From owner-software@net.bio.net Sat May 01 11:35:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!logbridge.uoregon.edu!nntp-relay.ihug.net!207.126.101.60.MISMATCH!ihug.co.nz!remarQ60!supernews.com!remarQ.com!iquest!cronkite.d48.lilly.com!not-for-mail From: "Dennis P. Smith" Newsgroups: bionet.software Subject: EC50 and Relative Efficacy Software Date: Sat, 01 May 1999 07:31:47 -0500 Organization: Eli Lilly and Company Lines: 5 Message-ID: <372AF433.C93D5170@lilly.com> NNTP-Posting-Host: 40.23.1.137 Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 4.04 [en] (Win95; U) We are doing cell based drug assays and we are looking for software that can calculate EC50 and relative efficacies. One package is called PRISM are there another software packages available? Thanks DPSMITH smith_dennis_p@lilly.com From owner-software@net.bio.net Sat May 01 15:23:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!newsfeed.berkeley.edu!dispose.news.demon.net!demon!diablo.theplanet.net!news.sol.co.uk!news-reader1.sol.co.uk!not-for-mail From: "John" Newsgroups: bionet.software Subject: Re: EC50 and Relative Efficacy Software Date: Sat, 1 May 1999 16:46:26 +0100 Organization: Scotland-On-Line Message-ID: <7gf7od$rfs$1@phys-ma.sol.co.uk> References: <372AF433.C93D5170@lilly.com> NNTP-Posting-Host: e1c5p21.scotland.net X-Priority: 3 X-MSMail-Priority: Normal X-Newsreader: Microsoft Outlook Express 5.00.2014.211 X-MimeOLE: Produced By Microsoft MimeOLE V5.00.2014.211 Lines: 17 PRISM is a good package which we use for EC50 calculations and enzyme kinetics. You might also try ORIGIN http://www.microcal.com/ . If you want something that uses Excel you could consider XLFIT from IDBS http://www.idbs.co.uk/ which is part of a corporate database system but can be used stand alone, John Dennis P. Smith wrote in message news:372AF433.C93D5170@lilly.com... > We are doing cell based drug assays and we are looking for software that > can calculate EC50 and relative efficacies. One package is called PRISM > are there another software packages available? Thanks DPSMITH > smith_dennis_p@lilly.com > From owner-software@net.bio.net Sat May 01 17:22:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!logbridge.uoregon.edu!isdnet!pasteur.fr!not-for-mail From: Pierre Rodrigues Newsgroups: bionet.software,bionet.molbio.methds-reagnts,bionet.software.gcg Subject: MBS Aligner now makes consensus too! Date: Sat, 01 May 1999 20:16:45 +0100 Organization: MBS Lines: 16 Message-ID: <372B531D.18778B2A@pasteur.fr> NNTP-Posting-Host: dial-ip-73.dial.pasteur.fr Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Trace: desdemone.pasteur.fr 925582645 23312 157.99.10.73 (1 May 1999 18:17:25 GMT) X-Complaints-To: usenet@pasteur.fr NNTP-Posting-Date: 1 May 1999 18:17:25 GMT X-Mailer: Mozilla 4.5 [en] (Win98; I) X-Accept-Language: en Xref: biosci bionet.software:23362 bionet.molbio.methds-reagnts:75777 bionet.software.gcg:3502 Hello, I have upgraded MBS aligner! Now you can obtain automatically the consensus sequence from your DNA alignments! The output is in degenerate universal code. Just put your DNA sequences and get the consensus ready for your degenrated primer selction! And of course the alignement from clustalw... Try it at: http://www.mbshortcuts.com/mbsalign Enjoy! Pierre Rodrigues From owner-software@net.bio.net Sat May 01 17:28:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!newsfeed.berkeley.edu!dispose.news.demon.net!demon!newsfeed.icl.net!oleane!pasteur.fr!not-for-mail From: Pierre Rodrigues Newsgroups: bionet.software,bionet.molbio.methds-reagnts Subject: MBS Tools Date: Sat, 01 May 1999 20:22:14 +0100 Organization: MBS Message-ID: <372B5466.B8BA0B6A@pasteur.fr> NNTP-Posting-Host: dial-ip-73.dial.pasteur.fr Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Trace: desdemone.pasteur.fr 925582974 23862 157.99.10.73 (1 May 1999 18:22:54 GMT) X-Complaints-To: usenet@pasteur.fr NNTP-Posting-Date: 1 May 1999 18:22:54 GMT X-Mailer: Mozilla 4.5 [en] (Win98; I) X-Accept-Language: en Lines: 19 Xref: biosci bionet.software:23363 bionet.molbio.methds-reagnts:75778 MBS offers to molecular biology scientists the following on-line tools: MBS ENZFINDER A restriction search engine: find all you need to know about a RE! http://www.mbshortcuts.com/enzfinder MBS ALIGNER A clustalw on-line interface very easy. Now generates degenerate consensus DNA sequence http://www.mbshortcuts.com/mbsalign MBS TRANSLATOR A very simple DNA to Protein translator, with up to 6 phase translation. http://www.mbshortcuts.com/translator Enjoy Pierre Rodrigues From owner-software@net.bio.net Sun May 02 16:14:00 1999 Path: biosci!newshost.lanl.gov!awabi.library.ucla.edu!208.134.241.18!newsfeed.cwix.com!205.252.116.205!howland.erols.net!news-feed1.tiac.net!cam-news-hub1.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news.gtei.net!firehose.mindspring.com!not-for-mail From: john_q_barlow@hotmail.com (John Barlow) Newsgroups: bionet.software Subject: Sequence format converter for Windows Date: 2 May 1999 17:04:25 GMT Organization: MindSpring Enterprises Lines: 13 Message-ID: <7gi0ip$80t$1@nntp8.atl.mindspring.net> NNTP-Posting-Host: cf.45.f4.43 Mime-Version: 1.0 Content-Type: Text/Plain; charset=US-ASCII X-Newsreader: WinVN 0.99.9 (Released Version) (x86 32bit) Hi: I need a sequence format converter for Win32 that would be more flexible than the command line Readseq or TOFASTA. As NCBI BLAST accepts input in FASTA format only, I would need at least to be able to convert GenBank files to FASTA. In addition, I would like to extract single sequences from my MSF or PHYLIP alignments and save them in FASTA format. Any suggestions? John From owner-software@net.bio.net Sun May 02 19:07:00 1999 Path: biosci!agate!newsfeed.berkeley.edu!newsfeed.cwix.com!216.33.68.11!nntp01.net-okbr01.exodus.net!nntp01.net-okbr01.exodus.net!131.103.1.118!NewsNG.Chicago.Qual.Net!128.255.56.80!news.uiowa.edu!not-for-mail From: Todd Scheetz Newsgroups: bionet.software Subject: Re: EST clustering Date: Sun, 02 May 1999 14:58:32 -0500 Organization: The University of Iowa Lines: 36 Message-ID: <372CAE68.DB4E378A@uiowa.edu> References: <717801BBC100D211B89500805F6FAD93047D7B@snap01.synapticcorp.com> NNTP-Posting-Host: huge.eng.uiowa.edu Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 4.07 [en] (X11; I; Linux 2.2.5 i686) Venky, Take a look at a program called tlcluster. It was developed here at the University of Iowa, and was designed specifically for clustering ESTs. It is available for download from http://ratest.eng.uiowa.edu/pubsoft/software.html. I may be able to help with questions about the ICAtools, but it's been about a year since we used them here. We developed tlcluster as a replacement when the run-time of ICAtools became prohibitive. -Todd Scheetz Genetics Ph.D. Program University of Iowa Tvenkatesh@synapticcorp.com wrote: > > Dear All > I am looking for EST clustering software. I would appreciate any > suggestions. > Also I would like to get in touch with some one in USA who has used JD > Parsons ICA tools > to clarify some questions I have. > Thanks > Venky > > ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ > T. V. (Venky) Venkatesh, Ph D > Senior Scientist (Bioinformatics and Molecular Biology) > Synaptic Pharmaceutical Corporation > 215 College Road > Paramus NJ 07652 - 1431 > 201-261-1331x720 (Phone) > 201-261-0623(Fax) > Tvenkatesh@synapticcorp.com From owner-software@net.bio.net Sun May 02 21:56:00 1999 Path: biosci!YAHOO.COM!biolinux From: biolinux@YAHOO.COM (s b) Newsgroups: bionet.software Subject: Finding maximally divergent segments Date: 2 May 1999 15:56:13 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 17 Sender: daemon@net.bio.net Distribution: world Message-ID: <19990502224838.16005.rocketmail@web902.mail.yahoo.com> NNTP-Posting-Host: net.bio.net Hi all, I'm wondering if there is any software or algorithms, given a set of DNA sequences to find a maximally divergent segment (of length N) in each sequence so when aligned to all other sequences it is of the highest divergence. Most people are looking for similiarities but I'd like to do this!! I guess that I could use blast, but that would give me similarities. I tried flipping scores for matches and mismatches but it did not quite work!! Sajeev. _________________________________________________________ Do You Yahoo!? Get your free @yahoo.com address at http://mail.yahoo.com From owner-software@net.bio.net Mon May 03 00:11:00 1999 Path: biosci!newshost.lanl.gov!awabi.library.ucla.edu!208.134.241.18!newsfeed.cwix.com!205.252.116.205!howland.erols.net!portc02.blue.aol.com!audrey01.news.aol.com!not-for-mail From: tidesoft@aol.com (TideSoft) Newsgroups: bionet.software Subject: ToxCalc Lines: 5 NNTP-Posting-Host: ladder05.news.aol.com X-Admin: news@aol.com Date: 3 May 1999 01:05:54 GMT Organization: AOL http://www.aol.com Message-ID: <19990502210554.26172.00001565@ng-fs1.aol.com> For those that have heard of ToxCalc and would like more information, please email tidesoft@aol.com and provide me with a fax number. Michael A. Ives Tidepool Scientific Software From owner-software@net.bio.net Mon May 03 02:20:00 1999 Path: biosci!agate!newsfeed.berkeley.edu!howland.erols.net!peerfeed.news.psi.net!uunet!ffx.uu.net!in2.uu.net!newsfeed.attap.net!mango.singnet.com.sg!dahlia.singnet.com.sg!ocean.singnet.com.sg!id4.nus.edu.sg!nuscc.nus.edu.sg!scip7290 From: scip7290@leonis.nus.edu.sg (Low Hai Sim) Newsgroups: bionet.software Subject: Evolutionary relationship between plants Date: 3 May 1999 03:10:00 GMT Organization: National University of Singapore Lines: 8 Message-ID: <7gj428$342$2@nuscc.nus.edu.sg> NNTP-Posting-Host: leonis.nus.edu.sg X-Newsreader: TIN [version 1.2 PL2] Hi folks, I was wondering if there is a software out there that allows you to check for the evolutionary relationships between plants..like how far apart they are and when they diverged. I know there are database for individual species..but not one on the distance. Thanks for any help :) HS From owner-software@net.bio.net Mon May 03 06:05:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!uchinews2!newsswitch.lcs.mit.edu!news-spur1.maxwell.syr.edu!news.maxwell.syr.edu!news-peer1.sprintlink.net!news-backup-west.sprintlink.net!news.sprintlink.net!news.wa-k20.net!news.wsu.edu!not-for-mail From: art roberts Newsgroups: bionet.software Subject: free molecular biology related software Date: Sun, 02 May 1999 23:52:23 -0700 Organization: Washington State University Lines: 20 Message-ID: <372D47A7.A8E2E9A3@wsunix.wsu.edu> NNTP-Posting-Host: xtsd1401.it.wsu.edu Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 4.05 [en] (Win95; I) You will find links to free software here: http://www.arc.unm.edu/~aroberts/myweb2/free.htm You can also access the site by typing http://biotech.isCool.net This site allows easy access to hyperlinks and free software for the biochemist, biophysicist and molecular biologist. This site is constantly evolving and expanding, so it can be easy to use, reliable, and comprehensive. This is a non-profit site for your ease and enjoyment. Thanks, Art Roberts (web designer) From owner-software@net.bio.net Mon May 03 06:06:00 1999 Path: biosci!agate!newsfeed.berkeley.edu!news-peer1.sprintlink.net!news-backup-west.sprintlink.net!news.sprintlink.net!news.wa-k20.net!news.wsu.edu!not-for-mail From: art roberts Newsgroups: bionet.software Subject: (no subject) Date: Sun, 02 May 1999 23:52:07 -0700 Organization: Washington State University Lines: 20 Message-ID: <372D4796.483322A1@wsunix.wsu.edu> NNTP-Posting-Host: xtsd1401.it.wsu.edu Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 4.05 [en] (Win95; I) You will find links to free software here: http://www.arc.unm.edu/~aroberts/myweb2/free.htm You can also access the site by typing http://biotech.isCool.net This site allows easy access to hyperlinks and free software for the biochemist, biophysicist and molecular biologist. This site is constantly evolving and expanding, so it can be easy to use, reliable, and comprehensive. This is a non-profit site for your ease and enjoyment. Thanks, Art Roberts (web designer) From owner-software@net.bio.net Mon May 03 06:55:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!remarQ73!supernews.com!remarQ.com!howland.erols.net!news.net.uni-c.dk!not-for-mail From: "Sřren W. Rasmussen" Newsgroups: bionet.software Subject: Dnatools, revision 459 (with Clustal W) Date: Mon, 03 May 1999 09:29:55 +0200 Organization: UNI-C Lines: 47 Message-ID: <372D5072.F08B1226@crc.dk> NNTP-Posting-Host: 130.226.182.97 Mime-Version: 1.0 Content-Type: text/plain; charset=iso-8859-1 Content-Transfer-Encoding: 8bit X-Trace: news.net.uni-c.dk 925717227 14420 130.226.182.97 (3 May 1999 07:40:27 GMT) X-Complaints-To: usenet@news.net.uni-c.dk NNTP-Posting-Date: 3 May 1999 07:40:27 GMT X-Mailer: Mozilla 4.03 [en] (Win95; I) Dear DNATools user. The latest revision of DNATools now includes multi-sequence alignment with Clustal W (1.74). The Clustal program has been fully integrated into DNATools and can be accessed in the same way as other project related functions. Just click to select the sequences in your project you want to align and choose the output format. The Find Repeat function has been redesigned and now returns the 10 largest largest repeats (direct or inverted) found in the selected sequence. The Build Contig alignment routine has been refined - but still only work on the basis of the longest identical region between sub-sequences. The Merge Overlapping Forward and Reverse sequences (mainly relevant for EST projects) has been refined. All SAGE (serial analysis of gene expression) programs have been extensively tested and optimized. Especially the link between EST and SAGE data has been extended with several options for generating reports of matches between the two types of data. The Help and Help Index files have been updated. You can read more about DNATools (5.1.459) at: http://www.crc.dk/phys/A01B04_dnatools.htm download the new revision (5.1.459) at http://www.crc.dk/phys/Dnatools/A01B04C04_Downloading.htm and register your copy of DNATools at http://www.crc.dk/phys/Dnatools/A01B04C08_Registration.htm Regards Soeren -- Dr. scient. Sřren W. Rasmussen Carlsberg Laboratory, Department of Physiology 10 Gl. Carlsbergvej, DK-2500, Copenhagen, Denmark Phone 45 3327 5230 / 45 3616 2259, Fax 45 3327 4766 E-mail swr@crc.dk, Homepage http://www.crc.dk/phys/ From owner-software@net.bio.net Mon May 03 07:53:00 1999 Path: biosci!agate!newsfeed.berkeley.edu!dispose.news.demon.net!demon!newsfeed.icl.net!newsfeed.wirehub.nl!news.belnet.be!news.uia.ac.be!treecon2.uia.ac.be From: Jeroen Raes Newsgroups: bionet.software Subject: Re: Sequence format converter for Windows Date: Mon, 03 May 1999 10:48:11 +0200 Organization: University of Antwerp - UIA Message-ID: <372D62CA.745F9A4D@uia.ua.ac.be> References: <7gi0ip$80t$1@nntp8.atl.mindspring.net> NNTP-Posting-Host: hnets.uia.ac.be Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Trace: naxos.belnet.be 925721311 17299 143.169.254.1 (3 May 1999 08:48:31 GMT) X-Complaints-To: abuse@belnet.be NNTP-Posting-Date: 3 May 1999 08:48:31 GMT X-Mailer: Mozilla 4.5 [en] (Win98; I) X-Accept-Language: en X-NNTP-Posting-Host: treecon2.uia.ac.be Lines: 40 John Barlow wrote: > Hi: > I need a sequence format converter for Win32 that would be > more flexible than the command line Readseq or TOFASTA. > > As NCBI BLAST accepts input in FASTA format only, I would need at least > to be able to convert GenBank files to FASTA. > In addition, I would like > to extract single sequences from my MSF or PHYLIP alignments and > save them in FASTA format. > > Any suggestions? > For the latter, you can use ForCon, a Win95 sequence alignment format conversion program, available for free at http://bioc-www.uia.ac.be/u/jraes/index.html. No GenBank format is added (been planning on adding that for ages), but you can intercovert the following formats: CLUSTAL, EMBL, FASTA, GCG/MSF, Hennig86, MEGA, NBRF/PIR, PAUP/Nexus, Parsimony Jackknifer, PHYLIP, TREECON. A selection of sequences and positions can be made. Jeroen ________________________________________________________________ Jeroen Raes Research Group of Molecular Biology Dept. of Biochemistry University of Antwerp (UIA) Universiteitsplein 1 B-2620 Wilrijk BELGIUM Email: jraes@uia.ua.ac.be http://bioc-www.uia.ac.be/u/jraes/index.html From owner-software@net.bio.net Mon May 03 13:01:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!uchinews2!newsswitch.lcs.mit.edu!news-spur1.maxwell.syr.edu!news.maxwell.syr.edu!howland.erols.net!math.ohio-state.edu!jussieu.fr!univ-lille1.fr!news.cict.fr!not-for-mail From: =?iso-8859-1?Q?Ram=F3n?