From owner-chromosomes@net.bio.net Wed Feb 01 22:00:00 1995 Path: biosci!DXI.NIH.GOV!goldman%bchem.dnet From: goldman%bchem.dnet@DXI.NIH.GOV Newsgroups: bionet.genome.chromosomes Subject: Re: pcr taq pfuu Date: 1 Feb 1995 11:32:07 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 6 Sender: daemon@net.bio.net Distribution: world Message-ID: <9502011931.AA01590@dxi.nih.gov> The assumption is that taq falls off because the error it makes creates a mismatch stopping its forward movement. Once taq is of pfu comes on, repairs the damage and continues. Pfu is not highly proccessive, falls of 'by accident' and taq takes over again. ASHG From owner-chromosomes@net.bio.net Wed Feb 01 22:00:00 1995 Path: biosci!rutgers!gatech!swrinde!howland.reston.ans.net!news1.digex.net!access3.digex.net!pennie From: frog Newsgroups: bionet.genome.chromosomes Subject: Re: pcr taq pfuu Date: Thu, 2 Feb 1995 08:14:12 -0500 Organization: Express Access Online Communications, USA Lines: 23 Message-ID: References: <9502011931.AA01590@dxi.nih.gov> NNTP-Posting-Host: access3.digex.net Mime-Version: 1.0 Content-Type: TEXT/PLAIN; charset=US-ASCII In-Reply-To: <9502011931.AA01590@dxi.nih.gov> On 1 Feb 1995 goldman%bchem.dnet@DXI.NIH.GOV wrote: > The assumption is that taq falls off because the error it makes creates a > mismatch stopping its forward movement. Once taq is of pfu comes on, > repairs the damage and continues. Pfu is not highly proccessive, falls of > 'by accident' and taq takes over again. > > ASHG > > This is the explanation I expected, but what I dont understand is what's to stop taq getting back on after the mistake-dropoff occurs (remember its x100 the conc of pfu from original post) and proceding thus fixing the error. When Taq is in such excess I would expect this reaction to be favoured. After all this is what happens in everyone's PCR reactions everyday. Frog From owner-chromosomes@net.bio.net Wed Feb 01 22:00:00 1995 Path: biosci!adam.cc.sunysb.edu!news.sprintlink.net!howland.reston.ans.net!news1.digex.net!access2.digex.net!pennie From: frog Newsgroups: bionet.genome.chromosomes Subject: Re: pcr taq pfuu Date: Thu, 2 Feb 1995 13:03:22 -0500 Organization: Express Access Online Communications, USA Lines: 32 Message-ID: References: <9502011931.AA01590@dxi.nih.gov> <9502021511.AA10939@cahaba.med.unc.edu> NNTP-Posting-Host: access2.digex.net Mime-Version: 1.0 Content-Type: TEXT/PLAIN; charset=US-ASCII In-Reply-To: <9502021511.AA10939@cahaba.med.unc.edu> On Thu, 2 Feb 1995, Philip L. Carl wrote: > Presumably it does get back on and proceed some considerable fraction of > the time-that's why Taq PCR is error prone. The key here is the ratio of > exo activity to polymerase activity, and while I agree the ratio of 100:1 > is a bit surprising, it's not so surprising that I find it a mystery. > > Phil Carl I agree but there are other factors which could come into play; 1) How far does taq continue after introducing an error. Does it fall off right away or not? If it can proceed further than pfu's ability to proofread back then a significant number of errors may go undetected. 2) What is the relative affinity of taq vs pfu for a missmatched template/primer. In other words if taq is poorer (say 100 times less affinity than pfu) at settling onto a mismatched elongating template you can imagine it falling on and off without getting anywhere. Then along comes the 1 in 100 molecule of pfu with no such distaste for a mismatched base pair and off it goes. If anyone can elaborate on any of these points I'd be happy to know (eg relative Km values for correct and missmatched templates, limit of "back" proofreading of pfu, processivity of taq after error). Later......... Frog. From owner-chromosomes@net.bio.net Thu Feb 02 22:00:00 1995 Path: biosci!RNA.BIO.MQ.EDU.AU!MSLADE From: MSLADE@RNA.BIO.MQ.EDU.AU Newsgroups: bionet.genome.chromosomes Subject: Re: pcr taq pfuu Date: 2 Feb 1995 16:50:19 -0800 Organization: School of Biological Sciences Lines: 16 Sender: daemon@net.bio.net Distribution: world Message-ID: <50F1EA374C7@rna.bio.mq.edu.au> NNTP-Posting-Host: net.bio.net We had a singular lack of success getting pfu polymerase to work on its own. As with most problems we have just used the technique that works -taq. However, since trying pfu out, I have wondered whether the problem could be the level of dNTPs. Presumably a low level of dNTPs (100uM) would bias the reaction towards the nuclease activity rather than the polymerase. Any comments? or do I need to try higher amounts of dNTPs ? 1mM? Cheers, Martin Slade Martin Slade, School of Biological Sciences, Macquarie University, NSW 2109, Australia FAX (61 2) 850 8174 Phone(61 2) 850 8210 From owner-chromosomes@net.bio.net Fri Feb 03 22:00:00 1995 Path: biosci!MERCURY.UARK.EDU!DRHOADS From: DRHOADS@MERCURY.UARK.EDU ("Douglas Rhoads") Newsgroups: bionet.genome.chromosomes Subject: Re: pcr taq pfuu Date: 3 Feb 1995 06:40:22 -0800 Organization: University of Arkansas Lines: 56 Sender: daemon@net.bio.net Distribution: world Message-ID: > To: biochrom@net.bio.net > From: frog > Subject: Re: pcr taq pfuu > Date: Thu, 2 Feb 1995 13:03:22 -0500 > > > On Thu, 2 Feb 1995, Philip L. Carl wrote: > > > Presumably it does get back on and proceed some considerable fraction of > > the time-that's why Taq PCR is error prone. The key here is the ratio of > > exo activity to polymerase activity, and while I agree the ratio of 100:1 > > is a bit surprising, it's not so surprising that I find it a mystery. > > > > Phil Carl > > > I agree but there are other factors which could come into play; > > 1) How far does taq continue after introducing an error. Does it fall off > right away or not? If it can proceed further than pfu's ability to > proofread back then a significant number of errors may go undetected. > > 2) What is the relative affinity of taq vs pfu for a missmatched > template/primer. In other words if taq is poorer (say 100 times less > affinity than pfu) at settling onto a mismatched elongating template > you can imagine it falling on and off without getting anywhere. Then > along comes the 1 in 100 molecule of pfu with no such distaste for a > mismatched base pair and off it goes. > > If anyone can elaborate on any of these points I'd be happy to know > (eg relative Km values for correct and missmatched templates, limit of > "back" proofreading of pfu, processivity of taq after error). > > Later......... > > Frog. You might check out a paper by Huang, Arnheim and Goodman in Nucleic Acids Research 20(17):4567-4573. `Extension of base mispairs by Taq DNA polymerase: implications for single nucleotide discrimination in PCR. They don't compare Taq and Pfu but they do sort out some of your association/dissociation questions for Taq. Maybe that will help, maybe not. //========================================================\\ ||Doug Rhoads || Dept. of Biological Sciences|| ||drhoads@mercury.uark.edu || 601 Science Engineering || ||drhoads@uafsysb.uark.edu || University of Arkansas || ||501-575-3251 || Fayetteville, AR 72701 || ==========================================================|| || My Dogma Just Got Run Over by Someone's Karma || \\========================================================// From owner-chromosomes@net.bio.net Fri Feb 03 22:00:00 1995 Path: biosci!PHENIX.TCH.HARVARD.EDU!satler From: satler@PHENIX.TCH.HARVARD.EDU Newsgroups: bionet.genome.chromosomes Subject: human chromosome 7q markers Date: 3 Feb 1995 11:11:11 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 10 Sender: daemon@net.bio.net Distribution: world Message-ID: <199502031911.LAA15588@net.bio.net> We are interested in obtaining information about additional human chromosome markers for 7q35-q36. If you have additional information, please contact us at the e-mail address listed above. Wea re interested in a collaborative agreement. Thank you, C.A. Satler, M.D., Ph.D. From owner-chromosomes@net.bio.net Sat Feb 04 22:00:00 1995 Path: biosci!bcm!cs.utexas.edu!swrinde!pipex!sunsite.doc.ic.ac.uk!daresbury!not-for-mail From: Newsgroups: bionet.genome.chromosomes Subject: Auto seq newsgroup Date: 5 Feb 1995 19:06:59 -0000 Lines: 21 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <3h37kj$je6@mserv1.dl.ac.uk> X-Mts: smtp X-Authentication-Warning: pluto: Host localhost didn't use HELO protocol Original-To: biochrom@dl.ac.uk Dear Autosequencers , A new newsgroup has been set up for the dedicated discussion of automated DNA sequencing , encompassing both the ABI and Pharmacia ALF as well as template preperations and different chemistrys. If you would like to join please send an email to either myself or use the following instructions for automatic subscription : to subscribe email mailbase@mailbase.ac.uk with no subject and as the body of the message : subscribe automated-dna-sequencing Any title should be placed before the fistname . I look forward to speaking to you all , if there are any problems or questions please do not hesitate to email me on cain@icr.ac.uk . Sincerely , David Cain From owner-chromosomes@net.bio.net Sat Feb 04 22:00:00 1995 Path: biosci!bcm!cs.utexas.edu!swrinde!pipex!sunsite.doc.ic.ac.uk!daresbury!hgmp.mrc.ac.uk!aschafer From: aschafer@crc.ac.uk (Dr. A.J. Schafer) Newsgroups: bionet.genome.chromosomes Subject: Re: Request information on Y-linked genes Date: 5 Feb 1995 19:04:56 GMT Organization: MRC Human Genome Resource Centre Lines: 16 Message-ID: <3h37go$sba@mercury.hgmp.mrc.ac.uk> References: <3f3cpt$1ud@canopus.cc.umanitoba.ca> NNTP-Posting-Host: tin.hgmp.mrc.ac.uk Summary: Here are some places to find out about Y-linked genes Two recent articles on Y chromosome genes. Wolf et al. (1992) Molecular biology of the human Y chromosome. Rev. Physiol. Bioch. Pharmocol. 121:147-213. Schafer (1994) Genes and phenotypes of the Y chromosome. Reproductive Medicine Reviews 3:77-95. Alan Schafer Department of Genetics University of Cambridge Downing Street Cambridge CB2 3EH England From owner-chromosomes@net.bio.net Sun Feb 05 22:00:00 1995 Path: biosci!CBIL.HUMGEN.UPENN.EDU!dsearls From: dsearls@CBIL.HUMGEN.UPENN.EDU (David Searls) Newsgroups: bionet.genome.chromosomes Subject: CALL: Gene-Finding Workshop Date: 6 Feb 1995 05:24:51 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 104 Sender: daemon@net.bio.net Distribution: world Message-ID: <9502061319.AA06416@cbil.humgen.upenn.edu> NNTP-Posting-Host: net.bio.net PRELIMINARY CALL Workshop on Gene-Finding and Gene Structure Prediction October 13-14, 1995 University of Pennsylvania Philadelphia, PA SCOPE The Workshop on Gene-Finding and Gene Structure Prediction will be concerned with the increasingly important activity in computational biology of discovering protein-encoding genes in otherwise uncharacterized primary sequence data. This has traditionally been done in genomic sequence by discriminating likely coding regions based on a variety of statistical analyses and by detection of landmark sequences such as splice junctions. Recent approaches have involved combination of such evidence using rule-based and/or connectionist architectures, and have dealt in a variety of ways with the combinatorial problem of exon assembly (dynamic programming, clustering, etc.) The recent profusion of expressed-sequence data and related techniques has also raised new issues and opportunities. In this workshop we will explore topics such as compositional measures of exonic tendency (including approaches founded in statistics, information theory, and signal processing), the effects of genome heterogeneity, the role of models of biological signals and processes, dealing with incomplete and error-prone sequence data, algorithmic and probabilistic techniques, and similarity-based gene prediction. Problems of interest include detecting coding sequences and assembling gene models from large-scale genomic sequence, collections of expressed sequence fragments, and sets of putative