aj0$1@vixen.cso.uiuc.edu> NNTP-Posting-Host: ux9.cso.uiuc.edu Announcing the release of NAMD version 1.5 beta 6 ------------------------------------------------- The Theoretical Biophysics group at the Beckman Institute, the University of Illinois would like to announce the availability of version 1.5 beta 6 of NAMD, a high-performance molecular mechanics program for simulating large biomolecular systems on parallel and distributed computers. This software is being made available to the molecular modeling community free of charge and includes commented source code and extensive documentation. New in this version ------------------- * Enhanced performance by as much as 30%. * Modified to work with the latest version of DPMTA (2.7). * Included DPMTA source to make installation easier. * Simplified build process, fewer options to specify, better documentation. * Several bug fixes. ==================== Basic information about NAMD ====================== Obtaining NAMD -------------- A more complete description of NAMD is available on the NAMD home page: http://www.ks.uiuc.edu/Research/namd/ The software itself is available via anonymous ftp in the directory: ftp://ftp.ks.uiuc.edu/pub/mdscope/namd/ Email questions to namd@ks.uiuc.edu. Features -------- Efficient full electrostatics: NAMD incorporates the Distributed Parallel Multiple Tree Algorithm (DPMTA) developed by the Scientific Computing Group at Duke University to provide full electrostatic interactions in O(N) time. To further reduce the computational cost, DPMTA is integrated using a multiple timestep integration scheme which computes full electrostatic interactions only periodically during the simulation. Scalable parallelism: NAMD has an efficient parallel design that allows large systems to scale well to many processors. The use of a spatial decomposition scheme combined with message-driven execution achieves load balance and the overlap of communication and computation. Modifiable: A major design goal of NAMD is to allow researchers to implement new algorithms and techniques easily. To achieve this, NAMD design and implementation is fully documented in the NAMD Programmer's Guide. NAMD has an object-oriented design implemented in C++ to provide a high degree of modularity and data abstraction. Portable: For communication, NAMD uses PVM (Parallel Virtual Machine) from Oak Ridge National Laboratories, which has itself been ported to most architectures. Porting NAMD is then simply a matter of having PVM and a reasonable C++ compiler. We have successfully ported NAMD to all of our UNIX computers, which include HP, SGI, and Sun, both single processor and shared memory multiprocessor. Compatibility with X-PLOR: The input and output files used by NAMD are identical to those used by the program X-PLOR. Thus, simulations can be easily migrated between the two packages, allowing the output of NAMD to be analyzed using X-PLOR or any other tool built for these file formats. Standard MD features: NAMD implements standard molecular dynamics features such as energy minimization, velocity rescaling, spherical boundary conditions, harmonic constraints, and Langevin dynamics. ========================================================================== Theoretical Biophysics Group NIH Resource for Macromolecular Modeling and Bioinformatics Beckman Institute for Advanced Science and Technology University of Illinois at Urbana-Champaign David Hardy namd@ks.uiuc.edu July 7, 1998 From owner-software@net.bio.net Mon Jul 06 23:00:00 1998 Path: biosci!NBRF.GEORGETOWN.EDU!MARZEC From: MARZEC@NBRF.GEORGETOWN.EDU ("Christopher R. Marzec") Newsgroups: bionet.software Subject: PIRALN Protein Sequence Alignment Database available Date: 7 Jul 1998 05:48:37 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 58 Sender: daemon@net.bio.net Distribution: world Message-ID: <01IZ42SS8N3M9357HR@NBRF.Georgetown.Edu> NNTP-Posting-Host: net.bio.net The PIRALN Protein Sequence Alignment Database is a database of protein alignments produced by L.-S. Yeh, G.Y. Srinivasarao and C.R. Marzec of NBRF/PIR. It is derived from sequences in the PIR-International Protein Sequence Database. Alignment entries are one of three types: sequences from one family which are less than 55% different from each other, sequences representing various families within a superfamily or sequence segments corresponding to some homology domain found in multiple proteins. Release 20.0, June 1998, of the PIRALN database contains a total of 3503 alignments, with 41,389 members. There are 2113 family, 1026 superfamily and 364 homology domain alignments. These alignments are curated and contain only representative sequences; alignment entries are not necessarily complete. The information contained in a PIRALN entry is divided into twelve sections. The sections are listed below in the order in which they occur in the entry. Header - entry beginning and identifier Title - title of the alignment Alternate names - alternate names for the group Date - creation, sequence revision and text revision dates Members - PIR entry codes of protein sequences used in the alignment Members Titles - PIR titles of sequences used in the alignment Other members - other members of the group not represented on the alignment Comment - comment lines Keywords - keywords present in all the members of the alignemnt Other keywords - keywords not common to every member of the alignment Alignment - alignment of sequences Matrix - matrix of percent differences The Alignment database has been integrated with the ATLAS multidatabase information retrieval system, developed at PIR, which provides full access to the data. The Alignment database can be accessed via the WWW at www-nbrf.georgetown.edu/pir and the "Atlas of Protein and Genomic Sequences" CD-ROM available from the PIR-International centers in the US, Europe, and Japan. For anonymous FTP download go to the PIR FTP site at address NBRF.Georgetown.edu directory [ANONYMOUS.PIR.ALIGNMENT]. Techical questions regarding PIRALN should be directed to Christopher Marzec and other questions to Lai-Su Yeh or Geetha Srinivasarao at E-mail: marzec, yeh or geetha @nbrf.georgetown.edu Regards, Christopher R. Marzec Database Manager PIR-International Protein Sequence Database National Biomedical Research Foundation Washington, DC 20007 MARZEC@NBRF.Georgetown.Edu voice: (202) 687-2121 fax: (202) 687-1662 From owner-software@net.bio.net Mon Jul 06 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!nyd.news.ans.net!newsjunkie.ans.net!newsfeeds.ans.net!news1.rmi.net!not-for-mail From: richard_steinman@cmagroup.com Newsgroups: misc.jobs.offered,bionet.software Subject: Florida; Sr. Software Engineer; NT, C++, DICOM, Imaging Date: 7 Jul 1998 16:13:59 GMT Organization: Career Marketing Associates Lines: 27 Message-ID: <6nthg7$1al$1@news1.rmi.net> NNTP-Posting-Host: 206.247.5.4 West Palm, Florida; Sr. Software Engineer; NT, C++, DICOM, Imaging **We are also working similar medical imaging software positions for clients in NE USA, Midwest, PNW, CA and BC Canada. -Senior Software Engineer -Southeast Florida Coastal -Salaried, Full-Time, Excellent Benefits (Relocation Assistance Available) Medical DICOM knowledge would be a major plus. Experience with C/C++ and NT required. Image manipulation, compression, edge detection, analysis, all good things to have. Please refer to JO# 5253RJS in your response. richard_steinman@cmagroup.com Richard Steinman Team Leader rjs@cmagroup.com IT & Software Solutions Team Career Marketing Associates http://www.cmagroup.com/IT.html From owner-software@net.bio.net Tue Jul 07 23:00:00 1998 Path: biosci!rutgers!rockyd.rockefeller.edu!news-nysernet-5.sprintlink.net!news.sprintlink.net!128.122.253.90!newsfeed.nyu.edu!news-nyc.telia.net!howland.erols.net!newsfeed.wli.net!nntp2.dejanews.com!nnrp1.dejanews.com!not-for-mail From: dlafonta@courrier.usherb.ca Newsgroups: bionet.software Subject: Covariation software Date: Wed, 08 Jul 1998 00:04:40 GMT Organization: Deja News - The Leader in Internet Discussion Lines: 13 Message-ID: <6nud2o$pmo$1@nnrp1.dejanews.com> NNTP-Posting-Host: 132.210.163.150 X-Article-Creation-Date: Wed Jul 08 00:04:40 1998 GMT X-Http-User-Agent: Mozilla/3.01 [fr] (Win95; I) Hello there, My question is relatively straightforward: Is there any Unix software (IRIX) that can predict some nucleotide covariations in a fasta (or msf) alignment ? Thanks for your help ! Dan. -----== Posted via Deja News, The Leader in Internet Discussion ==----- http://www.dejanews.com/rg_mkgrp.xp Create Your Own Free Member Forum From owner-software@net.bio.net Tue Jul 07 23:00:00 1998 Path: biosci!agate!logbridge.uoregon.edu!newsfeed.nyu.edu!newsfeed.gol.com!nspixp2!imnet3!news.imnet.ad.jp!crick!news.nih.go.jp!jun From: jun@nih.go.jp Newsgroups: bionet.software Subject: Re: Sequence Analysis Windows 95? Date: 08 Jul 1998 02:17:58 GMT Lines: 19 Message-ID: References: <35774B0E.4D8F4ABA@any.domain.com> NNTP-Posting-Host: watson.nih.go.jp Mime-Version: 1.0 Content-Type: text/plain; charset=US-ASCII In-reply-to: invalid.address@any.domain.com's message of 05 Jun 1998 10:34:06 +0900 In article <35774B0E.4D8F4ABA@any.domain.com> invalid.address@any.domain.com writes: > > Does anybody know if there is a good, cheap/free program (like DNA strider for > > the Mac) for sequence analysis ie restriction maps, translations etc for > > Windows 95. > > Yes, there's Prophet, a project of the NIH. You can download it from > http://www-prophet.bbn.com/ I'm trying to download Prophet5.0 for Windows from www-prophet.bbn.com. But the server said "User anonymous access denied". Reason why? -- ISHIKAWA Jun, Ph.D. Natl. Inst. of Infectious Diseases (jun@nih.go.jp) Dept. of Bioactive Molecules AUCUCCCACAUCAAAGCUUGGGCU Tokyo 162-8640, JAPAN http://www.nih.go.jp/~jun/research/ From owner-software@net.bio.net Tue Jul 07 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!news-peer.gip.net!news.gsl.net!gip.net!news-peer.sprintlink.net!news-backup-east.sprintlink.net!news.sprintlink.net!128.218.95.22!itssrv1.ucsf.edu!macmac-2.ucsf.edu!user From: bpmurray*STUFFER*@socrates.ucsf.edu (Bernard Murray) Newsgroups: bionet.software Subject: Re: Sequence Analysis Windows 95? Date: Wed, 08 Jul 1998 03:39:19 -0700 Organization: University of California, San Francisco Lines: 31 Message-ID: References: <35774B0E.4D8F4ABA@any.domain.com> <35A2FD7C.7204@arcbs.redcross.org.au> <6nv7g2$ijd$1@fu-berlin.de> NNTP-Posting-Host: macmac-2.ucsf.edu In article <6nv7g2$ijd$1@fu-berlin.de>, seidel@osiris.RZ-Berlin.MPG.DE (Henrik Seidel) wrote: > In article <35A2FD7C.7204@arcbs.redcross.org.au>, > Wayne Bolton writes: > > >> I'm trying to download Prophet5.0 for Windows from > >> www-prophet.bbn.com. But the server said "User anonymous access > >> denied". Reason why? > Is there any chance that the server is set up so that it will not accept "anonymous" as the password? If this is the case you should change your browser setting so that it sends your e-mail address instead (this is the equivalent of answering the "enter your complete e-mail address" message that some plain ftp servers give upon login). Using Netscape this is under Edit/Preferences/Advanced for other browsers there is probably an equivalent. Another problem could be that your browser refuses to accept cookies (I always do) and that their server insists on you receiving one. I'm sorry but I'm still using Win3.1x so I will not bother downloading it myself. I'm a big fan of GNU Plot for graphing but the incorporation of sequence analysis and display looks really nice so I hope they include Linux in their Unix platforms. Maybe some of this will help, Bernard -- Bernard Murray, PhD Dept. Cell. Mol. Pharmacol., UCSF, San Francisco, USA From owner-software@net.bio.net Tue Jul 07 23:00:00 1998 Path: biosci!biosci!not-for-mail From: gbirmingham64@NoSPAM-2236.yahoo.com Newsgroups: us.jobs,bionet.software Subject: MD-Environmental Data Analyst Date: 7 Jul 1998 19:43:23 -0700 Organization: Reference.Com Posting Service Lines: 45 Sender: daemon@net.bio.net Distribution: world Message-ID: <6mmb57$t0g$1@orthanc.reference.com> NNTP-Posting-Host: net.bio.net EA Engineering, an international leader in the environmental consulting industry for both private and government sectors, has the following outstanding career opportunity available: Environmental Data Analyst- Baltimore, MD Environmental professional to work with databases using MS ACCESS or ACCESS Jet Engine software. Responsibilities will include: 1)Maintaining environmental databases 2)Assisting with database migration. 