= VEGA TARANTINO Newsgroups: bionet.general,bionet.metabolic-reg,bionet.software Subject: metabolic fluxes calculating programs Date: Mon, 03 May 1999 15:57:02 +0100 Organization: Inconnue Lines: 9 Message-ID: <372DB93E.83146C83@insa-tlse.fr> NNTP-Posting-Host: bio39.gba.insa-tlse.fr Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Trace: news.cict.fr 925739650 15544 195.83.10.40 (3 May 1999 13:54:10 GMT) X-Complaints-To: usenet@news.cict.fr NNTP-Posting-Date: 3 May 1999 13:54:10 GMT X-Mailer: Mozilla 4.5 [en] (WinNT; I) X-Accept-Language: en Xref: biosci bionet.general:33043 bionet.metabolic-reg:2479 bionet.software:23375 I am looking for programs calculating the metabolic fluxes. I already have an old version of BIONET program from Stephanopoulos G.N. (1991) and I would like to know if someone else have tried it and if there exists a more recent version. Thanks for your help. Please answer to the following address: letisse@insa-tlse.fr From owner-software@net.bio.net Mon May 03 13:14:00 1999 Reply-To: "Norman" From: "Norman" Newsgroups: bionet.software Subject: NEW AND CHEAP SOFTWARES! Date: Mon, 3 May 1999 16:06:36 +0400 Lines: 12 X-Priority: 3 X-MSMail-Priority: Normal X-Newsreader: Microsoft Outlook Express 5.00.2314.1300 X-MimeOLE: Produced By Microsoft MimeOLE V5.00.2314.1300 NNTP-Posting-Host: dialup29.sia.telecom.lt Message-ID: <372dae09@news.takas.lt> X-Trace: 3 May 1999 16:09:13 +0100, dialup29.sia.telecom.lt Path: biosci!bloom-beacon.mit.edu!news.kodak.com!news-nysernet-16.sprintlink.net!news-east1.sprintlink.net!news-peer1.sprintlink.net!news-in-east1.sprintlink.net!news.sprintlink.net!newsfeed.nyu.edu!wesley.videotron.net!Pollux.Teleglobe.net!news.takas.lt!dialup29.sia.telecom.lt We have professional cracked full English version softwares We can make custom Cd's with softwares by your request. We also have a big collection over one million of the new graphic, animation, musics, multimedia, projection, engineering, video programs. If you wish we will give you our website. We also can send some files over Internet up to 54MB. Please reply to: cdzcd@usa.net Fax: +441716917580 From owner-software@net.bio.net Mon May 03 15:43:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!newsfeed.berkeley.edu!awabi.library.ucla.edu!204.121.3.5!newshost.lanl.gov!not-for-mail From: Carla Kuiken Newsgroups: bionet.software Subject: postscript -> GIF converter for UNIX Date: Mon, 03 May 1999 10:37:38 -0600 Organization: Los Alamos National Laboratory Lines: 9 Message-ID: <372DD0D2.ACC@lanl.gov> NNTP-Posting-Host: intron.lanl.gov Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Trace: newshost.lanl.gov 925749460 23875 128.165.24.153 (3 May 1999 16:37:40 GMT) X-Complaints-To: usenet@lanl.gov NNTP-Posting-Date: 3 May 1999 16:37:40 GMT X-Mailer: Mozilla 3.01 (X11; U; SunOS 5.5.1 sun4m) Does anyone know of a commandline postscript-to-GIF converter for UNIX that gives decent results? We use program called 'convert' at the moment, but the quality of the resulting GIFs is variable and sometimes truly atrocious. Thanks! Carla Kuiken Los Alamos HIV Sequence Database From owner-software@net.bio.net Mon May 03 18:24:00 1999 Path: biosci!agate!newsfeed.berkeley.edu!newspeer.monmouth.com!newsfeed.mad.ttd.net!news.bcn.ttd.net!not-for-mail From: "system" Newsgroups: bionet.software Subject: SORRY I¨M TRYING MY PROGRAM Date: Mon, 3 May 1999 21:14:28 +0200 Organization: Telefonica Transmision de Datos Lines: 3 Message-ID: <7gks5c$ept$1@diana.bcn.ttd.net> NNTP-Posting-Host: 194.224.98.233 X-Newsreader: Microsoft Outlook Express 4.72.3110.5 X-MimeOLE: Produced By Microsoft MimeOLE V4.72.3110.3 ESTO ES UNA PRUEBA From owner-software@net.bio.net Tue May 04 02:21:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!logbridge.uoregon.edu!news.indiana.edu!not-for-mail From: gilbertd@bio.indiana.edu (Don Gilbert) Newsgroups: bionet.software Subject: Re: Sequence format converter for Windows Date: 4 May 1999 03:16:37 GMT Organization: Biology, Indiana University - Bloomington Lines: 7 Message-ID: <7gloql$jf4$1@flotsam.uits.indiana.edu> References: <7gi0ip$80t$1@nntp8.atl.mindspring.net> NNTP-Posting-Host: chipmunk.bio.indiana.edu For a version of readseq for mswin, see ftp://iubio.bio.indiana.edu/molbio/readseq/mswin/ - don -- -- d.gilbert--biocomputing--indiana-u--bloomington-in-47405 -- gilbertd@bio.indiana.edu From owner-software@net.bio.net Tue May 04 07:42:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!newsfeed.berkeley.edu!dispose.news.demon.net!demon!nntp.news.xara.net!xara.net!server6.netnews.ja.net!server4.netnews.ja.net!server2.netnews.ja.net!hgmp.mrc.ac.uk!not-for-mail From: Keith James Newsgroups: bionet.software Subject: Re: postscript -> GIF converter for UNIX Date: 04 May 1999 09:36:51 +0100 Organization: MRC Human Genome Mapping Project Resource Centre Message-ID: References: <372DD0D2.ACC@lanl.gov> NNTP-Posting-Host: fes6.sanger.ac.uk X-Trace: niobium.hgmp.mrc.ac.uk 925807012 25195 193.60.84.41 (4 May 1999 08:36:52 GMT) X-Complaints-To: news@hgmp.mrc.ac.uk NNTP-Posting-Date: 4 May 1999 08:36:52 GMT X-Newsreader: Gnus v5.5/Emacs 20.3 Lines: 23 >>>>> "Carla" == Carla Kuiken writes: Carla> Does anyone know of a commandline postscript-to-GIF Carla> converter for UNIX that gives decent results? We use Carla> program called 'convert' at the moment, but the quality of Carla> the resulting GIFs is variable and sometimes truly Carla> atrocious. If you have Ghostscript and ppmtogif, you can do: gs -dNOPAUSE -dBATCH -sDEVICE=ppm -sOutputFile=image.ppm image.ps (you can change the resolution etc with other switches) Then: ppmtogif image.ppm > image.gif -- Keith James -- kdj@sanger.ac.uk -- http://www.sanger.ac.uk/Users/kdj The Sanger Centre, Wellcome Trust Genome Campus, Hinxton, Cambs CB10 1SA From owner-software@net.bio.net Tue May 04 09:16:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!newsfeed.berkeley.edu!dispose.news.demon.net!demon!bullseye.news.demon.net!demon!news.demon.nl!demon!koala.objectzoo.nl!not-for-mail From: gtupar@ObjectZoo.com (Georg Tuparev) Newsgroups: bionet.software Subject: Re: MacOS X(ten) notes Date: Tue, 04 May 1999 10:10:03 GMT Message-ID: <925812603.9401.0.rover.c30be7f5@news.demon.nl> References: <7g7qrl$m2e$1@flotsam.uits.indiana.edu> Reply-To: gtupar@ObjectZoo.com NNTP-Posting-Host: koala.objectzoo.nl X-NNTP-Posting-Host: koala.objectzoo.nl:195.11.231.245 X-Trace: news.demon.nl 925812603 rover:9401 NO-IDENT koala.objectzoo.nl:195.11.231.245 X-Complaints-To: abuse@demon.net X-Newsreader: RadicalNews (TM) 0.9.8 Beta(i) MIME-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit Cc: gilbertd@bio.indiana.edu Lines: 24 And here the good news ... some very cool biomed software is on the way ;-) -- georg -- In <7g7qrl$m2e$1@flotsam.uits.indiana.edu> Don Gilbert wrote: [...] > Mac OS X (ten) notes > For about $250 educational price for MacOS X, plus ~ $900 for an original iMac, > one could have a good unix server/workstation w/ some nice MacOS features. > It doesn't quite compete with a cheap Intel/Linux system in price, > but offers some niceties not available there. > > -- Don -- Georg Tuparev The ObjectZoo Ltd. Schipbeekstraat 1 3 Cathles Road 1078 BK Amsterdam, The Netherlands London SW12 9LE, UK Mobile: +31-655-798196 Fax: +31-20-524-1254 Windows NT is NOT a virus - a virus is small and efficient! From owner-software@net.bio.net Tue May 04 15:23:00 1999 Path: biosci!newshost.lanl.gov!awabi.library.ucla.edu!209.50.235.254!europa.netcrusader.net!205.252.116.205!howland.erols.net!vixen.cso.uiuc.edu!news.indiana.edu!not-for-mail From: gilbertd@bio.indiana.edu (Don Gilbert) Newsgroups: bionet.software Subject: Gr2Pix - Java graphics to PDF, HTML/GIF image maps, etc pictures Date: 4 May 1999 16:18:21 GMT Organization: Biology, Indiana University - Bloomington Lines: 15 Message-ID: <7gn6kd$mto$1@flotsam.uits.indiana.edu> NNTP-Posting-Host: chipmunk.bio.indiana.edu Gr2Pix - Java Graphics to Picture formats, including Adobe PDF, Postscript, GIF and HTML/GIF image maps, and Apple PICT. This includes freely reusable Java source code and demonstrations. Find at http://iubio.bio.indiana.edu/soft/molbio/java/apps/gr2pix/ Gr2Pix is a set of Java classes for producing pictures and image maps in different formats, from Java graphics. It is useful for programmers, for applications or for web (cgi) programs. -- Don Gilbert -- -- d.gilbert--biocomputing--indiana-u--bloomington-in-47405 -- gilbertd@bio.indiana.edu From owner-software@net.bio.net Tue May 04 17:45:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!newsfeed.berkeley.edu!news.maxwell.syr.edu!news-was.dfn.de!newsjunkie.ans.net!news.chips.ibm.com!newsfeed.btv.ibm.com!news.btv.ibm.com!not-for-mail From: Reece Kimball Hart Newsgroups: bionet.software Subject: Re: postscript -> GIF converter for UNIX Date: 04 May 1999 14:38:48 -0400 Organization: IBM T. J. Watson Research Center Lines: 16 Message-ID: References: <372DD0D2.ACC@lanl.gov> Reply-To: Reece Kimball Hart NNTP-Posting-Host: tallac.watson.ibm.com X-Trace: news.btv.ibm.com 925843227 12004 9.2.11.24 (4 May 1999 18:40:27 GMT) X-Complaints-To: news@btv.ibm.com NNTP-Posting-Date: 4 May 1999 18:40:27 GMT X-Attribution: Reece X-URL: X-Newsreader: Gnus v5.5/XEmacs 20.4 - "Emerald" >>>>> "CK" == Carla Kuiken writes: CK> Does anyone know of a commandline postscript-to-GIF converter for UNIX CK> that gives decent results? We use program called 'convert' at the CK> moment, but the quality of the resulting GIFs is variable and sometimes CK> truly atrocious. ImageMagick is a good Swiss Army knife for image manipulation. See http://www.wizards.dupont.com/cristy/ImageMagick.html Installation with support for all possible graphics formats is tiresome, but the resulting utilities will do just about anything you need. Binaries are available for many platforms. -- Reece Hart, http://www.research.ibm.com/people/r/reece, PGP:0xD178AAF9 From owner-software@net.bio.net Tue May 04 18:23:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!newsfeed.berkeley.edu!dispose.news.demon.net!demon!newspeer.clara.net!news.clara.net!newsfeed.nacamar.de!fu-berlin.de!server1.netnews.ja.net!server5.netnews.ja.net!server6.netnews.ja.net!newsfeed.ed.ac.uk!holyrood.ed.ac.uk!sokal From: Daniel Barker Newsgroups: bionet.software Subject: Reading and writing NEXUS: C source code wanted Date: Tue, 4 May 1999 20:17:55 +0100 Organization: Edinburgh University Message-ID: Reply-To: Daniel Barker NNTP-Posting-Host: holyrood.ed.ac.uk Mime-Version: 1.0 Content-Type: TEXT/PLAIN; charset=US-ASCII X-Trace: scotsman.ed.ac.uk 925845285 16298 129.215.38.17 (4 May 1999 19:14:45 GMT) X-Complaints-To: usenet@scotsman.ed.ac.uk NNTP-Posting-Date: 4 May 1999 19:14:45 GMT Lines: 28 I am looking for a library to read and write NEXUS files (Maddison et al. 1997). I would like this to be (1) written in ANSI C, (2) portable, (3) thoroughly tested and stable, (4) available as source code, (5) free and (6) either released from copyright or distributed under a licence which allows free re-distribution. So far, I have come across the following, which could be helpful in implementing such a C library but do not constitute one themselves: Visual Basic source code by N. Cathness at http://research.amnh.org/~neil/nexus.html PASCAL-like pseudocode by D. R. Maddison, D. L. Swofford and W. P. Maddison at http://phylogeny.arizona.edu/nexus/reading.html I would be grateful for advice on further resources, or any other information. Thank you. REFERENCE Maddison, D. R., Swofford, D. L. & Maddison, W.P. 1997. "NEXUS: an extensible file format for systematic information." Systematic Biology 46(4): 590-621 Daniel Barker. From owner-software@net.bio.net Tue May 04 18:26:00 1999 Path: biosci!biosci!not-for-mail From: Joao Paulo Kitajima Newsgroups: bionet.software Subject: >>> Software for Drawing Genome Figures <<< Date: 4 May 1999 12:26:11 -0700 Organization: Institute of Computing, University of Campinas, SP, Brazil Lines: 18 Sender: daemon@net.bio.net Distribution: world Message-ID: NNTP-Posting-Host: net.bio.net Is there public domain/commercial software for drawing: * circular representation of chromossomes (e.g., Tomb et al. paper in Nature 388(7) p. 539-547) * solute transport and metabolic pathways graphical representation * linear graphical representation of genes (in general, with putative identification), also known as gene map ??? Sincerely, JP Kitajima Bioinformatics Lab. Unicamp/Brazil From owner-software@net.bio.net Wed May 05 03:21:00 1999 Path: biosci!newshost.lanl.gov!awabi.library.ucla.edu!128.230.129.106!news.maxwell.syr.edu!dispose.news.demon.net!demon!news.demon.co.uk!demon!mail2news.demon.co.uk!not-for-mail From: amartin@stagleys.demon.co.uk (Andrew Martin) Newsgroups: bionet.software Subject: Re: postscript -> GIF converter for UNIX Date: Tue, 4 May 1999 14:35:42 GMT Organization: Private Address Message-ID: References: <372DD0D2.ACC@lanl.gov> X-Trace: mail2news.demon.co.uk 925877754 mail2news:14005 mail2news mail2news.demon.co.uk X-Complaints-To: abuse@demon.net X-Mail2News-Path: news.demon.net!finch-post-12.mail.demon.net![194.222.20.72]!stagleys.demon.co.uk