exons from a region. Practical issues of interest include dataset and performance metric standardization, annotation of genome databases, and software interoperability. SPONSORS The workshop is part of the DIMACS Special Year on Mathematical Support for Molecular Biology, and is sponsored by DIMACS, SmithKline Beecham Pharmaceuticals, and the Penn Computational Biology Research Training Program (funded by the National Science Foundation). It will be held at the Penn Tower Hotel and Conference Center, in close proximity to the facilities of the Computational Biology and Informatics Laboratory and the Human Genome Center for Chromosome 22. PRESENTATIONS A number of invited talks are planned, and in addition short papers and posters are solicited from participants. Anyone wishing to present should plan to submit a one-page abstract giving sufficient detail to allow the work to be evaluated for relevance and originality. The Program Committee will make decisions as to which submissions are appropriate, and whether they should be presented in oral or poster form. Authors will be asked to submit papers for an informal workshop proceedings, and certain of these may then be selected by the Program Committee to appear in revised form in a volume to appear later. This will be published by the American Mathematical Society, which issues Proceedings from DIMACS workshops, based on refereed, camera-ready papers submitted within a few months after the conference. The schedule is as follows: May 1, 1995 One-page abstracts due June 15, 1995 Notification to authors September 1, 1995 Final short papers due October 13-14, 1995 Workshop Abstracts should be mailed to the address given at the bottom of this announcement. Limited travel funds will be available for presenters who would otherwise be unable to attend. They should indicate this in a cover letter, stating also whether they are a student, woman, or minority. ORGANIZING COMMITTEE David Searls, University of Pennsylvania, Chair Jim Fickett, Los Alamos National Laboratory, Co-Chair Gary Stormo, University of Colorado, Boulder, Co-Chair PROGRAM COMMITTEE Howard Bilofsky, SmithKline Beecham Pharmaceuticals Jean-Michel Claverie, National Center for Biotechnology Information, NIH Misha Gelfand, Institute of Protein Research, Russian Academy of Sciences Roderic Guigo, Institut Municipal d'Investigacio Medica, Barcelona David Haussler, University of California at Santa Cruz Stephen Mount, Columbia University Pavel Pevzner, Penn State University Bruce Roe, University of Oklahoma Victor Solovyev, Baylor College of Medicine Ed Uberbacher, Oak Ridge National Laboratory Owen White, Institute for Genome Research FURTHER INFORMATION To express interest in the Workshop and to receive further mailings directly, send e-mail to dsearls@cbil.humgen.upenn.edu, or contact David Searls Department of Genetics, CRB475 University of Pennsylvania School of Medicine 422 Curie Boulevard Philadelphia, PA 19104-6145 Voice: (215)573-3107 FAX: (215)573-3111 From owner-chromosomes@net.bio.net Sun Feb 05 22:00:00 1995 Path: biosci!agate!news.Stanford.EDU!hsdndev!news.dfci.harvard.edu!usenet From: p_morrison@dfci.harvard.edu (Paul Morrison) Newsgroups: bionet.genome.chromosomes Subject: ABI 373A DNA Sequencer data just fades away. Date: 6 Feb 1995 19:45:35 GMT Organization: Dana-Farber Cancer Institute, Harvard Med Lines: 88 Sender: -Not-Authenticated-[8954] Message-ID: <3h5u8v$gju@cisunix1.dfci.harvard.edu> NNTP-Posting-Host: mbcf800.dfci.harvard.edu X-Posted-From: InterNews 1.0.5@mbcf800.dfci.harvard.edu Xdisclaimer: No attempt was made to authenticate the sender's name. Here is a problem that is starting to really bug me. It has been occurring intermittently since Oct94 at an increasing rate. Just as soon as we think we have figured out the problem. Whap, it's back. So a brief description of the problem. "Core Facility" (different sample preps) templates sequenced double stranded, Taq polymerase, cycle sequencing, DYE labeled terminators. On occasion we will get a gel that has _something_ wrong with it. We now call them "fast-fade" gels. On these fast-fade gels many lanes of data will look good but then abruptly (within 20 nucs) fade to practically nothing. These problem lanes will usually (but not all) come in groups on the left or right hand side of the gel. This problem has occurred in various places. After 50 to after 400 nucs of good data. We have contemplated just about every reason and not one of them holds up. Because it happens infrequently and we are sequencing Core Facility DNA from various sources this has been very hard to track down. What the problem looks like on the: Analysis file. Peaks are great and then abruptly drop and get the "shakes". There is usually trailing _in front_ of the peak that happens as the peaks spread out and quickly change to shaky waves of color. Raw Data file. Peaks are great and then fade to nothing. Gel file. Peaks are great and then get blurry. It looks as if the same amount of color is there but the resolution has gone to pot. Reasons why we have ruled out: secondary structure: the problem has occurred sequencing the ABI standard which shows no secondary structure problem. Also templates will be rerun the next day, same conditions and the problem disappears. Template prep, primer prep: templates from different sources fail and as above work fine the next day. The Gel: We have replaced all reagents many times. No correlation. 2 gels made at the same time by the same person loaded on different 373's. One fast-fades, one is fine. (This happened last night after we thought we got it). The sharkstooth comb: We prep this the same way. No loose acrylamide, no problems. Sample buffer, the formamide, the blue juice: Replaced, brand new, deionized. Still happens. The centrisep columns: Same lot, same technique used, one good gel, one bad gel. The Taq enzyme, the terminator dyes: The same lot, the same tube, one good gel, one bad gel. The 373: We have 2 373's. Old373 got a stretch upgrade in Apr94. New373 was delivered as stretch Sep94. The problem has occurred on both. While it is true that the problem has only occurred on a stretch machine, we ran stretch gels from April to October with no problems. The problem has occurred only once on the new 373 and has occurred 8-10 times on the old but I feel this could easily be _not_ significant because the old one is used more frequently. Data collection: The drop off does not occur at exactly the same spot (scan line) in the gel file. It will happen in _around_ the same spot but will have enough variation that rules out data collection problems. Final thoughts: Because it doesn't happen often it has been very difficult trying to pin this down. It may have multiple reasons and they all have to be _below_ tolerances in order for it to show up. If this is the case then it may be a reagent or column spec. that has changed since October 94. Has any other lab seen this problem? Anything close to this problem? Thanks for any help or suggestions. -Paul Paul Morrison Dana1030 Molecular Biology Core Facilities Dana Farber Cancer Institute 44 Binney Street Boston, MA 02115 p_morrison@dfci.harvard.edu From owner-chromosomes@net.bio.net Sun Feb 05 22:00:00 1995 Path: biosci!DXI.NIH.GOV!goldman%bchem.dnet From: goldman%bchem.dnet@DXI.NIH.GOV Newsgroups: bionet.genome.chromosomes Subject: Re: pcr taq pfuu Date: 6 Feb 1995 13:39:43 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 1 Sender: daemon@net.bio.net Distribution: world Message-ID: <9502062138.AA19944@dxi.nih.gov> NNTP-Posting-Host: net.bio.net Taq doesnot have 5'-3' nuclease. If it make a mistake, falls off and come back on it can't do anything. Not until pfu makes a hit and etc etc etc. From owner-chromosomes@net.bio.net Thu Feb 09 22:00:00 1995 Newsgroups: bionet.genome.chromosomes Path: biosci!rutgers!gatech!newsfeed.pitt.edu!dsinc!netnews.upenn.edu!msunews!harbinger.cc.monash.edu.au!news.cs.su.oz.au!metro!news From: Alberto Catalano Subject: GENESCAN and 373A Seq Analysis on Mac LC 630 Message-ID: Sender: news@ucc.su.OZ.AU Nntp-Posting-Host: morgan.angis.su.oz.au Organization: Information Services, Sydney University, Sydney, NSW, Australia Date: Fri, 10 Feb 1995 02:08:00 GMT Lines: 30 Hi, To all users of Genescan 672 (version 2.1.0 and 2.1.1-2) and 373A Sequqnce Analysis (vers 1.2.0). We are having problems with the software when running it on a Macintosh LC 630. The gel images on the gel files are corrupted so that they look skewed. The raster images are skewed as if extra pixels are added to each scan line. The problem is specific to the LC 630 and not to other macs in our lab such as the IIci and the LC III. The files themselves are uncorrupted because when transferred back to the other macs they work fine. Has anyone else had similar problems on other types of macs? I've heard that Powermacs are a problem. I'd be interested in hearing of similar promblems other people are having with any macs. Thanks. Alberto Catalano Kanematsu Labs, RPA Hospital Sydney, Australia ph:61-2- 516 7453 fax:61-2- 516 6255 email: kanemats@morgan.angis.su.oz.au From owner-chromosomes@net.bio.net Thu Feb 09 22:00:00 1995 Path: biosci!biosci!not-for-mail From: ert@karlo.wi.mit.edu (Ert Dredge) Newsgroups: bionet.announce,bionet.genome.chromosomes Subject: Release 9 of the Whitehead Institute genetic map of the mouse Date: 9 Feb 1995 22:21:53 -0800 Organization: Massachvsetts Institvte of Technology Lines: 70 Sender: biohelp@net.bio.net Approved: bionews-moderator@net.bio.net Distribution: world Message-ID: NNTP-Posting-Host: net.bio.net Xref: biosci bionet.announce:1799 bionet.genome.chromosomes:445 ANNOUNCING THE NINTH RELEASE OF THE WHITEHEAD INSTITUTE/MIT GENOME CENTER GENETIC MAP OF THE MOUSE Release nine of the Whitehead Institute/MIT Genome Center Genetic Map of the Mouse is now available. This map consists of randomly-chosen simple sequence length polymorphisms (microsatellites) that can be analyzed using the polymerase chain reaction, as described in Dietrich, W., et. al., Genetics 131:423-447 (1992), and most recently in Dietrich, W.F. et al., Nature Genetics 7:220-245 (1994) Currently the released map contains 5752 markers. The markers fall into 20 linkage groups spanning approximately 1400 cM with an average spacing of approximately 0.25 cM. This data can be obtained in three different ways: 1. (Preferred method) Via a "World-Wide Web" browser. Point your WWW client (e.g., NCSA Mosaic, Netscape) at "http://www-genome.wi.mit.edu/". 2. Via internet e-mail using a database e-mail server. Using this service you can obtain locus and assay names of mapped SSLPs, the forward and reverse primer sequences, the genotypes of the loci on the mapping cross, the sizes of the PCR products on selected standard inbred strains, and other useful information. The database can be queried for markers meeting a number of different criteria. For example, you can ask for markers by name, by chromosome, or by position on the map. You can even request a list of markers that are polymorphic between two mouse strains. 