3)Customizing environmental software on a project-by-project basis. 4)Importing electronic data(populating tables up and down stream). 5)Planning and supervising manual data entry of historical data. 6)Customizing report structures to meet client needs. Skills: The following are necessary for success in this position: 1) Experienced with MS ACCESS 95/97 software. 2) The ability to write programs in MS Visual Basic or similar language. 3) A career Environmental focus. 4) A general knowledge of Environmental Chemistry. 5) A general knowledge of Environmental Field Procedures (highly desired) 6) A general knowledge of ESRI ArcView ( a plus) Contact Information Gary Birmingham gbirming@eaest.com EA Engineering, Science, and Technology 11019 McCormick Road Hunt Valley, MD 21031 Fax: 410 771-1780 -------------------------------------------------------------------- Posted using Reference.COM http://WWW.Reference.COM FREE Usenet and Mailing list archive, directory and clipping service -------------------------------------------------------------------- From owner-software@net.bio.net Tue Jul 07 23:00:00 1998 Path: biosci!agate!nntp-out.monmouth.com!newspeer.monmouth.com!intgwpad.nntp.telstra.net!nsw.nntp.telstra.net!storia.ccf.health.nsw.gov.au!hd@ccf.health.nsw.gov.au From: Wayne Bolton Newsgroups: bionet.software Subject: Re: Sequence Analysis Windows 95? Date: Wed, 08 Jul 1998 15:02:52 +1000 Organization: ARCBS NSW Lines: 31 Message-ID: <35A2FD7C.7204@arcbs.redcross.org.au> References: <35774B0E.4D8F4ABA@any.domain.com> Reply-To: wbolton@arcbs.redcross.org.au NNTP-Posting-Host: 192.168.244.90 Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 3.01 (Win95; I) jun@nih.go.jp wrote: > > In article <35774B0E.4D8F4ABA@any.domain.com> invalid.address@any.domain.com writes: > > > > Does anybody know if there is a good, cheap/free program (like DNA strider for > > > the Mac) for sequence analysis ie restriction maps, translations etc for > > > Windows 95. > > > > Yes, there's Prophet, a project of the NIH. You can download it from > > http://www-prophet.bbn.com/ > > I'm trying to download Prophet5.0 for Windows from > www-prophet.bbn.com. But the server said "User anonymous access > denied". Reason why? > > -- > ISHIKAWA Jun, Ph.D. Natl. Inst. of Infectious Diseases > (jun@nih.go.jp) Dept. of Bioactive Molecules > AUCUCCCACAUCAAAGCUUGGGCU Tokyo 162-8640, JAPAN > http://www.nih.go.jp/~jun/research/ I had a similar problem. Apparently there is a restriction on downloads outside the USA. I was offerred a password to try but it didnt make any difference so I gave up. Can anybody tell me how good Prophet is - should I try again. -- Wayne Bolton Virology Department Australian Red Cross Blood Service NSW From owner-software@net.bio.net Tue Jul 07 23:00:00 1998 Path: biosci!agate!howland.erols.net!fu-berlin.de!osiris.rz-berlin.mpg.DE!seidel From: seidel@osiris.RZ-Berlin.MPG.DE (Henrik Seidel) Newsgroups: bionet.software Subject: Re: Sequence Analysis Windows 95? Date: 8 Jul 1998 07:35:30 GMT Lines: 28 Message-ID: <6nv7g2$ijd$1@fu-berlin.de> References: <35774B0E.4D8F4ABA@any.domain.com> <35A2FD7C.7204@arcbs.redcross.org.au> NNTP-Posting-Host: osiris.rz-berlin.mpg.de (141.14.132.207) Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii NNTP-Posting-User: seidel X-Access: 16 25 816 X-Trace: fu-berlin.de 899883330 19053 seidel 141.14.132.207 X-Newsreader: knews 1.0b.0 In article <35A2FD7C.7204@arcbs.redcross.org.au>, Wayne Bolton writes: >> I'm trying to download Prophet5.0 for Windows from >> www-prophet.bbn.com. But the server said "User anonymous access >> denied". Reason why? As the error message says, for some reason the ftp server www-prophet.bbn.com does not allow anonymous access. Either this is a mistake of the ftp site administrator, or it is a clever way to make the visitor hit the "Having Problems Downloading Prophet? - Click for Help" button and to enter her/his address etc. Anyway, you can try ftp://ftp.be.embnet.org/pub/biosoft/prophet/pro5setup.exe Regards --- Henrik -- Dr. Henrik Seidel, http://www.mpimg-berlin-dahlem.mpg.de/~seidel/ Max Planck Institute for Molecular Genetics 14195 Berlin, GERMANY, Ihnestrasse 73 tel: ++49-30-8413-1613 fax: ++49-30-8413-1384 see my home page for my public PGP key From owner-software@net.bio.net Tue Jul 07 23:00:00 1998 Path: biosci!biosci!not-for-mail From: "Liansheng Zheng" Newsgroups: bionet.plants,bionet.software Subject: Bioinformatics in Malibu, CA Date: 7 Jul 1998 19:44:36 -0700 Organization: EarthLink Network, Inc. Lines: 25 Sender: daemon@net.bio.net Distribution: world Message-ID: <6mp6jo$h77$1@suriname.it.earthlink.net> References: NNTP-Posting-Host: net.bio.net Xref: biosci bionet.plants:19154 bionet.software:21386 Ceres Incorporated, located in Malibu, California, is expanding its Bioinformatics Development Group and is looking for an experienced candidate who is proficient in Unix C programming and in the use of sequence analysis software. Several positions also exist for programmers with experience in Unix, C, SQL, or Web programming. Responsibilities for these positions include the development of integrated sequence analysis software, SQL-Web based database interfaces as well as production software interfaces and other programs to support Ceres's proprietary sequence databases. We provide competitive salaries and benefits. For consideration, please send your resume to: Nickolai Alexandrov, Ceres Inc, 3007 Malibu Canyon Malibu CA 90265 Tel (310) 317 8903 - Fax (310) 317 8998 nicka@ceres-inc.com From owner-software@net.bio.net Tue Jul 07 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!cam-news-reader1.bbnplanet.com!not-for-mail Message-ID: <35A378C9.22A0A4D5@bbn.com> From: Christopher Hopkins Reply-To: chopkins@bbn.com Organization: GTE Internetworking - BBN Technologies X-Mailer: Mozilla 4.05 [en] (WinNT; I) MIME-Version: 1.0 Newsgroups: bionet.software Subject: Re: Sequence Analysis Windows 95? References: <35774B0E.4D8F4ABA@any.domain.com> <35A2FD7C.7204@arcbs.redcross.org.au> <6nv7g2$ijd$1@fu-berlin.de> <6nvkrv$nuh@news.u-strasbg.fr> Content-Type: text/plain; charset=iso-8859-1 Content-Transfer-Encoding: 8bit Lines: 40 Date: Wed, 08 Jul 1998 13:51:05 GMT NNTP-Posting-Host: 128.89.8.69 NNTP-Posting-Date: Wed, 08 Jul 1998 09:51:05 EDT Distribution: world Francois Jeanmougin wrote: > They doen't seem to... > > Supported Systems: > · DecAlpha running Digital UNIX > · Sun Microsystems SPARCstations (TM) running Solaris 2.5 or higher > · Silicon Graphics computers including the SGI Indigo(TM) series running > IRIX version 6.2 or higher > > Probably we have to inform them that Linux is more and more > installed in biology labs... > Unfortunately, in order to port Prophet to Linux we would have to have a versionof the Win32 API as well as MFC for Linux. We are using a third-party version of this for the above mentioned platforms to port from Windows to Unix. As of now, there has been no mention of releasing that product for Linux. > Also the status of this program is unclear (will it stay free, > will it be delivered with sources, is it a new trap...). As of now, Prophet is free of charge if downloading over the web or via the FTP site. Sources will never be delivered as the source tree is roughly 150 meg in size. ;) As far as I know, Prophet will remain free for the life of the NIH contract that it is currently maintained under. Regards, Chris Hopkins Prophet Developer Website/FTPsite administrator From owner-software@net.bio.net Tue Jul 07 23:00:00 1998 Path: biosci!news.Stanford.EDU!agate!howland.erols.net!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!cam-news-reader1.bbnplanet.com!not-for-mail Message-ID: <35A377D9.824B96DD@bbn.com> From: Christopher Hopkins Reply-To: chopkins@bbn.com Organization: GTE Internetworking - BBN Technologies X-Mailer: Mozilla 4.05 [en] (WinNT; I) MIME-Version: 1.0 Newsgroups: bionet.software Subject: Re: Sequence Analysis Windows 95? References: <35774B0E.4D8F4ABA@any.domain.com> <35A2FD7C.7204@arcbs.redcross.org.au> <6nv7g2$ijd$1@fu-berlin.de> Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit Lines: 31 Date: Wed, 08 Jul 1998 13:47:05 GMT NNTP-Posting-Host: 128.89.8.69 NNTP-Posting-Date: Wed, 08 Jul 1998 09:47:05 EDT Distribution: world Henrik Seidel wrote: > As the error message says, for some reason the ftp server > > www-prophet.bbn.com > > does not allow anonymous access. Either this is a mistake of the ftp > site administrator, or it is a clever way to make the visitor hit the > "Having Problems Downloading Prophet? - Click for Help" button and to > enter her/his address etc. > This is completely intentional. As seen by my previous response, the FTP siteallows anonymous access to certain domains due to U.S. export control laws. > Anyway, you can try > > ftp://ftp.be.embnet.org/pub/biosoft/prophet/pro5setup.exe > Hmm. Noone else should be distributing the software especially since we have the above mentioned export issue. I'll have to look into this. If anyone is experiencing problems with downloading Prophet, please send email to prophet-help@bbn.com. Regards, Chris Hopkins From owner-software@net.bio.net Tue Jul 07 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!cam-news-reader1.bbnplanet.com!not-for-mail Message-ID: <35A376DB.9584C541@bbn.com> From: Christopher Hopkins Reply-To: chopkins@bbn.com Organization: GTE Internetworking - BBN Technologies X-Mailer: Mozilla 4.05 [en] (WinNT; I) MIME-Version: 1.0 Newsgroups: bionet.software Subject: Re: Sequence Analysis Windows 95? References: <35774B0E.4D8F4ABA@any.domain.com> <35A2FD7C.7204@arcbs.redcross.org.au> Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit Lines: 45 Date: Wed, 08 Jul 1998 13:42:50 GMT NNTP-Posting-Host: 128.89.8.69 NNTP-Posting-Date: Wed, 08 Jul 1998 09:42:50 EDT Distribution: world Wayne - Please send me some email and we can determine why you were not able to download the software. Thanks. Regards, Chris Hopkins Wayne Bolton wrote: > jun@nih.go.jp wrote: > > > > In article <35774B0E.4D8F4ABA@any.domain.com> invalid.address@any.domain.com writes: > > > > > > Does anybody know if there is a good, cheap/free program (like DNA strider for > > > > the Mac) for sequence analysis ie restriction maps, translations etc for > > > > Windows 95. > > > > > > Yes, there's Prophet, a project of the NIH. You can download it from > > > http://www-prophet.bbn.com/ > > > > I'm trying to download Prophet5.0 for Windows from > > www-prophet.bbn.com. But the server said "User anonymous access > > denied". Reason why? > > > > -- > > ISHIKAWA Jun, Ph.D. Natl. Inst. of Infectious Diseases > > (jun@nih.go.jp) Dept. of Bioactive Molecules > > AUCUCCCACAUCAAAGCUUGGGCU Tokyo 162-8640, JAPAN > > http://www.nih.go.jp/~jun/research/ > > I had a similar problem. Apparently there is a restriction on downloads > outside the USA. I was offerred a password to try but it didnt make any > difference so I gave up. > > Can anybody tell me how good Prophet is - should I try again. > -- > Wayne Bolton > > Virology Department > Australian Red Cross Blood Service NSW From owner-software@net.bio.net Tue Jul 07 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!cam-news-reader1.bbnplanet.com!not-for-mail Message-ID: <35A37693.43F091A@bbn.com> From: Christopher Hopkins Reply-To: chopkins@bbn.com Organization: GTE Internetworking - BBN Technologies X-Mailer: Mozilla 4.05 [en] (WinNT; I) MIME-Version: 1.0 Newsgroups: bionet.software Subject: Re: Sequence Analysis Windows 95? References: <35774B0E.4D8F4ABA@any.domain.com> Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit Lines: 42 Date: Wed, 08 Jul 1998 13:41:39 GMT NNTP-Posting-Host: 128.89.8.69 NNTP-Posting-Date: Wed, 08 Jul 1998 09:41:39 EDT Distribution: world jun@nih.go.jp wrote: >I'm trying to download Prophet5.0 for Windows from >www-prophet.bbn.com. But the server said "User anonymous access >denied". Reason why? I currently administer the www-prophet.bbn.com website. Due to export control laws we are unable to distribute Prophet outside the U.S. without first obtaining address information of the person wishing to download. The FTP site restricts sites based on the domain name. Also, if DNS fails then the FTP site will deny anonymous access. We do allow for anonymous access to those sites that are recognized as "within the U.S." (with some margin of error of course). These are sites like .edu, .gov, .com, etc. If you have any problems downloading, please send mail to prophet-help@bbn.com. Thanks. Regards, Chris Hopkins jun@nih.go.jp wrote: > In article <35774B0E.4D8F4ABA@any.domain.com> invalid.address@any.domain.com writes: > > > > Does anybody know if there is a good, cheap/free program (like DNA strider for > > > the Mac) for sequence analysis ie restriction maps, translations etc for > > > Windows 95. > > > > Yes, there's Prophet, a project of the NIH. You can download it from > > http://www-prophet.bbn.com/ > > I'm trying to download Prophet5.0 for Windows from > www-prophet.bbn.com. But the server said "User anonymous access > denied". Reason why? > > -- > ISHIKAWA Jun, Ph.D. Natl. Inst. of Infectious Diseases > (jun@nih.go.jp) Dept. of Bioactive Molecules > AUCUCCCACAUCAAAGCUUGGGCU Tokyo 162-8640, JAPAN > http://www.nih.go.jp/~jun/research/ From owner-software@net.bio.net Tue Jul 07 23:00:00 1998 Path: biosci!agate!howland.erols.net!news-peer.sprintlink.net!news-nysernet-5.sprintlink.net!news.sprintlink.net!128.122.253.90!newsfeed.nyu.edu!newsfeed.sgi.net!nntp.itis.com!news.doit.wisc.edu!ebv.oncology.wisc.edu!aiyar From: aiyar@ebv.oncology.wisc.edu (Ashok Aiyar) Newsgroups: bionet.software Subject: Re: Sequence Analysis Windows 95? Date: 8 Jul 1998 13:18:47 GMT Organization: Sugden Lab, McArdle Laboratory for Cancer Research, UW-Madison Lines: 26 Message-ID: References: <35774B0E.4D8F4ABA@any.domain.com> <35A2FD7C.7204@arcbs.redcross.org.au> <6nv7g2$ijd$1@fu-berlin.de> <6nvkrv$nuh@news.u-strasbg.fr> Reply-To: aiyar@ebv.oncology.wisc.edu NNTP-Posting-Host: ebv.oncology.wisc.edu Mime-Version: 1.0 Content-Type: text/plain; charset=iso-8859-1 Content-Transfer-Encoding: 8bit X-Newsreader: slrn (0.9.5.2 UNIX) On 8 Jul 1998 11:23:43 GMT, Francois Jeanmougin (pingouin@crystal.u-strasbg.fr) wrote: >Supported Systems: >· DecAlpha running Digital UNIX >· Sun Microsystems SPARCstations (TM) running Solaris 2.5 or higher >· Silicon Graphics computers including the SGI Indigo(TM) series running >IRIX version 6.2 or higher > > Probably we have to inform them that Linux is more and more >installed in biology labs... I know they have been sent ail several times specifically requesting a Linux port. So far they have not responded. > Also the status of this program is unclear (will it stay free, >will it be delivered with sources, is it a new trap...). I don't believe that they intend to ever release their sources. Later, Ashok -- Ashok Aiyar, Ph.D. McArdle Laboratory for Cancer Research aiyar@ebv.oncology.wisc.edu From owner-software@net.bio.net Tue Jul 07 23:00:00 1998 Path: biosci!agate!logbridge.uoregon.edu!news-peer.gip.net!news-raspail.gip.net!news.gsl.net!gip.net!oleane!jussieu.fr!univ-lille1.fr!u-strasbg.fr!news From: pingouin@crystal.u-strasbg.fr (Francois Jeanmougin) Newsgroups: bionet.software Subject: Re: Sequence Analysis Windows 95? Date: 8 Jul 1998 11:23:43 GMT Organization: CRC - Universite Louis Pasteur - Strasbourg France Lines: 29 Message-ID: <6nvkrv$nuh@news.u-strasbg.fr> References: <35774B0E.4D8F4ABA@any.domain.com> <35A2FD7C.7204@arcbs.redcross.org.au> <6nv7g2$ijd$1@fu-berlin.de> Reply-To: jeanmougin@igbmc.u-strasbg.fr NNTP-Posting-Host: crystal.u-strasbg.fr Mime-Version: 1.0 Content-Type: text/plain; charset=iso-8859-1 Content-Transfer-Encoding: 8bit X-Newsreader: knews 0.9.8 Mail-Copies-To: never In article , bpmurray*STUFFER*@socrates.ucsf.edu (Bernard Murray) writes: > I'm sorry but I'm still using Win3.1x so I will not bother > downloading it myself. I'm a big fan of GNU Plot for graphing > but the incorporation of sequence analysis and display looks > really nice so I hope they include Linux in their Unix platforms. They doen't seem to... Supported Systems: · DecAlpha running Digital UNIX · Sun Microsystems SPARCstations (TM) running Solaris 2.5 or higher · Silicon Graphics computers including the SGI Indigo(TM) series running IRIX version 6.2 or higher Probably we have to inform them that Linux is more and more installed in biology labs... Also the status of this program is unclear (will it stay free, will it be delivered with sources, is it a new trap...). Wait and see... François. -- François Jeanmougin | groupe de bioinformatique / bioinformatics groupe tel:(+33) 3 88 65 32 71 | IGBMC BP 163 67404 Illkirch France From owner-software@net.bio.net Tue Jul 07 23:00:00 1998 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!news2.ais.net!jamie!ais.net!howland.erols.net!woodstock.news.demon.net!demon!dispose.news.demon.net!demon!news-lond.gip.net!news.gsl.net!gip.net!demeter.clara.net!news.clara.net!peer.news-uk.wisper.net!peer.news-uk.wisper.net!newsgate.cistron.nl!het.net!newsfeed.wirehub.nl!news.wirehub.nl!not-for-mail From: Hans Wolters Newsgroups: alt.journalism.newspapers,bionet.software,de.comm.software.misc,chinese.comp.software,clari.tw.computers.pc.software.releases,comp.software.international,de.comm.software.crosspoint,misc.forsale.computers.mac-specific.software,news.software.misc,relcom.commerce.software,su.software.tools,clari.biz.industry.misc.releases Subject: Get your SEARCH started from here Date: Wed, 08 Jul 1998 23:50:41 +0200 Organization: Wirehub! Internet Message-ID: <35A3E9B0.6F95EFCC@gelrevision.nl> NNTP-Posting-Host: 195.86.58.223 Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 4.05 [en] (Win95; I) Lines: 10 If you want to find News, Stock, Sports, Software, People, etc....... than please take a look at the following site and Download you own free search engine. Just a tiny applet (made with the 1.0 Java JDK) allows your visitors to search from your site at more then 40 engines all over the world. http://www.geocities.com/BourbonStreet/Bayou/1162/ Regards Hans From owner-software@net.bio.net Tue Jul 07 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!news.bbnplanet.com!logbridge.uoregon.edu!news-peer.gip.net!news-lond.gip.net!news.gsl.net!gip.net!dispose.news.demon.net!demon!peer.news.zetnet.net!peer.news.bb.u-net.net!u-net!yama.mcc.ac.uk!hydraulix.bangor.ac.uk!manager From: Keith James Newsgroups: bionet.software Subject: Re: Sequence Analysis Windows 95? Date: 08 Jul 1998 21:30:58 +0100 Organization: University of Wales, Bangor. Sender: bss194@pwilliams.bangor.ac.uk Message-ID: References: <35774B0E.4D8F4ABA@any.domain.com> <35A2FD7C.7204@arcbs.redcross.org.au> <6nv7g2$ijd$1@fu-berlin.de> <6nvkrv$nuh@news.u-strasbg.fr> NNTP-Posting-Host: pwilliams.bangor.ac.uk X-Newsreader: Gnus v5.3/Emacs 19.34 Lines: 33 >>>>> "Francois" == Francois Jeanmougin writes: Francois> Supported Systems: · DecAlpha running Digital UNIX Francois> · Sun Microsystems SPARCstations (TM) running Solaris Francois> 2.5 or higher · Silicon Graphics computers including Francois> the SGI Indigo(TM) series running IRIX version 6.2 or Francois> higher Francois> Probably we have to inform them that Linux is more and Francois> more installed in biology labs... I recall asking them about Linux support some months ago and didn't get a supportive response. I tried the windows version to see if the package was worth pursuing. FWIW, my impression of the sequence analysis utilities was that they were adequate in terms of functions and were visually appealing, but had a very inflexible interface. The GUI could really slow things down and there was no apparent interface to any scripting facility to compensate for this. (This is an implied criticism of windows' lack of such a facility). Given the price, one can't complain. I find that on Linux GDE is superior, but that's largely because it can give output in awk/Perl-friendly plain text. Also, if I had the money for a Dec, I wouldn't be worried about paying out for nicer commercial package instead. -- Keith James -- k.james@bangor.ac.uk -- http://www.bangor.ac.uk/~bss194 Biodegradation Group - School of Biological Sciences - University of Wales PGP preferred when your e-mail is not for 3rd parties - www for Public Key Public Key fingerprint is 8F 60 5A 4D DB A9 23 65 7D 95 62 19 F0 9C A8 E0 From owner-software@net.bio.net Tue Jul 07 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!news.bbnplanet.com!newsfeed.direct.ca!feed.nntp.acc.ca!cyclone.mbnet.mb.ca!canopus.cc.umanitoba.ca!frist From: frist@cc.umanitoba.ca (Brian Fristensky) Newsgroups: bionet.software Subject: GDE under Solaris 2.6 Date: 8 Jul 1998 20:23:55 GMT Organization: University of Manitoba, Winnipeg, Manitoba, Canada Lines: 16 Message-ID: <6o0kgr$28s$1@canopus.cc.umanitoba.ca> NNTP-Posting-Host: brassica.cc.umanitoba.ca I have heard that Solaris 2.6 may not run OpenWindows applications. I don't know to what extent that may be true. Has anyone tried running GDE under Solaris 2.6? =============================================================================== Brian Fristensky | "I heard from one reader who said that at his Department of Plant Science | site, Linux on a 486 is outperforming University of Manitoba | WindowsNT on a 200 MHz Pentium, and he has Winnipeg, MB R3T 2N2 CANADA | Linux machines that have been running frist@cc.umanitoba.ca | _without interruption_ since before Office phone: 204-474-6085 | WindowsNT 4.0 was released." FAX: 204-474-7528 | http://home.cc.umanitoba.ca/~frist/ John Kirch, Networking Consultant =============================================================================== From owner-software@net.bio.net Tue Jul 07 23:00:00 1998 Path: biosci!rutgers!rockyd.rockefeller.edu!newsfeed.nyu.edu!logbridge.uoregon.edu!newspeer.monmouth.com!btnet-peer!btnet!dispose.news.demon.net!demon!news.demon.co.uk!demon!mail2news.demon.co.uk!not-for-mail From: amartin@stagleys.demon.co.uk (Andrew Martin) Newsgroups: bionet.software Subject: Re: Wanted program for superimposing peptides/proteins Date: Tue, 7 Jul 1998 21:54:37 GMT Organization: Private Address Distribution: bionet Message-ID: References: <6npvdm$cbn@mserv1.dl.ac.uk> X-Trace: mail2news.demon.co.uk 899871338 mail2news:3296 mail2news mail2news.demon.co.uk X-Complaints-To: abuse@demon.net X-Mail2News-Path: news.demon.net!post-11.mail.demon.net!post.mail.demon.net![194.222.20.72]!stagleys.demon.co.uk X-Newsreader: TIN [version 1.2 PL2] Lines: 31 Sangeeta Sawant (sangeeta@bioinfo.ernet.in) wrote: : Hi all! : I would like to know if there is any software/program (preferably : shareware/public-domain) which allows to superimpose several : protein/peptide conformations onto one (say, template confo.) in a batch : mode. The program may be for either IRIX or OS2 (DEC-ALPHA) or SOLARIS or : LINUX or DOS (No Mac-OS please). Any help will be appreciated. : Thanks in advance. : Sangeeta Try my ProFit program - designed for protein fitting, but should be fine for what you want. It uses a script language to control the fitting and you can easily write a script to run through a whole set of fits and output the results. It now has around 250 registered users. It's written for Unix/Linux, but I've had reports of people using it under DOS with only minor changes (to things like filenames, cos the source filenames are too long for DOS) - there are some instructions with the source. You can get it from: http://www.biochem.ucl.ac.uk/~martin/programs/ Best wishes, Andrew Martin From owner-software@net.bio.net Tue Jul 07 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!news.bbnplanet.com!news1.best.com!newshub.sdsu.edu!franklin.ljcrf.edu!not-for-mail From: greg@franklin.burnham-inst.org () Newsgroups: bionet.software Subject: Re: Sequence Analysis Windows 95? Date: 8 Jul 1998 17:06:26 GMT Organization: COMPUTATIONAL BIOLOGY at The BURNHAM INSTITUTE Lines: 10 Distribution: world Message-ID: <6o08ui$5rq$1@franklin.ljcrf.edu> References: <35774B0E.4D8F4ABA@any.domain.com> NNTP-Posting-Host: franklin.ljcrf.edu X-Newsreader: TIN [UNIX 1.3 950824BETA PL0] Christopher Hopkins (chopkins@bbn.com) wrote: Well done on creating a comprehensive and ambitious piece of software and allowing it to be freely used. : versionof the Win32 API as well as MFC for Linux. ^^^ I suppose this explains the huge size mentioned in a previous post in this thread; From owner-software@net.bio.net Tue Jul 07 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!cam-news-reader1.bbnplanet.com!not-for-mail Message-ID: <35A3C3BB.4CE735B4@bbn.com> From: Christopher Hopkins Reply-To: chopkins@bbn.com Organization: GTE Internetworking - BBN Technologies X-Mailer: Mozilla 4.05 [en] (WinNT; I) MIME-Version: 1.0 Newsgroups: bionet.software Subject: Re: Sequence Analysis Windows 95? References: <35774B0E.4D8F4ABA@any.domain.com> <6o08ui$5rq$1@franklin.ljcrf.edu> Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit Lines: 29 Date: Wed, 08 Jul 1998 19:10:48 GMT NNTP-Posting-Host: 128.89.8.69 NNTP-Posting-Date: Wed, 08 Jul 1998 15:10:48 EDT Distribution: world greg@franklin.burnham-inst.org wrote: > Christopher Hopkins (chopkins@bbn.com) wrote: > > Well done on creating a comprehensive and ambitious piece of > software and allowing it to be freely used. > Thanks. ;) > : versionof the Win32 API as well as MFC for Linux. > ^^^ > > I suppose this explains the huge size mentioned in a previous post > in this thread; Actually, the source tree is outside the realm of MFC. All of the VC++ projects and source code that make Prophet take up about 150 meg. One thing I didn't mention about distributing the source code (and a rather important one) is that the code is copyrighted by the NIH and they do not wish to distribute the code. Regards, Chris Hopkins From owner-software@net.bio.net Tue Jul 07 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!news.bbnplanet.com!newsfeed.direct.ca!fu-berlin.de!jussieu.fr!univ-lille1.fr!u-strasbg.fr!frenzy.u-strasbg.fr!francis.durst From: francis.durst@bota-ulp.u-strasbg.fr (Francis Durst) Newsgroups: bionet.software Subject: Re: Sequence Analysis Windows 95? Date: Wed, 8 Jul 1998 12:56:39 LOCAL Organization: CNRS Lines: 38 Message-ID: References: <35774B0E.4D8F4ABA@any.domain.com> NNTP-Posting-Host: frenzy.u-strasbg.fr X-Newsreader: Trumpet for Windows [Version 1.0 Rev B.7] In article jun@nih.go.jp writes: >From: jun@nih.go.jp >Subject: Re: Sequence Analysis Windows 95? >Date: 08 Jul 1998 02:17:58 GMT >In article <35774B0E.4D8F4ABA@any.domain.com> invalid.address@any.domain.com >writes: >> > Does anybody know if there is a good, cheap/free program (like DNA strider >for >> > the Mac) for sequence analysis ie restriction maps, translations etc for >> > Windows 95. >> >> Yes, there's Prophet, a project of the NIH. You can download it from >> http://www-prophet.bbn.com/ >I'm trying to download Prophet5.0 for Windows from >www-prophet.bbn.com. But the server said "User anonymous access >denied". Reason why? You have to put them an e-mail. They give a password, and you download by ftp using this pass. I did, it works, the program also. It is rather enormous and does a lot of different things (we call this 'une usine a gaz').It reads nuc seqs, does restriction, translation.. and pep seqs, does clivage and reverse translation. It has a nice interface to the web for doing direct blasts with bits of seqs and so on. Probably more but I haven't had time yet to explore All the best Francis =============================================================== Francis Durst, IBMP Strasbourg, France From owner-software@net.bio.net Wed Jul 08 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!rill.news.pipex.net!pipex!server1.netnews.ja.net!news.nott.ac.uk!usenet From: plxsrt@pln1.nott.ac.uk Newsgroups: bionet.software Subject: Re: Sequence Analysis Windows 95? Date: Thu, 09 Jul 1998 11:35:01 GMT Organization: Cripps Computing Centre, The University of Nottingham Lines: 8 Message-ID: <6o29r7$pkl@paperboy.ccc.nottingham.ac.uk> References: <35774B0E.4D8F4ABA@any.domain.com> NNTP-Posting-Host: dmg.life.nottingham.ac.uk X-Newsreader: Forte Free Agent 1.0.82 I'm sure prophet looses a lot of potential users because of the download problems. Why can't the web page specifically tell the downloader of the non-USA restrictions rather than give them a cryptic FTP error? Simon T From owner-software@net.bio.net Wed Jul 08 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!news-peer.gip.net!news.gsl.net!gip.net!newsfeed.internetmci.com!208.159.126.161!news.mci2000.com!not-for-mail From: "Woody" Newsgroups: bionet.software References: <1998060821163900.RAA07411@ladder03.news.aol.com> Subject: Re: internet connection Lines: 39 X-Newsreader: Microsoft Outlook Express 4.72.3110.1 X-MimeOLE: Produced By Microsoft MimeOLE V4.72.3110.3 Message-ID: Date: Thu, 09 Jul 1998 07:27:35 GMT NNTP-Posting-Host: 166.55.208.135 NNTP-Posting-Date: Thu, 09 Jul 1998 07:27:35 GMT Organization: MCI2000 To have a direct link to the internet, you need a direct connection to the internet. You can do that with a network card and an ISP providing you the connection. With modem or ISDN you can connect to the internet when you want, in that case you need a modem and an ISP. This applies to a single computer. For a group of networked computers, you can use one computer as a gateway. All networked computers can access internet through this computer. However these computers need to have their proxy setting filled. There are several softwares can be the proxy server, Microsoft has one, Wingate is a good choice too. Woody BTJohn5656 wrote in message <1998060821163900.RAA07411@ladder03.news.aol.com>... >how can I connect my computer running windows nt dirctly to the internet ? I >mean what kind of equipment do I need? what kind of phone lines? > >please help me answer the questions above in relation to the following >scenarios: > ># when I have only one computer ># when I have a group of netowrked computers > > >Bell John >-------------------------------------------------------------------------- >---------------------------------------------- >http://www.totalmarketing.com/125430 > >Special Interest Videos & CD Roms >Over 10,000 titles in stock. From owner-software@net.bio.net Wed Jul 08 23:00:00 1998 Path: biosci!rutgers!nntp.upenn.edu!newshub.northeast.verio.net!howland.erols.net!news.sgi.com!news.tamu.edu!news.utdallas.edu!nrchh45.rich.nt.com!news.cyberway.com.sg!despams.ocunix.on.ca!resurrector!not-for-mail Message-ID: X-Reposted-By: clewis@ferret.ocunix.on.ca From: "Saratoga" Subject: REPOST: Software to help start business Newsgroups: bionet.software X-Original-Message-ID: <01bda68a$00b065e0$0100007f@default> X-Newsreader: Microsoft Internet News 4.70.1155 NNTP-Posting-Host: 203.116.123.127 Date: 3 Jul 1998 22:04:15 +0800 X-Trace: 3 Jul 1998 22:04:15 +0800, 203.116.123.127 Lines: 15 X-Original-Path: ...!su-news-hub1.bbnplanet.com!news.bbnplanet.com!newsfeed.wli.net!uunet!in3.uu.net!newsfeed.attap.net!newsvr.cyberway.com.sg!news.cyberway.com.sg!203.116.123.127 X-Comments: DtR Repost: The following Usenet article was cancelled, X-Comments: more than likely by someone other than the original poster. X-Comments: Please see the end of this posting for a copy of the cancel. X-Comments: Dave the Resurrector can be contacted at dave@ferret.ocunix.on.ca You can turn your PC into a money making machine! We currently have a turnkey software package that can help you to create a small business of your own. It contains a step by step formula that explains and teaches you how you can be your own boss. We are also looking for email processors to join us in processing emails at home. Should you be interested in these opportunities, simply reply to this post and mention which of the above you are interested in. I will