X-Newsreader: TIN [version 1.2 PL2] Lines: 37 Carla Kuiken (kuiken@lanl.gov) wrote: : Does anyone know of a commandline postscript-to-GIF converter for UNIX : that gives decent results? We use program called 'convert' at the : moment, but the quality of the resulting GIFs is variable and sometimes : truly atrocious. : Thanks! : Carla Kuiken : Los Alamos HIV Sequence Database The only way to convert from PostScript to anything is to use a full PostScript interpreter. convert (I assume you mean the one from the ImageMagick package) is simply a wrapper to Ghostscript. The problem with Ghostscript tends to come from not-very-good (read awful!) fonts; this is supposedly remedied in more recent versions which have decent scalable fonts. You can, of course, sidestep using convert and use Ghostscript directly to create a PPM file: gs -q -dNOPAUSE -sDEVICE=ppm -sOutputFile=foo.ppm foo.ps and then use convert or the NetPBM package to convert the PPM file to GIF. This is useful with multi-page Postscript files since convert doesn't handle these properly. The LaTeX2HTML package also comes with a pstogif utility which uses gs followed by ppmtogif (from NetPBM). In summary the only think really likely to help is to upgrade your version of Ghostscript, but using these alternative routes may let you tweak the image quality :-) Andrew From owner-software@net.bio.net Wed May 05 10:25:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!logbridge.uoregon.edu!news.net.uni-c.dk!not-for-mail From: Kjeld Olesen Newsgroups: bionet.software Subject: pDRAW DNA analysis software Date: Wed, 05 May 1999 13:02:25 +0200 Organization: UNI-C Lines: 9 Message-ID: <37302541.A21A5B0C@crc.dk> NNTP-Posting-Host: 130.226.182.114 Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Trace: news.net.uni-c.dk 925902702 17322 130.226.182.114 (5 May 1999 11:11:42 GMT) X-Complaints-To: usenet@news.net.uni-c.dk NNTP-Posting-Date: 5 May 1999 11:11:42 GMT X-Mailer: Mozilla 4.05 [en] (Win95; I) Hi: Announcing pDRAW DNA analysis software. pDRAW is freeware. Have a look at http://www.angelfire.com/ne/acaclone/ Best regards, Kjeld Olesen From owner-software@net.bio.net Wed May 05 13:15:00 1999 Path: biosci!bloom-beacon.mit.edu!eecs-usenet-02.mit.edu!netnews.com!news.maxwell.syr.edu!newsfeed.cwix.com!205.219.255.8!argos.tel.hr!not-for-mail From: ivanpetrov@hotmail.com (Ivan Petrovic) Newsgroups: bionet.software Subject: EasyZip 2000 v2.6 - New version, ... Date: Wed, 5 May 1999 16:07:00 +0200 Organization: HiNet Lines: 45 Message-ID: NNTP-Posting-Host: 194.152.230.28 Mime-Version: 1.0 Content-Type: text/plain; charset=US-ASCII Content-Transfer-Encoding: 7bit X-Trace: as102.tel.hr 925913312 20266 194.152.230.28 (5 May 1999 14:08:32 GMT) X-Complaints-To: abuse@tel.hr NNTP-Posting-Date: 5 May 1999 14:08:32 GMT X-Newsreader: MicroPlanet Gravity v2.10 * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * EasyZip 2000 v2.6 Totally FREE Powerful Archive Manager for Windows * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * ... new version released on 5th May 1999 ... What is EasyZip? EasyZip is a program that manipulates with ZIP compressed archives. It has all basic functions (adding, extracting, deleting, viewing) and lot of other functions like creating powerful SFX Archives, Installing the archive, checking for viruses in archive, renaming files in archive as in Windows Explorer, writing comments, creating archives on more than one disk (disk spanning), selecting files by name, date, size, setting archive password, converting SFX archive to ZIP, .. Great user interface, better then any other, with new Windows 2000 style... Also it has integration with Windows (Drag & Drop from and to Explorer, Right mouse click on archive and folders, ...) Complete Help + Tutorial for beginners with pictures. What's new? Changes in this version --> Drag and drop to Explorer works fine, some new misc features, ... Support: EasyZip and more and more information about EasyZip you can find at: http://members.xoom.com/ipsoft and my e-mail address is: ivanpetrov@hotmail.com ... so just download it, try and you will love it. If you have any suggestions, remarks, please call me back at my e-mail, or if you just want to say that you are using my program, and would like to subscribe to EasyZip's mailing list call me at my e-mail, too ... ... Webmasters ... if you have your home page add link to EasyZip's homepage and I will link to your page from my page ... Thanks in advance... From owner-software@net.bio.net Wed May 05 13:49:00 1999 From: "Dave D." Newsgroups: bionet.software Subject: Hey lookin for someone to trade software with via ftp. Date: Wed, 5 May 1999 10:37:59 -0400 Lines: 3 X-Newsreader: Microsoft Outlook Express 4.72.3155.0 X-MimeOLE: Produced By Microsoft MimeOLE V4.72.3155.0 NNTP-Posting-Host: 208.19.238.79 Message-ID: <373058dc.0@news.primary.net> X-Trace: 5 May 1999 09:42:36 -0600, 208.19.238.79 Organization: Primary Network. http://www.primary.net Path: biosci!agate!newsfeed.berkeley.edu!news-peer1.sprintlink.net!news-backup-west.sprintlink.net!news.sprintlink.net!news.primary.net!208.19.238.79 Just mail me and Ill let u know what I've got. ddavis1070@Primary.net From owner-software@net.bio.net Wed May 05 14:06:00 1999 Path: biosci!888.NU!time1 From: time1@888.NU ("Toby") Newsgroups: bionet.software Subject: Deep discount houses...foreclosures Date: 5 May 1999 08:06:28 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 45 Sender: daemon@net.bio.net Distribution: world Message-ID: <199905051506.IAA22433@net.bio.net> Reply-To: time1@888.nu NNTP-Posting-Host: net.bio.net Huge Savings! Low to No Down Payments! Serving All 50 States! No matter where you live in the USA, we can help you save on beautiful Bank Owned Homes. With our nationwide network, working with over 1,200 banks and lending institutions and a database of over 30,000 homes, we can find you the house of your dreams. Here are some examples: Executive Country Retreat, over 2,788 sq. ft. in like new condition, valued at $129,000,start your offer at only $39,000; newer 4 bedroom home, under $45,000; 3 bedroom, 2.5 bath handyman special, only $18,000; 5 bedroom, 3 bath at only $59,900. We have all types of foreclosures: Single Family Homes, Condos, Multi-Family Units, Country Acreage, Commercial Land and Buildings. This could be your opportunity to upgrade or purchase that first home for less than your current monthly payments. Investor replies welcome! For information on bank foreclosed properties in your area, send an email to bizmarket14@bigfoot.com?subject=moreinfo PLEASE KEEP "moreinfo" IN THE SUBJECT We make the homes you have only wished for - Affordable! This message is sent in compliance of Senate bill: S.1618 SECTION 301. Sender: To be permanently removed from further mailings from this advertiser, just hit the link below mailto:vanderbeek_125@yahoo.com?subject=remove From owner-software@net.bio.net Wed May 05 16:33:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!newsfeed.berkeley.edu!dispose.news.demon.net!demon!news.demon.co.uk!demon!fssc.demon.co.uk!not-for-mail From: "Herbert M Sauro" Newsgroups: bionet.general,bionet.metabolic-reg,bionet.software Subject: Re: metabolic fluxes calculating programs Date: Wed, 5 May 1999 18:27:01 +0100 Message-ID: <925925223.21265.0.nnrp-04.c2de3927@news.demon.co.uk> References: <372DB93E.83146C83@insa-tlse.fr> NNTP-Posting-Host: fssc.demon.co.uk X-NNTP-Posting-Host: fssc.demon.co.uk:194.222.57.39 X-Trace: news.demon.co.uk 925925223 nnrp-04:21265 NO-IDENT fssc.demon.co.uk:194.222.57.39 X-Complaints-To: abuse@demon.net X-Priority: 3 X-MSMail-Priority: Normal X-Newsreader: Microsoft Outlook Express 5.00.2014.211 X-MimeOLE: Produced By Microsoft MimeOLE V5.00.2014.211 Lines: 20 Xref: biosci bionet.general:33062 bionet.metabolic-reg:2481 bionet.software:23393 What exactly do you mean by calculating metabolic fluxes? Herbert Sauro PS Just installed Outlook Express so Newsgroup management will I hope be a bit easier! Ramón VEGA TARANTINO wrote in message news:372DB93E.83146C83@insa-tlse.fr... > I am looking for programs calculating the metabolic fluxes. > I already have an old version of BIONET program from Stephanopoulos > G.N. (1991) and I would like to know if someone else have tried it and > if there exists a more recent version. > Thanks for your help. > Please answer to the following address: > > letisse@insa-tlse.fr > From owner-software@net.bio.net Wed May 05 16:36:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!logbridge.uoregon.edu!nuq-peer.news.verio.net!news-peer-west.sprintlink.net!news-peer1.sprintlink.net!news-in-west1.sprintlink.net!news.sprintlink.net!news.aecom.yu.edu!fengli From: Tristan Newsgroups: bionet.software Subject: Molecular bio/biochem. Screen Saver Date: Wed, 05 May 1999 13:23:02 -0400 Organization: Albert Einstein College of Medicine Lines: 2 Message-ID: <050519991323022901%fengli@aecom.yu.edu> NNTP-Posting-Host: skylark.aecom.yu.edu Mime-Version: 1.0 Content-Type: text/plain; charset=HZ-GB-2312 Content-Transfer-Encoding: 8bit User-Agent: YA-NewsWatcher/4.2.2 Is there any screen saveer able to display cartoons/movies of molecular biology or biochemistry process, proferabley Mac version? Thanks. From owner-software@net.bio.net Wed May 05 18:54:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!newsfeed.berkeley.edu!chippy.visi.com!news-out.visi.com!cam-news-hub1.bbnplanet.com!washdc3-snf1!news.gtei.net!icet.net.nih.gov!news From: Jonathan Epstein Newsgroups: bionet.software Subject: Re: Reading and writing NEXUS: C source code wanted Date: Wed, 05 May 1999 13:26:40 -0400 Organization: National Institutes of Health Lines: 37 Message-ID: <37307F50.FE8AFA4F@nih.gov> References: NNTP-Posting-Host: 137.187.221.54 Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 4.05 [en] (Win95; I) To: Daniel Barker The file desktop/salfiles.c in the NCBI toolkit seems to meet many of your needs, although I don't know how comprehensively it parses Nexus. You can get the toolkit from ftp://ncbi.nlm.nih.gov/toolbox/ Good luck, - Jonathan Daniel Barker wrote: > > I am looking for a library to read and write NEXUS files (Maddison et al. > 1997). I would like this to be (1) written in ANSI C, (2) portable, (3) > thoroughly tested and stable, (4) available as source code, (5) free and > (6) either released from copyright or distributed under a licence which > allows free re-distribution. > > So far, I have come across the following, which could be helpful in > implementing such a C library but do not constitute one themselves: > > Visual Basic source code by N. Cathness at > http://research.amnh.org/~neil/nexus.html > > PASCAL-like pseudocode by D. R. Maddison, D. L. Swofford and > W. P. Maddison at http://phylogeny.arizona.edu/nexus/reading.html > > I would be grateful for advice on further resources, or any other > information. Thank you. > > REFERENCE > > Maddison, D. R., Swofford, D. L. & Maddison, W.P. 1997. "NEXUS: an > extensible file format for systematic information." Systematic > Biology 46(4): 590-621 > > Daniel Barker. From owner-software@net.bio.net Wed May 05 19:39:00 1999 Path: biosci!CMMT.UBC.CA!francis From: francis@CMMT.UBC.CA Newsgroups: bionet.software Subject: Re: Reading and writing NEXUS: C source code wanted Date: 5 May 1999 13:39:39 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 62 Sender: daemon@net.bio.net Distribution: world Message-ID: <199905052031.NAA13080@monod.cmmt.ubc.ca> Reply-To: francis@cmmt.ubc.ca NNTP-Posting-Host: net.bio.net > From: Jonathan Epstein > Subject: Re: Reading and writing NEXUS: C source code wanted > Date: Wed, 05 May 1999 13:26:40 -0400 > The file desktop/salfiles.c in the NCBI toolkit seems to meet many of > your needs, although I don't know how comprehensively it parses Nexus. (Hi Jonathan :-) Sequin (in the NCBI toolkit) reads Nexus files, so I'm pretty sure the URL Jonathan provided below will have what you need. cheers, f. -- | B.F. Francis Ouellette tel: (604) 875-3815 | | Director, Bioinformatics Core Facility fax: (604) 875-3840 | | Centre for Molecular Medicine and Therapeutics, UBC, Canada | | francis@cmmt.ubc.ca http://www.cmmt.ubc.ca | > You can get the toolkit from > ftp://ncbi.nlm.nih.gov/toolbox/ > > Good luck, > > - Jonathan > > Daniel Barker wrote: > > > > I am looking for a library to read and write NEXUS files (Maddison et al. > > 1997). I would like this to be (1) written in ANSI C, (2) portable, (3) > > thoroughly tested and stable, (4) available as source code, (5) free and > > (6) either released from copyright or distributed under a licence which > > allows free re-distribution. > > > > So far, I have come across the following, which could be helpful in > > implementing such a C library but do not constitute one themselves: > > > > Visual Basic source code by N. Cathness at > > http://research.amnh.org/~neil/nexus.html > > > > PASCAL-like pseudocode by D. R. Maddison, D. L. Swofford and > > W. P. Maddison at http://phylogeny.arizona.edu/nexus/reading.html > > > > I would be grateful for advice on further resources, or any other > > information. Thank you. > > > > REFERENCE > > > > Maddison, D. R., Swofford, D. L. & Maddison, W.P. 1997. "NEXUS: an > > extensible file format for systematic information." Systematic > > Biology 46(4): 590-621 > > > > Daniel Barker. > From owner-software@net.bio.net Wed May 05 22:38:00 1999 Path: biosci!agate!newsfeed.berkeley.edu!cyclone.bc.net!news.UVic.CA!not-for-mail From: David Hiscock Newsgroups: bionet.software Subject: how to find changes in EST or OWL DBs? Date: Wed, 05 May 1999 16:31:50 -0700 Organization: University of Victoria Lines: 12 Message-ID: <3730D4E6.B26B3A08@uvic.ca> NNTP-Posting-Host: octane.bioc.uvic.ca Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Trace: uvaix7e1.comp.UVic.CA 925947192 444936 142.104.33.132 (5 May 1999 23:33:12 GMT) X-Complaints-To: abuse@UVic.CA NNTP-Posting-Date: 5 May 1999 23:33:12 GMT X-Mailer: Mozilla 4.51 [en] (X11; I; IRIX64 6.4 IP30) X-Accept-Language: en Hello all, does anyone out there know of a program or script that they are willing to share that determines differences between two EST DBs or two OWL DBs? I want to be able to compile a list of differences between an old and new DB to speed up searches... any help is appreciated. David From owner-software@net.bio.net Thu May 06 03:30:00 1999 Path: biosci!news.stanford.edu!nntp.cs.ubc.ca!news-spur1.maxwell.syr.edu!news.maxwell.syr.edu!news-peer1.sprintlink.net!news-in-central.sprintlink.net!news.sprintlink.net!itssrv1.ucsf.edu!macmac-2.ucsf.edu!user From: bpmurray*STUFFER*@socrates.ucsf.edu (Bernard P. Murray, PhD) Newsgroups: bionet.software Subject: Re: how to find changes in EST or OWL DBs? Date: Wed, 05 May 1999 21:10:59 -0700 Organization: University of California, San Francisco Lines: 20 Message-ID: References: <3730D4E6.B26B3A08@uvic.ca> NNTP-Posting-Host: macmac-2.ucsf.edu In article <3730D4E6.B26B3A08@uvic.ca>, David Hiscock wrote: > Hello all, > > does anyone out there know of a program or script that they are willing > to > share that determines differences between two EST DBs or two OWL DBs? > I want to be able to compile a list of differences between an old and > new DB > to speed up searches... any help is appreciated. > > David In what format are the databases? Any chance you could use diff (maybe after sorting them)? Bernard -- Bernard P. Murray, PhD Dept. Cell. Mol. Pharmacol., UCSF, San Francisco, USA From owner-software@net.bio.net Thu May 06 04:24:00 1999 Path: biosci!USA.NET!silvia_brown From: silvia_brown@USA.NET Newsgroups: bionet.software Subject: adv: Important Psychic Message For You... Date: 5 May 1999 22:24:02 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 42 Sender: daemon@net.bio.net Distribution: world Message-ID: <199905060522.WAA08769@net.bio.net> NNTP-Posting-Host: net.bio.net LIVE PERSONAL PSYCHIC! (as seen on T.V.) LEARN TODAY WHAT YOUR FUTURE HOLDS FOR LOVE, MONEY, MARRIAGE, JOB, & HEALTH ASTROLOGY CLAIRVOYANCY NUMEROLOGY TAROT ALL QUESTIONS ANSWERED IMMEDIATELY! REALIZE YOUR DESTINY! CALL RIGHT NOW! 1-900-226-4140 or 1-800-372-3384 for VISA, MC, & AMEX (These are not sex lines!) This message is intended for Psychic Readers, Psychic Users and people who are involved in the $1 Billion a year Psychic Industry. If this message has reached you in error, please disregard it and accept our apoligies. To be removed from this list, please respond with the subject "remove". Thank You. LIVE PERSONAL PSYCHIC! (as seen on T.V.) LEARN TODAY WHAT YOUR FUTURE HOLDS FOR OVE, MONEY, MARRIAGE, JOB, & HEALTH ASTROLOGY CLAIRVOYANCY From owner-software@net.bio.net Thu May 06 11:16:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!news-feed.inet.tele.dk!bofh.vszbr.cz!dispose.news.demon.net!demon!news.demon.co.uk!demon!cammol1.demon.co.uk!r_grant From: r_grant@see.sig.for.address (Richard P. Grant) Newsgroups: bionet.software Subject: Re: Molecular bio/biochem. Screen Saver Date: Thu, 06 May 1999 13:09:19 +0100 Organization: post does not necessarily reflect the views of Cambridge Molecular Message-ID: References: <050519991323022901%fengli@aecom.yu.edu> Reply-To: rgrant@netscape.net NNTP-Posting-Host: cammol1.demon.co.uk X-NNTP-Posting-Host: cammol1.demon.co.uk:212.228.79.177 X-Trace: news.demon.co.uk 925992601 nnrp-07:9673 NO-IDENT cammol1.demon.co.uk:212.228.79.177 X-Complaints-To: abuse@demon.net X-Newsreader: MT-NewsWatcher 2.4.4 X-No-ahbou: YES X-No-Archive: YES X-Face: E%wu[EoEhNnjFG!0[ 7cH@VuxC//iy$!n-+bh9Q`+SHW@&}E.&Ly(y'Tvrd5amG/o35>c3zF6QvXX, Tristan wrote: >Is there any screen saveer able to display cartoons/movies of molecular >biology or biochemistry process, proferabley Mac version? Thanks. Dark Side of the Mac (Free! I'm using v. 4.2 under 8.5.1) can run movies. It can also move picts around the screen. So it should be easy to make a QT movie of your process(es) and get DS to display it. R -- Richard P. Grant MA DPhil | rgrant at cmtech.co.uk System Defenestrator | home: www.avnet.co.uk/adastra | work: www.cmtech.co.uk From owner-software@net.bio.net Thu May 06 13:02:00 1999 Path: biosci!agate!newsfeed.berkeley.edu!news.maxwell.syr.edu!nntp.news.xara.net!xara.net!server6.netnews.ja.net!newsfeed.ed.ac.uk!aultmore!chrisb From: chrisb@hgu.mrc.ac.uk (Chris Boyd) Newsgroups: bionet.software Subject: Re: postscript -> GIF converter for UNIX Date: 6 May 1999 13:54:06 GMT Organization: MRC Human Genetics Unit Lines: 29 Message-ID: <7gs6tu$p2k$1@scotsman.ed.ac.uk> References: <372DD0D2.ACC@lanl.gov> NNTP-Posting-Host: aultmore.hgu.mrc.ac.uk X-Trace: scotsman.ed.ac.uk 925998846 25684 193.63.65.38 (6 May 1999 13:54:06 GMT) X-Complaints-To: usenet@scotsman.ed.ac.uk NNTP-Posting-Date: 6 May 1999 13:54:06 GMT X-Newsreader: TIN [version 1.2 PL2] Carla Kuiken (kuiken@lanl.gov) wrote: : Does anyone know of a commandline postscript-to-GIF converter for UNIX : that gives decent results? We use program called 'convert' at the : moment, but the quality of the resulting GIFs is variable and sometimes : truly atrocious. Have you tried raising the resolution? % convert -density 150x150 fred.ps gif:fred.gif or similar usually gives good results. The default density is only 72x72. The trouble is that convert and gs don't do any anti-aliasing, so you get jagged text. A horrendous freeware way of getting anti-aliasing is to (i) convert the image to PDF using ps2pdf in gs, (ii) display the resulting PDF using acroread with General Preferences set to "smooth text and monochrome images", (iii) capture (ugh) the resulting image from the screen using xwd or similar and (iv) use convert again to make a .gif version of the .xwd file. Well, I didn't say it was easy. The best solution, however, is to steer clear of bit-mapped imagery and stick to vector graphics. Best wishes, -- Chris Boyd | from (but not \ MRC Human Genetics Unit Christopher.Boyd@hgu.mrc.ac.uk | on behalf of) / Crewe Rd, Edinburgh http://www.hgu.mrc.ac.uk/Users/Christopher.Boyd EH4 2XU, SCOTLAND From owner-software@net.bio.net Thu May 06 14:05:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!news-feed.inet.tele.dk!bofh.vszbr.cz!dispose.news.demon.net!demon!newsfeed.icl.net!newsfeed.nacamar.de!fu-berlin.de!news-ber1.dfn.de!news-ham1.dfn.de!news-han1.dfn.de!newsserver.rrzn.uni-hannover.de!CIPPoolBiologie.CIPFB5Uni-Osnabrueck.com From: Administrator Newsgroups: bionet.software Subject: Software for phenological analysis Date: Thu, 6 May 1999 16:49:42 +0200 Organization: RRZN - Newsserver Sender: Administrator Message-ID: NNTP-Posting-Host: cip.biologie.uni-osnabrueck.de X-Newsreader: Microsoft (R) Exchange Internet News Service Version 5.5.1960.3 Lines: 13 Hello there, I have written a non commercial software for phenological analysis. The program runs under all 32bit ms windows operating system and is written completly in c. It is originally designed for flower phenological analysis, but an experienced programmer should be able to modify the code for his puposes. The programm is very very well documentet, unfortunately in german. Has somebody interestes in the program and/or code? Greetings from Germany S. Riediger From owner-software@net.bio.net Thu May 06 16:33:00 1999 Path: biosci!agate!newsfeed.berkeley.edu!newsfeed.cwix.com!136.167.2.7!delphi.bc.edu!news From: "J.W. Bizzaro" Newsgroups: bionet.software Subject: Re: Software for phenological analysis Date: Thu, 06 May 1999 13:28:09 -0400 Organization: Boston College Lines: 22 Message-ID: <3731D129.7123D2A3@bc.edu> References: NNTP-Posting-Host: shiv1p17.bc.edu Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 4.51 [en] (X11; I; Linux 2.2.5-15 i586) X-Accept-Language: en Administrator wrote: > > Hello there, > I have written a non commercial software for phenological analysis. The > program runs under all 32bit ms windows operating system and is written > completly in c. It is originally designed for flower phenological > analysis, but an experienced programmer should be able to modify the > code for his puposes. The programm is very very well documentet, > unfortunately in german. Has somebody interestes in the program and/or > code? Hello. Do you have a Web page for this program? I'd like to hear more about it. You're talking about genetic phenotype analysis, right? How about genotypes? Jeff -- J.W. Bizzaro mailto:bizzaro@bc.edu Boston College Chemistry http://www.uml.edu/Dept/Chem/Bizzaro/ -- From owner-software@net.bio.net Thu May 06 17:35:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!news-feed.inet.tele.dk!bofh.vszbr.cz!news.belnet.be!uni-erlangen.de!news-nue1.dfn.de!news-han1.dfn.de!newsserver.rrzn.uni-hannover.de!CIPPoolBiologie.CIPFB5Uni-Osnabrueck.com From: Administrator Newsgroups: bionet.software Subject: Sorry, no genetic phenotype anlysis Date: Thu, 6 May 1999 20:14:25 +0200 Organization: RRZN - Newsserver Lines: 14 Sender: Administrator Message-ID: References: <3731D129.7123D2A3@bc.edu> NNTP-Posting-Host: cip.biologie.uni-osnabrueck.de X-Newsreader: Microsoft (R) Exchange Internet News Service Version 5.5.1960.3 > Hello. > Do you have a Web page for this program? I'd like to hear more about > itYou're talking about genetic phenotype analysis, right? How about > genotypes? > [Administrator] Sorry no genetic phenotype analysis. The program allows to analyse flowering times of different species by comparation. You can set certain filters with different criteria, e.g. color, family, flower-hight etc. for the plants you want to view. Stephan From owner-software@net.bio.net Thu May 06 18:14:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!news.ems.psu.edu!news.cis.ohio-state.edu!nntp.sei.cmu.edu!news.psc.edu!not-for-mail From: Craig M Sager Newsgroups: bionet.general,bionet.general,bionet.software Subject: WORKSHOP: DEVELOPING AND USING PC CLUSTERS AS A BIOMEDICAL RESEARCH TOOL Date: Thu, 06 May 1999 15:07:34 -0400 Organization: Pittsburgh Supercomputing Center Lines: 25 Message-ID: <3731E876.E3375501@psc.edu> NNTP-Posting-Host: hdsx9.psc.edu Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 4.5 [en] (WinNT; I) X-Accept-Language: en-US Xref: biosci bionet.general:33071 bionet.software:23407 The Pittsburgh Supercomputing Center's Biomedical Initiative will be offering the following NIH-sponsored training workshop: DEVELOPING AND USING PC CLUSTERS AS A BIOMEDICAL RESEARCH TOOL Workshop Dates: June 17-19, 1999. Application deadline: May 20, 1999 This workshop is designed to assist biomedical researchers who are interested in establishing a PC cluster for use by their laboratory. The workshop will address software and hardware topics encountered in the process of building, operating and managing a PC cluster. In addition, software development issues will also be described. Topics of discussion will include: "What do you need to consider when creating an operating environment?" "How to select System Software?" "How to Administer the Cluster?" "What applications are appropriate?" and "How to get the best performance for your money?" Full details, including on-line applications and financial support, may be found on the PSC Web site: http://www.psc.edu/biomed/workshops/workshops.html The Pittsburgh Supercomputing Center's Biomedical Initiative is an NIH Supported Resource Center. From owner-software@net.bio.net Fri May 07 05:59:00 1999 Sender: thomas@beagle.bmc.uu.se To: Administrator Newsgroups: bionet.software Subject: Re: Software for phenological analysis References: Mime-Version: 1.0 (generated by tm-edit 7.108) Content-Type: text/plain; charset=ISO-8859-1 Content-Transfer-Encoding: quoted-printable From: Thomas Sicheritz Date: 07 May 1999 08:51:58 +0200 Message-ID: X-Newsreader: Gnus v5.5/XEmacs 20.4 - "Emerald" NNTP-Posting-Host: beagle.bmc.uu.se X-Trace: 7 May 1999 08:54:06 +0100, beagle.bmc.uu.se Path: biosci!agate!newsfeed.berkeley.edu!dispose.news.demon.net!demon!feed1.news.rcn.net!rcn!netnews.com!news-peer-europe.sprintlink.net!news.sprintlink.net!newsfeed.sunet.se!news01.sunet.se!news99.sunet.se!newsfeed.uu.se!beagle.bmc.uu.se Lines: 16 > I have written a non commercial software for phenological analysis. The > program runs under all 32bit ms windows operating system and is written > completly in c. It is originally designed for flower phenological > analysis, but an experienced programmer should be able to modify the > code for his puposes. = > The programm is very very well documentet, unfortunately in german. That doesn't matter - anyone can use Babalfish to translate documentation http://babelfish.altavista.com/ I did that recently with french C-code :-) = Gr=FC=DFe -thomas From owner-software@net.bio.net Fri May 07 15:39:00 1999 Path: biosci!sanger.ac.uk!solovyev From: solovyev@sanger.ac.uk ("Victor Solovyev") Newsgroups: bionet.software Subject: Read and View (Java) ABI trace file, analyze Error positions and polymorphism Date: 7 May 1999 09:39:39 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 218 Sender: daemon@net.bio.net Distribution: world Message-ID: <9905071734.ZM2592@octane> NNTP-Posting-Host: net.bio.net We installed ABIQ - Read and View ABI trace file and potential Error positions ABIQ Program is prepared to analyze ABi trace files and calculate error probability for each base using a new version of the approach described in (Lawrence,Solovyev,1994). We plan to develop these tools further to use in sequence EDITING/ASSEMBLING and study of HUMAN POLYMORPHISM. If we observe different bases in several reads of some locus and these bases have very small probability of errors, than we have a good candidate of polymorphic site. The program compute the PROBABILITY OF 3 TYPES OF BASE CALLING ERRORS (Insertion - Overcall; deletion - Undercall and substitution - Miscall). The program can be run at http://genomic.sanger.ac.uk/ of our Computational Genomic Group WEB server (http://genomic.sanger.ac.uk/abi/abi.shtml) This version of program uses ABI base calling sequence, but we plan to incorparate our version of base calling in the future, also we plan to tune the quality prediction part for new ABI sequencers. The Java viewer can be used for visual analysis of Trace files and quality data. References: Solovyev V.V., Salamov A.A. Assignment of base quality and partition of Overcall, Undercall, Miscall and sequence polymorphism (unpublished data). Seledtsov I.A., Solovyev V.V. Visual and computational analysys of ABI trace data (unpublished data). Lawrence C.B., Solovyev V.V. Assignment of Position-Specific Error Probability to primary DNA Sequence Data.Nucl.Acids Res., 1994, 22, 7,1272-1280. The program output includes : The sequence and probabilitoes of errors in 0-9 scale corresponding (0 - 100%). Sequence of ABI base calling in FASTA format and Quality data for each base: Total quality and Overcall, Undercall and Miscall, respectively. Quality scale is ( q = -10 Log (p)) similar with the used in (Ewing and Green,1998, Genome Res.,8,186-194. Browse --> Load File ---> Show data Example of output of the program: A01U0005 " View ABI traces and Quality data " (Java viewer button) 10 20 30 40 50 ACTATCATTAAAGATTCTGTCAATATTTAAAATAAGATGACAGATATAAT P over 00000000000000000000000000000000000000000000000000 P under 00000000000000000000000000000000000000000000000000 P mis 00000000000000000000000000000000000000000000000000 60 70 80 90 100 TCATATTGTAGGCTCACATGTAAGCATTAAATAACCGATATACTAAACTA P over 00000000000000000000000000000000000000000000000000 P under 00000000000000000000000000000000000000000000000000 P mis 00000000000000000000000000000000000000000000000000 110 120 130 140 150 TGCGATGCCTTCTTTAATCCTTCTTATTTTATTGTAGTCACTAAAATTTT P over 00000000000000000000000000000000000000000000000000 P under 00000000000000000000000000000000000000000000000000 P mis 00000000000000000000000000000000000000000000000000 160 170 180 190 200 AGATTGGAATACTGCAGGAACTTAGTACAAGTCAAATGTGTTAATACTAC P over 