From owner-chromosomes@net.bio.net Sun Jan 02 22:00:00 1994 Path: biosci!CS.Arizona.EDU!organpipe.uug.arizona.edu!uunet!nctuccca.edu.tw!TWNMOE10.Edu.TW!YMMCS023 From: YMMCS023@TWNMOE10.Edu.TW Newsgroups: bionet.genome.chromosomes Subject: What's the simplest way to map a cDNA clone? Date: Mon, 03 Jan 94 21:03:33 GMT Organization: MOE Computer Center, Taiwan Lines: 10 Message-ID: <16F3312825.YMMCS023@TWNMOE10.Edu.TW> NNTP-Posting-Host: twnmoe10.edu.tw X-Newsreader: NNR/VM S_1.3.2 I got 6 human fetal brain cDNA. They are not identical to any published sequ ence by comparing in "Blast". I am going to map these clones. Would any body give me suggestion on what's the method of choice for an unexperienced guy? Any information must be very helpful to me and be highly appresciated. CHEN-JEE HORNG, M.D. DEPARTMENT OF PSYCHIATRY VETERANS GENERAL HOSPITAL-TAIPEI TAIPEI, TAIWAN, R.O.C. E-mail: ymmcs023@twnmoe10.edu.tw From owner-chromosomes@net.bio.net Wed Jan 05 22:00:00 1994 Path: biosci!daresbury!not-for-mail From: "Jonathan L. Haines" Newsgroups: bionet.genome.chromosomes Subject: Course Announcement Date: 6 Jan 1994 18:16:41 -0000 Lines: 144 Sender: daemon@mserv1.dl.ac.uk Distribution: bionet Message-ID: <2ghki9$a0d@mserv1.dl.ac.uk> X-Vms-To: CHROM,GENLINK,GENOME Original-To: biochrom@net.bio.net, genetic-linkage@net.bio.net, gnome-pr@net.bio.net - COURSE ANNOUNCEMENT - GENETIC ANALYSIS METHODS FOR MEDICAL RESEARCHERS Description: A comprehensive four day course directed toward physician scientists and/or other medical researchers that will introduce them to state-of-the-art approaches for mapping human inherited disorders of both a monogenic and polygenic nature, such as cancer syndromes, multiple sclerosis, etc. The overall focus of the course is on the development of a broad-based knowledge of the resources available through the Human Genome Initiative, and overall project decision making, rather than the mechanics of specific techniques. The specific goals are: 1. To outline and instruct participants in detail about the necessary steps and procedures used in ascertaining and collecting pedigree data and family history information. These processes include the use of family history questionnaires, computer management systems, simulation of data to determine linkage power, designs for clinical sampling schemes, and the actual sampling and subsequent cataloguing and storing of pedigree DNA for study. 2. To discuss in detail the methodologies for using the Index Marker Maps generated by the efforts of the Human Genome Initiative. This will include a broad understanding of PCR technology and its use for genotyping dinucleotide or other simple sequence length polymorphisms. It will also include a discussion of statistical analytical methods such as lod scores and the examination of affected relative pairs. Emphasis will be on working examples as well as the basic theory behind these genetic mapping methodologies rather than intensive computational exercises. Information will be available about the computational resources necessary to undertake such a study and how to obtain them. 3. To educate participants on the general interpretation of linkage results. Discussions will include an overview of positional cloning strategies, refinement of the preliminary linkage data, examination of heterogeneity, physical mapping, cDNA analysis, exon amplification etc. This course will not include any bench or "wet" laboratory experience. 4. To incorporate discussion of the participant's individual research interests. Participants will be encouraged to bring preliminary information and/or data for both formal and informal group discussion and instructor consultation. Course participants will be polled prior to the course about their particular needs and interests and their own motivations for taking the course. Extensive efforts will be made to incorporate the suggested topics of participants. Faculty: Organizers: Margaret A. Pericak-Vance, Ph.D. Dept. of Medicine Division of Neurology Duke University Medical Center Jonathan L. Haines, Ph.D. Molecular Neurogenetics Unit Massachusetts General Hospital Instructors: Jeffrey Murray, M.D. Division of Medical Genetics Department of Pediatrics University of Iowa Hospitals Marcy C. Speer, Ph.D. Dept. of Medicine Division of Neurology Duke University Medical Center Arthur S. Aylsworth, M.D. Chief, Division of Genetics and Metabolism, Dept. of Pediatrics University of North Carolina at Chapel Hill David Goldgar, Ph.D. Dept. of Medical Informatics University of Utah Deborah Meyers, Ph.D. Dept. of Medicine School of Medicine Johns Hopkins University The broad-based faculty has extensive expertise in genetic epidemiology, positional cloning, reference marker mapping, laboratory techniques, clinical diagnosis and family collection. Faculty will be available throughout the course for informal discussions. Location: The R. David Thomas Center The Fuqua School of Business Duke University Durham, NC The Thomas center, by offering both in-house accommodations and meals, promotes maximum interactions, both formal and informal, between participants. Most faculty will be staying on-site for the duration of the course. Date: May 15 through May 18, 1994 Participation: Individuals with an M.D. or Ph.D. and a specific disease-related interest are encouraged to apply but participation will be limited to a total of 35 individuals. Up to five scholarships will be available for M.D. and/or Ph.D. students and fellows. Women and minorities are specifically encouraged to apply. The deadline for receipt of completed application forms is March 1, 1994. For more information about registration fees, course requirements, etc: Write: Genetic Methods Course c/o Dr. Margaret Pericak-Vance Division of Neurology, Box 2900 Duke University Medical Center Durham, NC 27710 OR: E-Mail: genclass@genemap.mc.duke.edu In any correspondence, please include a postal address. From owner-chromosomes@net.bio.net Sun Jan 09 22:00:00 1994 Path: biosci!bcm!cs.utexas.edu!math.ohio-state.edu!usc!elroy.jpl.nasa.gov!swrinde!menudo.uh.edu!uuneo.NeoSoft.com!sugar.NeoSoft.COM!not-for-mail From: claird@sugar.NeoSoft.COM (Cameron Laird) Newsgroups: sci.bio,bionet.molbio.genome-program,bionet.genome.chromosomes,alt.culture.internet,alt.culture.usenet Subject: Re: Questions about CEPH's map Followup-To: alt.culture.internet,alt.culture.usenet Date: 10 Jan 1994 15:23:49 -0600 Organization: NeoSoft Internet Services +1 713 684 5969 Lines: 50 Message-ID: <2gsh15$3qh@sugar.NeoSoft.COM> References: <2grtau$62m@sugar.neosoft.com> NNTP-Posting-Host: sugar.neosoft.com Xref: biosci sci.bio:6081 bionet.molbio.genome-program:611 bionet.genome.chromosomes:137 alt.culture.internet:1052 alt.culture.usenet:1380 Let me calm the roiled waters. I summarize below what I've learned from a couple of sources. In article <2grtau$62m@sugar.neosoft.com>, I wrote: >Does CEPH (Centre d'Etude du Polymorphism Humain) need some >automation help? In > > Nowak, Rachel > 1993 "Draft Genome Map Debuts on Internet", > Science, volume 262, page 1967 (24 > December 1993) > >Daniel Cohen is quoted as having said, "We received 64 requests >for map information ... We have a logistics problem that we did >not anticipate. We have only one person at any one time sending >out [the files on Internet]." What's up, here? I know Cohen is >famous around the world, and can get close to whatever he re- >quests, I know how severely a journalistic filter can degrade >technical information, and so on, but it *sounds* as though some- >one doesn't know how to automate Internet ftp or mail services. >Is there someone closer to the scene who knows more of the story? >Heck, for the chance to help out the HUGE mappers, *I*'ll get on >a plane to Paris to help set up their node ... . . . Folks assure me that the CEPH team is doing just what it wants. There are no particular technical constraints on their distribution of map data. They do *not* appear in need of help from the Internet community to automate their operations. Incidentally, reporter Rachel Nowak was quite gracious in a conversation with me in assuming responsibility for my misapprehension about the situation. I tried to con- vince her that she'd done her job just fine; I'm still not sure she didn't take this episode as a criticism. My description: the Internet has facilitated