rush to you all the necessary details right away. ========= WAS CANCELLED BY =======: From: "Saratoga" Subject: Software to help start business Newsgroups: bionet.software Control: cancel <01bda68a$00b065e0$0100007f@default> Message-ID: <01bdaae5$b91a8e80$2d7f74cb@default> X-Newsreader: Microsoft Internet News 4.70.1155 NNTP-Posting-Host: 203.116.121.83 Date: 9 Jul 1998 10:59:28 +0800 X-Trace: 9 Jul 1998 10:59:28 +0800, 203.116.121.83 Lines: 2 Path: ...!newsfeed.nyu.edu!btnet-peer!btnet!rill.news.pipex.net!pipex!uunet!in3.uu.net!newsfeed.attap.net!newsvr.cyberway.com.sg!news.cyberway.com.sg!203.116.121.83 From owner-software@net.bio.net Wed Jul 08 23:00:00 1998 Path: biosci!agate!howland.erols.net!news-peer.gip.net!news-raspail.gip.net!news.gsl.net!gip.net!oleane!jussieu.fr!univ-lille1.fr!u-strasbg.fr!news From: pingouin@crystal.u-strasbg.fr (Francois Jeanmougin) Newsgroups: bionet.software Subject: Re: Sequence Analysis Windows 95? Date: 9 Jul 1998 07:20:29 GMT Organization: CRC - Universite Louis Pasteur - Strasbourg France Lines: 46 Message-ID: <6o1qvt$r5h@news.u-strasbg.fr> References: <35774B0E.4D8F4ABA@any.domain.com> <35A2FD7C.7204@arcbs.redcross.org.au> <6nv7g2$ijd$1@fu-berlin.de> <6nvkrv$nuh@news.u-strasbg.fr> <35A378C9.22A0A4D5@bbn.com> Reply-To: jeanmougin@igbmc.u-strasbg.fr NNTP-Posting-Host: crystal.u-strasbg.fr Mime-Version: 1.0 Content-Type: text/plain; charset=iso-8859-1 Content-Transfer-Encoding: 8bit X-Newsreader: knews 0.9.8 Mail-Copies-To: never In article <35A378C9.22A0A4D5@bbn.com>, Christopher Hopkins writes: > Unfortunately, in order to port Prophet to Linux we would have to have a > versionof the Win32 API as well as MFC for Linux. We are using a third-party > version of > this for the above mentioned platforms to port from Windows to Unix. As of now, > > there has been no mention of releasing that product for Linux. Hmmm. I know two products that do the other job (from XWindow to Win32), that several developpers I know are using because "developping stable products under linux (unix) is easiest, in particular for trapping memory leak". Anyway, I can't see why a product that can port something to the above mentioned platforms can't port it to linux. As far as I know, this should give you a source code for XWindow, so it should compile well on all unix with apropriate libraries. Isn't it the one used by the StarOffice development team? It would be great if we can make some lobbying actions, regarding the importance of Linux in our community, so that you can provide Linux ports of your program. > As of now, Prophet is free of charge if downloading over the web or via the FTP > site. > Sources will never be delivered as the source tree is roughly 150 meg in size. Where is the problem? Lot of GNU products have such source size. Releasing the sources could help further development... > ;) As > far as I know, Prophet will remain free for the life of the NIH contract that > it is > currently maintained under. Is it possible to take a look at this contract? I know I'm paranoiac, but we had recently bad experiments from a product that slides from free to proprietary and having to recover all the data was not easy. Thanks for your answers. François. -- François Jeanmougin | groupe de bioinformatique / bioinformatics groupe tel:(+33) 3 88 65 32 71 | IGBMC BP 163 67404 Illkirch France From owner-software@net.bio.net Wed Jul 08 23:00:00 1998 Path: biosci!agate!nntp-out.monmouth.com!newspeer.monmouth.com!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!cam-news-reader1.bbnplanet.com!not-for-mail Message-ID: <35A4AFB4.2EB9645E@bbn.com> From: Christopher Hopkins Reply-To: chopkins@bbn.com Organization: GTE Internetworking - BBN Technologies X-Mailer: Mozilla 4.05 [en] (WinNT; I) MIME-Version: 1.0 Newsgroups: bionet.software Subject: Re: Sequence Analysis Windows 95? References: <35774B0E.4D8F4ABA@any.domain.com> <35A2FD7C.7204@arcbs.redcross.org.au> <6nv7g2$ijd$1@fu-berlin.de> <6nvkrv$nuh@news.u-strasbg.fr> <35A378C9.22A0A4D5@bbn.com> <6o1qvt$r5h@news.u-strasbg.fr> Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit Lines: 57 Date: Thu, 09 Jul 1998 11:57:28 GMT NNTP-Posting-Host: 128.89.8.69 NNTP-Posting-Date: Thu, 09 Jul 1998 07:57:28 EDT Distribution: world Francois Jeanmougin wrote: > In article <35A378C9.22A0A4D5@bbn.com>, > Christopher Hopkins writes: > > > Unfortunately, in order to port Prophet to Linux we would have to have a > > versionof the Win32 API as well as MFC for Linux. We are using a third-party > > version of > > this for the above mentioned platforms to port from Windows to Unix. As of now, > > > > there has been no mention of releasing that product for Linux. > > Hmmm. I know two products that do the other job (from XWindow to > Win32), that several developpers I know are using because "developping > stable products under linux (unix) is easiest, in particular for trapping > memory leak". Anyway, I can't see why a product that can port something to > the above mentioned platforms can't port it to linux. As far as I know, > this should give you a source code for XWindow, so it should compile > well on all unix with apropriate libraries. Isn't it the one used by > the StarOffice development team? > > It would be great if we can make some lobbying actions, regarding > the importance of Linux in our community, so that you can provide Linux > ports of your program. > I totally understand the importance of Linux. I run Linux at home. ;) Anyway, dueto time/budget constraints we don't have the manpower/money to devote to another port at this time. We hope to provide for more platforms in future releases though. > > As of now, Prophet is free of charge if downloading over the web or via the FTP > > site. > > Sources will never be delivered as the source tree is roughly 150 meg in size. > > Where is the problem? Lot of GNU products have such source size. > Releasing the sources could help further development... > I understated the reasons for this actually. The NIH does not wish the source codeto be distributed. > > ;) As > > far as I know, Prophet will remain free for the life of the NIH contract that > > it is > > currently maintained under. > > Is it possible to take a look at this contract? I know I'm paranoiac, > but we had recently bad experiments from a product that slides from > free to proprietary and having to recover all the data was not easy. I don't believe the contract is publicly available. Regards, Chris Hopkins Prophet Development Team From owner-software@net.bio.net Wed Jul 08 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!news.bbnplanet.com!newsfeed.wli.net!news.he.net!news.reference.com!not-for-mail From: Cori Lusk Newsgroups: bionet.general,bionet.software Subject: Survey Date: Thu, 09 Jul 1998 13:09:39 +0000 Organization: Sift, Inc. Lines: 13 Message-ID: <35A4C113.F01@oracle.enlist.com> NNTP-Posting-Host: elrond.reference.com Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 3.02Gold (WinNT; I) Xref: biosci bionet.general:30379 bionet.software:21413 I just completed a survey on computer systems in biology/ computational chemistry: http://www.markettools.com/projects/ione/survey.pl They give you a $10 gift certificate for use at CDNow (online music store) if you participate. Apparently, everyone is invited to give their $0.02 worth. Regards, Jeff Wilkins From owner-software@net.bio.net Wed Jul 08 23:00:00 1998 From: "Victor Nowecki" Newsgroups: alt.comp.software,alt.comp.software.tools,alt.fan.dean-stark.software.tester,alt.med.software,bionet.sci-resourcbionet.software.x-plor,bionet.software,bionet.software.acedb,bionet.software.contrib,bionet.software.gcg,bionet.software.pc,bionet.so Subject: Faxing software Date: Fri, 10 Jul 1998 02:12:39 -0700 Lines: 12 X-Newsreader: Microsoft Outlook Express 4.72.2106.4 X-MimeOLE: Produced By Microsoft MimeOLE V4.72.2106.4 NNTP-Posting-Host: async-47.box.net.au Message-ID: <35a4f360.0@news.box.net.au> Path: biosci!rutgers!rockyd.rockefeller.edu!newsfeed.nyu.edu!newsfeed.direct.ca!newsfeed.wli.net!uunet!in1.uu.net!news1.optus.net.au!yorrell.saard.net!news.camtech.net.au!news.box.net.au!async-47.box.net.au Xref: biosci bionet.software:21412 bionet.software.acedb:1847 bionet.software.gcg:3196 Hello Iam looking for a program that will allow me to send, as a fax format, to a fax machine. Id like to be able to click a file and send it as I see it on the monitor, may it be a database, spread sheet, HTML or whatever. If there is anything on the net that I could download to do this job?? please email me if yo u know of such software. Regards and thanks. From owner-software@net.bio.net Wed Jul 08 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!fu-berlin.de!jussieu.fr!univ-lille1.fr!u-strasbg.fr!news From: pingouin@crystal.u-strasbg.fr (Francois Jeanmougin) Newsgroups: bionet.software Subject: Re: GDE under Solaris 2.6 Date: 9 Jul 1998 07:34:54 GMT Organization: CRC - Universite Louis Pasteur - Strasbourg France Lines: 22 Message-ID: <6o1rqu$r5h@news.u-strasbg.fr> References: <6o0kgr$28s$1@canopus.cc.umanitoba.ca> Reply-To: jeanmougin@igbmc.u-strasbg.fr NNTP-Posting-Host: crystal.u-strasbg.fr Mime-Version: 1.0 Content-Type: text/plain; charset=iso-8859-1 Content-Transfer-Encoding: 8bit X-Newsreader: knews 0.9.8 Mail-Copies-To: never In article <6o0kgr$28s$1@canopus.cc.umanitoba.ca>, frist@cc.umanitoba.ca (Brian Fristensky) writes: > I have heard that Solaris 2.6 may not run OpenWindows > applications. I don't know to what extent that may > be true. Has anyone tried running GDE under Solaris 2.6? titus_bin_> ./gde ld.so.1: ./gde: fatal: libxview.so.3: open failed: No such file or directory Killed titus_bin_> uname -a SunOS titus 5.6 Generic sun4d sparc SUNW,SPARCserver-1000 titus_bin_> Well. Perhaps could we find libxview for Solaris2.6 Someone saw something like that? François. -- François Jeanmougin | groupe de bioinformatique / bioinformatics groupe tel:(+33) 3 88 65 32 71 | IGBMC BP 163 67404 Illkirch France From owner-software@net.bio.net Wed Jul 08 23:00:00 1998 From: Cornelius Krasel Subject: Re: Sequence Analysis Windows 95? Newsgroups: bionet.software References: <35774B0E.4D8F4ABA@any.domain.com> <35A2FD7C.7204@arcbs.redcross.org.au> <6nv7g2$ijd$1@fu-berlin.de> <6nvkrv$nuh@news.u-strasbg.fr> <35A378C9.22A0A4D5@bbn.com> <6o1qvt$r5h@news.u-strasbg.fr> User-Agent: tin/pre-1.4-980514 (UNIX) (Linux/2.0.34 (i486)) Date: Thu, 9 Jul 1998 17:23:28 +0200 Message-ID: NNTP-Posting-Host: wpxx02.toxi.uni-wuerzburg.de Path: biosci!news.Stanford.EDU!newsfeed.concentric.net!netnews.com!feed2.news.erols.com!erols!woodstock.news.demon.net!demon!dispose.news.demon.net!demon!newsfeed.nacamar.de!uni-erlangen.de!uni-wuerzburg.de!not-for-mail Lines: 31 Francois Jeanmougin wrote: > In article <35A378C9.22A0A4D5@bbn.com>, > Christopher Hopkins writes: >> Unfortunately, in order to port Prophet to Linux we would have to have a >> versionof the Win32 API as well as MFC for Linux. We are using a third-party >> version of this for the above mentioned platforms to port from Windows to >> Unix. As of now, there has been no mention of releasing that product