00000000000000000000000000000000000000000000000000 P under 00000000000000000000000000000000000000000000000000 P mis 00000000000000000000000000000100000000000000000000 210 220 230 240 250 ACATGGAAAGAATATTAGGAAACAAGCATTTGGTCACCTTCCAGTCATAA P over 00000000000000000000000000000000000000000000000000 P under 00000000000000000000000000000000000000000000000000 P mis 00000000000000000000000000000000000000000000000000 260 270 280 290 300 AAGAGACTGAGGCAGAAATAATATGAACCAGGGCTGTATGTTTACCTAAG P over 00000000000000000000000000000000000000000000000000 P under 00000000000000000000000000000000000000000000000000 P mis 00000000000000000000000000000000000000000000000000 310 320 330 340 350 ACAGTTGCACATAAGAATCAACTGGGGCATTTAAAACACAGCAACAACAA P over 00000000000000000000000000000000000000000000000000 P under 00000000000000000000000000000000000000000000000000 P mis 00000000000000000000000000000000000000000000000000 360 370 380 390 400 TAACCCAAACAGTGATCCTGGGGCTCCATTCCAGACCCAACTTAATCAGT P over 00000300000000000000000000000000000001000000000000 P under 00020000000000000010000000000000000000000000000000 P mis 00100400000000000000000000000000000002000000000000 410 420 430 440 450 ATTTCTGGAGGTTGGACACTGACGGCTGTTATTTTTCAAAGGCATCCCAG P over 00000000000000000000000010000000000000000100000100 P under 00002100011200000000011000000001000011000000020000 P mis 00000001010000000000010000000000040000000100010200 GGTGGA P over 000000 P under 000000 P mis 010000 > A01U0005 Length: 456 ACTATCATTAAAGATTCTGTCAATATTTAAAATAAGATGACAGATATAATTCATATTGTA GGCTCACATGTAAGCATTAAATAACCGATATACTAAACTATGCGATGCCTTCTTTAATCC TTCTTATTTTATTGTAGTCACTAAAATTTTAGATTGGAATACTGCAGGAACTTAGTACAA GTCAAATGTGTTAATACTACACATGGAAAGAATATTAGGAAACAAGCATTTGGTCACCTT CCAGTCATAAAAGAGACTGAGGCAGAAATAATATGAACCAGGGCTGTATGTTTACCTAAG ACAGTTGCACATAAGAATCAACTGGGGCATTTAAAACACAGCAACAACAATAACCCAAAC AGTGATCCTGGGGCTCCATTCCAGACCCAACTTAATCAGTATTTCTGGAGGTTGGACACT GACGGCTGTTATTTTTCAAAGGCATCCCAGGGTGGA > Total quality A01U0005 99 99 69 49 43 49 69 32 99 69 62 43 99 49 49 99 69 49 69 99 62 49 35 99 69 99 99 99 69 99 40 43 99 62 62 99 49 49 99 99 99 62 49 99 99 99 99 69 49 99 99 99 99 99 69 99 99 99 99 99 69 46 99 99 99 99 99 49 69 99 99 49 99 69 99 62 69 62 69 69 99 99 99 69 69 49 69 99 99 99 99 99 99 99 69 69 99 99 99 69 62 99 99 69 99 62 62 69 40 49 62 99 69 49 99 99 62 62 99 99 49 99 99 69 49 99 99 69 69 99 99 99 99 99 99 99 69 99 99 99 99 49 69 99 69 49 69 99 99 49 99 62 99 40 49 40 40 49 99 99 99 69 69 49 69 62 40 69 49 62 49 35 69 99 49 49 99 69 49 25 49 69 99 99 40 49 69 99 99 69 99 99 69 49 69 99 49 40 99 99 99 62 69 35 49 40 49 49 40 40 40 49 69 99 69 69 69 48 49 40 49 99 62 40 32 49 69 69 49 49 49 35 35 40 69 99 99 69 32 62 69 35 40 62 99 62 99 49 69 99 49 35 40 69 62 99 49 62 40 69 48 99 49 99 69 69 40 62 99 69 99 99 69 69 62 99 99 51 99 62 69 69 40 62 62 62 69 99 99 69 99 69 69 99 69 62 46 49 99 62 62 62 62 62 62 62 62 69 62 62 51 69 62 69 69 99 69 99 62 62 69 69 62 48 48 40 62 69 62 51 99 69 69 99 69 69 62 51 62 51 51 62 46 62 48 40 49 48 40 51 62 51 22 18 40 5 69 69 99 62 40 51 46 40 69 46 31 51 27 48 31 51 49 62 40 28 51 32 62 51 32 39 32 62 39 30 34 13 46 29 31 32 39 62 62 40 62 51 40 40 69 62 33 28 17 26 32 25 28 20 24 15 35 46 40 31 51 32 51 62 39 20 25 30 21 51 51 31 30 46 32 27 35 8 36 26 22 26 29 29 36 19 40 51 46 16 30 14 32 28 39 22 29 30 39 39 > Overcall quality A01U0005 99 99 69 49 43 49 69 32 99 99 69 43 99 49 49 99 99 49 69 99 99 99 35 99 99 99 99 99 99 99 69 43 99 99 69 99 49 49 99 99 99 99 49 99 99 99 99 99 49 99 99 99 99 99 99 99 99 99 99 99 99 49 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 69 99 99 99 99 99 99 99 49 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 69 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 69 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 37 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 37 99 99 10 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 49 99 19 99 32 99 99 99 99 99 99 99 99 99 99 99 99 99 40 99 99 99 43 99 99 99 99 37 99 99 99 99 99 99 99 99 43 99 99 24 99 99 99 99 99 99 99 99 49 99 43 99 99 37 35 99 24 99 99 99 99 99 21 43 37 99 43 99 40 43 43 > Undercall quality A01U0005 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 69 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 69 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 69 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 52 99 99 99 99 69 99 99 99 99 99 99 99 99 99 99 99 99 99 52 99 99 69 99 99 69 69 99 69 69 99 69 99 52 99 69 99 99 99 99 99 69 69 99 99 69 69 69 40 69 99 99 52 99 69 99 99 99 99 99 52 69 52 52 69 52 99 69 40 99 69 40 52 99 52 99 18 69 99 99 99 99 99 40 52 52 40 69 52 40 52 27 69 32 52 99 69 40 32 52 32 69 52 52 40 32 69 40 99 52 99 52 99 32 32 40 69 99 40 69 52 40 40 99 69 99 69 18 27 52 40 32 27 27 16 99 52 40 32 52 32 52 69 52 27 27 32 99 52 52 32 32 52 32 27 69 32 40 32 22 27 99 69 40 99 40 52 52 18 69 52 52 69 52 40 32 52 52 52 > Miscall quality A01U0005 99 99 99 99 99 99 99 99 99 99 69 99 99 99 99 99 99 99 99 99 69 49 99 99 99 99 99 99 99 99 40 99 99 69 69 99 99 99 99 99 99 69 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 49 99 99 99 99 99 49 69 99 99 49 99 99 99 69 69 69 99 69 99 99 99 99 99 69 99 99 99 99 99 99 99 99 69 69 99 99 99 69 69 99 99 99 99 69 69 69 40 49 69 99 69 49 99 99 69 69 99 99 49 99 99 99 49 99 99 69 69 99 99 99 99 99 99 99 99 99 99 99 99 49 69 99 69 49 69 99 99 49 99 69 99 40 49 40 40 49 99 99 99 69 99 49 69 69 40 69 49 69 49 35 69 99 49 49 99 69 49 27 49 69 99 99 40 49 69 99 99 69 99 99 69 49 69 99 49 40 99 99 99 69 69 35 49 40 49 49 40 40 40 49 69 99 69 69 69 49 49 40 49 99 69 40 32 49 69 69 49 49 49 35 35 40 99 99 99 99 32 69 69 35 40 69 99 69 99 49 69 99 49 35 40 69 69 99 49 69 40 69 49 99 49 99 99 69 40 69 99 99 99 99 99 99 69 99 99 69 99 69 69 69 40 69 69 69 99 99 99 99 99 99 99 99 69 69 49 49 99 69 69 69 69 99 69 99 69 99 69 69 99 99 99 69 99 99 99 99 99 69 99 99 69 49 49 99 69 99 69 99 99 99 99 99 99 69 69 99 99 69 99 69 49 69 49 69 49 49 69 99 69 69 23 49 40 9 99 69 99 69 69 99 49 99 99 49 33 99 99 49 49 99 49 99 69 33 69 99 69 99 32 49 99 99 49 30 35 17 49 33 69 69 49 99 69 69 99 99 69 99 99 99 33 30 33 49 33 27 32 23 33 30 49 49 69 49 99 99 69 99 40 23 40 40 30 69 99 69 40 49 99 99 35 9 40 30 49 69 32 32 40 23 69 69 49 27 30 17 35 30 40 23 35 33 49 49 -- Victor Solovyev The Sanger Centre, Hinxton, Cambridge CB10 1SA, UK Email: solovyev@sanger.ac.uk http://genomic.sanger.ac.uk Phone: 44-1223-494799 FAX: 44-1223-494919 From owner-software@net.bio.net Fri May 07 16:11:00 1999 Path: biosci!pravda.ucr.edu!ihnp4.ucsd.edu!sdd.hp.com!usc!howland.erols.net!newsfeed.cwix.com!152.163.199.19!portc03.blue.aol.com!audrey01.news.aol.com!not-for-mail From: krturbyfil@aol.com (KRTurbyfil) Newsgroups: bionet.software Subject: Micro Tube Label SW Lines: 20 NNTP-Posting-Host: ladder05.news.aol.com X-Admin: news@aol.com Date: 7 May 1999 17:05:56 GMT Organization: AOL http://www.aol.com Mime-Version: 1.0 Content-Type: text/plain; charset=ISO-8859-1 Content-Transfer-Encoding: 8bit Message-ID: <19990507130556.20937.00001095@ng-ch1.aol.com> Does anyone know of a labeling program that can print labels for microcentrifuge (Eppendorf) tubes? I would require that it have the following characteristics: 1) Mac O/S 8 compatible 2) Label size is user-defineable 3) It can print sequential labels based on user-defined characteristics; i.e., GF1-1, GF1-2, GF1-3, etc. 4) Does not require special labels (I am currently using Tough-Tags™ laser printer style) 5) Cost is minimal Any help anyone could give would be greatly appreciated. From owner-software@net.bio.net Fri May 07 19:22:00 1999 Path: biosci!agate!newsfeed.berkeley.edu!dispose.news.demon.net!demon!news.maxwell.syr.edu!hub1.ispnews.com!news13.ispnews.com.POSTED!not-for-mail From: "Joe Pylka" Newsgroups: bionet.software References: Subject: Re: Software for phenological analysis X-Newsreader: Microsoft Outlook Express 4.72.3110.1 X-MimeOLE: Produced By Microsoft MimeOLE V4.72.3110.3 Message-ID: <6THY2.7583$3F1.324353@news13.ispnews.com> NNTP-Posting-Host: 199.173.60.235 X-Trace: news13.ispnews.com 926108226 199.173.60.235 (Fri, 07 May 1999 16:17:06 EDT) NNTP-Posting-Date: Fri, 07 May 1999 16:17:06 EDT Date: Fri, 7 May 1999 16:17:01 -0400 Lines: 15 Administrator wrote in message ... >Hello there, >I have written a non commercial software for phenological analysis. The >program runs under all 32bit ms windows operating system and is written >completly in c. It is originally designed for flower phenological >analysis, but an experienced programmer should be able to modify the >code for his puposes. The programm is very very well documentet, >unfortunately in german. Has somebody interestes in the program and/or >code? Yes, there would be interest in this. Is it difficult to modify for other annual phenomena as sequences of frog breeding periods? Joe Pylka From owner-software@net.bio.net Sun May 09 08:39:00 1999 Path: biosci!GO2NET.COM!stockprofits900pc From: stockprofits900pc@GO2NET.COM Newsgroups: bionet.software Subject: Possible +900% Stock Investment Return! Date: 9 May 1999 02:39:46 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 33 Sender: daemon@net.bio.net Distribution: world Message-ID: <199905090939.CAA22936@net.bio.net> NNTP-Posting-Host: net.bio.net As Stock Investing Interests you, please CAREFULLY Review the Following - you will NOT be Disappointed! ========================================== "RNTK" Predicted Returns +900% over Next Few Months! ========================================== Imminent Outstanding Company News & Profit Potential Too Great to Ignore Dear Investor, Analysts have predicted a +900% rise in RNTK stock over the next few months due to recent developments and IMMINENT company news. RNTK (Rentech, Inc.) is the developer, marketer and licensor of PATENTED technology for the conversion of gasses (and liquids and solids) into super clean high value fuels, products and chemicals. In other words, RNTK makes it's money from selling PATENTED technology that BILLION Dollar Gas & Oil Corporations (such as Texaco) CANNOT do without. The technology converts otherwise waste, into valuable clean burning fuels while reducing greenhouse gas emissions and operating costs. Without such technology, energy companies are forced to utilize inferior technology accounting for 60% of their expenses. As RNTK has NEW superior and PATENTED technology scheduled for release, RNTK stock can only dramatically increase in value. The NASDAQ hearing for RNTK's proposed promotion of its stock and upcoming news is scheduled for 20th May 1999. An immediate purchase (BEFORE the promotion of several imminent releases) while the stock is barely $0.50/share virtually guarantees phenomenal profits - possibly +900% over the next few months. Even a $2,000 stock purchase stock could return over $18,000! *"Rentech is in a stronger position than it has ever been. We have working capital and meet the net tangible asset requirements for continued NASDAQ listing." **"BCP's excellent reputation and experience aligns Rentech with an engineering partner in an area of the world that could hold some of the greatest potential for Gas-To-Liquids technology" -- *Mr., Yakobson, CEO Rentech, Inc. (RNTK) Careful investigation will indicate our research is accurate, and will reveal RNTK's phenomenal profit potential - it will generate returns far greater than any other stock or investment program. As a buying frenzy is anticipated over the next few days, we advise you to act promptly to maximize returns. Understandably you may prefer to simply watch the stock, however the stock price being so low provides you with a very rare opportunity for enormous profits truly too great to miss. We recommend holding RNTK stock for at least 6 months until the promotion of the new patented technology is complete. ======================================================= This information is published by VSP when our research indicates particular stock will generate significant returns - this is where we put OUR money however it is not an endorsement to purchase any stock or security. To receive all further issues for a one-time fee of US$150, please reply to this email with "INFO" in subject, otherwise you will not be contacted again. Our 1998 stock picks generated in excess of 980% profit - statistics verified upon request. Sent on behalf of VSP Financial by Growth Success Strategies. VSP Financial currently owns 20,000 RNTK common stock From owner-software@net.bio.net Sun May 09 14:35:00 1999 Path: biosci!CYBERDUDE.COM!time3 From: time3@CYBERDUDE.COM ("Don") Newsgroups: bionet.software Subject: Learn... Date: 9 May 1999 08:35:03 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 197 Sender: daemon@net.bio.net Distribution: world Message-ID: Reply-To: time3@cyberdude.com NNTP-Posting-Host: net.bio.net How to get $200-300 in checks and cash stuffed into your mailbox...EVERY day! What you're about to read will stun you with its simplicity and its power to quickly generate a steady flow of $20 checks into your mailbox. It's a complete online marketing system...all contained on ONE SINGLE PAGE. This program is a 3-part system, utilizing a KILLER classified ad...a powerful one-page sales letter, delivered by autoresponder...and a top quality product. Let me explain: 1. Killer Ads. EVERY profitable marketing program starts here. If your ads work...then you're two thirds of the way home. And believe me...these work! The wording of these powerful little ads create an almost irresistible desire to click on the link to get the rest of the story. Curiosity, and the desire to make money, are 2 very powerful emotions...which makes them pull like crazy! 