From owner-srs@net.bio.net Fri Nov 01 22:00:00 1996 Path: biosci!daresbury!s-ind2!mph From: mph@s-ind2.dl.ac.uk (M.P. Hilbers) Newsgroups: bionet.software.srs Subject: Re: indexing Genbank 97 from gcg format Date: 2 Nov 1996 20:51:58 GMT Organization: Daresbury Lab, Warrington, U.K. Lines: 39 Distribution: bionet Message-ID: <55gc9e$3eo@mserv1.dl.ac.uk> References: <32789728.41C6@dl.ac.uk> NNTP-Posting-Host: s-ind2.dl.ac.uk X-Newsreader: TIN [version 1.2 PL2] Martin Hilbers (mph@dl.ac.uk) wrote: : Hi folks, : Has anybody been able to index genbank 97 from gcg formatted files ? - : For me indexing keeps falling over on entry HSHLAK1 in the primates : section. : The error message I get is: : e__nammismatch, names are not identical : "HSHLAK1" and "C" : It does not occur with the plain genbank files. It can't have anything : to do with the size of genbank, as it also occurs if I restrict : genbank to the primates section. As far as I can tell the gcg : seq and ref file are completely normal for this entry. : srsbuild is apparently supposed to produce this error message if : the names in the ref and seq files are not the same, but as far as I : can tell they are the same, and I really don't understand were this "C" : in the error message comes from. Well, I managed to figure things out. The problem was apparently caused by keywords in genbank extending over more than one line. The patch to genbank.sdl suggested by Janice Coventry earlier in this newsgroup solved the problem. Funny though that a misread keyword somehow ends up interfering with the entry name in a completely different file. But I suppose that if you carefully comb the code it all makes sense. Cheers, Martin --------------------------------------------------------------------------- | Martin Hilbers | E-mail: m.p.hilbers@dl.ac.uk | | SEQNET | Tel: +44-1925-603492 | | Daresbury Laboratory | Fax: +44-1925-603100 | | Daresbury, Warrington |----------------------------------------------| | Cheshire WA4 4AD | SEQNET is the UK national EMBNet node | | United Kingdom | http://www.dl.ac.uk/SEQNET/home.html | --------------------------------------------------------------------------- From owner-srs@net.bio.net Tue Nov 05 22:00:00 1996 Path: biosci!rutgers!mcrcr6!cmcl2!news.nyu.edu!mcrcr1.med.nyu.edu!user Newsgroups: bionet.software.gcg,bionet.software.srs Subject: Re: searching in comment field Message-ID: From: browns02@mcrcr.med.nyu.edu (Stuart M. Brown) Date: Wed, 06 Nov 1996 11:51:38 -0500 References: <558p26$pgc@dismay.ucs.indiana.edu> Organization: NYU-MC Research Computing Resource NNTP-Posting-Host: mcrcr1.med.nyu.edu Lines: 50 Xref: biosci bionet.software.gcg:2085 bionet.software.srs:335 > In article , > Stuart M. Brown wrote: > >We are doing a bunch of BLAST searches with the EST database. > > > >I just got an idea - since these est's are routinely BLASTed > >before they are submitted- and these results are generally noted > >in the comment field, why can't I search the EST database for > >comments that mention BLAST hits against my sequences of interest? > > > >I've tried LOOKUP- but the "All text" field does not appear to > >include the comment field of the GenBank entry. I also > >tried ENTREZ with only a bit more success - yet I can see mentions > >of my sequence in the comments when I do my own BLAST searches and > >then read the full annotation of the ESTs that we hit. In article <558p26$pgc@dismay.ucs.indiana.edu>, gilbertd@bio.indiana.edu (Don Gilbert) wrote: > Stuart, > > This may be a function of how SRS (or the GCG variant Lookup) is > configured at a particular server. At IUBIo Archive, I revised the > indexing for SRS to make sure the Genbank comment fields were > searchable. As a test of your question, I just now searched > the Genbank EST section at IUBIo, searching "Comment" fields > for "BLAST", and found 165 matches. > > Feel free to use this SRS server for Genbank lookups. > http://iubio.bio.indiana.edu:81/srs/srsc > > - Don > > -- d.gilbert--biocomputing--indiana u--bloomington--gilbertd@bio.indiana.edu ---------------------------------------------- Don, You found only 165 ESTs that mention "BLAST" in the comment field??? I believe that virtually all ESTs are BLAST searched before being submitted to the database, and I have heard a statistic that about 40% of them find one or more significant hits. You should get hundred of thousands of hits, no? Where is this information stored if it is not in the comment or description fields?? -- Stuart M. Brown, Molecular Biology Consultant NYU-MC Research Computing Resource, Dept. of Cell Biology 550 First Ave, New York, NY 10016 Phone: (212)263-7689 FAX: (212)263-8139 From owner-srs@net.bio.net Thu Nov 07 22:00:00 1996 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!newsfeed.internetmci.com!btnet!netcom.net.uk!nntpfeed.doc.ic.ac.uk!sunsite.doc.ic.ac.uk!lyra.csx.cam.ac.uk!hgmp.mrc.ac.uk!sanger.ac.uk!pmr From: pmr@sanger.ac.uk Newsgroups: bionet.software.gcg,bionet.software.srs Subject: Re: searching in comment field Date: 08 Nov 1996 10:47:10 GMT Organization: The Sanger Centre Lines: 265 Message-ID: References: <558p26$pgc@dismay.ucs.indiana.edu> NNTP-Posting-Host: unst.sanger.ac.uk In-reply-to: browns02@mcrcr.med.nyu.edu's message of Wed, 06 Nov 1996 11:51:38 -0500 Xref: biosci bionet.software.gcg:2087 bionet.software.srs:338 In article browns02@mcrcr.med.nyu.edu (Stuart M. Brown) writes: > > In article , > > Stuart M. Brown wrote: > > >We are doing a bunch of BLAST searches with the EST database. > > > > > >I just got an idea - since these est's are routinely BLASTed > > >before they are submitted- and these results are generally noted > > >in the comment field, why can't I search the EST database for > > >comments that mention BLAST hits against my sequences of interest? > > > > > >I've tried LOOKUP- but the "All text" field does not appear to > > >include the comment field of the GenBank entry. I also > > >tried ENTREZ with only a bit more success - yet I can see mentions > > >of my sequence in the comments when I do my own BLAST searches and > > >then read the full annotation of the ESTs that we hit. > > In article <558p26$pgc@dismay.ucs.indiana.edu>, gilbertd@bio.indiana.edu > (Don Gilbert) wrote: > > > Stuart, > > > > This may be a function of how SRS (or the GCG variant Lookup) is > > configured at a particular server. At IUBIo Archive, I revised the > > indexing for SRS to make sure the Genbank comment fields were > > searchable. As a test of your question, I just now searched > > the Genbank EST section at IUBIo, searching "Comment" fields > > for "BLAST", and found 165 matches. > > > Don, You found only 165 ESTs that mention "BLAST" in the comment field??? > > I believe that virtually all ESTs are BLAST searched before being > submitted to the database, and I have heard a statistic that about 40% of > them find one or more significant hits. You should get hundred of > thousands of hits, no? > Where is this information stored if it is not in the comment or > description fields?? The information about BLAST hits is generated by NCBI and included in the dbEST database (in the dbEST.reports file). The BLAST hit information is updated from time to time, but as far as I am aware it is not included in the GenBank entries unless it is used to clearly identify the EST. The dbEST.reports is available through SRS WWW servers at a number of sites. Sadly, our copy has a problem at the moment - it went over 2Gb file size and the SGI system running our SRS WWW server does not like it. I plan to split the file (SRS will still look the same) this weekend to work around it. Meanwhile, I am working on the new SRS 5.0 parsing for dbEST, and will certainly be trying to index the blast hits in some way. This gets a little tricky - for example, it is not trivial to combine the scores and the text for a given hits though it should be possible. So, an obvious question: what information would you like to search for in the BLAST hit fields? An example dbEST.reports entry is included below. Some dbEST entries have only nucleotide hits, some have only protein hits, and some have no hits at all. They can have anything up to 15 hits of either type. dbEST Id: 1 EST name: EST00001 GenBank Acc: M61954 GenBank gi: 272204 GDB Dsegment: D0S2263E CLONE INFO Clone Id: HHCI89 Source: ATCC Id as DNA: 65129 Id in host: 65128 DNA type: cDNA PRIMERS Sequencing: M13 Forward SEQUENCE GCCATCCTGCGTCTGGACCTGGCTGGCCGGGACCTGACTGACTACCTCATGAAGATCCTC ACCGAGCGCGGCTACAGCTTCACCACCACGGCCGAGCGGGAAATCGTGCGTGACATTAAG GAGAAGCTGTGCTACGTCGCCCTGGACTTCGAGCAAGAGATGGCCACGGCTGCTTCCAGC TCCTCCCTGGAGAAGAGCTACGAGCTGCCTGACGGCCAGGTCATCACCATTGGCAATGAG CGGTTCCGCTGCCCTGAGGCACTCTTCCAGCCTTCCTTCCTGGGCATGGAGTCCTGTGGC ATCCACGGAACTACCTTCAACTCCATCATGAAGTGTGACGTGGACATTCGGAAAGACCTG TACGGCAACACAGTGCT Entry Created: May 26 1992 Last Updated: May 26 1992 PUTATIVE ID Assigned by submitter Actin, gamma, cytoskeletal LIBRARY Lib Name: Hippocampus, Stratagene (cat. #936205) Organism: Homo sapiens Vector: lambdaZAP-II Description: Female, 2 years; oligo-dT + random primed cDNA synthesis; lambdaZAP-II vector, 1.0kb average insert size. SUBMITTER Name: Kerlavage AR Lab: Bioinformatics Institution: The Institute for Genomic Research Address: 9712 Medican Center Drive, Rockville, MD 20850 USA Tel: 3018699056 Fax: 3018699423 E-mail: arkerlav@tigr.org CITATIONS Medline UID: 91262645 Title: Complementary DNA sequencing: expressed sequence tags and human genome project Authors: Adams,M.D., Kelley,J.M., Gocayne,J.D., Dubnick,M., Polymeropoulos,M.H., Xiao,H., Merril,C.R., Wu,A., Olde,B., Moreno,R.F., etal Citation: Science 252: 1651-6 1991 MAP DATA NEIGHBORS Top 15 protein matches Neighbor: gi|1703 (X60733) gamma non-muscle actin [Oryctolagus cuniculus] gi|231506|sp|P29751|ACTB_RABIT ACTIN, CYTOPLASMIC 1 (BETA-ACTIN). gi|279668|pir||ATRBB actin beta - rabbit Pvalue: 9.309e-83 Neighbor: gi|576368|pdb|2BTF|A