3. Via anonymous ftp to genome.wi.mit.edu. Log in as "anonymous" and use your e-mail address as password. The release can be found in the directory /distribution/mouse_sslp_release/jan95/. The file "README" describes the file formats and gives other information about the map. To obtain copies of the most current e-mail query forms, send a message to "genome_database@genome.wi.mit.edu" with either a subject line or body text of "help". You will receive instructions and a query form by return mail. Just fill out the form, send it to "genome_database@genome.wi.mit.edu", and the answer to your query will be mailed back automatically. This project is an ongoing one. As new markers are added to the map they will be released on a quarterly basis. These data releases do not constitute scientific publication of CGR's work, but rather provides scientists with a regular look into our lab notebooks. For projects aimed at the analysis of particular genes or subchromosomal regions, the Whitehead/MIT CGR grants permission to use our data without the need for a formal collaboration, subject only to appropriate acknowledgment. For projects aimed at large-scale mapping of entire chromosomes or entire genomes, use of the data and markers should be on a collaborative basis. Please see the aforementioned README file or contact CGR directly. - Ert Dredge ------------------------------------------------------------------------------- Ert Dredge Mondays 8:30pm - 10:30pm Whitehead Institute's Center for Genome Research WMBR 88.1 FM, Cambridge One Kendall Sq, Cambridge, Bldg 300, 5th floor, 02139 Requests: 253-8810 617-252-1922 (w), 617-252-1902 (fax) Beauty Canadian tunes, eh? ------------------------------------------------------------------------------- -- ------------------------------------------------------------------------------- Ert Dredge | Mondays 8:30pm - 10:30pm Whitehead Institute's Center for Genome Research | WMBR 88.1 FM, Cambridge, MA "Love will keep us together, | Requests: 253-8810 love will drive us insane" -- Talking Heads | Beauty Canadian tunes, eh? ------------------------------------------------------------------------------- From owner-chromosomes@net.bio.net Thu Feb 09 22:00:00 1995 Path: biosci!internet!biosci!not-for-mail From: biohelp (BIOSCI Administrator) Newsgroups: bionet.genome.chromosomes Subject: UNSUBSCRIBING, BIOSCI ARCHIVES, ADDRESS DATABASE & BIOSCI FAQ Date: 10 Feb 1995 02:00:40 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 338 Sender: daemon@net.bio.net Distribution: world Message-ID: <199502101000.CAA25533@net.bio.net> NNTP-Posting-Host: net.bio.net Four important items follow: How to cancel e-mail subscriptions to BIOSCI newsgroups, BIOSCI archive searching, the BIOSCI FAQ, and the BIOSCI User Address Directory form. If you have not yet listed yourself in our BIOSCI user directory, please take a few minutes to complete and return the form below. If your personal information has changed since you listed yourself, please send us a complete new updated form. We can not make manual revisions to existing entries. Sincerely, Dave Kristofferson BIOSCI/bionet Manager biosci-help@net.bio.net **** How to cancel a BIOSCI e-mail subscription **** If you want to cancel your e-mail subscription to this group, PLEASE DO NOT POST YOUR UNSUBSCRIBE REQUEST TO THE NEWSGROUP ADDRESS (NOR REPLY TO A MESSAGE POSTED TO THE NEWSGROUP)!!! This would send your request to all of the readers of the newsgroup, but it might still not be seen by the BIOSCI staff - thus you would annoy many people and possibly not accomplish your goal anyway. IF YOU ARE LOCATED IN THE AMERICAS OR PACIFIC RIM COUNTRIES, please send a message to biosci@net.bio.net Instructions on how to subscribe/unsubscribe will be returned automatically, so the contents of your message do not matter. IF YOU ARE LOCATED IN EUROPE, AFRICA OR CENTRAL ASIA, please send a message to MXT@dl.ac.uk containing the word help in the body of the message to retrieve e-mail server instructions. Any text placed on the Subject: line of your message will be ignored, so be sure to put the "help" command in the body of the message. If you need personal assistance, a BIOSCI staff member can be contacted at either of the following addresses. Please contact the address designated for your location. Support Address Location --------------- -------- biosci@daresbury.ac.uk Europe, Africa, and Central Asia biosci-help@net.bio.net Americas and the Pacific Rim **** SEARCHING BIOSCI ARCHIVES **** The easiest way to search the BIOSCI archives is to use gopher software and connect over the Internet to net.bio.net, the U.S. BIOSCI computer. We maintain three indexes which are searchable from the main gopher menu on net.bio.net: (1) an index of all BIOSCI postings; (2) an index of individual journal article references from the Table of Contents postings on the BIO-JOURNALS newsgroup; and (3) an index of BIOSCI users including regular mail and e-mail addresses, phone/FAX numbers, research interests, and newsgroup participation. E-mail users can search the BIOSCI archives by using our waismail e-mail server. For instructions send the message help to waismail@net.bio.net. Leave the Subject: line blank (anything entered on the Subject: line is ignored). WAIS software can also be used to search the archives as described in the BIOSCI FAQ (see below). Finally, the BIOSCI archive files are accessible by anonymous FTP to net.bio.net [134.172.2.69] in the directory pub/BIOSCI. **** BIOSCI FREQUENTLY ASKED QUESTIONS (FAQ) SHEET **** New users of BIOSCI/bionet may want to read the "Frequently Asked Questions" or "FAQ" sheet for BIOSCI. The FAQ provides details on how to participate in these forums and is available for anonymous FTP from net.bio.net [134.172.2.69] in pub/BIOSCI/doc/biosci.FAQ or for retrieval by gopher to net.bio.net, port 70. It may also be requested by sending the command info faq in the body of an e-mail message to the Internet address biosci-server@net.bio.net. Please do not enter the info faq command on the Subject: line of your message since the e-mail server ignores text on the Subject: line. The FAQ is also posted on the first of each month to the newsgroup BIONEWS/bionet.announce immediately following the posting of the BIOSCI information sheet. **** BIOSCI USER ADDRESS DIRECTORY **** Please take this opportunity to add your name and address information to the BIOSCI User Address Database if you have not already done so. Below is the address form that we would like each reader of the BIOSCI/bionet newsgroups to complete and return if you would like to be listed in our database. The database serves as a directory that enables biologists, who are currently using (or even just reading) the BIOSCI newsgroups, to look up e-mail addresses and other information about our users. The address database is reindexed nightly for WAIS, waismail, and gopher access. If you have access to gopher, connect to net.bio.net to search the database. If you have access to WAIS, please use our WAIS source biologists-addresses.src. If you are not on the Internet, please use our waismail server (send the word "help" to waismail@net.bio.net to get instructions; any text on the Subject: line of your message will be ignored, so put the help command in the body of the mail message.). Please carefully follow the instructions for completing the form below and return it to either of the following two addresses (whichever is more convenient for you). Thanks in advance for taking the time to complete and return the form. Addresses for returning forms Location Network ----------------------------- -------- ------- biovote@net.bio.net U.S.A. Internet/BITNET biovote@daresbury.ac.uk U.K. JANET MAKING SURE THAT YOUR INFORMATION IS CURRENT This notice will be mailed bimonthly to each newsgroup. You should check your database entry from time-to-time to see if your address information is still up-to-date. Using Gopher to complete the form --------------------------------- If you don't want to use a text editor, you can also use Dan Jacobson's gopher site to fill out the address database form as follows. Otherwise skip this section on gopher and proceed to the instructions for filling out the form below. > To add yourself to the database just point your > gopher client at merlot.gdb.org and select the following: > > --> 14. Searching For Biologists/ > > --> 9. E-mail Addresses of Biosci-Bionet Users/ > > --> 1. Add (or Correct) Your Address to the BIOSCI User Address > Data.. > > > And fill out the form. or Rob Harper's gopher site in Europe as follows: > Europeans can point their gopher client at gopher.csc.fi and add their > information to the database. All entries will be mailed directly to > Dave for incorporation in a wais source. > > The path to the questionare is as follows. > > > 6. Information in English/ > > 5. Scientific and other topics/ > > 1. Finnish EMBnet BioBox/ > > 9. FAQ Files/ > > 5. Bionauts Address Database (questionaire) > IMPORTANT INSTRUCTIONS - PLEASE READ CAREFULLY Please enter all responses after the : on each line, leaving one (1) blank space after the : (i.e., before the start of your text). Please do NOT extend your responses past the end of each line (80 characters). PLEASE DO NOT alter any of the field identifiers such as "first name: ". If you have nothing to enter after a field identifier, PLEASE LEAVE IT - do not delete it even if there is no data on the line in question. Several lines are provided at the end of the form for comments, but, please adhere to the line length restriction. On the date: line, please enter the date in the DD-MM-YY format, e.g., 15-05-93 for 15 May 1993. This line will tell others when the information was last updated. Please be sure to include the 0's for single digit days or months, e.g., 15-05-93, not 15-5-93. Note that the "e-mail network: " line below is for specifying, e.g., "Internet," "BITNET," "EARN," "JANET," or whatever other network that your computer may be on. If you are uncertain about any field, please feel free to leave it blank, but please DO NOT DELETE the field identifier from the form! In the first field below, "New information or Update ...", please enter "N" if this is the first time that you have registered in the directory or "U" if you are correcting a listing that you sent to us previously. The comment: lines may be used for anything that you like but PLEASE DO NOT DELETE THEM FROM THE FORM OR ALTER THEM. One suggested use is to list the names of the newsgroups in which you participate. Please use the MAILING LIST name (see below - the latest version of the list can be requested from biosci@net.bio.net) instead of the USENET name even if you don't participate by e-mail. WAIS might get confused by the periods in the USENET names. This allows one to retrieve via WAIS or waismail the list of participants in a particular group. For example: comment: ARABIDOPSIS PLANT-BIOLOGY BIONEWS On the comment: lines use these names below ---- NOT the USENET names below MAILING LIST NAME USENET Newsgroup Name ----------------- --------------------- ACEDB-SOFT bionet.software.acedb AGEING bionet.molbio.ageing AGROFORESTRY bionet.agroforestry ARABIDOPSIS bionet.genome.arabidopsis ASCB bionet.prof-society.ascb BIOCAN bionet.prof-society.cfbs BIOFORUM bionet.general BIO-INFORMATION-THEORY bionet.info-theory BIONAUTS bionet.users.addresses BIONEWS bionet.announce BIO-JOURNALS bionet.journals.contents BIO-MATRIX bionet.molbio.bio-matrix BIOPHYSICAL-SOCIETY bionet.prof-society.biophysics BIOPHYSICS bionet.biophysics BIO-SOFTWARE bionet.software BIOTHERMOKINETICS bionet.metabolic-reg BIO-WWW bionet.software.www CARDIOVASCULAR-RESEARCH bionet.biology.cardiovascular CELEGANS bionet.celegans CELL-BIOLOGY bionet.cellbiol CHLAMYDOMONAS bionet.chlamydomonas CHROMOSOMES bionet.genome.chromosomes COMPUTATIONAL-BIOLOGY bionet.biology.computational CSM bionet.prof-society.csm CYTONET bionet.cellbiol.cytonet DROSOPHILA bionet.drosophila EMBL-DATABANK bionet.molbio.embldatabank EMF-BIO bionet.emf-bio EMPLOYMENT bionet.jobs EMPLOYMENT-WANTED bionet.jobs.wanted FASEB bionet.prof-society.faseb GDB bionet.molbio.gdb GENBANK-BB bionet.molbio.genbank GENETIC-LINKAGE bionet.molbio.gene-linkage GRASSES-SCIENCE bionet.biology.grasses HIV-MOLECULAR-BIOLOGY bionet.molbio.hiv HUMAN-GENOME-PROGRAM bionet.molbio.genome-program IMMUNOLOGY bionet.immunology INFO-GCG bionet.software.gcg JOURNAL-NOTES bionet.journals.note METHODS-AND-REAGENTS bionet.molbio.methds-reagnts MICROBIOLOGY bionet.microbiology MOLECULAR-EVOLUTION bionet.molbio.evolution MOLECULAR-MODELLING bionet.molec-model MOLLUSC-MOLECULAR-NEWS bionet.molbio.molluscs MYCOLOGY bionet.mycology NEUROSCIENCE