for >> Linux. > > Hmmm. I know two products that do the other job (from XWindow to > Win32), that several developpers I know are using because "developping > stable products under linux (unix) is easiest, in particular for trapping > memory leak". Anyway, I can't see why a product that can port something to > the above mentioned platforms can't port it to linux. Maybe because the product itself doesn't exist for Linux? > As far as I know, > this should give you a source code for XWindow, so it should compile > well on all unix with apropriate libraries. Isn't it the one used by > the StarOffice development team? No, StarOffice uses its own proprietary library. AFAIK there is no Win32 API for Linux. --Cornelius. -- /* Cornelius Krasel, U Wuerzburg, Dept. of Pharmacology, Versbacher Str. 9 */ /* D-97078 Wuerzburg, Germany email: phak004@rzbox.uni-wuerzburg.de SP4 */ /* "Science is the game we play with God to find out what His rules are." */ From owner-software@net.bio.net Wed Jul 08 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!news-peer.gip.net!news-raspail.gip.net!news.gsl.net!gip.net!oleane!jussieu.fr!univ-lille1.fr!u-strasbg.fr!news From: pingouin@crystal.u-strasbg.fr (Francois Jeanmougin) Newsgroups: bionet.software Subject: Re: Sequence Analysis Windows 95? Date: 9 Jul 1998 12:12:37 GMT Organization: CRC - Universite Louis Pasteur - Strasbourg France Lines: 24 Message-ID: <6o2c3l$r5h@news.u-strasbg.fr> References: <35774B0E.4D8F4ABA@any.domain.com> <35A2FD7C.7204@arcbs.redcross.org.au> <6nv7g2$ijd$1@fu-berlin.de> <6nvkrv$nuh@news.u-strasbg.fr> <35A378C9.22A0A4D5@bbn.com> <6o1qvt$r5h@news.u-strasbg.fr> <35A4AFB4.2EB9645E@bbn.com> Reply-To: jeanmougin@igbmc.u-strasbg.fr NNTP-Posting-Host: crystal.u-strasbg.fr Mime-Version: 1.0 Content-Type: text/plain; charset=iso-8859-1 Content-Transfer-Encoding: 8bit X-Newsreader: knews 0.9.8 Mail-Copies-To: never In article <35A4AFB4.2EB9645E@bbn.com>, Christopher Hopkins writes: > I totally understand the importance of Linux. I run Linux at home. ;) Anyway, dueto > time/budget constraints we don't have the manpower/money to devote to another > port at this time. We hope to provide for more platforms in future releases though. Well, if it is able to run properly from a server to a Linux box under X, it's not a big problem. Can it? > I understated the reasons for this actually. The NIH does not wish the source codeto > be distributed. OK, we will discuss it with NIH if necessary. > I don't believe the contract is publicly available. hmmm. So... another question to ask to NIH... François. -- François Jeanmougin | groupe de bioinformatique / bioinformatics groupe tel:(+33) 3 88 65 32 71 | IGBMC BP 163 67404 Illkirch France From owner-software@net.bio.net Wed Jul 08 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!news.bbnplanet.com!newsfeed.wli.net!howland.erols.net!vixen.cso.uiuc.edu!news.indiana.edu!not-for-mail From: gilbertd@bio.indiana.edu (Don Gilbert) Newsgroups: bionet.software Subject: Re: GDE under Solaris 2.6 Date: 9 Jul 1998 21:44:00 GMT Organization: Biology, Indiana University - Bloomington Lines: 16 Message-ID: <6o3dj0$tcc$1@flotsam.uits.indiana.edu> References: <6o0kgr$28s$1@canopus.cc.umanitoba.ca> NNTP-Posting-Host: chipmunk.bio.indiana.edu In article <6o0kgr$28s$1@canopus.cc.umanitoba.ca>, Brian Fristensky wrote: >I have heard that Solaris 2.6 may not run OpenWindows >applications. I don't know to what extent that may >be true. Has anyone tried running GDE under Solaris 2.6? I don't use gde, but I was able to get it running w/o any problem on a sol2.6 machine. Sol2.6 does include all the old openwindows stuff as far as I can tell, though I've switched to using CDE software mostly. - don -- -- d.gilbert--biocomputing--indiana-u--bloomington-in-47405 -- gilbertd@bio.indiana.edu From owner-software@net.bio.net Wed Jul 08 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!news.bbnplanet.com!logbridge.uoregon.edu!news-peer.gip.net!news-raspail.gip.net!news.gsl.net!gip.net!oleane!jussieu.fr!saphir.jouy.inra.fr!not-for-mail From: Xavier Cousin Newsgroups: bionet.software Subject: Re: tabulated mismatches from an alignment Date: Thu, 09 Jul 1998 17:53:54 +0200 Organization: I.N.R.A. Lines: 51 Message-ID: <35A4E792.7411@ensam.inra.fr> References: <35A491A2.4931@ensam.inra.fr> NNTP-Posting-Host: cypres.jouy.inra.fr Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 3.01Gold (X11; I; HP-UX B.10.20 9000/819) Dear all, I'm looking for a program (running preferentialy on Mac or PC) creating a table of mismatches observed in an alignment To be clear : seq 1 ATGCATGCATGC seq 2 ATTCATCCTACG from A C G T A - 0 0 1 to C 0 - 2 0 G 0 1 - 0 T 1 0 1 - I know I can write a little perl script but the program is to be used without imstallation of perl on the computer (by somebody who doesn't know how to do this). Thanks for your answers Sincerly, Xavier Cousin ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Xavier Cousin cousin@ensam.inra.fr INRA - DCC tel. (33) 04 99 61 28 14 2, place Pierre Viala fax (33) 04 67 54 56 94 34060 Montpellier Cedex 1 ESTHER URL http://meleze.ensam.inra.fr/cholinesterase/ ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ -- ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Xavier Cousin cousin@ensam.inra.fr INRA - DCC tel. (33) 04 99 61 28 14 2, place Pierre Viala fax (33) 04 67 54 56 94 34060 Montpellier Cedex 1 ESTHER URL http://meleze.ensam.inra.fr/cholinesterase/ ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ From owner-software@net.bio.net Thu Jul 09 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!news-peer.gip.net!news-raspail.gip.net!news.gsl.net!gip.net!oleane!jussieu.fr!univ-lille1.fr!ciril.fr!cnusc.fr!SP2N3.U-3MRS.FR!news From: Eric Blanc Newsgroups: bionet.software Subject: Re: int -> pdb conversion Date: Fri, 10 Jul 1998 09:46:29 -0700 Organization: Centre de Calcul de Saint Jerome Lines: 44 Message-ID: <35A64565.2781@afmb.cnrs-mrs.fr> References: <3PQIT1$qem@bbs.life.nthu.edu.tw> NNTP-Posting-Host: afmb.cnrs-mrs.fr Mime-Version: 1.0 Content-Type: text/plain; charset=iso-8859-1 Content-Transfer-Encoding: 8bit X-Mailer: Mozilla 3.01SGoldC-SGI (X11; I; IRIX 6.3 IP32) Try BABEL Software designed to modify file formats... I Don't remember the location... Eric. Á©sèû wrote: > > ==> Reece Kimball Hart wrote: > : Francis> I am trying to write a program convert torsion to pdb, > : Francis> did anybody write it before? > : Sorta. There are programs in the Tinker package to convert between > : Tinker's internal and Cartesian xyz format, and between xyz and pdb > : formats. Tinker source code and binaries are available from > : http://dasher.wustl.edu/. The relevant programs are intxyz and xyzpdb. I > : can't speak to whether this is the best (i.e., least tedious) way, but it > : is a way. Tinker may help, but I bet it'll require significant > : intervention by the user. > > Hmm, thanx for your information, I had written a program myself after > that day. It needs effort to deal witheularian angles. > > Seems that dihedral angle can't exactly determine the coordinate. :-) > > -- > Á©sèû,¥xÆW°ê¥ß²MµØ¤j¾Ç¥Í©R¬ì¾Ç¨t | Francis M.J. Hsieh,Life Science,NTHU,TWN > mjhsieh@life.nthu.edu.tw | Life Science BBS: bbs.life.nthu.edu.tw. > -- > ¡° Origin: ¥Í©R¬ì¾Ç BBS ¡» From: bpti.life.nthu.e -- ------------------------------------------------------------------------------ Eric Blanc Webmaster for AFMB Email: eric@afmb.cnrs-mrs.fr WWW: http://afmb.cnrs-mrs.fr/~eric/ InPerson:eric@afmb83.cnrs-mrs.fr AFMB CNRS-UPR 9039 31 Ch J. Aiguier 13402 Marseille CEDEX 20 FRANCE Phone: 33-4-91-16-45-29 ------------------------------------------------------------------------------ From owner-software@net.bio.net Thu Jul 09 23:00:00 1998 Path: biosci!agate!news-spur1.maxwell.syr.edu!news.maxwell.syr.edu!nntp.news.xara.net!xara.net!server5.netnews.ja.net!daresbury!not-for-mail From: jpleiss@tebio1.biologie.uni-stuttgart.de (Juergen Pleiss) Newsgroups: bionet.software Subject: Regular homology searches Date: 10 Jul 1998 14:16:36 +0100 Lines: 27 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <6o547k$r64@mserv1.dl.ac.uk> Original-To: jpleiss@tebio1.biologie.uni-stuttgart.de (self copy), bio-soft@dl.ac.uk, bio-www@dl.ac.uk, comp-bio@dl.ac.uk, molmodel@dl.ac.uk Dear colleagues, We want to regularily search sequence databases for proteins which are homologous to a given target. Thus, we are searching for a (commercial or academic) tool which allows us to - run a BLAST search in the current version of various protein sequence databases (SwissProt, nr,PIR,...) - mark all hits which are not yet found previously So it should - compare the results of a BLAST search with a database - create and change a database of protein sequence entries I would be glad if you could point me to such a program. Thank you for your help, Juergen Pleiss ================================================================================ Dr.Juergen Pleiss Institute of Technical Biochemistry University of Stuttgart Email:jpleiss@tebio1.biologie.uni-stuttgart.de Allmandring 31 Phone:(+49)-711-685-3191 D-70569 Stuttgart, Germany Fax: (+49)-711-685-3196 W3 home page: http://www.itb.uni-stuttgart.de:8080/ From owner-software@net.bio.net Thu Jul 09 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!news-peer.gip.net!news.gsl.net!gip.net!news-peer.sprintlink.net!news-backup-east.sprintlink.net!news.sprintlink.net!128.218.95.22!itssrv1.ucsf.edu!macmac-2.ucsf.edu!user From: bpmurray*STUFFER*@socrates.ucsf.edu (Bernard Murray) Newsgroups: bionet.software Subject: Re: int -> pdb conversion Date: Fri, 10 Jul 1998 15:03:59 -0700 Organization: University of California, San Francisco Lines: 29 Message-ID: References: <3PQIT1$qem@bbs.life.nthu.edu.tw> NNTP-Posting-Host: macmac-2.ucsf.edu In article , dumbo@xray.bmc.uu.se (Dombo Journal (Est. 1893)) wrote: > In article <3PQIT1$qem@bbs.life.nthu.edu.tw>, > mjhsieh.bbs@bbs.life.nthu.edu.tw (Á©sèû) wrote: > ;->Seems that dihedral angle can't exactly determine the coordinate. :-) > > (1) for internal coordinates to work, you'll need bond lengths, > bond angles, and dihedral angles - if you assume "ideal" > values for bond lengths and angles, errors will accumulate > and once you get to the C-terminus the result may be quite > large (This thread is becoming more informative than I first thought) I was just wondering.... Has anyone actually looked at the variation in bond lengths from "ideal" in the protein structure databases? (I realise the publication for individual structures usually comment on strange bonds). Are there any publications on this? It sounds like valuable information for the databases for protein dynamics simulation. Just curious, Bernard -- Bernard Murray, PhD Dept. Cell. Mol. Pharmacol., UCSF, San Francisco, USA From owner-software@net.bio.net Thu Jul 09 23:00:00 1998 Path: biosci!rutgers!rockyd.rockefeller.edu!newsfeed.nyu.edu!newsfeed.axxsys.net!news-nyc.telia.net!howland.erols.net!news-peer.gip.net!news-lond.gip.net!news.gsl.net!gip.net!dispose.news.demon.net!demon!peer.news.zetnet.net!peer.news.bb.u-net.net!u-net!yama.mcc.ac.uk!hydraulix.bangor.ac.uk!manager