2. The Letter. The page you're now reading is both the sales letter and the marketing plan. The simplicity of this program is the secret of its money-making power. You don't have to create any marketing copy. There's no complicated compensation plan to learn or to have explain to prospects...and there's no inventory for you to have to fuss with. It's brilliant, but a real no-brainer to implement. Here's how it works... When people see your little classified ad...curiosity will prompt a good percentage of them to click on the email link to see what it's about. The instant they do, then your autoresponder will deliver this letter into their inbox. Only this time it will be YOUR letter...with YOUR contact information. It's lightning fast... The speed at which the "CookieCutter" works is amazing! If your ad comes out in a publication at 12am...you can literally be getting checks faxed or emailed to you by 3pm. Just think about it for a second... If the prospect of INSTANT profits makes your pulse race just a little, then please understand...that's a universal reaction! This program is not a chain-letter...or a money game. This next point explains why... 3. It delivers a REAL-VALUE product. In order to keep from being downright illegal, many programs just tack any old excuse for a product onto their money-game. While this may be technically legal, it's not moral. Nor is it a sound business decision. If your integrity is important to you, then you'll be glad to know that the product you'll be marketing through the this system is access to a top quality training program called "Boot Camp", which is an in-depth training program, created for aspiring, entry-level internet marketers. The Internet represents the greatest marketing opportunity that has ever existed. But in spite of this fact, over 95% of all those involved in Electronic Marketing never make enough to even pay their expenses. The reason is simple. E-Marketing is a profession...but it's practiced mostly by AMATEURS! _______________________________ "Boot Camp" is just what it sounds like. It's "basic training". It's formatted to take you step-by-step from "wanna-be"... to "web-smart marketing professional". The training is thorough, practical and cumulative... each lesson taking up where the last one left off. And the best part is...while you're getting your own education, you can use this to literally make thousands of dollars. The cost to become a member is a one-time $20 outlay, all of which is paid DIRECTLY by the purchasing member to the member who enrolls him. Immediately upon receipt of the $20 payment, the new member receives access to the training site, which contains complete marketing instructionsand a wide selection of quality marketing tools. ____________________________ HERE'S HOW TO GET STARTED... First, get signed up. As soon as I receive your payment, you will receive the URL by email to the support site. In that site is a COMPLETE step-by-step guide to setting up your system. Nothing is left to chance or speculation. Next, Personalize this letter. This will take you 10 minutes. In the support site is a copy of this letter. You just copy and paste the support- site letter into a "plain vanilla" word processor document, and carefully personalize it with YOUR contact information and YOUR payment instructions. Third, Start placing the ad. The last critical part of the formula is to get the ad seen by tons of people. Most free advertising on the net is too time consuming to be worth the time it takes to set it up. In the support site is a complete step-by-step guide to advertising in the ONLY free forum I've found, that actually produces results. And it works really fast! I've actually placed ads at noon, and had people downloading my letter by 2 or 3pm... and sending me money by 5! This is where you should START your marketing... but the REAL PROFITS are to be made from paid ads. Once you have your system set up and tweaked, then I'll show you where you can spend just a few bucks and almost immediately get your ad in front of literally hundreds of thousands of qualified prospects. "To me, the marketing business is a fascinating way to make money. The excitement of getting cash and checks in the mail and through your computer is totally addictive." "Since getting into this business, my best single day so far was a little over $3,200 in checks and money orders... I've never been the same since." "I wish you success." Now it's okay not to believe in the tooth fairy...as long as you understand that 2 + 2 ALWAYS equals 4. Truly effective marketing is a science...not a lottery. And if a program is put together correctly...it will produce the same results... time after time. In one sense, this system is a product itself! But it's also a SYSTEM. And once you learn how to use this system, you can use it to market other products...each one producing it's own income stream for you. Now it's decision time... You can pass on this system...and blow your $20 on popcorn at the movies. But you should understand... "IF YOU KEEP ON DOING WHAT YOU'VE BEEN DOING, YOU'RE GONNA KEEP GETTING WHAT YOU'VE BEEN GETTING! Your other option is to "risk it all" and become a member. Just Imagine...within 24-48 hours you could be receiving checks through your computer! And once you reach that point, you're just a stone's throw away from mastering a marketing system that could revolutionize your life! If you think you can...you're right! If you think you can't...you're also right! It's your call! Send a $20 Money order or a $20 bill wrapped in paper to The Marketing Circle PO Box 15185 East Providence, RI 02915 Please include your email address and mailing address so we can send you the support web site and Boot Camp kit. From owner-software@net.bio.net Sun May 09 21:03:00 1999 Path: biosci!agate!newsfeed.berkeley.edu!logbridge.uoregon.edu!cyclone.mbnet.mb.ca!canopus.cc.umanitoba.ca!not-for-mail From: Brian Fristensky Newsgroups: bionet.software Subject: Re: AceDB as personal/laboratory management system for vectors and constructs? Date: Sun, 09 May 1999 16:57:43 -0500 Organization: University of Manitoba Lines: 62 Message-ID: <373604D7.73653BE@cc.umanitoba.ca> References: <3701F60C.F1A1E7D4@ibb.waw.pl> NNTP-Posting-Host: brassica.cc.umanitoba.ca Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Trace: canopus.cc.umanitoba.ca 926287074 2099 130.179.16.121 (9 May 1999 21:57:54 GMT) X-Complaints-To: Postmaster@cc.umanitoba.ca NNTP-Posting-Date: 9 May 1999 21:57:54 GMT X-Mailer: Mozilla 4.51 [en] (X11; U; SunOS 5.5.1 sun4u) X-Accept-Language: en Piotr Kozbial wrote: > > Do you think it is a good idea to use AceDB to store information about > plasmids available in one laboratory? What are the pros and cons? How > many of you are using AceDB this way? Are there any better solutions for > UNIX/Linux? > > Thanks > Piotr > > P.S. Links about AceDB: > newsgroup bionet.software.acedb (is very quiet) > ftp://probe.nalusda.gov/pub/ > http://www.sanger.ac.uk/Software/Acedb/index.shtml ACeDB can be an excellent in-house database, because it lets you tailor your objects to your own experimental system. Anything can be an object. The down side is that if you want to get fancy, you have to put a lot of thought into how your objects are defined. We found the ACeDB Tablemaker to be quite valuable for editing and categorizing genes in a small EST project that we did. As well, the ability of ACeDB to read and write objects as ASCII files made it easy to automate the creation of new ESTs, to submit them to GenBank, to update them with GenBank ACCESSION numbers, and to generate a HTML table for publication. This table is included in the following article: Fristensky B, Balcerzak M, He D-F, Zhang P, 1999. Expressed sequence tags from the defense response of Brassica napus to Leptosphaeria maculans. Mol. Plant Pathol. Online http://www.bspp.org.uk/mppol/1999/0301FRISTENSKY. I have put together a web site that describes using ACeDB for home-grown databases: http://home.cc.umanitoba.ca/~psgendb/acedb/acedb.html It includes a small sample database that you can download and use as a starting point in creating your own database. Note that my web site has screen shots made using ACeDB4.5. The current version (4.7) looks a bit different, but still works with the sample database. -- =============================================================================== Brian Fristensky | Original entry for Microsoft Windows, Department of Plant Science | in the Hitchiker's Guide to University of Manitoba | the Galaxy: "Harmless". Winnipeg, MB R3T 2N2 CANADA | frist@cc.umanitoba.ca | After the release of Windows NT, this Office phone: 204-474-6085 | was changed to "Mostly harmless". FAX: 204-261-5732 | http://home.cc.umanitoba.ca/~frist/ =============================================================================== From owner-software@net.bio.net Mon May 10 06:08:00 1999 Path: biosci!agate!newsfeed.berkeley.edu!news.maxwell.syr.edu!nntp.news.xara.net!xara.net!server6.netnews.ja.net!newsfeed.ed.ac.uk!aultmore!chrisb From: chrisb@hgu.mrc.ac.uk (Chris Boyd) Newsgroups: bionet.software Subject: Re: Read and View (Java) ABI trace file, analyze Error positions and polymorphism Date: 10 May 1999 07:00:00 GMT Organization: MRC Human Genetics Unit Lines: 71 Distribution: world Message-ID: <7h605g$asr$1@scotsman.ed.ac.uk> References: <9905071734.ZM2592@octane> NNTP-Posting-Host: aultmore.hgu.mrc.ac.uk X-Trace: scotsman.ed.ac.uk 926319600 11163 193.63.65.38 (10 May 1999 07:00:00 GMT) X-Complaints-To: usenet@scotsman.ed.ac.uk NNTP-Posting-Date: 10 May 1999 07:00:00 GMT X-Newsreader: TIN [version 1.2 PL2] Victor Solovyev (solovyev@sanger.ac.uk) wrote: : We installed ABIQ - Read and View ABI trace file and potential : Error positions : ABIQ Program is prepared to analyze ABi trace files and calculate : error probability for each base using a new version of the approach : described in (Lawrence,Solovyev,1994). : We plan to develop these tools further to use in sequence : EDITING/ASSEMBLING and study of HUMAN POLYMORPHISM. : If we observe different bases in several reads of some locus and : these bases have very small probability of errors, than we have a : good candidate of polymorphic site. : The program compute the PROBABILITY OF 3 TYPES OF BASE CALLING ERRORS : (Insertion - Overcall; deletion - Undercall and substitution - Miscall). (snip) : The sequence and probabilitoes of errors in 0-9 scale corresponding (0 - : 100%). It sounds very useful, but it would be a lot easier to spot the non-zero probabilities if the program used "." instead of "0" for 0 probability. For example: : Example of output of the program: : A01U0005 " View ABI traces and Quality data " (Java viewer button) (snip) : 360 370 380 390 400 : TAACCCAAACAGTGATCCTGGGGCTCCATTCCAGACCCAACTTAATCAGT : P over 00000300000000000000000000000000000001000000000000 : P under 00020000000000000010000000000000000000000000000000 : P mis 00100400000000000000000000000000000002000000000000 : 410 420 430 440 450 : ATTTCTGGAGGTTGGACACTGACGGCTGTTATTTTTCAAAGGCATCCCAG : P over 00000000000000000000000010000000000000000100000100 : P under 00002100011200000000011000000001000011000000020000 : P mis 00000001010000000000010000000000040000000100010200 : GGTGGA : P over 000000 : P under 000000 : P mis 010000 would become: 360 370 380 390 4.. TAACCCAAACAGTGATCCTGGGGCTCCATTCCAGACCCAACTTAATCAGT P over .....3...............................1............ P under ...2..............1............................... P mis ..1..4...............................2............ 410 420 430 440 450 ATTTCTGGAGGTTGGACACTGACGGCTGTTATTTTTCAAAGGCATCCCAG P over ........................1................1.....1.. P under ....21...112.........11........1....11.......2.... P mis .......1.1...........1...........4.......1...1.2.. GGTGGA P over ...... P under ...... P mis .1.... Best wishes, -- Chris Boyd | from (but not \ MRC Human Genetics Unit Christopher.Boyd@hgu.mrc.ac.uk | on behalf of) / Crewe Rd, Edinburgh http://www.hgu.mrc.ac.uk/Users/Christopher.Boyd EH4 2XU, SCOTLAND From owner-software@net.bio.net Mon May 10 11:57:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!remarQ73!supernews.com!remarQ.com!nntp.primenet.com!dispose.news.demon.net!demon!news.demon.co.uk!demon!right.celltech.co.uk!not-for-mail From: jpetts@celltech.co.uk (James Petts) Newsgroups: bionet.software Subject: Calculating coefficient of inbreeding Date: Mon, 10 May 1999 12:52:48 GMT Organization: Ye 'Ol Disorganized NNTPCache groupie Message-ID: <3736d682.21054004@right.celltech> Reply-To: jpetts@celltech.co.uk NNTP-Posting-Host: right.celltech.co.uk X-NNTP-Posting-Host: right.celltech.co.uk:194.217.191.12 X-Trace: news.demon.co.uk 926340661 nnrp-08:10534 NO-IDENT right.celltech.co.uk:194.217.191.12 X-Complaints-To: abuse@demon.net X-Newsreader: Forte Free Agent 1.11/32.235 Cache-Post-Path: Right.celltech!unknown@jpetts.celltech X-Cache: nntpcache 2.3.3 (see http://www.nntpcache.org/) Lines: 15 Hello All Does anybody have an algorithm or some code for calculating the coefficient of inbreeding, prefereable using Wright's formula, but Emik and Terrel's method would also be appreciated. The overall efficiency of the algorithm is not of paramount importance, as I have two fairly meaty servers to throw at this code, and I only have a population of some 10000 individuals with a maximum of 14 generations. If anybody has code in any (common :-) language, or just a paper algorithm I would very much appreciate it. Looking forward to hearing for you all... James Petts From owner-software@net.bio.net Mon May 10 12:13:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!news-feed.inet.tele.dk!bofh.vszbr.cz!news.belnet.be!not-for-mail From: Guy Droogmans Newsgroups: bionet.software,bionet.biophysics Subject: analysis software for pClamp data Date: Mon, 10 May 1999 14:58:34 +0200 Organization: KULeuvenNet Lines: 80 Message-ID: <3736D7FA.EE421ACB@med.kuleuven.ac.be> NNTP-Posting-Host: marvin.kulnet.kuleuven.ac.be Mime-Version: 1.0 Content-Type: multipart/alternative; boundary="------------836BA5E8AE12E2C4C751C06B" X-Trace: naxos.belnet.be 926341690 11886 134.58.127.3 (10 May 1999 13:08:10 GMT) X-Complaints-To: abuse@belnet.be NNTP-Posting-Date: 10 May 1999 13:08:10 GMT X-Mailer: Mozilla 4.51 [en] (Win98; I) X-Accept-Language: en Cache-Post-Path: marvin!unknown@n36pc34.med.kuleuven.ac.be X-Cache: nntpcache 2.3.3 (see http://www.nntpcache.org/) Xref: biosci bionet.software:23423 bionet.biophysics:4975 --------------836BA5E8AE12E2C4C751C06B Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit WinASCD is windows-32 program fro analyzing whole-cell and single channel currents acquired with pClamp software in triggered or continous sampling modes (Clampex, Fetchex, Axotape). Features 1. data correction procedures * baseline correction for removing slow drift * background correction * linear leak and capacitive transient correction 2. analysis * extract peak and average currents from traces * compose a record from a single or multiple files * ensemble averaged current * fit current traces: polynome, sum of exponentials, Hodgkin-Huxley kinetics, kinetic scheme * analysis of current variance * single channel: amplitude histogram, open probability, mean open time, construct and analyze idealized current traces. --------------836BA5E8AE12E2C4C751C06B Content-Type: text/html; charset=us-ascii Content-Transfer-Encoding: 7bit WinASCD is windows-32 program fro analyzing whole-cell and single channel currents acquired with pClamp software in triggered or continous sampling modes (Clampex, Fetchex, Axotape).
Features
1. data correction procedures
  • baseline correction for removing slow drift
  • background correction
  • linear leak and capacitive transient correction
2.  analysis
  • extract peak and average currents from traces
  • compose a record from a single or multiple files
  • ensemble averaged current
  • fit current traces: polynome, sum of exponentials, Hodgkin-Huxley kinetics, kinetic scheme
  • analysis of current variance
  • single channel: amplitude histogram, open probability, mean open time, construct and analyze idealized current traces.