a couple mismatches of scale (Cohen's expectations and the post- *Nature* response) or vocabulary (the *Science* readership and my NetNews-affected idiolect). What ought one expect, though, from a technology that persists in expanding by roughly 10%/month? I've re-directed follow-ups. -- Cameron Laird claird@Neosoft.com (claird%Neosoft.com@uunet.uu.net) +1 713 267 7966 claird@litwin.com (claird%litwin.com@uunet.uu.net) +1 713 996 8546 From owner-chromosomes@net.bio.net Sun Jan 09 22:00:00 1994 Newsgroups: sci.bio,bionet.molbio.genome-program,bionet.genome.chromosomes,alt.culture.internet Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!xlink.net!zib-berlin.de!netmbx.de!Germany.EU.net!EU.net!julienas!genethon!vaysseix From: vaysseix@genethon.fr (Guy Vaysseix) Subject: Re: Questions about CEPH's map Message-ID: <1994Jan10.225607.16218@genethon.fr> Sender: news@genethon.fr Nntp-Posting-Host: genethon.genethon.fr Organization: Genethon -- Human Genome Research Centre References: <2grtau$62m@sugar.NeoSoft.COM> Date: Mon, 10 Jan 1994 22:56:07 GMT Lines: 35 Xref: biosci sci.bio:6083 bionet.molbio.genome-program:612 bionet.genome.chromosomes:138 alt.culture.internet:1055 In article <2grtau$62m@sugar.NeoSoft.COM> claird@sugar.NeoSoft.COM (Cameron Laird) writes: >Does CEPH (Centre d'Etude du Polymorphism Humain) need some >automation help? >[...] I know how severely a journalistic filter can degrade >technical information, and so on, but it *sounds* as though some- >one doesn't know how to automate Internet ftp or mail services. >Is there someone closer to the scene who knows more of the story? >Heck, for the chance to help out the HUGE mappers, *I*'ll get on >a plane to Paris to help set up their node ... >-- >> Thank you very much for your help, but before to get a plane, just try to get files from : ftp anonymous : ceph-genethon-map.genethon.fr dir pub/ceph-genethon-map or gopherize at gopher.genethon.fr -> Genethon Data -> Pmap or just click into your favorite mosaic client at : WWW : http://www.genethon.fr/genethon_en.html and read the current "policy". IMHO not really a computer related problem... and last but not least, for infos, requests, flames, etc mail ceph-genethon-map@genethon.fr most of the HUGE mappers staff read this. Amicalement; Guy Vaysseix (CEPH/Genethon) From owner-chromosomes@net.bio.net Sun Jan 09 22:00:00 1994 Path: biosci!bcm!cs.utexas.edu!swrinde!menudo.uh.edu!uuneo.NeoSoft.com!sugar.NeoSoft.COM!not-for-mail From: claird@sugar.NeoSoft.COM (Cameron Laird) Newsgroups: sci.bio,bionet.molbio.genome-program,bionet.genome.chromosomes,alt.culture.internet Subject: Questions about CEPH's map Date: 10 Jan 1994 09:47:42 -0600 Organization: NeoSoft Internet Services +1 713 684 5969 Lines: 24 Message-ID: <2grtau$62m@sugar.NeoSoft.COM> NNTP-Posting-Host: sugar.neosoft.com Xref: biosci sci.bio:6079 bionet.molbio.genome-program:610 bionet.genome.chromosomes:136 alt.culture.internet:1050 Does CEPH (Centre d'Etude du Polymorphism Humain) need some automation help? In Nowak, Rachel 1993 "Draft Genome Map Debuts on Internet", Science, volume 262, page 1967 (24 December 1993) Daniel Cohen is quoted as having said, "We received 64 requests for map information ... We have a logistics problem that we did not anticipate. We have only one person at any one time sending out [the files on Internet]." What's up, here? I know Cohen is famous around the world, and can get close to whatever he re- quests, I know how severely a journalistic filter can degrade technical information, and so on, but it *sounds* as though some- one doesn't know how to automate Internet ftp or mail services. Is there someone closer to the scene who knows more of the story? Heck, for the chance to help out the HUGE mappers, *I*'ll get on a plane to Paris to help set up their node ... -- Cameron Laird claird@Neosoft.com (claird%Neosoft.com@uunet.uu.net) +1 713 267 7966 claird@litwin.com (claird%litwin.com@uunet.uu.net) +1 713 996 8546 From owner-chromosomes@net.bio.net Mon Jan 10 22:00:00 1994 Path: biosci!bcm!cs.utexas.edu!uunet!MathWorks.Com!transfer.stratus.com!noc.near.net!das-news.harvard.edu!husc-news.harvard.edu!husc.harvard.edu!husc10!robison1 Newsgroups: sci.bio,bionet.molbio.genome-program,bionet.genome.chromosomes,alt.culture.internet Subject: Re: Questions about CEPH's map Message-ID: From: robison1@husc10.harvard.edu (Keith Robison) Date: 11 Jan 94 06:56:29 GMT References: <2grtau$62m@sugar.NeoSoft.COM> <1994Jan10.225607.16218@genethon.fr> Organization: Harvard University, Cambridge, Massachusetts NNTP-Posting-Host: husc10.harvard.edu Lines: 25 Xref: biosci sci.bio:6085 bionet.molbio.genome-program:614 bionet.genome.chromosomes:139 alt.culture.internet:1060 It's been obvious from the start that the CEPH/Genethon people had a good Internet scheme going -- access by all the favorite protocols. (and to make things even better, the good folks at the U.Michigan Genome Center have provided WWW search facilities. Human Genome Physical Map from CEPH-Genethon (at U.Michigan Genome Center) But what is the explanation for the Cohen quote in the Science article about "only 1 person sending out requests on the Internet"? Was some important context lost? Did Dr. Cohen mean that there was one person available for non-internet requests or for showing non-netliterate biologists how to get the data? The incongruence between that article and the excellent (and well net-publicized) net access has had me wondering for days. Hope someone can shed some light on this curious statement. Keith Robison Harvard University Department of Cellular and Developmental Biology Department of Genetics / HHMI krobison@nucleus.harvard.edu From owner-chromosomes@net.bio.net Tue Jan 11 22:00:00 1994 Path: biosci!daresbury!doc.ic.ac.uk!uknet!pipex!howland.reston.ans.net!agate!msuinfo!harbinger.cc.monash.edu.au!uniwa!newsman!Jim.Cummins From: cummins@possum.murdoch.edu.au (Jim Cummins) Newsgroups: sci.bio,bionet.molbio.genome-program,bionet.genome.chromosomes Subject: Timing of genomic imprinting Date: 12 Jan 1994 02:26:34 GMT Organization: Murdoch University, Western Australia Lines: 20 Sender: -Not-Authenticated-[4958] Message-ID: <2gvn4qINNt7u@newsman.csu.murdoch.edu.au> NNTP-Posting-Host: vetmac3.csu.murdoch.edu.au X-Posted-From: InterNews 1.0@newsman.csu.murdoch.edu.au. Xdisclaimer: No attempt was made to authenticate the sender's name. Xref: biosci sci.bio:6088 bionet.molbio.genome-program:617 bionet.genome.chromosomes:140 Does anyone have any information on when genomic imprinting is completed in mammalian spermatogenesis? There's a report of fertilization by fusion of round spermatids with oocytes (mouse, hamster) but so far no successful embryo development. This question is relevant to current techniques using micro-assisted human fertilization by intracytoplasmic sperm injection (ICSI) in cases of severe male infertility. There are already reports of fertilization using very immature sperm from the rete testis. Poor chromatin condensation is significantly associated with male infertility, and if imprinting is not completed until after the second meiotic division this could lead to problems in embryo development. In addition, there are strong associations between epididymal blockage ( a common indication used for carrying out ICSI) and cystic fibrosis, which is a bit worrying. Jim Cummins School of Veterinary Studies Murdoch University Western Australia 6150 Tel +61-9-360 2668 Fax +61-9-310 4144 For every complex problem there's a simple solution. And it's wrong! From owner-chromosomes@net.bio.net Wed Jan 12 22:00:00 1994 Path: biosci!hubcap!emory!europa.eng.gtefsd.com!howland.reston.ans.net!cs.utexas.edu!swrinde!menudo.uh.edu!uuneo.NeoSoft.com!sugar.NeoSoft.COM!not-for-mail From: claird@sugar.NeoSoft.COM (Cameron Laird) Newsgroups: sci.bio,bionet.genome.chromosomes,alt.culture.internet Subject: Re: Questions about CEPH's map Date: 13 Jan 1994 12:50:53 -0600 Organization: NeoSoft Internet Services +1 713 684 5969 Lines: 57 Message-ID: <2h456d$abi@sugar.NeoSoft.COM> References: <2grtau$62m@sugar.NeoSoft.COM> <1994Jan10.225607.16218@genethon.fr> NNTP-Posting-Host: sugar.neosoft.com Xref: biosci sci.bio:6090 bionet.genome.chromosomes:141 alt.culture.internet:1072 In article , Keith Robison wrote: >It's been obvious from the start that the CEPH/Genethon people had a >good Internet scheme