Beta-Actin-Profilin Complex Pvalue: 9.309e-83 Neighbor: gi|537596 (M24769) actin [Xenopus laevis] gi|280660|pir||A43552 actin - African clawed frog Pvalue: 9.309e-83 Neighbor: gi|309090 (J04181) A-X actin [Mus musculus] gi|90260|pir||A31900 actin A(X) - mouse Pvalue: 9.309e-83 Neighbor: gi|28252 (X00351) beta-actin [Homo sapiens] gi|177968 (M10277) cytoplasmic beta actin [Homo sapiens] gi|49866 (X03672) beta-actin (aa 1-375) [Mus musculus] gi|55575 (V01217) beta-actin [Rattus norvegicus] gi|211237 (L08165) beta-actin [Gallus gallus] gi|113270|sp|P02570|ACTB_HUMAN ACTIN, CYTOPLASMIC 1 (BETA-ACTIN). gi|71618|pir||ATHUB actin beta - human gi|71619|pir||ATMSB actin beta - mouse gi|279669|pir||ATCHB actin beta - chicken Pvalue: 9.309e-83 Neighbor: gi|28339 (X04098) gamma-actin [Homo sapiens] gi|178043 (M19283) gamma-actin [Homo sapiens] gi|57574 (X52815) cytoskeletal gamma-actin (AA 1-375) [Rattus rattus] gi|309089 (M21495) gamma-actin [Mus musculus] gi|113278|sp|P02571|ACTG_HUMAN ACTIN, CYTOPLASMIC 2 (GAMMA-ACTIN). gi|71623|pir||ATHUG actin gamma - human gi|71624|pir||ATMSG actin gamma - mouse gi|111332|pir||S11222 actin gamma, cytoskeletal - rat Pvalue: 9.309e-83 Neighbor: gi|202654 (J00691) cytoplasmic beta actin [Rattus norvegicus] gi|71620|pir||ATRTC actin beta - rat Pvalue: 9.309e-83 Neighbor: gi|1334642|gnl|PID|e184505 (X07507) actin [Xenopus borealis] gi|113271|sp|P15475|ACTB_XENBO ACTIN, CYTOPLASMIC TYPE 1 (BETA ACTIN). gi|85691|pir||S01077 actin beta, cytoskeletal - Kenyan clawed frog Pvalue: 9.309e-83 Neighbor: gi|213273 (M26111) beta-actin [Anser anser] gi|113267|sp|P14104|ACTB_ANSAN ACTIN, CYTOPLASMIC BETA. gi|627304|pir||A55001 actin beta - goose Pvalue: 9.309e-83 Neighbor: gi|63018 (X00182) beta-actin [Gallus gallus] Pvalue: 9.309e-83 Neighbor: gi|761724 (U20114) beta-actin [Cricetulus griseus] gi|1351867|sp|P48975|ACTB_CRIGR ACTIN, CYTOPLASMIC 1 (BETA-ACTIN). Pvalue: 9.309e-83 Neighbor: gi|71621|pir||ATBOB actin beta - bovine (tentative sequence) Pvalue: 9.309e-83 Neighbor: gi|71625|pir||ATBOG actin gamma - bovine (tentative sequence) Pvalue: 9.309e-83 Neighbor: gi|809561 (X13055) gamma-actin [Mus musculus] Pvalue: 9.786e-83 Neighbor: gi|49868 (X03765) put. beta-actin (aa 27-375) [Mus musculus] gi|387083 (M12481) cytoplasmic beta-actin [Mus musculus] Pvalue: 1.029e-82 Top 15 nucleotide matches Neighbor: gi|28251|emb|X00351|HSAC07 Human mRNA for beta-actin Pvalue: 3.325e-149 Neighbor: gi|28335|emb|X63432|HSACTB H.sapiens ACTB mRNA for mutant beta-actin (beta'-actin) Pvalue: 3.325e-149 Neighbor: gi|476331|gb|U07786|SSU07786 Sus scrofa beta actin mRNA, partial cds. Pvalue: 2.014e-129 Neighbor: gi|178044|gb|M16247|HUMACTGAA Human gamma-actin mRNA, partial cds. Pvalue: 3.857e-129 Neighbor: gi|28338|emb|X04098|HSACTCGR Human mRNA for cytoskeletal gamma-actin Pvalue: 6.359e-129 Neighbor: gi|1702|emb|X60733|OCRNAGNMA O.cuniculus mRNA for gamma-non muscle actin Pvalue: 2.003e-127 Neighbor: gi|191660|gb|J04181|MUSACTMEL Mouse A-X actin mRNA, complete cds. Pvalue: 1.144e-123 Neighbor: gi|49865|emb|X03672|MMACTBR Mouse cytoskeletal mRNA for beta-actin Pvalue: 1.202e-123 Neighbor: gi|191581|gb|M12481|MUSACCYB Mouse cytoplasmic beta-actin mRNA. Pvalue: 1.030e-121 Neighbor: gi|49867|emb|X03765|MMACTBR2 Mouse mRNA for cytoplasmatic beta-actin (pAL 41; AA 27-375) Pvalue: 1.698e-121 Neighbor: gi|213272|gb|M26111|GOOACTB Goose beta-actin mRNA, complete cds. Pvalue: 2.180e-121 Neighbor: gi|567191|gb|L36342|MOZBEAC Morone saxatilis (striped bass) beta-actin mRNA, partial cds. Pvalue: 2.655e-120 Neighbor: gi|211236|gb|L08165|CHKBACTN Gallus gallus beta-actin mRNA, complete cds. Pvalue: 3.392e-118 Neighbor: gi|57573|emb|X52815|RRGAMACT Rat mRNA for cytoplasmic-gamma isoform of actin Pvalue: 1.184e-117 Neighbor: gi|51042|emb|X13055|MMGACTR Murine mRNA for cytoplasmic gamma-actin Pvalue: 1.952e-117 -- ------------------------------------------------------------------------ Peter Rice | Informatics Division, E-mail: pmr@sanger.ac.uk | The Sanger Centre, Tel: (44) 1223 494967 | Wellcome Trust Genome Campus, Fax: (44) 1223 494919 | Hinxton, Cambridge, CB10 1SA, URL: http://www.sanger.ac.uk/~pmr/ | England From owner-srs@net.bio.net Sun Nov 10 22:00:00 1996 Path: biosci!rutgers!mcrcr6!cmcl2!news.nyu.edu!mcrcr1.med.nyu.edu!user Newsgroups: bionet.software.gcg,bionet.software.srs Subject: Re: searching in comment field Message-ID: From: browns02@mcrcr.med.nyu.edu (Stuart M. Brown) Date: Mon, 11 Nov 1996 16:31:38 -0500 References: <558p26$pgc@dismay.ucs.indiana.edu> Organization: NYU-MC Research Computing Resource NNTP-Posting-Host: mcrcr1.med.nyu.edu Lines: 44 Xref: biosci bionet.software.gcg:2097 bionet.software.srs:341 > > I believe that virtually all ESTs are BLAST searched before being > > submitted to the database, and I have heard a statistic that about 40% of > > them find one or more significant hits. You should get hundred of > > thousands of hits, no? > > Where is this information