bionet.neuroscience N2-FIXATION bionet.biology.n2-fixation PARASITOLOGY bionet.parasitology PHOTOSYNTHESIS bionet.photosynthesis PLANT-BIOLOGY bionet.plants POPULATION-BIOLOGY bionet.population-bio PROTEIN-ANALYSIS bionet.molbio.proteins PROTEIN-CRYSTALLOGRAPHY bionet.xtallography PROTISTA bionet.protista RAPD bionet.molbio.rapd SCIENCE-RESOURCES bionet.sci-resources STADEN bionet.software.staden STRUCTURAL-NMR bionet.structural-nmr TROPICAL-BIOLOGY bionet.biology.tropical URODELES bionet.organisms.urodeles VIROLOGY bionet.virology WOMEN-IN-BIOLOGY bionet.women-in-bio YEAST bionet.molbio.yeast ZBRAFISH bionet.organisms.zebrafish Listing newsgroups on the comment: line is optional, of course. Thanks again for your cooperation! --------------- please cut here and return portion below --------------- New information or Update to old record (enter N or U): date (DD-MM-YY): first name: middle initial: family name: job title: e-mail address: e-mail network: phone number: FAX number: institution: address1: address2: address3: city: state/province: country: postal code: research interest: research interest: comment: comment: comment: comment: comment: From owner-chromosomes@net.bio.net Thu Feb 09 22:00:00 1995 Path: biosci!WATSON.WUSTL.EDU!rwilson From: rwilson@WATSON.WUSTL.EDU (Rick Wilson) Newsgroups: bionet.genome.chromosomes Subject: Re: GENESCAN and 373A Seq Analysis on Mac LC 630 Date: 10 Feb 1995 04:41:54 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 33 Sender: daemon@net.bio.net Distribution: world Message-ID: <9502101240.AA06047@watson.wustl.edu> NNTP-Posting-Host: net.bio.net (original posting to: biochrom@net.bio.net) Alberto Catalano writes: >We are having problems with the software when running it on a Macintosh >LC 630. The gel images on the gel files are corrupted so that they look >skewed. The raster images are skewed as if extra pixels are added to >each scan line. > >The problem is specific to the LC 630 and not to other macs in our lab >such as the IIci and the LC III. > >The files themselves are uncorrupted because when transferred back to >the other macs they work fine. > >Has anyone else had similar problems on other types of macs? I've heard >that Powermacs are a problem. Yep. We've seen the same thing with Quadra 630s and Power Macs. According to Kevin Corcoran at ABI, this is specific to the video config. of these computers. Maybe Kevin can post a more detailed explanation. (How about it, Kevin?) Rick **************************************** Richard K. Wilson, Ph.D. Genome Sequencing Center Washington University School of Medicine St. Louis, MO 63108 USA (314) 286-1804 rick@geneman.wustl.edu **************************************** From owner-chromosomes@net.bio.net Fri Feb 10 22:00:00 1995 Path: biosci!rutgers!gatech!swrinde!howland.reston.ans.net!news2.near.net!delphi.bc.edu!bg33.bc.edu!riverar From: riverar@bcvms.bc.edu (Raymond Rivera) Newsgroups: bionet.genome.chromosomes Subject: Translocation and Corpus Callosum Date: Fri, 10 Feb 1995 19:51:40 EDT Organization: Boston College Lines: 9 Message-ID: NNTP-Posting-Host: bg33.bc.edu X-Newsreader: Trumpet for Windows [Version 1.0 Rev B final beta #4] Does anyone know of any case of apparent balanced translocation between 5 and 19 combined with partial absence of corpus callosum? Looking for developmental responses and general growth patterns. . Raymond Rivera, Boston College, Chestnut Hill, MA 02703 e-mail:riverar@bcvmcms.bc.edu From owner-chromosomes@net.bio.net Sat Feb 11 22:00:00 1995 Path: biosci!newshost.lanl.gov!news.ttu.edu!aurora.LaTech.edu!darwin.sura.net!maze.dpo.uab.edu!usenet From: Mpsy0l3@uabdpo.dpo.uab.edu (Flammable) Newsgroups: bionet.genome.chromosomes Subject: What is the Genome project? Date: 11 Feb 1995 23:37:06 GMT Organization: Friedman Graphix Lines: 4 Message-ID: <3hjhn2$eae@maze.dpo.uab.edu> NNTP-Posting-Host: tty17.maze.ppp.uab.edu X-Newsreader: WinVN 0.92.6+ Please send me some E-Mail to Mpsy013@uabdpo.dpo.uab.edu and in it please tell me what the Genome project is about, what it entails, who's involved, or any other information you have availible. ANYTHING you can give me would be incredibly apperciated. Thank you. From owner-chromosomes@net.bio.net Sun Feb 12 22:00:00 1995 Path: biosci!SERVIDOR.DGSCA.UNAM.MX!poggio From: poggio@SERVIDOR.DGSCA.UNAM.MX (sebastian poggio) Newsgroups: bionet.genome.chromosomes Subject: telomerase Date: 13 Feb 1995 12:08:39 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 6 Sender: daemon@net.bio.net Distribution: world Message-ID: <9502132010.AA28820@servidor> NNTP-Posting-Host: net.bio.net Hi I am no sure if this is the right discution group to make this question sorry if not. I am doing some reserch on telomerase an after reading a few articles I have a question that may be irrelevant or due to my bad memory but in any way here it goes: I remember that the okazaki fragments have a special sequence that is not the sequence of telomeres, but in any model where telomerase acts an okazaki fragment has to be done, so how the primasa manages to produce the frament? From owner-chromosomes@net.bio.net Mon Feb 13 22:00:00 1995 Path: biosci!bloom-beacon.mit.edu!eru.mt.luth.se!news.luth.se!sunic!news.kth.se!nac.no!nntp.uio.no!pcdnr83.uio.no!user From: ehovig@radium.uio.no (Eivind Hovig) Newsgroups: bionet.genome.chromosomes Subject: Chromosome 1 cosmids? Date: Tue, 14 Feb 1995 23:31:45 +0100 Organization: Inst for Cancer Research, Oslo Lines: 13 Message-ID: NNTP-Posting-Host: pcdnr83.uio.no I am on the lookout for chromosome 1q21-q23 cosmids. And I am not aware of anybody having such beasts, although a number of people or organizations must have. All suggestions are appreciated... Sincerely Eivind -- Eivind Hovig PhD email= ehovig@radium.uio.no Dept. of Tumor Biology S=EHOVIG; OU=radium; O=uio; ADMD= ; PRMD=no Inst. for Cancer Res. Phone:-47-22935416 The Norwegian Radium Hosp. Fax: -47-22522421 0310 Oslo, Norway From owner-chromosomes@net.bio.net Mon Feb 13 22:00:00 1995 Path: biosci!rutgers!uwm.edu!news.moneng.mei.com!howland.reston.ans.net!news.sprintlink.net!uunet!in1.uu.net!news.iij.ad.jp!wincgw1!creamy!icspub!odins-suita!oskgate0.mei!wnoc-kyo-news!hakozaki.karrn!kyu-cs!NewsWatcher-J!user From: umenotcm@mbox.nc.kyushu-u.ac.jp (Daisuke Umeno) Newsgroups: bionet.genome.chromosomes Subject: Help Please!! about Histon Octamer Message-ID: Date: 14 Feb 95 17:11:02 GMT Organization: Takagi Lab. Chem. Sci. & Tech. Kyushu Univ. Lines: 25 NNTP-Posting-Host: 133.5.150.51 Mime-Version: 1.0 Content-Type: text/plain; charset=iso-2022-jp Hello, netters. I'm graduate student in dept. chemistry and I'm really in trouble. I made up my mind to post here because you, experts in this field can help us. I have studied chemistry, so I have no carrier and few understanding ( except general understanding from textbook in biology / biochemistry.) But in my study, I've been use DNA as target of chemical modification. Of course this study has no relation with life science (at least for now). But nowadays, I want to use histon octamer ( from chicken blood which is said that it have exact positioning site on certain DNA fragment ) in the process of modification we are developing. But we don't know about (1) How and where to get this; Can I buy it from somewhere? Or do I have to ask to some professional biologist (or Biochemist) ? (2) How much is it; is it expensive ? (3) How to handle it; Is it too difficult for us chemist to deal it, or relatively easy to handle like restriction enzymes which we purchase ? Can I learn ? ( I have prenty of time ) (4) And another info. about histon octamer / nucleosome positioning I would be greatful if someone who know very well about this subject are kind enough to give me some suggestion & coment. Any information would be helpful foe me. Thanks in advance. -- Daisuke Umeno (umenotcm@mbox.nc.kyushu-u.ac.jp) Takagi Lab. Chem. Sci. & Tech. Kyushu Univ. Japan From owner-chromosomes@net.bio.net Mon Feb 13 22:00:00 1995 Path: biosci!rutgers!uwm.edu!spool.mu.edu!torn!nott!ehd.hwc.ca!usenet From: "D.A. McLeod" Newsgroups: bionet.virology,bionet.genome.chromosomes,bionet.microbiology,bionet.immunology,bionet.general Subject: Biomarkers Date: Tue, 14 Feb 1995 11:41:28 -0500 (EST) Organization: Health Canada Lines: 15 Message-ID: NNTP-Posting-Host: hpb.hwc.ca Mime-Version: 1.0 Content-Type: TEXT/PLAIN; charset=US-ASCII Xref: biosci bionet.virology:1593 bionet.genome.chromosomes:452 bionet.microbiology:1415 bionet.immunology:3148 bionet.general:13544 I'm brainstorming for ideas. In the future, I anticipate making recommendations re: measuring biomarkers in blood samples from a large cross section of the normal population. I will have a sample(s) of blood and will be able to use whole blood, plasma, serum as well as DNA extracted from the lymphocytes and a bank of immortalized lymphocytes stored in liquid nitrogen as a biorepository. The focus of the study must be on disease or risk factors that impact on the health of the population. A reasonable argument to justify each idea would be appreciated and a reference if possible. Thanx Dan McLeod e-mail dmcleod@hpb.hwc.ca From owner-chromosomes@net.bio.net Mon Feb 13 22:00:00 1995 Path: biosci!rutgers!gatech!howland.reston.ans.net!Germany.EU.net!ieunet!maths.tcd.ie!not-for-mail From: jmccorm@maths.tcd.ie (James Mc Cormack) Newsgroups: bionet.genome.chromosomes Subject: Imprinting Date: 14 Feb 1995 14:05:42 -0000 Organization: Dept. of Maths, Trinity College, Dublin, Ireland. Lines: 3 Message-ID: <3hqdbm$qch@salmon.maths.tcd.ie> NNTP-Posting-Host: salmon.maths.tcd.ie Keywords: position effect variegation in Huntingtons disease Could any-one explain Laird's model which sees position effect variegation as the cause of earlier age of onset of Huntington's disease when inherited paternally especially how the sex-linked modifier genes of the parent affect the expression in the off-spring. Any information that would shed some light on this for me would be appreciated. From owner-chromosomes@net.bio.net Tue Feb 14 22:00:00 1995 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!swrinde!pipex!uknet!comlab.ox.ac.uk!oxuniv!ayoung From: ayoung@vax.oxford.ac.uk (Geordie +1865 740 011) Newsgroups: bionet.genome.chromosomes Subject: course in multifactorial diseases Message-ID: <1995Feb15.142713.28973@oxvaxd> Date: 15 Feb 95 14:27:13 GMT Organization: Oxford University VAX 6620 Lines: 105 WELLCOME SUMMER SCHOOLS FOURTEENTH ADVANCED COURSE 16th - 21st July 1995 The Wellcome Trust Centre for Human Genetics, University of Oxford Windmill Road, Headington, Oxford, OX3 7BN All email inquiries to: wss@umds.ac.uk. HUMAN GENOME ANALYSIS: GENETIC ANALYSIS OF MULTIFACTORIAL DISEASES An intensive computer-based course aimed at scientists actively involved in genetic analysis of multifactorial traits. The following topics will be covered: Programme 1. Gel analysis Operation of GENESCAN software for defining tracks and checking size standards on the ABI fluorescent 373A DNA sequencer. Including sample sheet set up, installation of matrix files, analysis and pre-process parameters. 2. Genotyping Scoring of microsatellite results using GENOTYPER and GAS software, including setting up of macros files, export of data, allele binning and format conversions. 3. Linkage Introduction to basic concepts of linkage analysis, in particular, those related to non-Mendelian diseases. 4. Sibpair Analysis Comparison of identity-by-descent, identity-by-state and maximum likelihood methods of affected sib-pair analysis. Analysis of quantitative traits. 5. Lodscore analysis Use of LINKAGE program to calculate likelihoods for general pedigrees, including construction of locus linkage maps, error checking and analysis of marker locus linked to disease. 6. Affected Relative Methods General non-parametric tests aimed at detecting linkage by examining correlation between the affected members of a pedigree. 