going -- access by all the favorite protocols. . . . >But what is the explanation for the Cohen quote in the Science article >about "only 1 person sending out requests on the Internet"? Was some >important context lost? Did Dr. Cohen mean that there was one person >available for non-internet requests or for showing non-netliterate >biologists how to get the data? The incongruence between that article >and the excellent (and well net-publicized) net access has had me wondering >for days. > >Hope someone can shed some light on this curious statement. . . . The incongruity of that quote was indeed what initiated this thread. I don't have a definitive answer, but, as was recently posted in bionet.molbio.genome-program, #We have received a number of inquiries about the availability of the #CEPH-Genethon data. The following message, dated mid December, #was taken directly from the Genethon Gopher. It explains CEPH's plans #for releasing the information for the different level maps. Dr. Cohen #recently confirmed that all of the data will be available by anonymous #FTP on the schedule given. # #Jane Peterson #NCHGR # # "As mentioned in the Nature publication (A first generation # physical map of the the human genome, December 16 1993), # routes will be submitted to exhaustive verification and will # be available by anonymous ftp as soon as they are checked. # This checking process will last approximately two months. # However, level 1-2 routes are already available by anonymous # ftp. Investigators interested in level 3-7 routes that have # not been checked yet can obtain them by electromic mail # requests addressed to CEPH-genethon-map@genethon.fr or by # fax. This personal request procedure could delay the access # to these routes due to logistic problems that will be solved # within a few weeks. But even if the number of requests is # high, this delay will not exceed a few days for any request. # Based on an unfortunate experience on chromosome 21, we # consider now that the personal request procedure is the best # way to keep contact with the potential users of this map. # Indeed, this will allow us to be informed on the progress in # checking validity of the routes and also to understand any # problem in using these data." -- Cameron Laird claird@Neosoft.com (claird%Neosoft.com@uunet.uu.net) +1 713 267 7966 claird@litwin.com (claird%litwin.com@uunet.uu.net) +1 713 996 8546 From owner-chromosomes@net.bio.net Wed Jan 19 22:00:00 1994 Newsgroups: bionet.genome.chromosomes,bionet.general Path: biosci!bcm!cs.utexas.edu!sdd.hp.com!saimiri.primate.wisc.edu!news.crd.ge.com!sunblossom!sonic!lamastus From: lamastus@sonic.dab.ge.com (Patrick Lamastus) Subject: Help with determination of sex Message-ID: Sender: news@sunblossom.ge.com Organization: Martin Marietta Simulation & Automated Systems Date: Thu, 20 Jan 1994 12:41:04 GMT Lines: 21 Xref: biosci bionet.genome.chromosomes:142 bionet.general:7161 Hi!, I'm sorry if this is not the proper group to post this, but I don't know where else to ask. Knowing that women provides a Y chromosome (correct me if I'm wrong) and the male the X or the Y (correct me if I'm wrong) does the male spermatocyte has X and Y or Only one (X or Y) before penetrates the egg. In other words does the spermatocyte has X or Y or both? How is the sex determined? Thanks in advance, Patrick Lamastus P.S. Please reply to me I don't have news so if you post your answer to the news I will never be able to read it. E-MAIL: lamastus@sunny.dab.ge.com From owner-chromosomes@net.bio.net Thu Jan 20 22:00:00 1994 Path: biosci!daresbury!mrccrc!news.dcs.warwick.ac.uk!warwick!uknet!comlab.ox.ac.uk!oxuniv!oxpath!rhubner Newsgroups: bionet.genome.chromosomes Subject: mouse chromosome painting Message-ID: <1994Jan21.103550.1@molbiol.ox.ac.uk> From: rhubner@molbiol.ox.ac.uk Date: 21 Jan 94 10:35:50 GMT Organization: Oxford University Molecular Biology Data Centre Nntp-Posting-Host: kasia.path Lines: 6 Hi there everybody! are there any (commercial) mouse chromosome painting probes available somewhere? info, Roland Thanks so much for a From owner-chromosomes@net.bio.net Thu Jan 20 22:00:00 1994 Path: biosci!CS.Arizona.EDU!organpipe.uug.arizona.edu!math.arizona.edu!news.Arizona.EDU!hamblin.math.byu.edu!sol.ctr.columbia.edu!howland.reston.ans.net!vixen.cso.uiuc.edu!ux2.cso.uiuc.edu!supat From: supat@ux2.cso.uiuc.edu (Supat Faarungsang Anim.Gen) Newsgroups: bionet.genome.chromosomes Subject: Re: mouse chromosome painting Date: 21 Jan 1994 22:59:07 GMT Organization: University of Illinois at Urbana Lines: 11 Message-ID: <2hpmnr$pkg@vixen.cso.uiuc.edu> References: <1994Jan21.103550.1@molbiol.ox.ac.uk> NNTP-Posting-Host: ux2.cso.uiuc.edu rhubner@molbiol.ox.ac.uk writes: I used to use G-banding 20 years ago. I have change to study in computer sci now. Bye, Supat >Hi there everybody! > are there any (commercial) mouse chromosome painting probes available >somewhere? >info, >Roland > Thanks so much for a From owner-chromosomes@net.bio.net Thu Jan 20 22:00:00 1994 Newsgroups: bionet.genome.chromosomes Path: biosci!CS.Arizona.EDU!math.arizona.edu!news.Arizona.EDU!hamblin.math.byu.edu!sol.ctr.columbia.edu!howland.reston.ans.net!EU.net!sun4nl!news.nic.surfnet.nl!rlmix1.rulimburg.nl!Farmaco.RuLimburg.NL!G.Fazzi From: G.Fazzi@Farmaco.RuLimburg.NL (G.E. Fazzi) Subject: chromosome 11 Message-ID: Keywords: chromosome 11 Lines: 8 Sender: news@rlmix1.rulimburg.nl (USENET News System) Organization: University of Limburg X-Newsreader: Trumpet for Windows [Version 1.0 Rev A] Date: Fri, 21 Jan 1994 15:43:43 GMT Does anyone know what the effects are of an inversion on chromosome 11? Thanks in advance, G.E.Fazzi (G.Fazzi@Farmaco.RuLimburg.NL) Dept. Pharmacology, University of Limburg, The Netherlands From owner-chromosomes@net.bio.net Mon Jan 24 22:00:00 1994 Newsgroups: bionet.genome.chromosomes,bionet.general Path: biosci!CS.Arizona.EDU!math.arizona.edu!news.Arizona.EDU!hamblin.math.byu.edu!sol.ctr.columbia.edu!howland.reston.ans.net!pipex!pavo.csi.cam.ac.uk!fjmd1 From: fjmd1@cl.cam.ac.uk (Francis Davey) Subject: Re: Help with determination of sex Message-ID: <1994Jan25.121352.13149@infodev.cam.ac.uk> Sender: news@infodev.cam.ac.uk (USENET news) Nntp-Posting-Host: ouse.cl.cam.ac.uk Organization: U of Cambridge Computer Lab, UK References: Date: Tue, 25 Jan 1994 12:13:52 GMT Lines: 45 Xref: biosci bionet.genome.chromosomes:147 bionet.general:7213 In article lamastus@sonic.dab.ge.com (Patrick Lamastus) writes: >Hi!, > >I'm sorry if this is not the proper group to post this, but >I don't know where else to ask. > >Knowing that women provides a Y chromosome (correct me if I'm wrong) * * most human females are XX, so would provide a single X chromosome * >and the male the X or the Y (correct me if I'm wrong) does the >male spermatocyte has X and Y or Only one (X or Y) before penetrates >the egg. * * again most human males are XY and therefore most sperm have a single * X or a single Y chromosome. * > >In other words does the spermatocyte has X or Y or both? >How is the sex determined? > * * Generally speaking an XX individual is female and an XY individual is male * things are a touch more complicated than this, you should ask someone who * knows rather more than I do if you are interested. * * Occasionally things do go wrong and people end up with exotic sex chromosomes * For example about 1/1000 males are XXY and a similar numer XYY. Similarly * the same proportion of women are XXX and about 1/10,000 women have Turner's * syndrome (a single X chromosome). * * I believe that the fact that X sperm and Y sperm are not identical has been * used as a method of biasing conception in favour of a sex determined by the * parents. * >Thanks in advance, > >Patrick Lamastus > >P.S. Please reply to me I don't have news so if you post your answer to the >news I will never be able to read it. > >E-MAIL: lamastus@sunny.dab.ge.com From owner-chromosomes@net.bio.net Mon Jan 24 22:00:00 1994 Path: biosci!daresbury!keele!uknet!pipex!howland.reston.ans.net!sol.ctr.columbia.edu!hamblin.math.byu.edu!news.Arizona.EDU!NewsWatcher!user From: Tmeyn@ccit.arizona.edu (Tony Meyn) Newsgroups: bionet.genome.chromosomes Subject: TAC Repeat Followup-To: bionet.genome.chromosomes Date: Mon, 24 Jan 1994 18:32:46 +1603 Organization: University of Arizona Lines: 13 Message-ID: NNTP-Posting-Host: blast.agmarley.arizona.edu I recently sequenced a fungal gene that contained the sequence: AATATTACTACTACTACTACTACTACT within a transcribed but untranslated region. A database search revealed a number of eucaryotes with this "TAC" repeat, but investigation of the papers did not reveal anything of use about this sequence. Any help leading to info. about this sequence would be appreciated. Tony Meyn University of Arizona From owner-chromosomes@net.bio.net Tue Jan 25 22:00:00 1994 Path: biosci!daresbury!doc.ic.ac.uk!pipex!howland.reston.ans.net!agate!msuinfo!netnews.upenn.edu!NewsWatcher!user From: Lensch@chop.edu (M. William Lensch) Newsgroups: bionet.genome.chromosomes Subject: uniparental disomy Followup-To: bionet.genome.chromosomes Date: 26 Jan 1994 20:24:49 GMT Organization: U. of Penn./Neurology Lines: 4 Distribution: world Message-ID: NNTP-Posting-Host: 159.14.16.4 Does anyone have any statistics on uniparental disomy? Which chromosomes have been noted as being involved other than chr. 15? What conditions does this cause other than those associated w/ chr. 15? I don't have e-mail so post here please. Thanks............ From owner-chromosomes@net.bio.net Tue Jan 25 22:00:00 1994 Path: biosci!daresbury!bioftp.unibas.ch!rc1.vub.ac.be!ub4b!EU.net!howland.reston.ans.net!agate!msuinfo!netnews.upenn.edu!NewsWatcher!user From: Lensch@chop.edu (M. William Lensch) Newsgroups: bionet.genome.chromosomes Subject: Re: Help with determination of sex Followup-To: bionet.genome.chromosomes,bionet.general Date: 26 Jan 1994 19:55:30 GMT Organization: U. of Penn./Neurology Lines: 46 Distribution: world Message-ID: References: <1994Jan25.121352.13149@infodev.cam.ac.uk> NNTP-Posting-Host: 159.14.16.4 In article <1994Jan25.121352.13149@infodev.cam.ac.uk>, fjmd1@cl.cam.ac.uk (Francis Davey) wrote: > > In article lamastus@sonic.dab.ge.com (Patrick Lamastus) writes: > >Hi!, > > > >I'm sorry if this is not the proper group to post this, but > >I don't know where else to ask. > > > >Knowing that women provides a Y chromosome (correct me if I'm wrong) > * > * most human females are XX, so would provide a single X chromosome > * > >and the male the X or the Y (correct me if I'm wrong) does the > >male spermatocyte has X and Y or Only one (X or Y) before penetrates > >the egg. > * > * again most human males are XY and therefore most sperm have a single > * X or a single Y chromosome. > * > > > >In other words does the spermatocyte has X or Y or both? > >How is the sex determined? > > > * > * Generally speaking an XX individual is female and an XY individual is male > * things are a touch more complicated than this, you should ask someone who > * knows rather more than I do if you are interested. > *####there is a specific gene(s) on the Y chrom. loosely refered to as the sex determination gene that I belive has not been identified though is has been assigned to a narrow window (my info. also is prob. outdated). > * Occasionally things do go wrong and people end up with exotic sex chromosomes > * For example about 1/1000 males are XXY and a similar numer XYY. Similarly > * the same proportion of women are XXX and about 1/10,000 women have Turner's > * syndrome (a single X chromosome). > *##### there are also cases where GENOTYPIC males (XY) are PHENOTYPIC females (they look female) due to things like mutation in the androgen receptor gene (androgen being a key player as far as hormomes go in maleness). This condition is known as testicular feminization. These individuals are sterile. > * I believe that the fact that X sperm and Y sperm are not identical has been > * used as a method of biasing conception in favour of a sex determined by the > * parents. > *####this technique is based upon the different densities of sperm (or other cells) and uses centrifugation to seperate cell type (those w/X and those w/Y). This is termed flow cytometry. > >Thanks in advance, > > > >Patrick Lamastus > > > >P.S. Please reply to me I don't have news so if you post your answer to the > >news I will never be able to read it. > > > >E-MAIL: lamastus@sunny.dab.ge.com From owner-chromosomes@net.bio.net Thu Jan 27 22:00:00 1994 Path: biosci!CS.Arizona.EDU!math.arizona.edu!news.Arizona.EDU!hamblin.math.byu.edu!news.byu.edu!news.kei.com!sol.ctr.columbia.edu!howland.reston.ans.net!usc!elroy.jpl.nasa.gov!swrinde!sgiblab!munnari.oz.au!uniwa!newsman!Jim.Cummins From: cummins@possum.murdoch.edu.au (Jim Cummins) Newsgroups: bionet.genome.chromosomes,bionet.general Subject: Re: Help with determination of sex Date: 28 Jan 1994 05:53:27 GMT Organization: Murdoch University, Western Australia Lines: 61 Sender: -Not-Authenticated-[2792] Message-ID: <2ia98nINNbov@newsman.csu.murdoch.edu.au> References: <1994Jan25.121352.13149@infodev.cam.ac.uk> NNTP-Posting-Host: vetmac3.csu.murdoch.edu.au X-Posted-From: InterNews 1.0@newsman.csu.murdoch.edu.au. Xdisclaimer: No attempt was made to authenticate the sender's name. Xref: biosci bionet.genome.chromosomes:150 bionet.general:7255 Patrick Lamastus writes: >t his technique is based upon the different densities of sperm (or other cells) and uses centrifugation to seperate cell type (those w/X and those w/Y). This is termed flow cytometry. Wrong, sorry. There have been a number of attempts to separate X and Y sperm by differential centrifugation. None have been repeatable. Flow cytometry relies on separation of sperm based on fluorescence staining. This can be a specific in situ hybridisation stain (eg for a region of the Y or X chromosome) or a generalised DNA stain that gives information about the total DNA content. Theoretically X and Y sperm differ in DNA content by about 2% but as this is less than the within-gender variation you can see that there are big problems in successful sorting. The following refernces may help Auger J, Leonce S, Jouannet P, Ronot X (1993): Flow cytometric sorting of living, highly motile human spermatozoa based on evaluation of their mitochondrial activity. J Histochem Cytochem 41:1247-51. Cran DG, Johnson LA, Miller NG, Cochrane D, Polge C (1993): Production of bovine calves following separation of X- and Y-chromosome bearing sperm and in vitro fertilisation. Vet Rec 132:40-1. Dresser DW, Atkins CJ, Pinder A, Morrell JM (1993): Analyses of DNA content of living spermatozoa using flow cytometry techniques. J Reprod Fertil 98:357-365. Johnson LA, Clarke RN (1988): Flow sorting of X and Y chromosome-bearing mammalian sperm: activation and pronuclear development of sorted bull, boar and ram sperm microinjected into hamster oocytes. Gamete Res 21:335-343. Johnson LA, Welch GR, Keyvanfar K, Dorfmann A, Fugger EF, Schulman JD (1993): Gender preselection in humans? Flow cytometric separation of X and Y spermatozoa for the prevention of X-linked diseases. Human Reprod 8:1733-1739. Morrell JM (1991): Applications of flow cytometry to artificial insemination: a review. Vet Rec 129:375-8. Pasteur X, Maubon I, Sabido O, Cottier M, Laurent JL (1992): Comparison of the chromatin stainability of human spermatozoa separated by discontinuous Percoll gradient centrifugation. A flow cytometric contribution. Anal Quant Cytol Histol 14:96-104. Pasteur X, Sabido O, Maubon I, Perrin CM, Laurent JL (1991): Quantitative assessment of chromatin stability alteration in human spermatozoa induced by freezing and thawing. A flow cytometric study. Anal Quant Cytol Histol 13:383-90. Peter AT, Jones PP, Robinson JP (1993): Fractionation of bovine spermatozoa for sex selection - a rapid immunomagnetic technique to remove spermatozoa that contain the H Y antigen. Theriogenology 40:1177-1185. Seligman J, Shalgi R, Oschry Y, Kosower NS (1991): Sperm analysis by flow cytometry using the fluorescent thiol labeling agent monobromobimane. Mol Reprod Devel 29:276-281. Spano M, Evenson DP (1993): Flow cytometric analysis for reproductive biology. Biology of the Cell 78:53-62. Tao J, Du JY, Critser ES, Critser JK (1993): Assessment of the acrosomal status and viability of human spermatozoa simultaneously using flow cytometry. Human Reprod 8:1879-1885. Jim Cummins School of Veterinary Studies Murdoch University Western Australia 6150 Tel +61-9-360 2668 Fax +61-9-310 4144 "An inordinate fondness for Beetles" From owner-chromosomes@net.bio.net Thu Jan 27 22:00:00 1994 Path: biosci!daresbury!not-for-mail From: Patrick Macleod 727-4461 Newsgroups: bionet.genome.chromosomes Subject: Imprinting Date: 27 Jan 1994 22:12:39 -0000 Lines: 6 Sender: daemon@mserv1.dl.ac.uk Distribution: bionet Message-ID: <2i9e8n$8s7@mserv1.dl.ac.uk> Alternate-Recipient: prohibited Hop-Count: 0 A1-Type: MAIL Importance: normal Posting-Date: Thu, 27 Jan 1994 13:57:00 -0800 (PST) Disclose-Recipients: prohibited Mr-Received: by mta MARS; Relayed; Thu, 27 Jan 1994 14:08:42 -0800 Original-To: biochrom@net.bio.net A place to start that answers many of your questions about which chromosomes are imprinted would be the American Journal of Human Genetics for January 1990 by Hall J. 46:857-873 1990. From owner-chromosomes@net.bio.net Thu Jan 27 22:00:00 1994 Path: biosci!daresbury!not-for-mail From: dmorgan@crc.ac.uk (Mr. D.D. Morgan) Newsgroups: bionet.genome.chromosomes Subject: subscrition Date: 28 Jan 1994 09:21:56 -0000 Lines: 1 Sender: daemon@mserv1.dl.ac.uk Distribution: bionet Message-ID: <2ialfk$n30@mserv1.dl.ac.uk> content-length: 38 Original-To: biochrom@dl.ac.uk Please subscribe me to this newsgroup From owner-chromosomes@net.bio.net Thu Jan 27 22:00:00 1994 Newsgroups: bionet.genome.chromosomes Path: biosci!daresbury!doc.ic.ac.uk!pipex!zaphod.crihan.fr!jussieu.fr!univ-lyon1.fr!swidir.switch.ch!scsing.switch.ch!rzusuntk.unizh.ch!wendy From: wendy@medgen.unizh.ch (Wendy Robinson) Subject: Re: uniparental disomy Message-ID: <1994Jan28.162833.1529@rzu-news.unizh.ch> Sender: newsadm@rzu-news.unizh.ch (CNEWS ADMINISTRATION) Organization: University of Zurich, Switzerland X-Newsreader: TIN [version 1.2 PL2] References: Date: Fri, 28 Jan 1994 16:28:33 GMT Lines: 40 M. William Lensch (Lensch@chop.edu) wrote: : Does anyone have any statistics on uniparental disomy? Which chromosomes : have been noted as being involved other than chr. 15? What conditions does : this cause other than those associated w/ chr. 15? I don't have e-mail so : post here please. Thanks............ Updates concerning which chromsomes UPD has been observed for is published by the 'committee for clinical disorders, chromosome abnormalities and uniparental disomy' as part of the Human Gene Mapping Workshops that are published by Cytogenetics and Cell Genetics. Statistics: Ch15 maternal UPD occurs at a frequency of roughly 1/100,000. Ch15 paternal UPD is much less frequently (roughly 1/500,000). No statistics exist for any other chromosome. Which chromosomes: Mat UPD has been observed for chromosome 4, 7, 9,13, 14, 15, 16, 21, 22. Pat UPD has been observed for chromosomes 6,10, 14, 16, 21, X, XY. Abnormal phenotype (besides homozygosity for recessive alleles: Ch7 mat UPD -- short stature (e.g. Spotila et al. AJHG 1992 51:1396-1405). Ch14 mat and pat UPD various findings including mild mental retardation (e.g. Antonarakis AJHG 52:1145-1152). Ch15 mat UPD (Prader-Willi syndrome) pat UPD (Angelman syndrome). Ch11 UPD(pat) is associated with Wilms Tumor and Beckwith-Wiedemann syndrome. However this is segemental and seems to only exist as a post- fertilization event. (see Henry et al. Eur. J Hum Genet 1:19-29). For most other chromosomes there is either no imprinting effect, or the effect of the UPD is obscured by presence of trisomic cell lines or recessive conditions. Chromosome 15 is the only UPD for which a clearly identifiable syndrome is associated with UPD. Wendy Robinson Univ. of ZŸŸurich Dept. of Medical Genetics wendy@medgen.unizh.ch From owner-chromosomes@net.bio.net Thu Jan 27 22:00:00 1994 Path: biosci!daresbury!not-for-mail From: stephen hedman Newsgroups: bionet.genome.chromosomes Subject: Beefalo and Sturgeon Date: 28 Jan 1994 21:33:09 -0000 Lines: 25 Sender: daemon@mserv1.dl.ac.uk Distribution: bionet Message-ID: <2ic0al$qbt@mserv1.dl.ac.uk> Original-To: biochrom@net.bio.net I am embarking upon two rather interesting projects and would like to benefit from the expertise and/or experience of people in this group. I will soon be presented with some tissue samples from beefalo (also called cattalo in Canada) upon which to do some cytogenetic work. Beefalo (cattalo) are hybrids between male beef cows and female buffalo (bison). One of my intents is to follow the inheritance of both cow and buffalo chromosomes during subsequent inbreeding of the hybrids. The other project involves the freshwater sturgeon (species: fulvescens). Although I have had a fair amount of experience with fish cytogenetics, I have never worked with sturgeons. I am assuming that cell culture techniques and restriction methods appropriate for other fish species would also work with sturgeons. I will appreciate any and all comments about either of these two projects. Thanks, Steve Hedman Professor Biology and Biochemistry/Molecular Biology University of Minnesota Duluth, Minnesota 55812 email: grad@ua.d.umn.edu From owner-chromosomes@net.bio.net Fri Jan 28 22:00:00 1994 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!pipex!uknet!daresbury!not-for-mail From: dmorgan@crc.ac.uk (Mr. D.D. Morgan) Newsgroups: bionet.genome.chromosomes Subject: subscrition Date: 28 Jan 1994 09:21:56 -0000 Lines: 1 Sender: daemon@mserv1.dl.ac.uk Distribution: bionet Message-ID: <2ialfk$n30@mserv1.dl.ac.uk> content-length: 38 Original-To: biochrom@dl.ac.uk Please subscribe me to this newsgroup From owner-chromosomes@net.bio.net Fri Jan 28 22:00:00 1994 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!agate!msuinfo!netnews.upenn.edu!NewsWatcher!user From: Lensch@chop.edu (M. William Lensch) Newsgroups: bionet.genome.chromosomes Subject: uniparental disomy Followup-To: bionet.genome.chromosomes Date: 26 Jan 1994 20:24:49 GMT Organization: U. of Penn./Neurology Lines: 4 Distribution: world Message-ID: NNTP-Posting-Host: 159.14.16.4 Does anyone have any statistics on uniparental disomy? Which chromosomes have been noted as being involved other than chr. 15? What conditions does this cause other than those associated w/ chr. 15? I don't have e-mail so post here please. Thanks............ From owner-chromosomes@net.bio.net Fri Jan 28 22:00:00 1994 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!agate!msuinfo!netnews.upenn.edu!NewsWatcher!user From: Lensch@chop.edu (M. William Lensch) Newsgroups: bionet.genome.chromosomes Subject: Re: Help with determination of sex Followup-To: bionet.genome.chromosomes,bionet.general Date: 26 Jan 1994 19:55:30 GMT Organization: U. of Penn./Neurology Lines: 46 Distribution: world Message-ID: References: <1994Jan25.121352.13149@infodev.cam.ac.uk> NNTP-Posting-Host: 159.14.16.4 In article <1994Jan25.121352.13149@infodev.cam.ac.uk>, fjmd1@cl.cam.ac.uk (Francis Davey) wrote: > > In article lamastus@sonic.dab.ge.com (Patrick Lamastus) writes: > >Hi!, > > > >I'm sorry if this is not the proper group to post this, but > >I don't know where else to ask. > > > >Knowing that women provides a Y chromosome (correct me if I'm wrong) > * > * most human females are XX, so would provide a single X chromosome > * > >and the male the X or the Y (correct me if I'm wrong) does the > >male spermatocyte has X and Y or Only one (X or Y) before penetrates > >the egg. > * > * again most human males are XY and therefore most sperm have a single > * X or a single Y chromosome. > * > > > >In other words does the spermatocyte has X or Y or both? > >How is the sex determined? > > > * > * Generally speaking an XX individual is female and an XY individual is male > * things are a touch more complicated than this, you should ask someone who > * knows rather more than I do if you are interested. > *####there is a specific gene(s) on the Y chrom. loosely refered to as the sex determination gene that I belive has not been identified though is has been assigned to a narrow window (my info. also is prob. outdated). > * Occasionally things do go wrong and people end up with exotic sex chromosomes > * For example about 1/1000 males are XXY and a similar numer XYY. Similarly > * the same proportion of women are XXX and about 1/10,000 women have Turner's > * syndrome (a single X chromosome). > *##### there are also cases where GENOTYPIC males (XY) are PHENOTYPIC females (they look female) due to things like mutation in the androgen receptor gene (androgen being a key player as far as hormomes go in maleness). This condition is known as testicular feminization. These individuals are sterile. > * I believe that the fact that X sperm and Y sperm are not identical has been > * used as a method of biasing conception in