stored if it is not in the comment or > > description fields?? > > The information about BLAST hits is generated by NCBI and included in > the dbEST database (in the dbEST.reports file). The BLAST hit > information is updated from time to time, but as far as I am aware it > is not included in the GenBank entries unless it is used to clearly > identify the EST. > > The dbEST.reports is available through SRS WWW servers at a number of > sites. > > Meanwhile, I am working on the new SRS 5.0 parsing for dbEST, and will > certainly be trying to index the blast hits in some way. This gets a > little tricky - for example, it is not trivial to combine the scores > and the text for a given hits though it should be possible. > > So, an obvious question: what information would you like to search for > in the BLAST hit fields? This is really agonizing. Here is all of this beautiful data, but apparently no good way to use it. I don't think that the SRS indicies should be expanded to include 15 protein and 15 nucleotide hits (and their names and the significance level of each hit). It already takes us anywhere from 6 to 36 hours to recreate the SRS indicies on our GCG system after each full GenBank updaate (and this is on a fast Alpha machine!). Perhaps the time is ripe for a new tool - sort of a reverse BLASTer that takes a given sequence and identifies all EST's that mention that sequence in their BLAST report. Think about it - here is all of this information about EST's, but unless you already know the accession # of a particular EST, then you will never see it - so everyone has to do the BLAST against the EST's for themselves without knowing that the EST's have already been compared with their sequence. -- Stuart M. Brown, Molecular Biology Consultant NYU-MC Research Computing Resource, Dept. of Cell Biology 550 First Ave, New York, NY 10016 Phone: (212)263-7689 FAX: (212)263-8139 From owner-srs@net.bio.net Mon Nov 11 22:00:00 1996 Path: biosci!bcm.tmc.edu!cs.utexas.edu!www.nntp.primenet.com!nntp.primenet.com!nntp.uio.no!nntp.zit.th-darmstadt.de!fu-berlin.de!news-ber1.dfn.de!news-ham1.dfn.de!news-han1.dfn.de!news.dfn.de!news.embl-heidelberg.de!usenet From: Thure Etzold Newsgroups: bionet.software.gcg,bionet.software.srs Subject: Re: searching in comment field Date: Tue, 12 Nov 1996 13:40:32 +0100 Organization: EMBL Lines: 47 Distribution: world Message-ID: <3288703F.41C6@embl-heidelberg.de> References: <558p26$pgc@dismay.ucs.indiana.edu> NNTP-Posting-Host: kappa.embl-heidelberg.de Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 3.0 (X11; I; OSF1 V2.0 alpha) To: "Stuart M. Brown" Xref: biosci bionet.software.gcg:2098 bionet.software.srs:342 Stuart M. Brown wrote: > > Meanwhile, I am working on the new SRS 5.0 parsing for dbEST, and will > > certainly be trying to index the blast hits in some way. This gets a > > little tricky - for example, it is not trivial to combine the scores > > and the text for a given hits though it should be possible. > > > > So, an obvious question: what information would you like to search for > > in the BLAST hit fields? > > This is really agonizing. Here is all of this beautiful data, but apparently no > good way to use it. I don't think that the SRS indicies should be expanded > to include 15 protein and 15 nucleotide hits (and their names and the > significance level of each hit). It already takes us anywhere from 6 to 36 > hours to recreate the SRS indicies on our GCG system after each full GenBank > updaate (and this is on a fast Alpha machine!). Perhaps the time is ripe for > a new tool - sort of a reverse BLASTer that takes a given sequence and > identifies all EST's that mention that sequence in their BLAST report. > I wouldn't be so pessimistic about using the data in dbEST. The protein and nucleotide hits could be even indexed as subentries so it could be possible to search them independently of the entries in which they occur. So questions would be possible like find me all ESTs that are similar above a certain threshold with a certain DNA sequence. The indexing in SRS4 is a problem since the memory usage can be enormous depending on the size of the databank. The reason that from your experience indexing can take from 6 to 36 hours is probably swapping: once SRS runs out of physical memory the computer must start swapping and that slows down indexing to almost a halt. In srs5 that problem is solved by indexing large databanks in chunks and merging them later. A good candidate - and one of the reasons I did it - is dbEST. regards Thure ...latest predictions for the final release is end of november - am currently working on displaying subentries From owner-srs@net.bio.net Mon Nov 11 22:00:00 1996 Path: biosci!daresbury!bioftp.unibas.ch!infobiogen.fr!newsmaster From: Jean-Marc Plaza Newsgroups: bionet.software.srs Subject: Hyperlink problem Date: Tue, 12 Nov 1996 16:30:38 +0100 Organization: INFOBIOGEN Lines: 93 Message-ID: <3288981E.5E89@infobiogen.fr> NNTP-Posting-Host: lovelace.infobiogen.fr Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 2.02 (X11; I; SunOS 5.5.1 sun4d) Hello SRS managers, I have a problem with making an hyperlink field in virgil. When i build a list with displaying the GDBuid field, the hyperlink is OK : ******************************************** VIRGIL:14582 IDa gdb:118728; ANPEP; 31-MAY-1993 ^^^^^^ hyperlink is OK ******************************************** Then when i display the all entry the hyperlink is lost. ******************************************** TYP vgl:14582; GDB[gene] * Genbank[sequence] OR1 genXref; v1.0; 0.61; 01-AUG-1996 OR2 GDB; v6.1; undef; undef xxx IDa gdb:118728; ANPEP; 31-MAY-1993 <---- no more hyperlink DFa- alanyl (membrane) aminopeptidase (aminopeptidase N, DFa aminopeptidase M, microsomal aminopeptidase, CD13, p150) xxx IDb gbk:M22324; HUMAMIPEP; 31-OCT-1994 DFb- Human aminopeptidase N/CD13 mRNA encoding aminopeptidase DFb N, complete cds. ******************************************** This case coud be occured in other databank. Could someone have a clue in my problem ??? Thanks all in advance -------------------------------------- here is an extract of virgil.sdl noticed that IDa field is indexed in DF_ID1 but also in DF_DBI and DF_LINK. #libformat ...... ! database id !------------ #field /itype=key /ftype=@DF_DBI /idtype=@SRSxSEQID /begstr="TYP", "IDa", "IDb" /find=db_id /maxlines=1 ! object 1 !--------- #field /gblid=%VIRGIL_GDB /itype=key /ftype=@DF_ID1 /idtype=@SRSxSEQID /begstr="IDa" /find=id /maxlines=1 ! link to MIMMAP !----------------- #field /itype=link /ftype=@DF_LINK /idtype=@SRSxLINKID /begstr="IDa" /maxlines=1 /find=link2mimmap #parser ...... id = [ vgl_id | gbk_id | gdb_id ]; gbk_id = 'gbk' ':' ~A-Za-z0-9~ ; vgl_id = 'vgl' ':' ~0-9~ ; gdb_id = 'gdb' ':' ~0-9~ ; db_id = [ vgl_lnk | gbk_lnk | gdb_lnk ]; gbk_lnk = 'gbk:' accno ; gdb_lnk = 'gdb:' uid ; vgl_lnk = 'vgl:' uid ; link2mimmap = [ gdb_map | gbk_map ]; gdb_map = 'gdb' ':' ~A-Z0-9a-z~ ';' ~A-Z0-9a-z_\-~ ; gbk_map = 'gbk' ':' ~A-Z0-9a-z~ ';' ~A-Z0-9a-z_\-~ ; extract of hyperlink.sdl: .... #hyperlink /field=@VIRGIL_GDB /parse=gdb_id /parser=@INSERTLINK_PARSER ..... gdb_id = ~A-Za-z0-9~ 'gdb' ':' ~0-9~ ; --------------------------------------------------- Jean-Marc PLAZA INFOBIOGEN - CNRS 7, rue Guy Moquet BP8 94801 VILLEJUIF Cedex, France tel: +33 45 59 52 39 fax: +33 45 59 52 50 e-mail: plaza@infobiogen.fr --------------------------------------------------- From owner-srs@net.bio.net Tue Nov 12 22:00:00 1996 Path: biosci!agate!howland.erols.net!EU.net!Ireland.EU.net!web3.tcd.ie!gen035.gen.tcd.ie!user From: atlloyd@acer.gen.tcd.ie (Andrew T. Lloyd) Newsgroups: bionet.software.srs Subject: SRS 4.08 indexing Date: Wed, 13 Nov 1996 09:55:46 +0000 Organization: INCBI, Trinity College, Dublin 2, Ireland. Lines: 28 Message-ID: NNTP-Posting-Host: gen035.gen.tcd.ie I have a minimal SRS setup here: SW PIR PRosite EMBL-without-ESTs but have problems getting the links sorted: the links from SW - EMBL are looking for the NI field and report INFO: no entries found I see that the EBI and Sanger have changed things so that the link is seeking the AC field and successfully finds it. Another large site in Hinxton appears to have the same problem as I do. Can some kind, patient soul tell me what I have to tweak ? I also note that I have acquired (through no effort of mine!) a link from SW to MIM at wwwgdb.gdb.org but that this is asking for http://wwwgdb.gdb.org/omim/omimx which is "not found on this server" this is something in hyperlink.sdl which I should be able to figure out for myself but I cannot solve my first problem with grep ! Thanks, Andrew -- Andrew T. Lloyd Irish National Centre for BioInformatics INCBI atlloyd@acer.gen.tcd.ie http://acer.gen.tcd.ie Tel: (+353)-1-608-1969 EMBnet Ireland Fax: (+353)-679-8558 From owner-srs@net.bio.net Tue Nov 12 22:00:00 1996 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!newsfeed.internetmci.com!www.nntp.primenet.com!nntp.primenet.com!nntp.uio.no!nntp.zit.th-darmstadt.de!fu-berlin.de!news-ber1.dfn.de!news-ham1.dfn.de!news-han1.dfn.de!news.dfn.de!news.embl-heidelberg.de!usenet From: Ramu Chenna Newsgroups: bionet.software.srs Subject: Re: Hyperlink problem Date: 13 Nov 1996 13:25:06 GMT Organization: EMBL Heidelberg Lines: 20 Distribution: world Message-ID: <56ci7i$jej@lion.embl-heidelberg.de> References: <3288981E.5E89@infobiogen.fr> NNTP-Posting-Host: shag.embl-heidelberg.de Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 1.12IS (X11; I; IRIX 5.3 IP22) X-URL: news:3288981E.5E89@infobiogen.fr Hello With old srs the "complete entries" in the result page, looks like designed to save the entries to your disk (without hyerlink ofcouse) for further processing, so you loose the hypertext link when you click this. Workaround is just "select all the fields" to display from the queryform page and your hyper link is there... hope this helps. Ramu =============================================================== Ramu C | EMBL E-mail: chenna@embl-heidelberg.de | Postfach 10.2209 Tel: (49) 6221 356229 (Res) | 69012 Heidelberg Fax: (49) 6221 387517 | Germany http://www.embl-heidelberg.de/~chenna/ ------------------------------------------------------------- From owner-srs@net.bio.net Mon Nov 18 22:00:00 1996 Path: biosci!internet!biosci!not-for-mail From: biohelp (BIOSCI Administrator) Newsgroups: bionet.software.srs Subject: BIOSCI/bionet miniFAQ & Fundraiser Date: 19 Nov 1996 02:00:42 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 239 Sender: daemon@net.bio.net Distribution: world Message-ID: <199611191000.CAA16163@net.bio.net> NNTP-Posting-Host: net.bio.net (LAST REVISION: 30-JUL-95) This BIOSCI "miniFAQ" is designed to answer the questions that come up the *most frequently*. The main BIOSCI FAQ (Frequently Asked Questions) is accessible on the World Wide Web at URL http://www.bio.net/. If you can not find an answer to your question in this or other documentation, the BIOSCI technical support staff answers e-mail queries sent to biosci-help@net.bio.net We can only answer questions about the use of the newsgroups and mailing lists. We unfortunately do not have the staff to do Internet information searches or answer scientific questions. Please post those to the appropriate BIOSCI/bionet newsgroups. Contents: -------- 0) BIOSCI NEEDS YOUR SUPPORT!! 1) Using the WWW to access the BIOSCI/bionet newsgroups. 2) What to do about "spams," i.e., junk mail, ads, etc. 3) Examples of subscribing and unsubscribing to the mailing lists. 4) The BIOSCI user address and research interest directory. 0) BIOSCI NEEDS YOUR SUPPORT!! ------------------------------ BIOSCI's government funding has been expended, and we are now operating solely from advertising revenue that we have raised from our Web site at http://www.bio.net/. We need just a few minutes of your time to help us serve you. You can do two important things which will take very little time for you individually and will immensely help us continue to help you. First, please use our WWW system at http://www.bio.net/ to access the archives. You can post or reply to messages via your Web browser as described in item #1 below. Your usage helps attract sponsors. If you contact any of our sponsors, please be sure to thank them for supporting BIOSCI. It is critical for them to get this feedback if they are to continue their sponsorship for the long term. Second, if you work for a company or organization that provides products or services of interest to the biology community, please pass this message on to your marketing or marketing communications department or other appropriate group. Please ask them to help support BIOSCI by sponsoring our Web site and explain the uses and benefits of the system to the biology community. If they are interested, they can then contact us for further information at our tech support address, biosci-help@net.bio.net. 1) Using the WWW to access the BIOSCI/bionet newsgroups. -------------------------------------------------------- As of 10 December 1995, all BIOSCI/bionet full newsgroups are accessible through the World Wide Web (WWW) at URL http://www.bio.net. One can read and reply publicly or privately to both recent postings and archived messages through one's Web browser if it is configured properly to send e-mail. Each newsgroup is equipped with its own WAIS index. The main BIOSCI home page also has access to the BIO-JOURNALS Table of Contents database WAIS index and the BIOSCI user address database described in another item further below. 2) What to do about "spams," i.e., junk mail, ads, etc. ------------------------------------------------------- BIOSCI is a set of parallel USENET newsgroups (the "bionet" groups), mailing lists, and a hypermail archive at URL http://www.bio.net/. The same postings are distributed on all media (except for a small number of mailing-list-only groups at net.bio.net). Unfortunately it is becoming a despicable practice on the Internet (by a few people out to make a fast buck) to do automated mass postings to thousands of newsgroups and mailing lists. These attempts to grab free advertising are refered to as "spams" in the usual, somewhat boneheaded, net terminology. USENET is more susceptible to this practice, and many spams originate on the USENET groups and then are passed on to the mailing lists. However, spammers also get lists of mailing addresses and hit these too, so neither medium is immune. What should you do personally if you get junk mail? --------------------------------------------------- Just delete it and move on without reading it further. Filing a protest is becoming increasingly useless because spammers are often disguising the addresses where the messages are sent from. Unless you really understand Internet mail systems, your attempt at protest by sending replies to the message will often end up