 
 
  --------------836BA5E8AE12E2C4C751C06B-- From owner-software@net.bio.net Mon May 10 18:34:00 1999 From: "Eric Wu" Newsgroups: bionet.software Subject: Up To Date ! ! ! Date: Tue, 11 May 1999 03:29:31 +0800 Lines: 10 X-Priority: 3 X-MSMail-Priority: Normal X-Newsreader: Microsoft Outlook Express 5.00.2014.211 X-MimeOLE: Produced By Microsoft MimeOLE V5.00.2014.211 NNTP-Posting-Host: 203.116.55.32 Message-ID: <37373387.0@news.cyberway.com.sg> Path: biosci!news.stanford.edu!newsfeed.stanford.edu!newsfeed.berkeley.edu!newsfeed.cwix.com!210.132.92.62!news2.kddnet.ad.jp!news1.kddnet.ad.jp!newsvr.cyberway.com.sg!news.cyberway.com.sg!203.116.55.32 Hello: Welcome To Visit My New Hompage. Guarantee No Advertisement, No Rubbish. Just Up To Date Software. Just Try It ,You Won't Regret Of It. http://gzwchr.163.net Thanks For Your Patientce From owner-software@net.bio.net Tue May 11 09:14:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!newsfeed.berkeley.edu!dispose.news.demon.net!demon!newspeer.clara.net!news.clara.net!newsfeed.nacamar.de!fu-berlin.de!server1.netnews.ja.net!hgmp.mrc.ac.uk!biosci From: gwilliam@hgmp.mrc.ac.uk (Gary Williams) Newsgroups: bionet.software Subject: BLAST search with large sequences Date: 11 May 1999 11:08:11 +0100 Organization: MRC Human Genome Mapping Project Resource Centre Message-ID: <199905111008.LAA01818@tin.hgmp.mrc.ac.uk> NNTP-Posting-Host: mercury.hgmp.mrc.ac.uk X-Trace: niobium.hgmp.mrc.ac.uk 926417292 26216 193.62.192.80 (11 May 1999 10:08:12 GMT) X-Complaints-To: news@hgmp.mrc.ac.uk NNTP-Posting-Date: 11 May 1999 10:08:12 GMT X-Received: from mserv1.dl.ac.uk (root@mserv1.dl.ac.uk [148.79.160.65]) by hgmp.mrc.ac.uk (8.9.3/8.9.3) with ESMTP id LAA18088 for ; Tue, 11 May 1999 11:08:08 +0100 (BST) X-Received: from hgmp.mrc.ac.uk (mercury.hgmp.mrc.ac.uk [193.62.192.80]) by mserv1.dl.ac.uk with ESMTP id LAA05978 (8.8.8/5.4[ref postmaster@dl.ac.uk] for dl.ac.uk from gwilliam@hgmp.mrc.ac.uk); Tue, 11 May 1999 11:08:11 +0100 (BST) X-Precedence: first-class X-Received: (from root@localhost) by hgmp.mrc.ac.uk (8.9.3/8.9.3) id LAA18069 for bio-soft@daresbury.ac.uk.filtered; Tue, 11 May 1999 11:08:06 +0100 (BST) X-Received: from tin.hgmp.mrc.ac.uk (tin [193.62.192.50]) by hgmp.mrc.ac.uk (8.9.3/8.9.3) with ESMTP id LAA18063 for ; Tue, 11 May 1999 11:08:05 +0100 (BST) X-Received: (from gwilliam@localhost) by tin.hgmp.mrc.ac.uk (8.9.1b+Sun/8.8.8) id LAA01818 for bio-soft@daresbury.ac.uk; Tue, 11 May 1999 11:08:06 +0100 (BST) X-To: bio-soft@dl.ac.uk Lines: 32 It is starting to become common for people to want to do BLAST searches with sequences of 200 Kb and upwards. There are then problems with memory, time to do the search and many strong matches forcing interesting weak matches in other regions of the query sequence off the bottom of the list of output alignments. I am interested in how other sites are approaching this problem. My initial thoughts on this are that the query sequence should be split into lengths of maybe 50 Kb with a overlap of maybe 1 Kb. The results can then be processed to produce a composite MSPcrunch format file which can be searched with existing scripts. Display scripts can then reintegrate the alignment results from two or more output files in the region of interest. Are there any publicly available solutions to doing BLAST searches with large sequences, then viewing and manipulating the results? Has anyone found ways to do BLAST searches with large sequences without splitting them? What other problems (and solutions) do people encounter with large sequence searches? Gary Williams Tel: +44 1223 494522 Fax: +44 1223 494512 mailto:G.Williams@hgmp.mrc.ac.uk http://www.hgmp.mrc.ac.uk/ Bioinformatics,MRC HGMP Resource Centre,Hinxton,Cambridge, CB10 1SB,UK --- From owner-software@net.bio.net Tue May 11 09:45:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!remarQ73!supernews.com!remarQ.com!dispose.news.demon.net!demon!nntp.news.xara.net!xara.net!server5.netnews.ja.net!server3.netnews.ja.net!server4.netnews.ja.net!server2.netnews.ja.net!brookes.ac.uk!not-for-mail From: Mark Poolman Newsgroups: bionet.general,bionet.metabolic-reg,bionet.software Subject: Re: metabolic fluxes calculating programs Date: Tue, 11 May 1999 11:34:02 +0100 Organization: Oxford Brookes University Message-ID: <3738079A.AAF4BE9@brookes.ac.uk> References: <372DB93E.83146C83@insa-tlse.fr> NNTP-Posting-Host: tb2cefdd.brookes.ac.uk Mime-Version: 1.0 Content-Type: multipart/alternative; boundary="------------046A7D6000B71CE05F77D021" X-Mailer: Mozilla 4.07 [en] (X11; I; Linux 2.0.36 i686) Lines: 48 Xref: biosci bionet.general:33095 bionet.metabolic-reg:2492 bionet.software:23426 --------------046A7D6000B71CE05F77D021 Content-Type: text/plain; charset=iso-8859-1 Content-Transfer-Encoding: 8bit Ramón VEGA TARANTINO wrote: > I am looking for programs calculating the metabolic fluxes. > I already have an old version of BIONET program from Stephanopoulos > G.N. (1991) and I would like to know if someone else have tried it and > if there exists a more recent version. > Thanks for your help. > Please answer to the following address: > > letisse@insa-tlse.fr Try ftp://bmshuxley.brookes.ac.uk or see our web page www://bms-mudshark.brookes.ac.uk for links to other sites, and relavent discussion. -- --------------046A7D6000B71CE05F77D021 Content-Type: text/html; charset=us-ascii Content-Transfer-Encoding: 7bit Ramón VEGA TARANTINO wrote:

I  am  looking for programs calculating the metabolic fluxes.
I already have an old version  of BIONET program from Stephanopoulos
G.N. (1991) and I would like to know if someone else have tried it and
if there exists a more recent version.
Thanks for your help.
Please answer to the following address:

letisse@insa-tlse.fr

Try ftp://bmshuxley.brookes.ac.uk or see our web page www://bms-mudshark.brookes.ac.uk for links to other sites, and relavent discussion. 
-- 
  --------------046A7D6000B71CE05F77D021-- From owner-software@net.bio.net Tue May 11 12:50:00 1999 Path: biosci!NBRF.GEORGETOWN.EDU!wuc From: wuc@NBRF.GEORGETOWN.EDU (Cathy Wu) Newsgroups: bionet.software Subject: New Release 4.1 - ProClass Database and GeneFIND System Date: 11 May 1999 06:50:41 -0700 Organization: National Biomedical Research Foundation Lines: 46 Sender: daemon@net.bio.net Distribution: world Message-ID: <3738333B.2DE941A4@nbrf.georgetown.edu> Reply-To: wuc@NBRF.Georgetown.Edu NNTP-Posting-Host: net.bio.net New release 4.1 of the ProClass Protein Family Database and the GeneFIND Family Identification System are now accessible from a new WWW site at: http://pir.georgetown.edu/gfserver/ Direct on-line searches are available at: http://pir.georgetown.edu/gfserver/proclass.html (ProClass) http://pir.georgetown.edu/gfserver/genefind.html (GeneFIND) The ProClass Protein Family Database is a non-redundant database organized according to family relationships as defined collectively by PIR superfamilies and ProSite motif patterns. The current ProClass release consists of 138,004 annotated sequence entries retrieved from PIR-international (Release 60.0, March 1999) and SwissProt (Release 37.0, December 1998) databases. It has three sub-databases, ProClass_Family (PCFam), ProClass_Sequence (PCSeq) and ProClass_Motif (PCMotif) for the collections of family, sequence and motif entries. ProClass has hypertext links to all major family/domain and structural class databases. GeneFIND (Gene Family Identification Network Design) is an integrated database search system that provides rapid and accurate protein family classification using multi-level filters, including MOTIFIND neural networks, BLAST search, SSEARCH (Smith-Waterman) sequence alignment, motif pattern matching, hidden Markov motif modeling and ClustalW multiple motif alignment. The current GeneFIND implementation provides full-scale identification of more than 1200 ProSite protein groups and more than 6000 PIR superfamilies. The on-line server allows direct family identification of query sequences, and returns search results showing overall global and motif scores of likely families, BLAST scores, full-length and motif alignments, as well as corresponding ProClass records with hypertext links. References: - Wu, Cathy, S. Shivakumar and H. Huang. (1999). ProClass protein family database. Nucleic Acids Research, 27 (1), 272-274. - Wu, Cathy, S. Shivakumar, C. V. Shivakumar and S. Chen. (1998). GeneFIND web server for protein family identification and information retrieval. Bioinformatics, 14 (2), 223-224. Please contact Cathy Wu at wuc@nbrf.georgetown.edu for any comments, and for inquiries regarding obtaining copies of the ProClass database or GeneFIND program, or setting up mirror sites or links. From owner-software@net.bio.net Tue May 11 20:22:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!newsfeed.berkeley.edu!dispose.news.demon.net!demon!colt.net!news0.de.colt.net!newscore.gigabell.net!newscore.ipf.de!newsfeed.tli.de!newsfeed1.uni2.dk!news.get2net.dk!not-for-mail From: "Rene Villadsen" Newsgroups: bionet.software Subject: dot/slot blot analysis X-Newsreader: Microsoft Outlook Express 4.72.3110.5 X-MimeOLE: Produced By Microsoft MimeOLE V4.72.3110.3 Message-ID: Date: Tue, 11 May 1999 23:14:35 +0200 NNTP-Posting-Host: 195.82.197.201 X-Complaints-To: abuse@get2.net X-Trace: news.get2net.dk 926457445 195.82.197.201 (Tue, 11 May 1999 23:17:25 MET DST) NNTP-Posting-Date: Tue, 11 May 1999 23:17:25 MET DST Organization: get2net Internet Kunde Lines: 14 Hi, Does anyone know of a freeware/shareware program (for PC or Mac) to analyze images from dot/slot blot arrays? Or maybe a macro for Scion Image??!! As for the commercially available software: any recommendations? Thanks, Rene Villadsen Panum Institute, Denmark From owner-software@net.bio.net Tue May 11 20:25:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!arclight.uoregon.edu!wn4feed!worldnet.att.net!128.230.129.106!news.maxwell.syr.edu!dispose.news.demon.net!demon!news.demon.co.uk!demon!fssc.demon.co.uk!not-for-mail From: "Herbert M Sauro" Newsgroups: bionet.general,bionet.metabolic-reg,bionet.software Subject: Re: metabolic fluxes calculating programs Date: Tue, 11 May 1999 22:19:11 +0100 Message-ID: <926457576.6674.0.nnrp-08.c2de3927@news.demon.co.uk> References: <372DB93E.83146C83@insa-tlse.fr> <3738079A.AAF4BE9@brookes.ac.uk> NNTP-Posting-Host: fssc.demon.co.uk X-NNTP-Posting-Host: fssc.demon.co.uk:194.222.57.39 X-Trace: news.demon.co.uk 926457576 nnrp-08:6674 NO-IDENT fssc.demon.co.uk:194.222.57.39 X-Complaints-To: abuse@demon.net MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_0009_01BE9BFC.4B925E20" X-Priority: 3 X-MSMail-Priority: Normal X-Newsreader: Microsoft Outlook Express 5.00.2014.211 X-MimeOLE: Produced By Microsoft MimeOLE V5.00.2014.211 Lines: 67 Xref: biosci bionet.general:33099 bionet.metabolic-reg:2494 bionet.software:23429 This is a multi-part message in MIME format. ------=_NextPart_000_0009_01BE9BFC.4B925E20 Content-Type: text/plain; charset="iso-8859-1" Content-Transfer-Encoding: quoted-printable Hi Mark What's the www site you gave? I can't connect to it. Is the address = correct? www://bms-medshark.brookes.ac.uk ????? Herbert Mark Poolman wrote in message Try = ftp://bmshuxley.brookes.ac.uk or see our web page = www://bms-mudshark.brookes.ac.uk for links to other sites, and relavent = discussion.=20 --=20 =20 ------=_NextPart_000_0009_01BE9BFC.4B925E20 Content-Type: text/html; charset="iso-8859-1" Content-Transfer-Encoding: quoted-printable
Hi Mark
 
What's the www site you gave? I can't connect to it. = Is the=20 address correct?
 
www://bms-medshark.brookes.ac.uk ?????
 
 
Herbert
 
Mark Poolman <mgpoolman@brookes.ac.uk> = wrote in=20 message Try ftp://bmshuxley.brookes.ac.uk = or see=20 our web page www://bms-mudshark.brookes.ac.uk for links to other = sites, and=20 relavent discussion. 