favour of a sex determined by the > * parents. > *####this technique is based upon the different densities of sperm (or other cells) and uses centrifugation to seperate cell type (those w/X and those w/Y). This is termed flow cytometry. > >Thanks in advance, > > > >Patrick Lamastus > > > >P.S. Please reply to me I don't have news so if you post your answer to the > >news I will never be able to read it. > > > >E-MAIL: lamastus@sunny.dab.ge.com From owner-chromosomes@net.bio.net Fri Jan 28 22:00:00 1994 Newsgroups: bionet.genome.chromosomes,bionet.general Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!pipex!pavo.csi.cam.ac.uk!fjmd1 From: fjmd1@cl.cam.ac.uk (Francis Davey) Subject: Re: Help with determination of sex Message-ID: <1994Jan25.121352.13149@infodev.cam.ac.uk> Sender: news@infodev.cam.ac.uk (USENET news) Nntp-Posting-Host: ouse.cl.cam.ac.uk Organization: U of Cambridge Computer Lab, UK References: Date: Tue, 25 Jan 1994 12:13:52 GMT Lines: 45 Xref: biosci bionet.genome.chromosomes:158 bionet.general:7295 In article lamastus@sonic.dab.ge.com (Patrick Lamastus) writes: >Hi!, > >I'm sorry if this is not the proper group to post this, but >I don't know where else to ask. > >Knowing that women provides a Y chromosome (correct me if I'm wrong) * * most human females are XX, so would provide a single X chromosome * >and the male the X or the Y (correct me if I'm wrong) does the >male spermatocyte has X and Y or Only one (X or Y) before penetrates >the egg. * * again most human males are XY and therefore most sperm have a single * X or a single Y chromosome. * > >In other words does the spermatocyte has X or Y or both? >How is the sex determined? > * * Generally speaking an XX individual is female and an XY individual is male * things are a touch more complicated than this, you should ask someone who * knows rather more than I do if you are interested. * * Occasionally things do go wrong and people end up with exotic sex chromosomes * For example about 1/1000 males are XXY and a similar numer XYY. Similarly * the same proportion of women are XXX and about 1/10,000 women have Turner's * syndrome (a single X chromosome). * * I believe that the fact that X sperm and Y sperm are not identical has been * used as a method of biasing conception in favour of a sex determined by the * parents. * >Thanks in advance, > >Patrick Lamastus > >P.S. Please reply to me I don't have news so if you post your answer to the >news I will never be able to read it. > >E-MAIL: lamastus@sunny.dab.ge.com From owner-chromosomes@net.bio.net Fri Jan 28 22:00:00 1994 Path: biosci!lhc!biosci!daresbury!not-for-mail From: stephen hedman Newsgroups: bionet.genome.chromosomes Subject: Beefalo and Sturgeon Date: 28 Jan 1994 21:33:09 -0000 Lines: 25 Sender: daemon@mserv1.dl.ac.uk Distribution: bionet Message-ID: <2ic0al$qbt@mserv1.dl.ac.uk> Original-To: biochrom@net.bio.net I am embarking upon two rather interesting projects and would like to benefit from the expertise and/or experience of people in this group. I will soon be presented with some tissue samples from beefalo (also called cattalo in Canada) upon which to do some cytogenetic work. Beefalo (cattalo) are hybrids between male beef cows and female buffalo (bison). One of my intents is to follow the inheritance of both cow and buffalo chromosomes during subsequent inbreeding of the hybrids. The other project involves the freshwater sturgeon (species: fulvescens). Although I have had a fair amount of experience with fish cytogenetics, I have never worked with sturgeons. I am assuming that cell culture techniques and restriction methods appropriate for other fish species would also work with sturgeons. I will appreciate any and all comments about either of these two projects. Thanks, Steve Hedman Professor Biology and Biochemistry/Molecular Biology University of Minnesota Duluth, Minnesota 55812 email: grad@ua.d.umn.edu From owner-chromosomes@net.bio.net Fri Jan 28 22:00:00 1994 Newsgroups: bionet.genome.chromosomes Path: biosci!lhc!biosci!daresbury!doc.ic.ac.uk!pipex!zaphod.crihan.fr!jussieu.fr!univ-lyon1.fr!swidir.switch.ch!scsing.switch.ch!rzusuntk.unizh.ch!wendy From: wendy@medgen.unizh.ch (Wendy Robinson) Subject: Re: uniparental disomy Message-ID: <1994Jan28.162833.1529@rzu-news.unizh.ch> Sender: newsadm@rzu-news.unizh.ch (CNEWS ADMINISTRATION) Organization: University of Zurich, Switzerland X-Newsreader: TIN [version 1.2 PL2] References: Date: Fri, 28 Jan 1994 16:28:33 GMT Lines: 40 M. William Lensch (Lensch@chop.edu) wrote: : Does anyone have any statistics on uniparental disomy? Which chromosomes : have been noted as being involved other than chr. 15? What conditions does : this cause other than those associated w/ chr. 15? I don't have e-mail so : post here please. Thanks............ Updates concerning which chromsomes UPD has been observed for is published by the 'committee for clinical disorders, chromosome abnormalities and uniparental disomy' as part of the Human Gene Mapping Workshops that are published by Cytogenetics and Cell Genetics. Statistics: Ch15 maternal UPD occurs at a frequency of roughly 1/100,000. Ch15 paternal UPD is much less frequently (roughly 1/500,000). No statistics exist for any other chromosome. Which chromosomes: Mat UPD has been observed for chromosome 4, 7, 9,13, 14, 15, 16, 21, 22. Pat UPD has been observed for chromosomes 6,10, 14, 16, 21, X, XY. Abnormal phenotype (besides homozygosity for recessive alleles: Ch7 mat UPD -- short stature (e.g. Spotila et al. AJHG 1992 51:1396-1405). Ch14 mat and pat UPD various findings including mild mental retardation (e.g. Antonarakis AJHG 52:1145-1152). Ch15 mat UPD (Prader-Willi syndrome) pat UPD (Angelman syndrome). Ch11 UPD(pat) is associated with Wilms Tumor and Beckwith-Wiedemann syndrome. However this is segemental and seems to only exist as a post- fertilization event. (see Henry et al. Eur. J Hum Genet 1:19-29). For most other chromosomes there is either no imprinting effect, or the effect of the UPD is obscured by presence of trisomic cell lines or recessive conditions. Chromosome 15 is the only UPD for which a clearly identifiable syndrome is associated with UPD. Wendy Robinson Univ. of ZŸŸurich Dept. of Medical Genetics wendy@medgen.unizh.ch From owner-chromosomes@net.bio.net Fri Jan 28 22:00:00 1994 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!sol.ctr.columbia.edu!hamblin.math.byu.edu!news.Arizona.EDU!NewsWatcher!user From: Tmeyn@ccit.arizona.edu (Tony Meyn) Newsgroups: bionet.genome.chromosomes Subject: TAC Repeat Followup-To: bionet.genome.chromosomes Date: Mon, 24 Jan 1994 18:32:46 +1603 Organization: University of Arizona Lines: 13 Message-ID: NNTP-Posting-Host: blast.agmarley.arizona.edu I recently sequenced a fungal gene that contained the sequence: AATATTACTACTACTACTACTACTACT within a transcribed but untranslated region. A database search revealed a number of eucaryotes with this "TAC" repeat, but investigation of the papers did not reveal anything of use about this sequence. Any help leading to info. about this sequence would be appreciated. Tony Meyn University of Arizona From owner-chromosomes@net.bio.net Fri Jan 28 22:00:00 1994 Path: biosci!bcm!cs.utexas.edu!swrinde!sgiblab!munnari.oz.au!uniwa!newsman!Jim.Cummins From: cummins@possum.murdoch.edu.au (Jim Cummins) Newsgroups: bionet.genome.chromosomes,bionet.general Subject: Re: Help with determination of sex Date: 28 Jan 1994 05:53:27 GMT Organization: Murdoch University, Western Australia Lines: 61 Sender: -Not-Authenticated-[2792] Message-ID: <2ia98nINNbov@newsman.csu.murdoch.edu.au> References: <1994Jan25.121352.13149@infodev.cam.ac.uk> NNTP-Posting-Host: vetmac3.csu.murdoch.edu.au X-Posted-From: InterNews 1.0@newsman.csu.murdoch.edu.au. Xdisclaimer: No attempt was made to authenticate the sender's name. Xref: biosci bionet.genome.chromosomes:162 bionet.general:7353 Patrick Lamastus writes: >t his technique is based upon the different densities of sperm (or other cells) and uses centrifugation to seperate cell type (those w/X and those w/Y). This is termed flow cytometry. Wrong, sorry. There have been a number of attempts to separate X and Y sperm by differential centrifugation. None have been repeatable. Flow cytometry relies on separation of sperm based on fluorescence staining. This can be a specific in situ hybridisation stain (eg for a