being sent to the address of an innocent person that the spammer is victimizing. What can BIOSCI/bionet do to protect its newsgroups? ---------------------------------------------------- The only solution currently available is to moderate the newsgroup. If this newsgroup is already moderated, then you are in good shape. Moderation protects the USENET distribution from about 95% of the spams that are being sent to date and protects the mailing lists completely. Moderation means, however, that someone has to take the time to review each message before it goes out. We have set up software here that simply allows the moderator to forward to an address at net.bio.net messages that (s)he wishes to have distributed. This takes no more time than that needed to read the message and pass it on, say about 1 min. per message. Most newsgroups currently have a discussion leader who is responsible for their newsgroup. The discussions leaders and their e-mail addresses are listed in the BIOSCI Information Sheet which is available on the Web at http://www.bio.net/. If a newsgroup is being hit with too many junk postings, please contact the discussion leader for that group and see if there is interest in moderating the group. Please do not assume that by simply posting a complaint to the newsgroup itself, anyone on the BIOSCI staff will act on your complaint. With close to 100 newsgroups to run, the BIOSCI staff has to rely on the discussion leaders of each newsgroup to report problems directly to us at biosci-help@net.bio.net. We will moderate any of our newsgroups if the discussion leader tells us that the readership of the group wishes to do so and if a moderator is willing to do the work. For most BIOSCI/bionet groups, this entails only a few minutes of work each day. Moderating a newsgroup will resolve probably 95% of the junk postings on the USENET distribution. Unfortunately there are easy ways for determined spammers to override the moderation mechanism on USENET, but we can protect our e-mail subscribers from unwanted postings if the newsgroup is moderated. You can also access our newsgroups over the WWW at URL http://www.bio.net. While this Web interface will not stop spammers from trying to post to the groups, this will give you yet another way, besides using USENET news, to keep the junk out of your personal mail files. For those of you with local USENET news systems, the Web interface will also give you faster access to new newsgroups and recent postings. 3) Examples of subscribing and unsubscribing to the mailing lists. ------------------------------------------------------------------ PLEASE NOTE: The BIOSCI management does NOT act on subscription/unsubscription requests that are posted improperly to the newsgroups and mailing lists. People who do this only bother everyone on the lists to no avail. Please be sure to follow the proper procedures below. Gory details are in the BIOSCI Information sheets on the Web at http://www.bio.net. Below we give an example utilizing the METHODS-AND-REAGENTS list at both of our two BIOSCI sites: Users in the Americas and Pacific Rim countries who use the BIOSCI ------------------------------------------------------------------ node at computer net.bio.net: ---------------------------- A) Determine the "listname" which is the <=8 character mail address ^^^^^^^^^^^^^ for the group. These can be found in the BIOSCI Info. Sheet. For the METHODS-AND-REAGENTS group the mailing address is methods@net.bio.net. The listname is the portion of the address to the left of the @ sign, i.e., "methods". The listname is used with the "subscribe" and "unsubscribe" commands illustrated below. B) Mail all commands in the body of a mail message addressed to biosci-server@net.bio.net. Do NOT send commands to the newsgroup posting addresses! Leave the Subject: line blank, any text on it will be ignored. C) In the body of your message put one or more of the following commands with an "end" command on the last line, e.g., subscribe methods unsubscribe methods end Do NOT put your e-mail address or other text on these lines. The server only allows you to cancel your subscription if the address on your mail header matches the address on our mailing list. Please ask for help at biosci-help@net.bio.net if your address has changed, e.g., if you know you are on the list but the server tells you that you are not a member. Users in Europe, Africa, and Central Asia who use the BIOSCI node at -------------------------------------------------------------------- computer daresbury.ac.uk (also known as dl.ac.uk): ------------------------------------------------- To subscribe and unsubscribe to/from the BIOSCI lists, you need to specify the full USENET newsgroup name with "bionet-news." prepended. The USENET newsgroup names are listed in the BIOSCI Information sheet on the Web at http://www.bio.net/. For the METHODS-AND-REAGENTS list the USENET newsgroup name is