7. Associated Tests Use of tests for linkage disequilibrium between markers and disease, construction and analysis of haplotypes. Teaching will take the form of lectures by invited speakers, informal tutorials, hands-on computer sessions and analysis of disease family data sets. There will also be an opportunity to analyse and discuss participants' own data sets. Course Instructors SUMIT BHATTICHARYYA, HEATHER CORDELL, JUNE DAVIES, SIW DANIELS, TONY MERRIMAN, LYNN PRITCHARD, PETER REED, JOHN TODD, JOE TERWILLIGER, MARGARET TOWN, DAN WEEKS, ALAN YOUNG. Confirmed speakers include: MIKE BOEHNKE (Ann Arbor), ARAVINDA CHAKRAVARTI (Case Western), DOUG EASTON (Sutton), MARTIN FARRALL (Oxford), MARK LATHROP (Oxford), MARGARET PERICAK-VANCE (Duke). Participants Applicants should be scientists at an advanced level of research (post-doctoral or equivalent). Documentation verifying that the applicant is actively engaged in a linkage or family-based association study (animal/human) must be provided with the application, as well as evidence of access to a fluorescence-based automated genotyping system. The course is subsidised by the Wellcome Trust for scientists based in academic institutions anywhere in the world. This is a residential course, without exception, and there is a charge of 350 pounds Sterling towards board and lodging. Applications There are no formal application forms, but applicants should send a hard copy of their full CV together with a 300 word outline of their research plans and supporting documentation, to Dr Pelin Faik, Course Co-ordinator, Division of Biochemistry & Molecular Biology, UMDS, Guy's Campus, London Bridge SE1 9RT. Tel: 0171 403 6998 Fax: 0171 407 5281 Email: wss@umds.ac.uk. Closing date for applications is 14th April 1995 -- ------------------------------------------------------------------------------- ___ / \ / | / Alan Young @ uk.ac.ox.vax /____/ / ___ __ |___/ / / / / | / | / "The bigger they are, / \_/\__\__/|_/ /_________/ the harder they fall on you." From owner-chromosomes@net.bio.net Tue Feb 14 22:00:00 1995 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!swrinde!pipex!uknet!comlab.ox.ac.uk!oxuniv!ayoung From: ayoung@vax.oxford.ac.uk (Geordie +1865 740 011) Newsgroups: bionet.genome.chromosomes Subject: Wellcome Summer School in YACs Message-ID: <1995Feb15.144155.28979@oxvaxd> Date: 15 Feb 95 14:41:55 GMT Organization: Oxford University VAX 6620 Lines: 114 WELLCOME SUMMER SCHOOLS : FIFTHTEENTH ADVANCED COURSE HUMAN GENOME ANALYSIS : FROM YAC TO GENE 27th July - 4th August 1995 Division of Biochemistry & Molecular Biology, United Medical and Dental Schools of Guy's and St Thomas's Hospitals, Guy's Campus, London All email enquiries to: wss@umds.ac.uk An intensive laboratory course to introduce participants to YAC and cosmid contig assembly, clone characterisation and gene hunting. Programme 1. Analysis of YAC clones A range of methods for analysis of individual YAC clones will be covered. These include the preparation of YAC plugs, gel purification of artificial chromosomes, experiments to recover sequences from within and at the ends of YAC clones for further studies. 2. Subcloning of YACs and integration with prokaryotic cloning system For more detailed mapping and isolation of specific landmarks such as genes and polymorphisms it is necessary to integrate YACs with prokaryotic cloning systems containing smaller inserts. Direct screening of cosmid arrays with YACs, and subcloning of individual YACs into lambda phage and cosmid vectors will be carried out as part of the course. 3. Assembly of chromosome specific cosmid contigs Cosmid library screening techniques will be discussed. Filters containing hundreds of cosmids will be screened with YACs. YAC and cosmid based techniques will be used to generate cosmid contigs. 4. FISH analysis of YAC and cosmid clones YACs and cosmids will be mapped on metaphase chromosomes. Selected cosmid clones will be mapped on extended chromatin fibers for high resolution. 5. Retrofitting and fragmentation of YACs Manipulation of YAC inserts e.g. the joining of two or more inserts by recombination between YACs, or the introduction of individual YACs into heterologous cells for further study of the function of the cloned sequences, may require alteration of the selectable markers in the YAC. Methods will be used to retrofit such markers into the vector sequences. Recombination in yeast can also be used to fragment YACs and generate a nested set of shorter artificial chromosomes, as well as to amplify the YAC DNA over the yeast chromosomal background. YAC fragmentation and amplification experiments will be performed. All these methods will also provide experience in yeast transformation. 6. Application of YACs to specific problems in human genetics The particular features of YAC cloning have resulted in the development of new approaches to solving problems in human genetics. Specific examples will be presented both as part of the experimental work and in discussion. 7. Gene hunting Experiments will include cDNA and non cDNA based approaches. cDNA libraries will be screened with cosmid genomic DNA inserts. In addition cDNAs will be isolated using cDNA selection techniques. These techniques will be compared with exon trapping, a technique which does not require prior knowledge of the expression pattern of a gene. 8. YAC transfer to mammalian cells YAC transfer to mammalian cells by spheroplast fusion will be undertaken using a short term assay to determine transfer efficiency. Informal tutorials and evening lectures (by invited speakers) will supplement the laboratory sessions. Course Instructors DUNCAN CAMPBELL (Oxford), ANGELA DAVIES (London), DAVID MARKIE (London), TONY MONACO (Oxford), IOANNIS RAGOUSSIS (London), CAROL WISE (Texas). Confirmed speakers include: ANDREA BALLABIO (Milan) ADRIAN BIRD (Edinburgh), ALAN BUCKLER (Massachusetts), IAN DUNHAM (Hinxton), MICHAEL LOVETT (Texas), CRAIG VENTER (Maryland). Participants Applicants should be post-doctoral (or close to) scientists engaged in relevant research. Applicants with molecular biology and/or some cell culture experience will be particularly welcome. The course is subsidised by the Wellcome Trust for scientists based in academic institutions anywhere in the world. This is a residential course, without exception, and there is a charge of 400 pounds towards board and lodging. Applications There are no formal application forms, but applicants should send a copy of their full CV together with a 300 word outline of their research plans to Dr Pelin Faik, Course Co-ordinator, Division of Biochemistry & Molecular Biology, UMDS, Guy's Campus, London Bridge SE1 9RT. Tel: 0171 403 6998 Fax: 0171 407 5281 Email: wss@umds.ac.uk Closing date for applications is 31st March 1995. -- ------------------------------------------------------------------------------- ___ / \ / | / Alan Young @ uk.ac.ox.vax /____/ / ___ __ |___/ / / / / | / | / "The bigger they are, / \_/\__\__/|_/ /_________/ the harder they fall on you." From owner-chromosomes@net.bio.net Tue Feb 14 22:00:00 1995 Path: biosci!ns1.faseb.org!darwin.sura.net!maze.dpo.uab.edu!usenet From: Mpsy0l3@uabdpo.dpo.uab.edu (Flammable) Newsgroups: bionet.genome.chromosomes Subject: Recent Updates to the Genome Project? Date: 15 Feb 1995 02:25:05 GMT Organization: Friedman Graphix Lines: 4 Message-ID: <3hrom1$19v3@maze.dpo.uab.edu> NNTP-Posting-Host: tty5.maze.ppp.uab.edu X-Newsreader: WinVN 0.92.6+ Does anyone know of any major advances in the Genome project in the last few years? If so would you please E-Mail them to me? Thank You. From owner-chromosomes@net.bio.net Wed Feb 15 22:00:00 1995 Newsgroups: bionet.genome.chromosomes Subject: The Bell Curve From: mike.mehta@canrem.com (Mike Mehta) Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!news.sprintlink.net!uunet!uunet.ca!uunet.ca!portnoy!canrem.com!mike.mehta Distribution: world Message-ID: <60.816.5254.0N1D01C3@canrem.com> Date: Wed, 15 Feb 95 08:19:00 -0500 Organization: CRS Online (Toronto, Ontario) Lines: 34 Hello, I am reading a book called "The Bell Curve" by Richard Hernstein and Charles Murray. It is a book about intelligence and class structure in American life. Since I have started reading this book, I have become extremely interested in intelligence and genetics. I was hoping to receive as much information: opinions, facts, recent updates, regarding these topics. There are hundreds of questions I am dying to ask, so to start: - What is intelligence defined as? Does it have multiple definitions? - What methods exist of measuring intelligence? How accurate are they? Can I obtain copies of these tests or test questions? - Is Intelligence generally considered to be due to genetics or environment? What evidence is there supporting either? - What do you people see as the consequences of the revelation that intelligence may differ ON AVERAGE by racial group? - Have scientists found an 'intelligence gene'? - How does the brain function to form thought? Is it just a reaction to various chemicals being shifted around? If that is true, can we accurately predict every thought of the mind? As well, information on cases regarding tests done on identical twins, or children and parents, etc. would be appreciated. I am open to any and all comments and opinions. Please respond, Mike From owner-chromosomes@net.bio.net Wed Feb 15 22:00:00 1995 Path: biosci!BROODER.KATKI.HU!hidas From: hidas@BROODER.KATKI.HU (Hidas Andras) Newsgroups: bionet.genome.chromosomes Subject: (none) Date: 15 Feb 1995 23:24:35 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 1 Sender: daemon@net.bio.net Distribution: world Message-ID: NNTP-Posting-Host: net.bio.net REVIEW CHROMOSOMES From owner-chromosomes@net.bio.net Wed Feb 15 22:00:00 1995 Path: biosci!BROODER.KATKI.HU!hidas From: hidas@BROODER.KATKI.HU (Hidas Andras) Newsgroups: bionet.genome.chromosomes Subject: (none) Date: 15 Feb 1995 23:23:19 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 1 Sender: daemon@net.bio.net Distribution: world Message-ID: NNTP-Posting-Host: net.bio.net SUB CHROMOSOMES Andras HIDAS From owner-chromosomes@net.bio.net Thu Feb 16 22:00:00 1995 Path: biosci!ALLIANT.SNU.AC.KR!chunglee From: chunglee@ALLIANT.SNU.AC.KR Newsgroups: bionet.genome.chromosomes Subject: please send me marker information Date: 16 Feb 1995 18:32:19 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 5 Sender: daemon@net.bio.net Distribution: world Message-ID: <9502170232.AA27708@alliant.snu.ac.kr> NNTP-Posting-Host: net.bio.net I'm a graduated student. I'd like the linkage analysise to linkage analysis study. so, I need the h highly polymorphic marker near 16q21. please give me how I get this imformation. Thank you. From owner-chromosomes@net.bio.net Thu Feb 16 22:00:00 1995 Path: biosci!adam.cc.sunysb.edu!news.sprintlink.net!howland.reston.ans.net!news.cac.psu.edu!news.pop.psu.edu!hudson.lm.com!newsfeed.pitt.edu!dsinc!netnews.upenn.edu!jake.esu.edu!falcon.lhup.edu!tkeck From: tkeck@falcon.lhup.edu (Brother Joe Cole) Newsgroups: bionet.genome.chromosomes Subject: Double y chormosome info Date: 17 Feb 1995 01:45:14 GMT Organization: East Stroudsburg University, Pennsylvania Lines: 6 Message-ID: <3i0v3a$u4@jake.esu.edu> NNTP-Posting-Host: falcon.lhup.edu X-Newsreader: TIN [version 1.2 PL2] Hello I would like some direction on finding some info on double Y chromos. Thank you (any info will be a big help), Thor Keck From owner-chromosomes@net.bio.net Thu Feb 16 22:00:00 1995 Path: biosci!MSCF.MED.UPENN.EDU!dnasequence From: dnasequence@MSCF.MED.UPENN.EDU (Vahe Bedian) Newsgroups: bionet.genome.chromosomes Subject: Genotyper Date: 17 Feb 1995 08:57:08 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 28 Sender: daemon@net.bio.net Distribution: world Message-ID: <01HN5LFIZBAA000PES@mail.med.upenn.edu> NNTP-Posting-Host: net.bio.net Hello