region of the Y or X chromosome) or a generalised DNA stain that gives information about the total DNA content. Theoretically X and Y sperm differ in DNA content by about 2% but as this is less than the within-gender variation you can see that there are big problems in successful sorting. The following refernces may help Auger J, Leonce S, Jouannet P, Ronot X (1993): Flow cytometric sorting of living, highly motile human spermatozoa based on evaluation of their mitochondrial activity. J Histochem Cytochem 41:1247-51. Cran DG, Johnson LA, Miller NG, Cochrane D, Polge C (1993): Production of bovine calves following separation of X- and Y-chromosome bearing sperm and in vitro fertilisation. Vet Rec 132:40-1. Dresser DW, Atkins CJ, Pinder A, Morrell JM (1993): Analyses of DNA content of living spermatozoa using flow cytometry techniques. J Reprod Fertil 98:357-365. Johnson LA, Clarke RN (1988): Flow sorting of X and Y chromosome-bearing mammalian sperm: activation and pronuclear development of sorted bull, boar and ram sperm microinjected into hamster oocytes. Gamete Res 21:335-343. Johnson LA, Welch GR, Keyvanfar K, Dorfmann A, Fugger EF, Schulman JD (1993): Gender preselection in humans? Flow cytometric separation of X and Y spermatozoa for the prevention of X-linked diseases. Human Reprod 8:1733-1739. Morrell JM (1991): Applications of flow cytometry to artificial insemination: a review. Vet Rec 129:375-8. Pasteur X, Maubon I, Sabido O, Cottier M, Laurent JL (1992): Comparison of the chromatin stainability of human spermatozoa separated by discontinuous Percoll gradient centrifugation. A flow cytometric contribution. Anal Quant Cytol Histol 14:96-104. Pasteur X, Sabido O, Maubon I, Perrin CM, Laurent JL (1991): Quantitative assessment of chromatin stability alteration in human spermatozoa induced by freezing and thawing. A flow cytometric study. Anal Quant Cytol Histol 13:383-90. Peter AT, Jones PP, Robinson JP (1993): Fractionation of bovine spermatozoa for sex selection - a rapid immunomagnetic technique to remove spermatozoa that contain the H Y antigen. Theriogenology 40:1177-1185. Seligman J, Shalgi R, Oschry Y, Kosower NS (1991): Sperm analysis by flow cytometry using the fluorescent thiol labeling agent monobromobimane. Mol Reprod Devel 29:276-281. Spano M, Evenson DP (1993): Flow cytometric analysis for reproductive biology. Biology of the Cell 78:53-62. Tao J, Du JY, Critser ES, Critser JK (1993): Assessment of the acrosomal status and viability of human spermatozoa simultaneously using flow cytometry. Human Reprod 8:1879-1885. Jim Cummins School of Veterinary Studies Murdoch University Western Australia 6150 Tel +61-9-360 2668 Fax +61-9-310 4144 "An inordinate fondness for Beetles" From owner-chromosomes@net.bio.net Fri Jan 28 22:00:00 1994 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!pipex!uknet!daresbury!not-for-mail From: Patrick Macleod 727-4461 Newsgroups: bionet.genome.chromosomes Subject: Imprinting Date: 27 Jan 1994 22:12:39 -0000 Lines: 6 Sender: daemon@mserv1.dl.ac.uk Distribution: bionet Message-ID: <2i9e8n$8s7@mserv1.dl.ac.uk> Alternate-Recipient: prohibited Hop-Count: 0 A1-Type: MAIL Importance: normal Posting-Date: Thu, 27 Jan 1994 13:57:00 -0800 (PST) Disclose-Recipients: prohibited Mr-Received: by mta MARS; Relayed; Thu, 27 Jan 1994 14:08:42 -0800 Original-To: biochrom@net.bio.net A place to start that answers many of your questions about which chromosomes are imprinted would be the American Journal of Human Genetics for January 1990 by Hall J. 46:857-873 1990. From owner-chromosomes@net.bio.net Fri Jan 28 22:00:00 1994 Path: biosci!rutgers!biosci!daresbury!doc.ic.ac.uk!pipex!howland.reston.ans.net!agate!msuinfo!netnews.upenn.edu!NewsWatcher!user From: Lensch@chop.edu (M. William Lensch) Newsgroups: bionet.genome.chromosomes Subject: uniparental disomy Message-ID: Date: 26 Jan 94 20:24:49 GMT Followup-To: bionet.genome.chromosomes Organization: U. of Penn./Neurology Lines: 4 NNTP-Posting-Host: 159.14.16.4 Does anyone have any statistics on uniparental disomy? Which chromosomes have been noted as being involved other than chr. 15? What conditions does this cause other than those associated w/ chr. 15? I don't have e-mail so post here please. Thanks............ From owner-chromosomes@net.bio.net Fri Jan 28 22:00:00 1994 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!pipex!uknet!daresbury!not-for-mail From: stephen hedman Newsgroups: bionet.genome.chromosomes Subject: Beefalo and Sturgeon Date: 28 Jan 1994 21:33:09 -0000 Lines: 25 Sender: daemon@mserv1.dl.ac.uk Distribution: bionet Message-ID: <2ic0al$qbt@mserv1.dl.ac.uk> Original-To: biochrom@net.bio.net I am embarking upon two rather interesting projects and would like to benefit from the expertise and/or experience of people in this group. I will soon be presented with some tissue samples from beefalo (also called cattalo in Canada) upon which to do some cytogenetic work. Beefalo (cattalo) are hybrids between male beef cows and female buffalo (bison). One of my intents is to follow the inheritance of both cow and buffalo chromosomes during subsequent inbreeding of the hybrids. The other project involves the freshwater sturgeon (species: fulvescens). Although I have had a fair amount of experience with fish cytogenetics, I have never worked with sturgeons. I am assuming that cell culture techniques and restriction methods appropriate for other fish species would also work with sturgeons. I will appreciate any and all comments about either of these two projects. Thanks, Steve Hedman Professor Biology and Biochemistry/Molecular Biology University of Minnesota Duluth, Minnesota 55812 email: grad@ua.d.umn.edu From owner-chromosomes@net.bio.net Fri Jan 28 22:00:00 1994 Newsgroups: bionet.genome.chromosomes Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!EU.net!uknet!pipex!zaphod.crihan.fr!jussieu.fr!univ-lyon1.fr!swidir.switch.ch!scsing.switch.ch!rzusuntk.unizh.ch!wendy From: wendy@medgen.unizh.ch (Wendy Robinson) Subject: Re: uniparental disomy Message-ID: <1994Jan28.162833.1529@rzu-news.unizh.ch> Sender: newsadm@rzu-news.unizh.ch (CNEWS ADMINISTRATION) Organization: University of Zurich, Switzerland X-Newsreader: TIN [version 1.2 PL2] References: Date: Fri, 28 Jan 1994 16:28:33 GMT Lines: 40 M. William Lensch (Lensch@chop.edu) wrote: : Does anyone have any statistics on uniparental disomy? Which chromosomes : have been noted as being involved other than chr. 15? What conditions does : this cause other than those associated w/ chr. 15? I don't have e-mail so : post here please. Thanks............ Updates concerning which chromsomes UPD has been observed for is published by the 'committee for clinical disorders, chromosome abnormalities and uniparental disomy' as part of the Human Gene Mapping Workshops that are published by Cytogenetics and Cell Genetics. Statistics: Ch15 maternal UPD occurs at a frequency of roughly 1/100,000. Ch15 paternal UPD is much less frequently (roughly 1/500,000). No statistics exist for any other chromosome. Which chromosomes: Mat UPD has been observed for chromosome 4, 7, 9,13, 14, 15, 16, 21, 22. Pat UPD has been observed for chromosomes 6,10, 14, 16, 21, X, XY. Abnormal phenotype (besides homozygosity for recessive alleles: Ch7 mat UPD -- short stature (e.g. Spotila et al. AJHG 1992 51:1396-1405). Ch14 mat and pat UPD various findings including mild mental retardation (e.g. Antonarakis AJHG 52:1145-1152). Ch15 mat UPD (Prader-Willi syndrome) pat UPD (Angelman syndrome). Ch11 UPD(pat) is associated with Wilms Tumor and Beckwith-Wiedemann syndrome. However this is segemental and seems to only exist as a post- fertilization event. (see Henry et al. Eur. J Hum Genet 1:19-29). For most other chromosomes there is either no imprinting effect, or the effect of the UPD is obscured by presence of trisomic cell lines or recessive conditions. Chromosome 15 is the only UPD for which a clearly identifiable syndrome is associated with UPD. Wendy Robinson Univ. of ZŸŸurich Dept. of Medical Genetics wendy@medgen.unizh.ch From owner-chromosomes@net.bio.net Fri Jan 28 22:00:00 1994 Path: biosci!rutgers!biosci!daresbury!bioftp.unibas.ch!rc1.vub.ac.be!ub4b!EU.net!howland.reston.ans.net!agate!msuinfo!netnews.upenn.edu!NewsWatcher!user From: Lensch@chop.edu (M. William Lensch) Newsgroups: bionet.genome.chromosomes Subject: Re: Help with