bionet.molbio.methds-reagnts, thus the appropriate commands are sub bionet-news.bionet.molbio.methds-reagnts unsub bionet-news.bionet.molbio.methds-reagnts These commands are included in a message addressed to mxt@dl.ac.uk, NOT to the newsgroup mailing addresses. As usual, include the text in the body of the message as text on the Subject: line is ignored. To unsubscribe from all the lists at the UK node, use unsub bionet-news Please note that if the address in the list is different than the one in your mail message header, you will not be able to unsubscribe by this method. If you have problems, please mail biosci@daresbury.ac.uk. 4) The BIOSCI user address and research interest directory. ----------------------------------------------------------- Please take this opportunity to add your name, address, and research interest information to the BIOSCI User Address Database if you have not already done so. You can fill out the address form directly through our Web page at URL http://www.bio.net/adrform.html. The address database is reindexed nightly for WWW access (the URL is http://www.bio.net/). If you are not directly on the Internet but can reach it by e-mail, please use our waismail server to access the user directory. waismail use is described above. You can also request a user address form by e-mail from biosci-help@net.bio.net. Please check your database entry from time-to-time to see if your address information is still up-to-date. Because of our limited personnel resources, we ask that you resubmit a *complete* form to revise your entry; we only replace complete entries and do not have resources to edit old forms. Sincerely, Dave Kristofferson BIOSCI/bionet Manager biosci-help@net.bio.net From owner-srs@net.bio.net Tue Nov 19 22:00:00 1996 Path: biosci!rutgers!uwm.edu!www.nntp.primenet.com!nntp.primenet.com!howland.erols.net!surfnet.nl!swidir.switch.ch!swsbe6.switch.ch!news.vub.ac.be!ben!gbottu From: gbottu@ben.vub.ac.be (Guy Bottu) Newsgroups: bionet.software.srs Subject: Re: SRS 4.08 indexing Date: 20 Nov 1996 19:11:58 GMT Organization: Belgian EMBnet Node Lines: 56 Message-ID: <56vl5u$7o4@rc1.vub.ac.be> References: NNTP-Posting-Host: ben.vub.ac.be X-Newsreader: TIN [version 1.2 PL2] Andrew T. Lloyd (atlloyd@acer.gen.tcd.ie) wrote: : I have a minimal SRS setup here: SW PIR PRosite EMBL-without-ESTs : but have problems getting the links sorted: : the links from SW - EMBL are looking for the NI field and report : INFO: : no entries found The SwissProt contains lines of the type : DR EMBL; M15203; G167391; - So, they should be correctly parsed with the swissprot.sdl from the distribution, since this contains : #field /gblid=%SWISSPROT_DR_FIELD /itype=link /ftype=@DF_LINK /idtype=@SRSxLINKID /begstr="DR " /nextstr="DR EXIT " /maxlines=1 /find=link ... #readlink /id=%GENEMBL_REF /link=@SWISSPROT_EMBL_LINK, @SWISSPROT_GENBANK_LINK ... link = [emlink | pirlink | pdblink | proslink | rebaselink | mimlink]; emlink = 'EMBL' ';' accno ';'; ... #link /id=%SWISSPROT_EMBL_LINK /weight=10 /lib1=@SWISSPROT_DB /lib2=@EMBL_DB /field1=@SWISSPROT_ID_FIELD /field2=@EMBL_ACC_FIELD /idtype1=@SRSxSEQID /idtype2=@SRSxSEQID I really do not see what might go wrong... : I also note that I have acquired (through no effort of mine!) : a link from SW to MIM at wwwgdb.gdb.org but that this is asking : for http://wwwgdb.gdb.org/omim/omimx which is "not found on : this server" I think OMIM is not available from the GDB site or they have changed the path. Anyway, I get OMIM from the NCBI's Entrez site with : /call="%s" That does work. I hope this will help you. Guy Bottu From owner-srs@net.bio.net Wed Nov 20 22:00:00 1996 Path: biosci!ELIRIS.MED.YALE.EDU!lolis From: lolis@ELIRIS.MED.YALE.EDU (Elias Lolis) Newsgroups: bionet.software.srs Subject: N-term analysis software Date: 21 Nov 1996 13:21:45 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 18 Sender: daemon@net.bio.net Distribution: world Message-ID: <3294C7B2.446B@eliris.med.yale.edu> NNTP-Posting-Host: net.bio.net Is there a program that can be used to compile a list of the frequencies of individual amino acids at the N-terminus of mature proteins in the database? I am working on a cytokine with a proline at the N-terminus. This protein has structural (but not sequence) homology to 2 microbial enzymes that use a proline at the N-terminus as a catalytic base. There are many similarities in the local environment of the proline between the cytokine and the 2 microbial enzymes, and I am now investigating the possibility that this cytokine has catalytic activity. Toward that end, I am interested in determining the frequency of proline (relative to other amino acids) to be present at the amino terminus. Does anyone know of a program that can do this or whether such a list has been compiled? It will be important for the program to distinguish between entire polypeptides and mature, processed forms of proteins. Thanks. Elias Lolis lolis@eliris.med.yale.edu