everyone, We are considering purchasing ABI's Genotyper software. If you have this software and have experience with it, I would appreciate hearing your opinions about its capabilities, usefulness, etc. Thanks for your time. Vahe Bedian ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGAT University of Pennsylvania Department of Genetics DNA Sequencing Facility 455 Clinical Research Building, 422 Curie Blvd, Philadelphia, PA 19104-6145 Vahe Bedian, Ph.D. Technical Director Phone: 215-573-7407 Sabine Baxter, Research Specialist Fax: 215-573-5892 Tasha Adams, Research Specialist e-mail: DNASequence@mail.med.upenn.edu Charlotte Furey, Research Specialist FTP: DNASEQ.MED.UPENN.EDU ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGAT From owner-chromosomes@net.bio.net Thu Feb 16 22:00:00 1995 Path: biosci!VM.UCS.UALBERTA.CA!ZWANG2 From: ZWANG2@VM.UCS.UALBERTA.CA (Charlie Wang) Newsgroups: bionet.genome.chromosomes Subject: Host for foreign scholar needed Date: 16 Feb 1995 19:15:10 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 18 Sender: daemon@net.bio.net Distribution: world Message-ID: <199502170315.TAA27949@net.bio.net> NNTP-Posting-Host: net.bio.net Hi everybody, A professor I know in China is seaking an oppertunity to do research over seas. He did extensive research on chromosomes, very successive on C- an banding. He has been doing in situ hybridization in rice and corn. He is interested in doing research about physical location and expression of agricultural character and important function geneswith in situ hybridiza He visited US twice as visiting scholar. If you are interested in hosting him, please reply to this address. I appologize for those who are not interested. Thank you. Charlie Wang. From owner-chromosomes@net.bio.net Fri Feb 17 22:00:00 1995 Newsgroups: bionet.genome.chromosomes Path: biosci!agate!howland.reston.ans.net!news.sprintlink.net!uunet!newsflash.concordia.ca!canopus.cc.umanitoba.ca!tribune.usask.ca!quartz.ucs.ualberta.ca!rover.ucs.ualberta.ca!news.ucalgary.ca!holly.cc.uleth.ca!honte.uleth.ca!botany.biology.uleth.ca!bain From: John Bain Subject: Geneticist Position - U. of Lethbridge again Message-ID: <1995Feb15.222822.8324@honte.uleth.ca> X-Xxmessage-Id: X-Xxdate: Wed, 15 Feb 95 15:30:20 GMT Sender: news@honte.uleth.ca (News System) Organization: University of Lethbridge X-Useragent: Nuntius v1.1.1d12 Date: Wed, 15 Feb 1995 22:28:22 GMT Lines: 45 THE UNIVERSITY OF LETHBRIDGE Faculty of Arts and Science Department of Biological Sciences 1. TITLE: Applications are invited for a tenure-track appointment in Genetics at the level of Assistant Professor. The position will commence 1 July 1995 subject to budgetary approval. 2. QUALIFICATIONS: Ph.D. required by the appointment date. Post-doctoral experience, teaching experience, and evidence of ability to develop an externally funded research program will be assets. Researchers in plant population genetics and plant or microbial molecular genetics are particularly encouraged to apply. In accordance with Canadian Immigration Regulations, this advertisement is directed to Canadian citizens and permanent residents of Canada. The University aspires to hire individuals who have demonstrated potential for excellence in teaching, research, and scholarship. The university is an equal opportunity employer and offers a non-smoking environment. 3. RESPONSIBILITIES: The appointee will be expected to participate in the undergraduate program, including teaching courses in general and molecular genetics, and to develop a strong research program. Opportunities for collaborative research with Agriculture Canada and for graduate student supervision exist. 4. SALARY (1994-95): Assistant Professor $37,350 minimum per annum. 5. APPLICATIONS: Applicants should submit a letter of application, including curriculum vitae, statement of research interests, statement of teaching philosophy, a maximum of three important and/or recent publications, and names of referees. Arrange for this material and three letters of recommendation to be sent to Dr. Gail R. Michener, Chairperson Department of Biological Sciences The University of Lethbridge 4401 University Drive Lethbridge, Alberta T1K 3M4 -E-mail: Michener@hg.uleth.ca 6. Effective Date: 1 July 1995 7. Closing Date: 28 February 1995 From owner-chromosomes@net.bio.net Sat Feb 18 22:00:00 1995 Path: biosci!agate!howland.reston.ans.net!torn!news.unb.ca!coranto.ucs.mun.ca!leif!roger From: roger@kean.ucs.mun.ca (ROGER GREEN,MEDICINE,ST.JOHN'S,NF,CAN) Newsgroups: bionet.genome.chromosomes Subject: Re: Double y chormosome info Date: 19 Feb 95 10:44:45 -0230 Organization: Memorial University. St.John's Nfld, Canada Lines: 13 Message-ID: <1995Feb19.104445.1@leif> References: <3i0v3a$u4@jake.esu.edu> NNTP-Posting-Host: leif.ucs.mun.ca In article <3i0v3a$u4@jake.esu.edu>, tkeck@falcon.lhup.edu (Brother Joe Cole) writes: > Hello I would like some direction on finding some info on double > Y chromos. > Thank you (any info will be a big help), > > Thor Keck > Any good text book on human genetics will have this information. The walk to the library will be good for you too! :-) Roger C. Green, Faculty of Medicine Phone: (709)737-6884 Memorial University , St. John's, Newfoundland FAX : (709)737-7010 From owner-chromosomes@net.bio.net Mon Feb 20 22:00:00 1995 Path: biosci!DXI.NIH.GOV!goldman%bchem.dnet From: goldman%bchem.dnet@DXI.NIH.GOV Newsgroups: bionet.genome.chromosomes Subject: HUman chromosme 6 Date: 21 Feb 1995 08:38:51 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 3 Sender: daemon@net.bio.net Distribution: world Message-ID: <9502211631.AA07692@dxi.nih.gov> NNTP-Posting-Host: net.bio.net Can anyone advise on the physical (Mb) size of the bands 6q16.2-6q23.1 inclusive. Thanx. Alastair Goldman goldman%bchem.dnet@dxi.nih.gov From owner-chromosomes@net.bio.net Mon Feb 20 22:00:00 1995 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!news.moneng.mei.com!uwm.edu!msunews!netnews.upenn.edu!jake.esu.edu!falcon.lhup.edu!tkeck From: Brother Joe Cole Newsgroups: bionet.genome.chromosomes Subject: Re: Double y chormosome info Date: Mon, 20 Feb 1995 20:14:27 -0500 Organization: East Stroudsburg University, Pennsylvania Lines: 4 Message-ID: References: <3i0v3a$u4@jake.esu.edu> <199502202318.PAA01565@cmgm.Stanford.EDU> NNTP-Posting-Host: falcon.lhup.edu Mime-Version: 1.0 Content-Type: TEXT/PLAIN; charset=US-ASCII In-Reply-To: <199502202318.PAA01565@cmgm.Stanford.EDU> Juliette Thank you very much you have been a great help. THOR KECK From owner-chromosomes@net.bio.net Tue Feb 21 22:00:00 1995 Path: biosci!bcm!cs.utexas.edu!swrinde!howland.reston.ans.net!news.sprintlink.net!uunet!bird.bwh.harvard.edu!hsdndev!news.dfci.harvard.edu!mbcf800.dfci.harvard.edu!user From: p_morrison@dfci.harvard.edu (Paul Morrison) Newsgroups: bionet.genome.chromosomes Subject: re: ABI 373A DNA Sequencer data just fades away.(longish) Date: Fri, 17 Feb 1995 15:30:28 -0500 Organization: Mol. Bio. Facility/ Dana-Farber Cancer Institute Lines: 440 Message-ID: NNTP-Posting-Host: mbcf800.dfci.harvard.edu Thank you to the 14 people who responded to my sequencing problem that I posted. Since all of them had enlightening things to say I have included all of the responses and my original post at the end of this synopsis. Briefly the problem: ABI373 automated sequencing, double strand "Core Facility" templates, cycle sequence with Taq polymerase and DYE terminators. Every 15 gels or so a dramatic loss of signal in the chromatogram in a _group_ of samples on the gel (details below). The reason for posting was to find out if other people had this problem occurring in the same time frame (Oct94-present) as mine so we could blame it on a reagent. This hasn't been ruled out but does not seem to be the case (one response with same time frame). Take home message from responses: Because of the low frequency of the problem I have thought that several factors fall below tolerances in order for it to occur. I now have three favorites. Detergent, formamide, and X factor. Because it is difficult to deduce even from the raw data or the gel file whether I have a drastic loss of fluorescence or loss of resolution, both formamide and detergent on the glass are in the running as the culprits. For the last ten days we have deionized formamide, capped aliquots under argon and will make new aliquots every three weeks,(if anyone has proof this is extreme overkill please tell me). We have also increased the rinsing procedure that follows the Alconox cleaning of the glass plates. The problem has not reoccurred. If it does I'll be back on the net to find the X factor. Thanks again, Paul Morrison Molecular Biology Core Facilities Dana Farber Cancer Institute 44 Binney Street Boston, MA 02115 (this message has been cross posted to: bionet.genome.chromosomes bionet.molbio.methds-reagnts and the ABRF, Association of Biomolecular Resource Facilities. If you want information about these network resources please email me.) _______________________________________________________________ Responders: Allison Pinder pinder@mail1.ciwemb.edu W.Alton Jones Cell Science mbcf@transit.nyser.net walter.just walter.just@medizin.uni-ulm.de Mulligan, John mulligan@darwin.com Thomas_C.Newman 22313TCN@msu.edu Vahe Bedian DNASequence@mail.med.upenn.edu Sheila Sheila@lenti.med.umn.edu Tom Keller Tom_Keller@gene.biotech.wisc.edu Mel Kronick kronicmn@ccmail.apldbio.com Di James DI@molbiol.uct.ac.za Steve Hardies HARDIES@thorin.uthscsa.edu Anthony Otsuka ajotsuka@rs6000.cmp.ilstu.edu Laura Livingstone lrl@med.unc.edu Dave Knorr dak@biosys.apldbio.com _________ORIGINAL POST __________________ORIGINAL POST_____________ Subject: ABI 373A DNA Sequencer data just fades away. Here is a problem that is starting to really bug me. It has been occurring intermittently since Oct94 at an increasing rate. Just as soon as we think we have figured out the problem. Whap, it's back. So a brief description of the problem. "Core Facility" (different sample preps) templates sequenced double stranded, Taq polymerase, cycle sequencing, DYE labeled terminators. On occasion we will get a gel that has _something_ wrong with it. We now call them "fast-fade" gels. On these fast-fade gels many lanes of data will look good but then abruptly (within 20 nucs) fade to practically nothing. These problem lanes will usually (but not all) come in groups on the left or right hand side of the gel. This problem has occurred in various places. After 50 to after 400 nucs of good data. We have contemplated just about every reason and not one of them holds up. Because it happens infrequently and we are sequencing Core Facility DNA from various sources this has been very hard to track down. What the problem looks like on the: Analysis file. Peaks are great and then abruptly drop and get the "shakes". There is usually trailing _in front_ of the peak that happens as the peaks spread out and quickly change to shaky waves of color. Raw Data file. Peaks are great and then fade to nothing. Gel file. Peaks are great and then get blurry. It looks as if the same amount of color is there but the resolution has gone to pot. Reasons why we have ruled out: secondary structure: the problem has occurred sequencing the ABI standard which shows no secondary structure problem. Also templates will be rerun the next day, same conditions and the problem disappears. Template prep, primer prep: templates from different sources fail and as above work fine the next day. The Gel: We have replaced all reagents many times. No correlation. 