From: Keith James Newsgroups: bionet.software Subject: Re: Regular homology searches Date: 10 Jul 1998 15:50:29 +0100 Organization: University of Wales, Bangor. Distribution: bionet Message-ID: References: <6o547k$r64@mserv1.dl.ac.uk> NNTP-Posting-Host: pwilliams.bangor.ac.uk X-Newsreader: Gnus v5.3/Emacs 19.34 Lines: 28 >>>>> "Juergen" == Juergen Pleiss writes: Juergen> Dear colleagues, We want to regularily search sequence Juergen> databases for proteins which are homologous to a given Juergen> target. Juergen> Thus, we are searching for a (commercial or academic) Juergen> tool which allows us to - run a BLAST search in the Juergen> current version of various protein sequence databases Juergen> (SwissProt, nr,PIR,...) - mark all hits which are not Juergen> yet found previously Juergen> So it should - compare the results of a BLAST search with Juergen> a database - create and change a database of protein Juergen> sequence entries There is DBWatcher: http://www-igbmc.u-strasbg.fr/BioInfo/LocalDoc/DBWatcher/ which does much of what you require. -- Keith James -- k.james@bangor.ac.uk -- http://www.bangor.ac.uk/~bss194 Biodegradation Group - School of Biological Sciences - University of Wales PGP preferred when your e-mail is not for 3rd parties - www for Public Key Public Key fingerprint is 8F 60 5A 4D DB A9 23 65 7D 95 62 19 F0 9C A8 E0 From owner-software@net.bio.net Thu Jul 09 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!news-peer.gip.net!news.gsl.net!gip.net!portc01.blue.aol.com!audrey01.news.aol.com!not-for-mail From: tnelson1@aol.com (TNelson1) Newsgroups: bionet.software Subject: Re: Sequence Analysis Windows 95? Lines: 12 Message-ID: <1998071021193000.RAA21960@ladder01.news.aol.com> NNTP-Posting-Host: ladder01.news.aol.com X-Admin: news@aol.com Date: 10 Jul 1998 21:19:29 GMT Organization: AOL http://www.aol.com References: <6o1qvt$r5h@news.u-strasbg.fr> >> As of now, Prophet is free of charge if downloading over the web or via the >FTP >> site. The copy I downloaded from the website says it is a "60 day free trial edition", what happens when the 60 days are up? Do I then have to pay? Tom ********************** Tom tnelson1@aol.com ********************** From owner-software@net.bio.net Thu Jul 09 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!cpk-news-feed4.bbnplanet.com!cpk-news-feed1.bbnplanet.com!news.bbnplanet.com!lhc.nlm.nih.gov!not-for-mail From: Roland Walker Newsgroups: bionet.software Subject: Re: Regular homology searches Date: Fri, 10 Jul 1998 15:57:32 -0400 Organization: National Center for Biotechnology Information Lines: 65 Message-ID: <35A6722C.B0091919@ncbi.nlm.nih.gov> References: <6o547k$r64@mserv1.dl.ac.uk> Reply-To: walker@ncbi.nlm.nih.gov NNTP-Posting-Host: 130.14.25.216 Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 4.0 [en] (Win95; I) To: Juergen Pleiss X-Priority: 3 (Normal) Juergen Pleiss wrote: > We want to regularily search sequence databases for proteins which are homologous to a given target. This is easy to do with a shell script using the SEALS package http://www.ncbi.nlm.nih.gov/Walker/SEALS/index.html Many variations are possible on the following script, which (starting with a fasta library of your favorite sequences) uses PSI-BLAST to find new homologs, which are mailed to you and added to the library. The latest additions are kept in a file with a name based on the input file, suffixed with '_new'. What is even more interesting is that by using the 'tax_filt' command, you can limit or sort your new additions by any taxonomic node. If you also want software to keep your databases updated, this functionality is about to be added to SEALS (two releases from now). Email me with any questions. R #!/bin/sh # # newhits # # Notify me when new sequences are added to the # database that match into my list of favorites. # # Suitable for use as a cron job. # # Invoke like this # # newhits favorites.fa # if test ! -s $1; then echo ' ' echo " $0: input file $1 is empty or does not exist" echo ' ' exit 1 fi splishpgp nr $1 -proc= smart -psi= 3 | blast2gi -pcut= .001 | \ gi2fasta | fanot $1 > $1_new if test -s $1_new; then cat $1_new >> $1 mailme New members for $1 can be found in $1_new < $1_new # else mailme No new members for $1 today # uncomment if you like fi # ========================================================= > > Dr.Juergen Pleiss > Institute of Technical Biochemistry > University of Stuttgart Email:jpleiss@tebio1.biologie.uni-stuttgart.de > Allmandring 31 Phone:(+49)-711-685-3191 > D-70569 Stuttgart, Germany Fax: (+49)-711-685-3196 > W3 home page: http://www.itb.uni-stuttgart.de:8080/ From owner-software@net.bio.net Thu Jul 09 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!feed2.news.erols.com!erols!news1.best.com!newshub.sdsu.edu!franklin.ljcrf.edu!not-for-mail From: greg@franklin.burnham-inst.org () Newsgroups: bionet.software Subject: Re: emacs Mode for gcg-SeqED Date: 10 Jul 1998 23:27:18 GMT Organization: COMPUTATIONAL BIOLOGY at The BURNHAM INSTITUTE Lines: 9 Message-ID: <6o680m$mkl$1@franklin.ljcrf.edu> References: <35A66825.760C7AE8@gwdg.de> NNTP-Posting-Host: franklin.ljcrf.edu X-Newsreader: TIN [UNIX 1.3 950824BETA PL0] Arne Mueller (amuelle3@gwdg.de) wrote: : Hi All, : : I'm looking for an emacs/xemacs mode which can handel gcg formated : sequences. I'd like to perfrom operations like those in seqed : (inserting, : deleting fragments... : For an X solution, have you tried SeqLab which comes with GCG? From owner-software@net.bio.net Thu Jul 09 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!newspeer.monmouth.com!news-was.dfn.de!news-fra1.dfn.de!news-ber1.dfn.de!news-ham1.dfn.de!news-han1.dfn.de!news.gwdg.de!not-for-mail From: Arne Mueller Newsgroups: bionet.software Subject: emacs Mode for gcg-SeqED Date: Fri, 10 Jul 1998 19:14:45 +0000 Organization: GWDG, Goettingen Lines: 23 Message-ID: <35A66825.760C7AE8@gwdg.de> NNTP-Posting-Host: roko28.stud.uni-goettingen.de Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 4.05 [en] (X11; I; Linux 2.0.33 i586) Hi All, I'm looking for an emacs/xemacs mode which can handel gcg formated sequences. I'd like to perfrom operations like those in seqed (inserting, deleting fragments... thanks for help, Arne -- Arne Mueller Institut fuer Mikrobiologie und Genetik Abt. Molekulare Genetik und Praeparative Molekularbiologie Universitaet Goettingen Grisebachstr. 8 37077 Goettingen Germany phone: +49-551-399654 | fax : +49-551-393805 email: amuelle3@gwdg.de | http://www.roko.goe.net/~amuell4/ From owner-software@net.bio.net Thu Jul 09 23:00:00 1998 Path: biosci!news.Stanford.EDU!newsfeed.concentric.net!netnews.com!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!cam-news-reader1.bbnplanet.com!not-for-mail Message-ID: <35A62CF5.82ECAC2B@bbn.com> From: Christopher Hopkins Reply-To: chopkins@bbn.com Organization: GTE Internetworking - BBN Technologies X-Mailer: Mozilla 4.05 [en] (WinNT; I) MIME-Version: 1.0 Newsgroups: bionet.software Subject: Re: Sequence Analysis Windows 95? References: <35774B0E.4D8F4ABA@any.domain.com> <6o29r7$pkl@paperboy.ccc.nottingham.ac.uk> Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit Lines: 18 Date: Fri, 10 Jul 1998 15:04:54 GMT NNTP-Posting-Host: 128.89.8.69 NNTP-Posting-Date: Fri, 10 Jul 1998 11:04:54 EDT Distribution: world When we release Prophet 5.1 I'm going to make sure there are better indicators for such things. Unfortunately, I had no input on the first wave of the web page but I'm going to add stuff for 5.1. plxsrt@pln1.nott.ac.uk wrote: > I'm sure prophet looses a lot of potential users because of the > download problems. > > Why can't the web page specifically tell the downloader of the > non-USA restrictions rather than give them a cryptic FTP error? > > Simon T From owner-software@net.bio.net Thu Jul 09 23:00:00 1998 Path: biosci!keep.out.com!spammers From: spammers@keep.out.com (Robert Fraczkiewicz) Newsgroups: bionet.software Subject: New web interface to solvent accessible area calculations Date: 10 Jul 1998 15:25:08 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 26 Sender: daemon@net.bio.net Distribution: world Message-ID: <35A6946A.79BCE097@keep.out.com> NNTP-Posting-Host: net.bio.net Dear Colleagues, We would like to announce the release of beta version of GETAREA 1.0, the new free WWW service for calculating the solvent accessible surface area of molecules. Users wanting to calculate SASA of proteins will merely supply the name of their local file containing atomic coordinates in PDB format. There is an otpion to calculate solvation energy and inclusion of molecules other than proteins. The relevant URL is: http://www.scsb.utmb.edu/getarea/area_form.html Note: the current release is for testing purposes only. Surely there are still some undiscovered bugs. Please help us disclose them by submitting test inputs. All remarks and suggestions should be directed to robert@nmr.utmb.edu or werner@newton.utmb.edu Thank you in advance, Robert Fraczkiewicz Sealy Center for Structural Biology University of Texas Medical Branch Galveston, TX 77555 From owner-software@net.bio.net Thu Jul 09 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!news-peer.gip.net!news.gsl.net!gip.net!spring.edu.tw!news.nctu.edu.tw!newsfeed.nthu.edu.tw!news.nthu.edu.tw!nthuls From: mjhsieh.bbs@bbs.life.nthu.edu.tw (Á©sèû) Newsgroups: bionet.software Subject: Re: int -> pdb conversion Date: 10 Jul 1998 03:16:00 GMT Organization: ²MµØ¥Í©R¬ì¾Ç BBS Lines: 22 Message-ID: <3PQIT1$qem@bbs.life.nthu.edu.tw> NNTP-Posting-Host: bbs.life.nthu.edu.tw X-Filename: bn.software/M.900040561.A ==> Reece Kimball Hart wrote: : Francis> I am trying to write a program convert torsion to pdb, : Francis> did anybody write it before? : Sorta. There are programs in the Tinker package to convert between : Tinker's internal and Cartesian xyz format, and between xyz and pdb : formats. Tinker source code and binaries are available from : http://dasher.wustl.edu/. The relevant programs are intxyz and xyzpdb. I : can't speak to whether this is the best (i.e., least tedious) way, but it : is a way. Tinker may help, but I bet it'll require significant : intervention by the user. Hmm, thanx for your information, I had written a program myself after that day. It needs effort to deal witheularian angles. Seems that dihedral angle can't exactly determine the coordinate. :-) -- Á©sèû,¥xÆW°ê¥ß²MµØ¤j¾Ç¥Í©R¬ì¾Ç¨t | Francis M.J. Hsieh,Life Science,NTHU,TWN mjhsieh@life.nthu.edu.tw | Life Science BBS: bbs.life.nthu.edu.tw. -- ¡° Origin: ¥Í©R¬ì¾Ç BBS ¡» From: bpti.life.nthu.e From owner-software@net.bio.net Thu Jul 09 23:00:00 1998 Path: biosci!agate!howland.erols.net!news.starnet.net!newsreader.wustl.edu!not-for-mail From: Reece Kimball Hart Newsgroups: bionet.software Subject: int -> pdb conversion Date: 09 Jul 1998 19:57:28 -0500 Organization: Biophysics & Biochemistry, Washington University, St. Louis, USA Lines: 19 Message-ID: <82zpeittdz.fsf@whoville.wustl.edu> References: <3PN3KT$sO_@bbs.life.nthu.edu.tw> Reply-To: Reece Kimball Hart NNTP-Posting-Host: whoville.wustl.edu X-Attribution: Reece X-URL: X-Newsreader: Gnus v5.5/Emacs 20.2 >>>>> On 05 Jul 1998 21:23:40 GMT, mjhsieh.bbs@bbs.life.nthu.edu.tw (Á©sèû) said: Francis> I am trying to write a program convert torsion to pdb, did anybody write Francis> it before? Sorta. There are programs in the Tinker package to convert between Tinker's internal and Cartesian xyz format, and between xyz and pdb formats. Tinker source code and binaries are available from http://dasher.wustl.edu/. The relevant programs are intxyz and xyzpdb. I can't speak to whether this is the best (i.e., least tedious) way, but it is a way. Tinker may help, but I bet it'll require significant intervention by the user. Bonne Chance. Reece -- Reece Hart, http://dasher.wustl.edu/~reece/, PGP:0xD178AAF9 Do not send unsolicited bulk email. Boycott companies which do so. From owner-software@net.bio.net Thu Jul 09 23:00:00 1998 Date: Fri, 10 Jul 1998 21:33:44 +0200 From: dumbo@xray.bmc.uu.se (Dombo Journal (Est. 1893)) Newsgroups: bionet.software Subject: Re: int -> pdb conversion Message-ID: References: <3PQIT1$qem@bbs.life.nthu.edu.tw> Organization: Molecular Biology, Uppsala University X-Newsreader: Value-Added NewsWatcher 2.1d3+ NNTP-Posting-Host: nostromo.bmc.uu.se Lines: 27 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!hammer.uoregon.edu!news.algonet.se!newsfeed1.telenordia.se!newsfeed.sunet.se!news01.sunet.se!news99.sunet.se!newsfeed.uu.se!nostromo.bmc.uu.se!user In article <3PQIT1$qem@bbs.life.nthu.edu.tw>, mjhsieh.bbs@bbs.life.nthu.edu.tw (Á©sèû) wrote: ;-> ;->Hmm, thanx for your information, I had written a program myself after ;->that day. It needs effort to deal witheularian angles. ;-> ;->Seems that dihedral angle can't exactly determine the coordinate. :-) ;-> (1) for internal coordinates to work, you'll need bond lengths, bond angles, and dihedral angles - if you assume "ideal" values for bond lengths and angles, errors will accumulate and once you get to the C-terminus the result may be quite large (2) if you have the correct bond lengths, angles, and dihedrals, you still need the coordinates of one of the atoms if you want to reproduce the exact orientation/translation of the molecule (probably only relevant for crystal structures) --cd ----------------------------------------------------------- Gerard J. Kleywegt Department of Molecular Biology, Biomedical Centre, Uppsala University, Uppsala, SWEDEN mailto:gerard@xray.bmc.uu.se *** http://alpha2.bmc.uu.se/usf/ From owner-software@net.bio.net Fri Jul 10 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!newsfeed.internetmci.com!192.232.20.2!malgudi.oar.net!news.cas.org!not-for-mail From: lvirden@cas.org Newsgroups: bionet.software Subject: Re: GDE under Solaris 2.6 Date: 11 Jul 1998 14:57:26 GMT Organization: Nedriv Software and Shoe Shiners, Uninc. Lines: 27 Message-ID: <6o7ugm$len$1@srv38s4u.cas.org> References: <6o0kgr$28s$1@canopus.cc.umanitoba.ca> <6o1rqu$r5h@news.u-strasbg.fr> Reply-To: lvirden@cas.org NNTP-Posting-Host: lwv26awm.cas.org Mime-Version: 1.0 Content-Type: text/plain; charset=US-ASCII Content-Transfer-Encoding: 7BIT X-Newsreader: trn 4.0-test66 (4 June 1998) Originator: lwv26@cas.org (Larry W. Virden) According to Francois Jeanmougin : :In article <6o0kgr$28s$1@canopus.cc.umanitoba.ca>, : frist@cc.umanitoba.ca (Brian Fristensky) writes: :> I have heard that Solaris 2.6 may not run OpenWindows :> applications. I don't know to what extent that may :> be true. Has anyone tried running GDE under Solaris 2.6? : :titus_bin_> ./gde :ld.so.1: ./gde: fatal: libxview.so.3: open failed: No such file or directory :Killed :titus_bin_> uname -a :SunOS titus 5.6 Generic sun4d sparc SUNW,SPARCserver-1000 :titus_bin_> : : : Well. Perhaps could we find libxview for Solaris2.6 : : Someone saw something like that? yes - it came installed on my sparc/solaris 2.6 from sun. Perhaps someone at your site hasn't installed the openwindows package? -- Quote: In heaven, there is no panic, <*> O- only planning. Unless explicitly stated to the contrary, nothing in this posting should be construed as representing my employer's opinions. From owner-software@net.bio.net Fri Jul 10 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!news.maxwell.syr.edu!newsfeed.internetmci.com!128.158.254.10!news.msfc.nasa.gov!bcm.tmc.edu!news From: harley@bcm.tmc.edu Newsgroups: bionet.software Subject: Re: emacs Mode for gcg-SeqED Date: 11 Jul 1998 13:55:03 -0500 Organization: Molecular and Human Genetics, Baylor College of Medicine Lines: 14 Sender: harley@crane.imgen.bcm.tmc.edu Message-ID: References: <35A66825.760C7AE8@gwdg.de> Reply-To: harley@bcm.tmc.edu NNTP-Posting-Host: crane.imgen.bcm.tmc.edu X-Attribution: harley X-Fax: 713-798-5741 X-Phone: 713-798-8719 X-Newsreader: Gnus v5.5/Emacs 19.34 >>>>> "Arne" == Arne Mueller writes: Arne> I'm looking for an emacs/xemacs mode which can handle Arne> gcg formated sequences. I have a simple dna-mode which may do some of what you want. [1] http://gc.bcm.tmc.edu:8088/~harley/elisp/index.html harley. -- 'What are words for / What are words for / When no-one listens any more' - Words, Missing Persons From owner-software@net.bio.net Sat Jul 11 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!howland.erols.net!spring.edu.tw!news.nctu.edu.tw!newsfeed.nthu.edu.tw!news.nthu.edu.tw!nthuls From: mjhsieh.bbs@bbs.life.nthu.edu.tw (Á©sèû) Newsgroups: bionet.software Subject: Re: int -> pdb conversion Date: 12 Jul 1998 10:23:01 GMT Organization: ²MµØ¥Í©R¬ì¾Ç BBS Lines: 142 Message-ID: <3PS8Yc$rey@bbs.life.nthu.edu.tw> NNTP-Posting-Host: bbs.life.nthu.edu.tw X-Filename: bn.software/M.900238982.A ==> Eric Blanc wrote: : Try BABEL : Software designed to modify file formats... : I Don't remember the location... : ==> Á©sèû wrote: : > Hmm, thanx for your information, I had written a program myself after : > that day. It needs effort to deal witheularian angles. : > Seems that dihedral angle can't exactly determine the coordinate. :-) Thanx Eric, but babel seems have no such function to convert torsion data to coordinate[1]. -- 1. from the output of babel: bpti [/home/mjhsieh/] -mjhsieh- babel | more Babel 1.6 -- Dec 22 1997 -- 14:14:52 for menus type -- babel -m Usage is : babel [-v] -i -o "" Currently supported input types alc -- Alchemy file prep -- AMBER PREP file bs -- Ball and Stick file bgf -- MSI BGF file car -- Biosym .CAR file boog -- Boogie file caccrt -- Cacao Cartesian file cadpac -- Cambridge CADPAC file charmm -- CHARMm file c3d1 -- Chem3D Cartesian 1 file c3d2 -- Chem3D Cartesian 2 file cssr -- CSD CSSR file fdat -- CSD FDAT file gstat -- CSD GSTAT file dock -- Dock Database file dpdb -- Dock PDB file feat -- Feature file fract -- Free Form Fractional file gamout -- GAMESS Output file gzmat -- Gaussian Z-Matrix file gauout -- Gaussian 92 Output file g94 -- Gaussian 94 Output file gr96A -- GROMOS96 (A) file gr96N -- GROMOS96 (nm) file hin -- Hyperchem HIN file sdf -- MDL Isis SDF file m3d -- M3D file macmol -- Mac Molecule file macmod -- Macromodel file micro -- Micro World file mm2in -- MM2 Input file mm2out -- MM2 Output file mm3 -- MM3 file mmads -- MMADS file mdl -- MDL MOLfile file molen -- MOLIN file mopcrt -- Mopac Cartesian file mopint -- Mopac Internal file mopout -- Mopac Output file pcmod -- PC Model file pdb -- PDB file psin -- PS-GVB Input file psout -- PS-GVB Output file msf -- Quanta MSF file schakal -- Schakal file shelx -- ShelX file smiles -- SMILES file spar -- Spartan file semi -- Spartan Semi-Empirical file spmm -- Spartan Mol. Mechanics file mol -- Sybyl Mol file mol2 -- Sybyl Mol2 file wiz -- Conjure file unixyz -- UniChem XYZ file xyz -- XYZ file xed -- XED file Currently supported output types diag -- DIAGNOTICS file alc -- Alchemy file bs -- Ball and Stick file bgf -- BGF file bmin -- Batchmin Command file box -- DOCK 3.5 box file caccrt -- Cacao Cartesian file cacint -- Cacao Internal file cache -- CAChe MolStruct file c3d1 -- Chem3D Cartesian 1 file c3d2 -- Chem3D Cartesian 2 file cdct -- ChemDraw Conn. Table file dock -- Dock Database file wiz -- Wizard file contmp -- Conjure Template file cssr -- CSD CSSR file dpdb -- Dock PDB file feat -- Feature file fhz -- Fenske-Hall ZMatrix file gamin -- Gamess Input file gcart -- Gaussian Cartesian file gzmat -- Gaussian Z-matrix file gotmp -- Gaussian Z-matrix tmplt file gr96A -- GROMOS96 (A) file gr96N -- GROMOS96 (nm) file hin -- Hyperchem HIN file icon -- Icon 8 file idatm -- IDATM file sdf -- MDL Isis SDF file m3d -- M3D file macmol -- Mac Molecule file macmod -- Macromodel file micro -- Micro World file mm2in -- MM2 Input file mm2out -- MM2 Ouput file mm3 -- MM3 file mmads -- MMADS file mdl -- MDL Molfile file miv -- MolInventor file mopcrt -- Mopac Cartesian file mopint -- Mopac Internal file csr -- MSI Quanta CSR file pcmod -- PC Model file pdb -- PDB file psz -- PS-GVB Z-Matrix file psc -- PS-GVB Cartesian file report -- Report file smiles -- SMILES file spar -- Spartan file mol -- Sybyl Mol file mol2 -- Sybyl Mol2 file maccs -- MDL Maccs file torlist -- Torsion List file tinker -- Tinker XYZ file unixyz -- UniChem XYZ file xyz -- XYZ file xed -- XED file From owner-software@net.bio.net Sat Jul 11 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!news.bbnplanet.com!news1.best.com!newshub.northeast.verio.net!btnet-peer!btnet!rill.news.pipex.net!pipex!easynet-uk!easynet-fr!not-for-mail From: philimar@easynet.fr (Philippe MARQUIS) Newsgroups: bionet.software Subject: logiciel freeware de controle de qualite Date: Sun, 12 Jul 1998 08:28:26 GMT Organization: [posted via] Easynet France Lines: 42 Message-ID: <6o9s2j$kif$2@buggy.news.easynet.net> Reply-To: philimar@easynet.fr NNTP-Posting-Host: pop-metz-4.pops.easynet.fr X-Newsreader: Forte Free Agent 1.0.82 Vous pouvez télécharger sur http://perso.easynet.fr/~philimar un logiciel gratuit conçu pour le contrôle de qualité interne des techniques analytiques manuelles dans les laboratoires de biologie clinique. Il trace les cartes de contrôle, archive le données et calcule les fourchettes de validation. L’accès aux principales fonctions par des icônes ainsi que l’aide en ligne font de ContQual un logiciel à l’abord immédiat et sans apprentissage pour tout technicien familiarisé avec les cartes de contrôle. Le nombre d’analytes contrôlables est illimité, chacun pouvant l’être avec trois produits différents. Les trois niveaux sont validés simultanément dans un affichage graphique (vert, orange, rouge) symbolisant les intervalles de contrôle, d’alerte et d’action. Ces intervalles sont calculés à partir des données saisies antérieurement en utilisant un t de Student avec deux seuils de probabilité : 5% et 1%. Au moment du changement de lot d’un produit de contrôle, les statistiques de l’ancien lot sont archivées et la carte de contrôle réinitialisée. La modification ou la supression des points aberrants est réservée aux cadres du laboratoire et protégée par un mot de passe. Les fichiers sont sauvegardés périodiquement sur une disquette avec un intervalle paramétrable. Un rappel apparaît à l’ouverture du programme dès que le délai est écoulé. En fin de journée, on peut affic