-- 
  ------=_NextPart_000_0009_01BE9BFC.4B925E20-- From owner-software@net.bio.net Tue May 11 20:35:00 1999 Path: biosci!lhc.nlm.nih.gov!corin!madden From: madden@corin.nlm.nih.gov (Tom Madden) Newsgroups: bionet.software Subject: NCBI toolkit and binaries Date: 11 May 1999 20:33:54 GMT Organization: National Library of Medicine Lines: 54 Message-ID: <7ha47i$qmp$1@lhc.nlm.nih.gov> NNTP-Posting-Host: corin.nlm.nih.gov X-Trace: lhc.nlm.nih.gov 926454834 27353 130.14.25.41 (11 May 1999 20:33:54 GMT) X-Complaints-To: usenet@lhc.nlm.nih.gov NNTP-Posting-Date: 11 May 1999 20:33:54 GMT X-Newsreader: TIN [version 1.2 PL2] A new release of the NCBI toolkit, as well as executables for BLAST, Sequin, and Entrez is now available on the NCBI FTP site at ftp://ncbi.nlm.nih.gov/Home.html A previously announced, support for Win16 and SunOs has been dropped. Release notes for BLAST are below. Notes for 2.0.9 release: Enhancements: 1.) two new options have been added to blastall: to produce output in HTML and to search a subset of the database based upon a list of GI's. Please see the options section for full information. 2.) two new options have been added to blastpgp: to produce HTML output and to produce an ASCII version of the PSI-BLAST Matrix. Please see the options section for more information. 3.) formatdb has a new option to allow specification of a 'base' name. see the options section for full details. 4.) it is possible to mask only during the phase when the lookup table is being built, but not during the extensions. See the options section for full details. Bug fixes: 1.) a problem that occurred when too many HSP's aligned to the same part of the query from one database sequence has been fixed. 2.) a problem that caused seedtop to not perform pattern-matching for DNA sequences has been fixed. 3.) the number of HSP's saved for ungapped BLAST and tblastx is now limited to 200 to prevent problems with memory and speed. 4.) a missing thread join that caused problems under DEC Alpha has been added. 5.) a formatting problem with the database summary at the beginning of the BLAST output (if multiple databases totaling over 2 Gig) has been fixed. 6.) a bug in formatdb that caused a core-dump if the total number of sequences was an exact multiple of 100000 was fixed. From owner-software@net.bio.net Tue May 11 23:00:00 1999 Path: biosci!agate!newsfeed.berkeley.edu!news.u.washington.edu!learn From: Jerry Learn Newsgroups: bionet.software Subject: GDE on DEC vs Linux Date: Tue, 11 May 1999 16:38:49 -0700 Organization: University of Washington Lines: 28 Message-ID: <110519991638499254%learn@u.washington.edu> Reply-To: learn@u.washington.edu NNTP-Posting-Host: tench.microbiol.washington.edu Mime-Version: 1.0 Content-Type: text/plain; charset=Macintosh Content-Transfer-Encoding: 8bit X-Trace: nntp4.u.washington.edu 926465964 40380 (None) 140.142.17.35 X-Complaints-To: help@cac.washington.edu Posted-And-Mailed: yes User-Agent: YA-NewsWatcher/4.2.1 [[ This message was both posted and mailed: see the "To," "Cc," and "Newsgroups" headers for details. ]] We are considering getting a second UNIX box for our lab to supplement our aging Sun SPARCstation. We are considering a couple of alternatives both of which would have multiple processors: either a Dell running Linux on Xeon 500 MHz processors or a DEC alpha clone running Digital UNIX. I expect that the alpha clone would have a performance edge but that is not what I'm enquiring about here. One concern that we have is that many of us in the lab use Steve Smith's GDE package on the Sun and we would like to continue. I can find a port of this package to Linux on the web, but I am having difficulty finding the DEC port that use to be available. If anyone has suggestions on what course to follow here, I would be very grateful to hear them. Thanks, Jerry Learn Research Associate Health Sci. Ctr., Rm. K443-C | Dept. of Microbiology | Learn@u.washington.edu University of Washington | Phone: (206) 616-4286 Box 357740 | FAX: (206) 616-1575 Seattle, WA 98195-7740 USA | From owner-software@net.bio.net Tue May 11 23:35:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!logbridge.uoregon.edu!news-peer.gip.net!news.gsl.net!gip.net!news.maxwell.syr.edu!nntp2.dejanews.com!nnrp1.dejanews.com!not-for-mail From: Willy Wriggers Newsgroups: bionet.software Subject: update: multi-res. docking w/ Situs 1.1 Date: Wed, 12 May 1999 00:19:37 GMT Organization: Deja.com - Share what you know. Learn what you don't. Lines: 34 Message-ID: <7hahen$tgb$1@nnrp1.deja.com> NNTP-Posting-Host: 132.239.156.46 X-Article-Creation-Date: Wed May 12 00:19:37 1999 GMT X-Http-User-Agent: Mozilla/4.51 [en] (X11; I; Linux 2.2.6 i686) X-Http-Proxy: 1.0 x37.deja.com:80 (Squid/1.1.22) for client 132.239.156.46 Hi all, A new version (1.1) of the free single-molecule, multi-resolution docking package went online at URL http://chemcca10.ucsd.edu/~situs Some of the new features are: - A more powerful and more accurate clustering algorithm to correlate features within structural data sets. - Electron microscopy: support of ASCII, CCP4, SPIDER, and MRC file formats, map file export in CCP4 format for visualization e.g. with Swiss PDB Viewer - Small-angle X-ray scattering: Support for docking of crystal structures to bead models from SAXS refinements (Chacon et al., Biophys. J. 74:2760-2775, 1998) More info can be found online and in the current issue of J. Structural Biology (1999) 125:185-195, URL http://www.academicpress.com/jsb Cheers, Willy -- Willy Wriggers, Ph.D. -- URL http://chemcca10.ucsd.edu/~wriggers Tel: (619)534-2913. Fax: (619)534-7042. E-mail: wriggers@ucsd.edu --== Sent via Deja.com http://www.deja.com/ ==-- ---Share what you know. Learn what you don't.--- From owner-software@net.bio.net Wed May 12 07:28:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!newsfeed.berkeley.edu!dispose.news.demon.net!demon!baron.netcom.net.uk!netcom.net.uk!server3.netnews.ja.net!is.bbsrc.ac.uk!Andy.Law From: Andy.Law@bbsrc.ac.uk (Andy Law) Newsgroups: bionet.software Subject: Re: BLAST search with large sequences Date: Wed, 12 May 1999 09:21:11 +0100 Organization: Roslin Institute Message-ID: References: <199905111008.LAA01818@tin.hgmp.mrc.ac.uk> NNTP-Posting-Host: pc1076.ri.bbsrc.ac.uk X-Newsreader: MT-NewsWatcher 2.4.4 Lines: 21 In article <199905111008.LAA01818@tin.hgmp.mrc.ac.uk>, gwilliam@hgmp.mrc.ac.uk (Gary Williams) wrote: > > Are there any publicly available solutions to doing BLAST searches with > large sequences, then viewing and manipulating the results? > Although I have no direct experience, PowerBLAST seems to claim to do what you want? (http://www.ncbi.nlm.nih.gov/htbin-post/Entrez/query?uid=9199938&form=6&db=m&Dopt=b) Later, -- Andy Law ---------------------- (Andy.Law@bbsrc.ac.uk) (Big Nose in Edinburgh) From owner-software@net.bio.net Wed May 12 12:25:00 1999 Path: biosci!NHGRI.NIH.GOV!jfryan From: jfryan@NHGRI.NIH.GOV (Joe Ryan) Newsgroups: bionet.software Subject: RE: BLAST search with large sequences Date: 12 May 1999 06:25:34 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 72 Sender: daemon@net.bio.net Distribution: world Message-ID: <19990512091954.C8506@nhgri.nih.gov> NNTP-Posting-Host: net.bio.net > Are there any publicly available solutions to doing BLAST searches with > large sequences, then viewing and manipulating the results? (full contents of original post follows my reply) Hello Gary, I have considered this problem as well. And I began work on a perl program that would split sequences, use an overlap and reassemble the results into a BLAST Report (you are welcome to the code). However, my work got put on hold. One of the reasons the project was put on hold is, I questioned whether splitting and BLASTing and reassembling would be more sensitive than straight BLASTing. I did not do a whole lot of comparing results but here is my gut feeling on the situation. Both PowerBLAST and NCBI BLAST are phenomenal programs. PowerBLAST will handle very large sequences and has a lot of other nice features such as masking and taxonomy filters. The downside to PowerBLAST is that it runs over the network so you are limited by bandwidth and demand on the server. You are also limited to databases available at NCBI (no local databases). I would recommend reading the PowerBLAST paper (PMID: 9199938) which explains the problem that you are describing and their approach in great detail. The latest local NCBI BLAST seems to handle very large sequences pretty nicely. Your limiting factor is memory; I have been told that there is no upper limit in query size. I trust the results of the local BLAST a little more than PowerBLAST because the local BLAST uses the latest Gap algorithms from NCBI. And local BLAST is continually being updated and maintained. I would be interested in hearing any other results or conclusions others have. I have also CCed blast-help@ncbi.nlm.nih.gov who can perhaps address the question as well. (initial post follows this mail) Joe -- Joseph Ryan Programmer National Human Genome Research Institute > It is starting to become common for people to want to do BLAST searches with > sequences of 200 Kb and upwards. > > There are then problems with memory, time to do the search and many strong > matches forcing interesting weak matches in other regions of the query > sequence off the bottom of the list of output alignments. > > I am interested in how other sites are approaching this problem. > > My initial thoughts on this are that the query sequence should be split > into lengths of maybe 50 Kb with a overlap of maybe 1 Kb. The results > can then be processed to produce a composite MSPcrunch format file which > can be searched with existing scripts. Display scripts can then > reintegrate the alignment results from two or more output files in the > region of interest. > > Are there any publicly available solutions to doing BLAST searches with > large sequences, then viewing and manipulating the results? > > Has anyone found ways to do BLAST searches with large sequences without > splitting them? > > What other problems (and solutions) do people encounter with large sequence > searches? > From owner-software@net.bio.net Thu May 13 02:46:00 1999 Path: biosci!rutgers!rockyd.rockefeller.edu!news-nysernet-5.sprintlink.net!news-east1.sprintlink.net!news-peer-europe.sprintlink.net!news.sprintlink.net!howland.erols.net!newsfeed.concentric.net!global-news-master From: gayle@wdoutlet.com Newsgroups: bionet.software,bionet.software.acedb,bionet.software.gcg Subject: Want to buy Computer Products at Wholesale Prices?? Date: 12 May 1999 20:40:13 PDT Organization: Concentric Internet Services Lines: 3 Message-ID: <7hdhit$8sc@chronicle.concentric.net> NNTP-Posting-Host: ts004d16.aus-tx.concentric.net Xref: biosci bionet.software:23435 bionet.software.acedb:2329 bionet.software.gcg:3517 To add your name to my daily Wholesale Price list for computer software and hardware deals, please e-mail me and request to be added to the list. The list is E-mailed daily and contains incredible deals on Legitimate Software and Hardware. If you have any questions, please leaave me e-mail at gayle@wdoutlet.com. This is also where you can request to be placed on my listing. hjiojtuntyusssbqcjipkflmedrfwidccnlmxfcumfisdnxncltblxcjeyldqqmzdcqjuvbhwlyqx From owner-software@net.bio.net Thu May 13 10:49:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!arclight.uoregon.edu!logbridge.uoregon.edu!dispose.news.demon.net!demon!colt.net!newspeer.clara.net!news.clara.net!remarQ-uK!remarQ.com!supernews.com!newsfeed.uk.ibm.net!ibm.net!newsfeed.eris.dera.gov.uk!diablo.dera.gov.uk!server1.netnews.ja.net!hgmp.mrc.ac.uk!biosci From: patareco@mail.pt (=?ISO-8859-1?Q?Paulo Figueiredo?=) Newsgroups: bionet.software Subject: =?ISO-8859-1?Q??= Date: 13 May 1999 12:43:47 +0100 Organization: MRC Human Genome Mapping Project Resource Centre Message-ID: <19990513114329.18126.qmail@noz.mail.pt> NNTP-Posting-Host: mercury.hgmp.mrc.ac.uk Mime-Version: 1.0 Content-Type: multipart/mixed; boundary="----------=_926595809-18069-0" Content-Transfer-Encoding: binary X-Trace: niobium.hgmp.mrc.ac.uk 926595827 19606 193.62.192.80 (13 May 1999 11:43:47 GMT) X-Complaints-To: news@hgmp.mrc.ac.uk NNTP-Posting-Date: 13 May 1999 11:43:47 GMT X-Received: from mserv1.dl.ac.uk (root@mserv1.dl.ac.uk [148.79.160.65]) by hgmp.mrc.ac.uk (8.9.3/8.9.3) with ESMTP id MAA22057 for ; Thu, 13 May 1999 12:43:44 +0100 (BST) X-Received: from noz.mail.pt (noz.mail.pt [195.23.2.91]) by mserv1.dl.ac.uk with SMTP id MAA04460 (8.8.8/5.4[ref postmaster@dl.ac.uk] for dl.ac.uk from patareco@mail.pt); Thu, 13 May 1999 12:43:41 +0100 (BST) X-Precedence: first-class X-Received: (qmail 18127 invoked by alias); 13 May 1999 11:43:29 -0000 X-To: bio-software@dl.ac.uk Lines: 21 This is a multi-part message in MIME format... ------------=_926595809-18069-0 Content-Type: text/plain Content-Disposition: inline Hello! I'm a student of pharmacy in Portugal and i'm looking for software for identification of bacteria. Can you help me? Please answer me to my e-mail: patareco@mail.pt Thank you, Paulo Figueiredo ______________________________________________________ mail.pt, um mail para todos - Gratuito em http://mail.pt/ ------------=_926595809-18069-0-- --- From owner-software@net.bio.net Thu May 13 11:58:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!newsfeed.berkeley.edu!dispose.news.demon.net!demon!newspeer.clara.net!news.clara.net!newsfeed.nacamar.de!fu-berlin.de!server1.netnews.ja.net!hgmp.mrc.ac.uk!biosci From: gabor@otis.geobio.elte.hu (Gabor Toth) Newsgroups: bionet.software Subject: NEXUS format conversion? Date: 13 May 1999 13:52:59 +0100 Organization: MRC Human Genome Mapping Project Resource Centre Message-ID: NNTP-Posting-Host: mercury.hgmp.mrc.ac.uk Mime-Version: 1.0 Content-Type: TEXT/PLAIN; charset=US-ASCII X-Trace: niobium.hgmp.mrc.ac.uk 926599980 20472 193.62.192.80 (13 May 1999 12:53:00 GMT) X-Complaints-To: news@hgmp.mrc.ac.uk NNTP-Posting-Date: 13 May 1999 12:53:00 GMT X-Received: from otis.elte.hu (otis.geobio.elte.hu [157.181.4.136]) by hgmp.mrc.ac.uk (8.9.3/8.9.3) with SMTP id NAA26399 for ; Thu, 13 May 1999 13:52:53 +0100 (BST) X-Received: from localhost by otis.elte.hu (5.x/SMI-SVR4) id AA03957; Thu, 13 May 1999 14:58:41 +0200 X-To: bio-software@hgmp.mrc.ac.uk Lines: 22 Hi, Could you please suggest a program to convert a PAUP/NEXUS format alignment file into GenBank or FASTA format? (Preferably on UNIX or Windows platform.) Readseq would not convert my file correctly and GDE also messed the sequences up when using the import function. Thanks for your help in advance, Gabor Toth ======================================================================== Gabor Toth E-mail: tothg@ludens.elte.hu Department of Genetics or gabor@otis.elte.hu Eotvos Lorand University Phone: (36-1) 266-1296 Budapest, Muzeum krt. 4/a. Fax: (36-1) 266-2694 H-1088 Hungary URL: http://falco.elte.hu/~gabor/ ======================================================================== --- From owner-software@net.bio.net Thu May 13 12:50:00 1999 Path: biosci!NHGRI.NIH.GOV!jfryan From: jfryan@NHGRI.NIH.GOV (Joe Ryan) Newsgroups: bionet.software Subject: Re: NEXUS format conversion? Date: 13 May 1999 06:50:36 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 27 Sender: daemon@net.bio.net Distribution: world Message-ID: <19990513094454.I8779@nhgri.nih.gov> References: NNTP-Posting-Host: net.bio.net See previous bionet.software thread... http://www.deja.com/getdoc.xp?AN=474443813 On Thu, May 13, 1999 at 01:52:59PM +0100, Gabor Toth wrote: > Hi, > > Could you please suggest a program to convert a PAUP/NEXUS format > alignment file into GenBank or FASTA format? (Preferably on > UNIX or Windows platform.) > Readseq would not convert my file correctly and GDE also messed the > sequences up when using the import function. > > Thanks for your help in advance, > > Gabor Toth > > ======================================================================== > Gabor Toth E-mail: tothg@ludens.elte.hu > Department of Genetics or gabor@otis.elte.hu > Eotvos Lorand University Phone: (36-1) 266-1296 > Budapest, Muzeum krt. 4/a. Fax: (36-1) 266-2694 > H-1088 Hungary URL: http://falco.elte.hu/~gabor/ > ======================================================================== > > > --- > From owner-software@net.bio.net Thu May 13 12:57:00 1999 Path: biosci!CMMT.UBC.CA!francis From: francis@CMMT.UBC.CA (Francis Ouellette) Newsgroups: bionet.software Subject: Re: NEXUS format conversion? Date: 13 May 1999 06:57:31 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 41 Sender: daemon@net.bio.net Distribution: world Message-ID: References: NNTP-Posting-Host: net.bio.net > From: Gabor Toth > Subject: NEXUS format conversion? > > Could you please suggest a program to convert a PAUP/NEXUS format > alignment file into GenBank or FASTA format? (Preferably on > UNIX or Windows platform.) Gabor, did you have a look at Sequin from NCBI? I think it will do what you want. see: http://www.ncbi.nlm.nih.gov/Sequin/ Sequin reads Nexus format and can out put GenBank, EMBL, FASTA (and 'graphical, and its own 'alignment' format, as well as in ASN.1 format). cheers, f. -- | B.F. Francis Ouellette tel: (604) 875-3815 | | Director, Bioinformatics Core Facility fax: (604) 875-3840 | | Centre for Molecular Medicine and Therapeutics, UBC, Canada | | francis@cmmt.ubc.ca http://www.cmmt.ubc.ca | > ======================================================================== > Gabor Toth E-mail: tothg@ludens.elte.hu > Department of Genetics or gabor@otis.elte.hu > Eotvos Lorand University Phone: (36-1) 266-1296 > Budapest, Muzeum krt. 4/a. Fax: (36-1) 266-2694 > H-1088 Hungary URL: http://falco.elte.hu/~gabor/ > ======================================================================== > > > --- > > From owner-software@net.bio.net Thu May 13 14:28:00 1999 Path: biosci!agate!newsfeed.berkeley.edu!sunqbc.risq.qc.ca!cyclone.mbnet.mb.ca!canopus.cc.umanitoba.ca!not-for-mail From: Brian Fristensky Newsgroups: bionet.software Subject: Re: GDE on DEC vs Linux Date: Thu, 13 May 1999 10:23:31 -0500 Organization: University of Manitoba Lines: 45 Message-ID: <373AEE73.C0F82E01@cc.umanitoba.ca> References: <110519991638499254%learn@u.washington.edu> NNTP-Posting-Host: brassica.cc.umanitoba.ca Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Trace: canopus.cc.umanitoba.ca 926609012 2130 130.179.16.121 (13 May 1999 15:23:32 GMT) X-Complaints-To: Postmaster@cc.umanitoba.ca NNTP-Posting-Date: 13 May 1999 15:23:32 GMT X-Mailer: Mozilla 4.51 [en] (X11; U; SunOS 5.5.1 sun4u) X-Accept-Language: en Jerry Learn wrote: > > [[ This message was both posted and mailed: see > the "To," "Cc," and "Newsgroups" headers for details. ]] > > We are considering getting a second UNIX box for our lab to supplement > our aging Sun SPARCstation. We are considering a couple of alternatives > both of which would have multiple processors: either a Dell running > Linux on Xeon 500 MHz processors or a DEC alpha clone running Digital > UNIX. I expect