2 gels made at the same time by the same person loaded on different 373's. One fast-fades, one is fine. (This happened last night after we thought we got it). The sharkstooth comb: We prep this the same way. No loose acrylamide, no problems. Sample buffer, the formamide, the blue juice: Replaced, brand new, deionized. Still happens. The centrisep columns: Same lot, same technique used, one good gel, one bad gel. The Taq enzyme, the terminator dyes: The same lot, the same tube, one good gel, one bad gel. The 373: We have 2 373's. Old373 got a stretch upgrade in Apr94. New373 was delivered as stretch Sep94. The problem has occurred on both. While it is true that the problem has only occurred on a stretch machine, we ran stretch gels from April to October with no problems. The problem has occurred only once on the new 373 and has occurred 8-10 times on the old but I feel this could easily be _not_ significant because the old one is used more frequently. Data collection: The drop off does not occur at exactly the same spot (scan line) in the gel file. It will happen in _around_ the same spot but will have enough variation that rules out data collection problems. Final thoughts: Because it doesn't happen often it has been very difficult trying to pin this down. It may have multiple reasons and they all have to be _below_ tolerances in order for it to show up. If this is the case then it may be a reagent or column spec. that has changed since October 94. Has any other lab seen this problem? Anything close to this problem? Thanks for any help or suggestions and if you know another owner of an ABI 373, please give them a copy of this. -Paul Paul Morrison Dana1030 Molecular Biology Core Facilities Dana Farber Cancer Institute 44 Binney Street Boston, MA 02115 p_morrison@dfci.harvard.edu ______END OF ORIGINAL POST____________________________________ responses in order of of reception: _____________________________________________________________ Tom Keller Tom_Keller@gene.biotech.wisc.edu WRITES: RE>ABI 373A DNA Sequencer data just... 2/6/95 We have seen various, intermittant, problem as well. In our case, however,though we didn't want to believe it, it ended up being one or more of the postcycle sequencing steps. I.e., getting the fluorescent extension products to the well, or a combination of these steps. The most frequent cause is the formamide. Buying deionized formamide is not good enough. We've done the experiment. Freshly deionized formamide works, month old deionized formamide,stored at 4#161# gives short reads. We have also had a case where not paying attention to getting the entire dried sample dissolved in the loading mixture gave intermittant problems. Finally, we have seen samples were poor recovery from the method used to remove dye-terminators gave poor results. It is unlikely that an instrument problem will fix itself. There's the rub. _________________________________________________________________ Sheila Sheila@lenti.med.umn.edu WRITES: i havent seen your intermittant problem with signals suddenly fading out. that the problem occurs with the abi standard, and that it can be both presentand absent on the same gel depending on the lane, makes me think what you're seeing is the result of something going on with the centricep columns. do you have two lots pooled together? or possibly people spinning them at different speeds.by the way, we've found that fine sephadex g50 (1 gram/16 mls ddwater) works well in recycled centricep plastic columns. we make up a new slurry every 3 weeks. it beats paying $2 plus dollars per column. _____________________________________________________________ Vahe Bedian DNASequence@mail.med.upenn.edu WRITES: Paul, I can't say that I have encountered the exact same problem, but let me address some possibilities. We have two relatively new 373s with stretch, and the one difficult to track problem ended up resulting from the angle at which plates were held while pouring the gel. If too verticle, hydrostatic pressure caused some separation of the plates near the bottom. This resulted in lower resolution (overlapping peaks) because the focal point of the laser was not exactly in the middle of the gel. We generally had a good start on chromatograms, with a generally fast but not sudden drop off of signal, and waves of lower-higher resolution: ie ~60 nucl would look OK,then lower intensity and broad peaks would appear, then it would get better again. Another manifestation that correlates is variablitly in electrical characteristecs and spacing. Now we clip the plates on each side near the bottom, which does not stop the spacers from getting thoroughly wetted, andget more consistent results. I don't know if your problem is related to this, but since it is an affliction of the whole gel, I thought I'd mention it. Another thought that comes to mind is a malfunction of your cycler. If it stops cycling correctly after a certain point, you would expect exactly the results you describe. Good luck, Vahe __________________________________________________________________ Thomas_C.Newman 22313TCN@msu.edu WRITES: Dear Paul, Does your problem show up on the gel image as a green smeared background.We have been having similar problems, and in one case have found the problem to migrate with the gel plates. ABI recently changed vendors for the glassplates and my gut feeling is that the quality is not to the old standard. If you would like to discuss this over the phone, you can reach me at517-353-0854. We will have both the ABI field service engineer and the field applications specialist here Tuesday (Feb 7). So if you could call me in the AM (after nine EST) I would appreciate it or send me your phone # and I willgive you a call when I get in. Maybe we can join forces and get some of our problems addressed, if not solved. The applications specialist is coming to "show" us how to pour a gel! We have only poured 3 gels a day, 5 days a week for a year and a half...I guess we are slow learners. Tom Newman DNA Sequencing Facility Michigan State University ________________________________________________________________ John Mulligan mulligan@darwin.com WRITES: Paul- We have seen something that looks something like what you have described. My current theory on it was that it was due to residual detergent on the glass plates (see Biotechniques Vol. 15, No. 5, p. 840). You might try other detergents, more rinsing... John Mulligan Darwin Molecular Corp mulligan@darwin.com _________________________________________________________________ Walter Just walter.just@medizin.uni-ulm.de WRITES: Dear Paul Morrison you encountered severe problems with the sequencer. When I was reading your message, I noticed that you use "blue juice".I think this may be a problem since you may not use any dyes in theABI373a.We also had and still have problems with the ABI. The analysis ofthe data often results in high level peaks at the beginning of thesequence and then immediately decreases to +/- zero. When we performa manual "CALL BASES", we obtain all of our data. Mystery?! Best wishes Walter Just ________________________________________________________________ Allison Pinder pinder@mail1.ciwemb.edu WRITES: Paul- I am in the DNA Sequencing core facility at the Carnegie Institution Dep't of Embryology in Baltimore. I just recieved a copy of your ABRF memo re fast-fade gels courtesy of Betsy Nanthakumar of Johns Hopkins. I have seen this phenomenon crop up intermittantly since summer of 1994. It's starting toreally bug me,too.I have only one 373 in the lab. This problem has occurred on the instrumentin its original configuration with 24cm WTR and, since we upgraded to stretch,on 34cm WTR gels. The same thing can occur with a wide variety of samples:Different templates, different vectors, different thermocyclers, prepared by different people-all subject to the same effect. Like you, I have replaced reagents and changed suppliers several times over. The EPT doesn't indicate any electrophoresis problems, and two ABI servicemenhave told me the machine is fine and that I have a gel chemistry problem. I have changed glass plates 4 times in the past 8 months and had the same problem at least once with every pair. The problem has occurred with two different software versions. Sometimes the problem will disappear after oneof these changes, but turn up again later. I have been at my wits' end over this. The problem had been gone for about 2 months, then showed up again in some samples on each of two gels last week. I am in agreement with your thought that there may be multiple causes, all of which must be below tolerance to produce the effect. My strategy now is turning toward getting ABI to take notice and expend some real resources on solving the problem. Our best chance of getting them to do this is if several people are complaining-loudly- about the same thing. Would you let me know if you hear from others having the same problem (I'm not on the ABRF network now)? Hope we can communicate on solving this in the future. Thanks- Allison Pinder Carnegie Institution of Washington Department of Embryology 115 W. University Parkway Baltimore, MD 21210 (410) 554-1207 _______________________________________________________________ Anthony Otsuka ajotsuka@rs6000.cmp.ilstu.edu WRITES Although we have not used fluorescence-based machines, have you considered a problem with the amount or quality of the chain terminators? It sounds as though the gels are working properly since you are obtaining discrete bands. It seems as though your reactions are terminating prematurely. This could be due to an incorrect ratio of dideoxys to deoxys or to errors in pipetting or degraded nucleoside triphosphates, etc. Also consider anything that could be killing the polymerase, e.g. temperature, organic solvents, lack of magnesium, etc. I would suggest calling the company and obtaining a good stock of control DNA template. Most of our sequencing problems result from bad template. At least with a uniform source of DNA you can rule out that variable. Good luck, Tony Otsuka _____________________________________________________________ Mel Kronick kronicmn@ccmail.apldbio.com WRITES: We saw your note on the net this morning regarding gels. I can tell you about something we have seen here that is similar, but not identical. We have seen signals fade away and come back. As you observed, it was difficult to correlate with other parameters. One thing we found helped significantly was to pre-run the gels before loading (for at least 15 minutes, preferably more like 30 minutes). We realize that many people get away without pre-running but, as you noted, the problem probably only occurs when several sub-optimal conditions in the gel occur at the same time. I would be curious if my comments have any bearing on your problem. In any event, I'll ask around some more here before we go back East. We can discuss more when I see you next Tuesday. Hope all else is going well. Mel Kronick _______________________________________________________________ Di James DI@molbiol.uct.ac.za WRITES: Dear Paul, This might help. We do not have a auto sequencer, but doing manual seq. I have noticed on occasion the same phenomena. I pinned it down to the acrylamide. The students especially, leave traces of detergent on areas of the plates and the matrix becomes weak or polymerisation is affected in that area and the bands 'just fade away'. Di James (Sen Tech Officer) Micobiology Sequencign Lab. ________________________________________________________________ Steve Hardies HARDIES@thorin.uthscsa.edu WRITES: Paul Morrison writes [extensive description of a sporadic abberation affecting sequence in some regions of an automated seq. gel] My experience is limited to manual seq., but I am struck by the similarity of your problem to the glycerol artifact. That is, the sporadic nature (related to the way people sporadically decide more enzyme is better), and the position and nature of the artifact (bands spread out but not missing, and only high on the gel) sounds just like the glycerol effect. I don't know if your sample work up removes glycerol, but if you're not using glycerol tolerant buffer, you might try it. More generally, it might be