determination of sex Message-ID: Date: 26 Jan 94 19:55:30 GMT References: <1994Jan25.121352.13149@infodev.cam.ac.uk> Followup-To: bionet.genome.chromosomes,bionet.general Organization: U. of Penn./Neurology Lines: 46 NNTP-Posting-Host: 159.14.16.4 In article <1994Jan25.121352.13149@infodev.cam.ac.uk>, fjmd1@cl.cam.ac.uk (Francis Davey) wrote: > > In article lamastus@sonic.dab.ge.com (Patrick Lamastus) writes: > >Hi!, > > > >I'm sorry if this is not the proper group to post this, but > >I don't know where else to ask. > > > >Knowing that women provides a Y chromosome (correct me if I'm wrong) > * > * most human females are XX, so would provide a single X chromosome > * > >and the male the X or the Y (correct me if I'm wrong) does the > >male spermatocyte has X and Y or Only one (X or Y) before penetrates > >the egg. > * > * again most human males are XY and therefore most sperm have a single > * X or a single Y chromosome. > * > > > >In other words does the spermatocyte has X or Y or both? > >How is the sex determined? > > > * > * Generally speaking an XX individual is female and an XY individual is male > * things are a touch more complicated than this, you should ask someone who > * knows rather more than I do if you are interested. > *####there is a specific gene(s) on the Y chrom. loosely refered to as the sex determination gene that I belive has not been identified though is has been assigned to a narrow window (my info. also is prob. outdated). > * Occasionally things do go wrong and people end up with exotic sex chromosomes > * For example about 1/1000 males are XXY and a similar numer XYY. Similarly > * the same proportion of women are XXX and about 1/10,000 women have Turner's > * syndrome (a single X chromosome). > *##### there are also cases where GENOTYPIC males (XY) are PHENOTYPIC females (they look female) due to things like mutation in the androgen receptor gene (androgen being a key player as far as hormomes go in maleness). This condition is known as testicular feminization. These individuals are sterile. > * I believe that the fact that X sperm and Y sperm are not identical has been > * used as a method of biasing conception in favour of a sex determined by the > * parents. > *####this technique is based upon the different densities of sperm (or other cells) and uses centrifugation to seperate cell type (those w/X and those w/Y). This is termed flow cytometry. > >Thanks in advance, > > > >Patrick Lamastus > > > >P.S. Please reply to me I don't have news so if you post your answer to the > >news I will never be able to read it. > > > >E-MAIL: lamastus@sunny.dab.ge.com From owner-chromosomes@net.bio.net Sun Jan 30 22:00:00 1994 Path: biosci!bcm!cs.utexas.edu!swrinde!sgiblab!sgigate.sgi.com!olivea!news.bu.edu!med-pharm5.bu.edu!user From: leach@mbcrr.harvard.edu (Martin Leach) Newsgroups: bionet.genome.chromosomes Subject: ### REAL TIME SCIENCE DISCUSSION ### Followup-To: bionet.genome.chromosomes Date: Mon, 31 Jan 1994 11:53:43 +0000 Organization: Boston University Dept. of Pharmacology Lines: 46 Message-ID: NNTP-Posting-Host: med-pharm5.bu.edu Dear netters, for those who haven't tried BioMOO they should. Its a real time world where scientists can communicate. to get there telnet bioinfo.weizmann.ac.il 8888 or if this doesnt work try telnet bioinfo.weizmann.ac.il 8888 /port=8888 and connect as a guest or register. I am bringing this to everyones attention as i am thinking of starting a molbiol discussion group in this world. Last Friday was held the first journal club in the seminar room on BioMOO. Up to 28 people were logged on and I hear it was a very interesting experience. The journal club is about evolutionary biology (i think). If any one is interested try telnetting to the BioMOO. Any problems then contact bmgustav@bioinformatics.weizmann.ac.il Bolo on Martin Leach -- ..... Martin Leach Email:leach@mbcrr.harvard.edu _|____ Dept. of Pharmacology Phone: (617) 638-5323 / o / Boston Univ. School of Med. Fax: (617) 638-4329 _/ |-/__==/ 80 E. Concord St. (L603) (BULLDOZER) \_ Boston MA 02118 "Not the old underpants on your USA head.....WIBBLE" -BLACKADDER From owner-chromosomes@net.bio.net Mon Jan 31 22:00:00 1994 Path: biosci!CS.Arizona.EDU!math.arizona.edu!news.Arizona.EDU!hamblin.math.byu.edu!sol.ctr.columbia.edu!howland.reston.ans.net!news.moneng.mei.com!uwm.edu!msuinfo!netnews.upenn.edu!NewsWatcher!user From: Lensch@chop.edu (M. William Lensch) Newsgroups: bionet.genome.chromosomes Subject: Re: Help with determination of sex Followup-To: bionet.genome.chromosomes,bionet.general Date: 1 Feb 1994 14:03:37 GMT Organization: U. of Penn./Neurology Lines: 68 Distribution: world Message-ID: References: <2ia98nINNbov@newsman.csu.murdoch.edu.au> NNTP-Posting-Host: 159.14.16.4 In article <2ia98nINNbov@newsman.csu.murdoch.edu.au>, cummins@possum.murdoch.edu.au (Jim Cummins) wrote: > > > Patrick Lamastus writes: > > >t his technique is based upon the different densities of sperm (or other cells) and uses centrifugation to seperate cell type (those w/X and those w/Y). This is termed flow cytometry. > > Wrong, sorry. There have been a number of attempts to separate X and Y > sperm by differential centrifugation. None have been repeatable. > > Flow cytometry relies on separation of sperm based on fluorescence > staining. This can be a specific in situ hybridisation stain (eg for a > region of the Y or X chromosome) or a generalised DNA stain that gives > information about the total DNA content. Theoretically X and Y sperm > differ in DNA content by about 2% but as this is less than the > within-gender variation you can see that there are big problems in > successful sorting. The following refernces may help > Auger J, Leonce S, Jouannet P, Ronot X (1993): Flow cytometric sorting > of living, highly motile human spermatozoa based on evaluation of their > mitochondrial activity. J Histochem Cytochem 41:1247-51. > Cran DG, Johnson LA, Miller NG, Cochrane D, Polge C (1993): Production > of bovine calves following separation of X- and Y-chromosome > bearing sperm and in vitro fertilisation. Vet Rec 132:40-1. > Dresser DW, Atkins CJ, Pinder A, Morrell JM (1993): Analyses of DNA > content of living spermatozoa using flow cytometry techniques. J Reprod > Fertil 98:357-365. > Johnson LA, Clarke RN (1988): Flow sorting of X and Y > chromosome-bearing mammalian sperm: activation and pronuclear > development of sorted bull, boar and ram sperm microinjected into > hamster oocytes. Gamete Res 21:335-343. > Johnson LA, Welch GR, Keyvanfar K, Dorfmann A, Fugger EF, Schulman JD > (1993): Gender preselection in humans? Flow cytometric separation of X > and Y spermatozoa for the prevention of X-linked diseases. Human Reprod > 8:1733-1739. > Morrell JM (1991): Applications of flow cytometry to artificial > insemination: a review. Vet Rec 129:375-8. > Pasteur X, Maubon I, Sabido O, Cottier M, Laurent JL (1992): Comparison > of the chromatin stainability of human spermatozoa separated by > discontinuous Percoll gradient centrifugation. A flow cytometric > contribution. Anal Quant Cytol Histol 14:96-104. > Pasteur X, Sabido O, Maubon I, Perrin CM, Laurent JL (1991): > Quantitative assessment of chromatin stability alteration in human > spermatozoa induced by freezing and thawing. A flow cytometric study. > Anal Quant Cytol Histol 13:383-90. > Peter AT, Jones PP, Robinson JP (1993): Fractionation of bovine > spermatozoa for sex selection - a rapid immunomagnetic technique to > remove spermatozoa that contain the H Y antigen. Theriogenology > 40:1177-1185. > Seligman J, Shalgi R, Oschry Y, Kosower NS (1991): Sperm analysis by > flow cytometry using the fluorescent thiol labeling agent > monobromobimane. Mol Reprod Devel 29:276-281. > Spano M, Evenson DP (1993): Flow cytometric analysis for reproductive > biology. Biology of the Cell 78:53-62. > Tao J, Du JY, Critser ES, Critser JK (1993): Assessment of the > acrosomal status and viability of human spermatozoa simultaneously > using flow cytometry. Human Reprod 8:1879-1885. > > > Jim Cummins > School of Veterinary Studies > Murdoch University > Western Australia 6150 Tel +61-9-360 2668 Fax +61-9-310 4144 > "An inordinate fondness for Beetles" ####Just to set the record straight, the blunder about flow cytometery and sperm was mine, and not Patrick Lamastus (sorry Patrick). -Will, U. of Penn./Neurology