anything in the samples that varies from sample to sample, runs as a high broad band on the gel, and interacts with the DNA running along with it. You say that the same template will give the problem one day and not the next. I would suggest taking such a template and doing a series where the amount of template used varies from way too much to less than usually used. If the problem reproducibly sets in on the high end of the template, then you're bringing something in with the template that's causing the problem, and the sporadicity is related to how much this substance gets concentrated on the way to the gel. A similar strategy aimed at other components (primers, enz) might finger the problem. Good luck; sounds like a tough problem. Steve Hardies, Assoc. Prof. of Biochem., Univ. of Texas HSC at San Antonio Hardies@uthscsa.edu ___________________________________________________________________ Laura Livingston lrl@med.unc.edu (Laura Livingstone) WRITES: Hello from another Core Facility: Have you made any progress with your problem? When you have fast-fade, is it a resolution problem where the peaks broaden to low signal or is the signal of the larger fragments gone or reduced? I don't think we have had exactly the same thing but we have had major problems with resolution quality of peaks and, like you, can "prove" that all imaginable sources are not causing it so have been unable to track down the source of the problem. We had alot of problems after Stretch upgrades but both of our machines were upgraded within a month of each other so maybe it was the upgrades just coincided with whatever the problem is. Laura R. Livingstone, PhD Director UNC-CH Automated DNA Sequencing Facility U. North Carolina ________________________________________________________________ Dave Knorr dak@biosys.apldbio.com (Dave Knorr) WRITES: Paul: I read your post last week about the problem(s) you are having with your 373 runs. I'm not currently sequencing much, but your observations sounded vaguely familiar, so I contacted a bunch of folks here who are developing some of our sequencing chemistries. As you pointed out there may be more than one problem going on, but the responses I received boiled down to a couple of areas to look at. 1) Even though you replaced the formamide, it is importnat to make sure it is truely deionized. Our QC guy runs it through resin 3X, then freezes it in 500 microliter aliquots. He keeps those only for a couple of weeks. 2) Yo may be having gel problems. Recently we have noticed inconsistencies reagent mixes from a couple of suppliers. Bis-acrylamide mixtures may not have consistent proportions of the two, and pre-weighed pre-mixes may not have accurate weights. This will throw off the amount of crosslinking and percentage of the gel. For in-house QC we now use only hand-mixed gel ingredients. 3) Indeed the glycerol present in some of the reactions will cause problems with smearing at higher molecular weights similar to what you described. We have occasionally seen situations where gels poured sequentially by the same person may not be consistent. Even more rare is the situation where only a portion of the gel is good. I hope this helps. You may want to call Technical Support at ABD about this. Dave Knorr Perkin Elmer/Applied Biosystems Agricultural Applications dak@apldbio.com __________END OF RESPONSES___________________________ From owner-chromosomes@net.bio.net Tue Feb 21 22:00:00 1995 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!news.cac.psu.edu!news.tc.cornell.edu!news.graphics.cornell.edu!newsstand.cit.cornell.edu!usenet From: sg19@cornell.edu (Silvana Grandillo) Newsgroups: bionet.genome.chromosomes Subject: MAPMAKER + MAPMAKER QTL Date: 22 Feb 1995 21:10:26 GMT Organization: Cornell University Lines: 6 Sender: sg19@cornell.edu (Verified) Message-ID: <3ig982$q70@newsstand.cit.cornell.edu> NNTP-Posting-Host: cu-dialup-0033.cit.cornell.edu X-Newsreader: WinVN 0.90.5 Does anybody know if, besides the DOS, Unix and Mac version there is also a WINDOWS version for MAPMAKER and MAPMAKER QTL ? sg19@cornell.edu Thanks, Silvana From owner-chromosomes@net.bio.net Tue Feb 21 22:00:00 1995 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!news.sprintlink.net!uunet!newstf01.news.aol.com!newsbf02.news.aol.com!not-for-mail From: amvid@aol.com (AMVID) Newsgroups: bionet.genome.chromosomes Subject: DNA testing in crime Date: 22 Feb 1995 17:07:03 -0500 Organization: America Online, Inc. (1-800-827-6364) Lines: 10 Sender: root@newsbf02.news.aol.com Message-ID: <3igci7$p8i@newsbf02.news.aol.com> Reply-To: amvid@aol.com (AMVID) NNTP-Posting-Host: newsbf02.mail.aol.com I am doing a paper on DNA testing in crime. It will consist of fingerprinting, blood testing, and other related material. I would appreciate any information that could be sent to me. You can E-mail it to AMVID@aol.com If you do send information, could you please include a bibliography or the information needed to make one. Thank you in advance. From owner-chromosomes@net.bio.net Wed Feb 22 22:00:00 1995 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!nctuccca.edu.tw!aladdin.iii.org.tw!usenet From: shengfan@tpts1.seed.net.tw (自由嚮往者) Newsgroups: bionet.genome.chromosomes Subject: genomic mapping on X chromosome Date: 23 Feb 1995 15:06:29 GMT Organization: Seednet, Institute for Information Industry, Taiwan Lines: 13 Message-ID: <3ii89l$5r9@aladdin.iii.org.tw> NNTP-Posting-Host: 192.72.69.170 Summary: Want help for mapping on X Chromosome Keywords: X chromosome X-Newsreader: Winspan < 中文 version 3.02 > Dear Friends: We have isolated a human cDNA which is determined to locate at X chromosome by PCR on a human-hamster hybrid cell DNA panel. What we plan to do next is to accomplish the gene's fine mapping. We hope that there are hybrid cell panels containing X chromosome contigs. Does anybody have information about such panels? Or are there sources where X chromosome YAC contigs are provided? Thank you very much in advance. Frank S. Fan e-mail: shengfan@tpts1.seed.net.tw Institute of Genetics, National Yang Ming University, Taipei, Taiwan, R.O.C. From owner-chromosomes@net.bio.net Thu Feb 23 22:00:00 1995 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!ix.netcom.com!netnews From: bryan6@ix.netcom.com (Bryan Thornberg) Newsgroups: bionet.genome.chromosomes Subject: DNA/Electrophoresis...I Would Like Some Input Date: 24 Feb 1995 00:26:57 GMT Organization: Netcom Lines: 6 Distribution: world Message-ID: <3ij94h$fvq@ixnews1.ix.netcom.com> NNTP-Posting-Host: ix-pit2-19.ix.netcom.com I am currently in the process of putting a college course onto the Internet relating to electrphoresis . This will be a hands-on course to allow students to see DNA (fingerprinting), proteins, lipoproteins, and specific unique features and benefits of the gels themselves. I would like some additional input on what could be added to the course or any examples, thoughts, or ideas that you may have. From owner-chromosomes@net.bio.net Fri Feb 24 22:00:00 1995 Path: biosci!agate!howland.reston.ans.net!ix.netcom.com!netnews From: bryan6@ix.netcom.com (Bryan Thornberg) Newsgroups: bionet.genome.chromosomes Subject: FREE COLLEGE COURSE ON INTERNET Date: 25 Feb 1995 22:49:30 GMT Organization: Netcom Lines: 25 Distribution: world Message-ID: <3ioc5q$me4@ixnews2.ix.netcom.com> NNTP-Posting-Host: ix-pit1-10.ix.netcom.com RE: DNA FINGERPRINTING, PROTEIN & GENE SEPARATION I am currently in the process of utting a college course onto the Internet relating to the electrophoresis system. This system is FUNDAMENTAL to the study of biotechnology & is designed for the research, educational, forensic, and clinical application. This course will eventually be a requirement at all colleges & universities. Polyacrylamide is used in the electrphoresis rocess to searate molecules. The gels that are formed using polyacrylamide separate the molecules by weight and electrical charge, allowing onme to view the smalles components of life, including DNA. The implications of this process for the medical field alone are stunning. It could one day lead to the cure for all inherited diseases known to man, including heart disease and cancer. I would appreciate any thoughts or feedback that you may have regarding this, as well as any links to any group(s) or person(s) who may be able to utilize this information. Samples will also be available. Thank You. Bryan D. Thornberg From owner-chromosomes@net.bio.net Sat Feb 25 22:00:00 1995 Newsgroups: bionet.genome.chromosomes From: Brendan@bphughes.demon.co.uk (Brendan P Hughes) Path: biosci!bloom-beacon.mit.edu!gatech!swrinde!pipex!peernews.demon.co.uk!bphughes.demon.co.uk!Brendan Subject: Gene localisation Organization: Myorganisation Reply-To: Moonshine@bothy.demon.co.uk X-Newsreader: Demon Internet Simple News v1.29 Lines: 41 X-Posting-Host: bphughes.demon.co.uk Date: Sun, 26 Feb 1995 22:36:29 +0000 Message-ID: <793838189snz@bphughes.demon.co.uk> Sender: usenet@demon.co.uk I come to this group as a humble biochemist who has stumbled across information in a gene bank search and doesn't know if it's significant or not. The story so far: As part of project a cDNA was isolated for a particular binding protein. From time to time I searched the databases with the cDNA sequence to see if I could find homology with other sequences which might reveal a conserved motif for binding the particular ligand. Searches through EMBL and Genbank using FASTA were uninformative, they pulled a number of the homologous binding proteins across the various species. Then, one day, I tried TFASTA. I ran the predicted peptide sequence of the binding protein against Gen:EMBL translated in all six reading frames. I got two hits-both very high quality. What was ver exciting was that both hits were from the biosynthetic enzyme for the ligand of the bining protein I was working with. Serendipity or a real biological significance. I tried to align the nucleotide sequences of the hits with my cDNA but could find no match. Finally, after trying every possible combination I tried aligning with opposite strands. This is where I had success-the hit on the biosynthetic gene was on a genomic sequence and the area of homology with the binding protein was in the 3' untranslated region of the synthetase. Starting with that last nucleotide on the 3' untranslated strand of the synthetase, the binding protein protein amino acid sequence was read off in two overlapping stretches. In all, there is 90% amino acid homology,and this is across species so with conservative substitution, this may be as high as a perfect match if I could use the homologous genomic sequences. However, they are not in the databases. Also interesting,the boundary of the two overlapping regions is marked by a peculiar motif. The overlapping stretches are in different reading frames. Is this unusual? Can anyone direct me to a reference which might explain the phenomenon (if it is such!). I have lloked for intron/exon structure but the cDNA stretches are so close together it lloks more like a reverse transcript Is this worth a note in one of the Genomics Journals? -- Brendan P Hughes From owner-chromosomes@net.bio.net Tue Feb 28 22:00:00 1995 Newsgroups: bionet.genome.chromosomes From: Brendan@bphughes.demon.co.uk (Brendan P Hughes) Path: biosci!bcm!cs.utexas.edu!swrinde!pipex!bt!btnet!peernews.demon.co.uk!bphughes.demon.co.uk!Brendan Subject: Gene Localisation Organization: Myorganisation Reply-To: Moonshine@bothy.demon.co.uk X-Newsreader: Demon Internet Simple News v1.29 Lines: 5 X-Posting-Host: office.demon.net Date: Wed, 1 Mar 1995 20:32:47 +0000 Message-ID: <794089967snz@bphughes.demon.co.uk> Sender: usenet@demon.co.uk If anyone finds the topic of my first posting interesting, please main directly to me. My local news server has become so overloaded as to be almost useless. I will summarise any replies I get. -- Brendan P Hughes