From owner-chromosomes@net.bio.net Wed Mar 01 22:00:00 1995 Path: biosci!bcm!cs.utexas.edu!swrinde!gatech!udel!news.sprintlink.net!uunet!pipex!sunsite.doc.ic.ac.uk!susx.ac.uk!baff9 From: baff9@central.susx.ac.uk (Hoochie Coochie Man) Newsgroups: bionet.genome.chromosomes Subject: AUTOMATED SEQUENCING ? Date: 2 Mar 1995 19:56:02 GMT Organization: University of Sussex Lines: 7 Message-ID: <3j57si$s1j@infa.central.susx.ac.uk> NNTP-Posting-Host: solx1.central.susx.ac.uk X-Newsreader: TIN [version 1.2 PL2] Is there anyone out there who wants to discuss automated sequencing ? Problems etc If not, then why not ? From owner-chromosomes@net.bio.net Wed Mar 01 22:00:00 1995 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!news.sprintlink.net!news.clark.net!kcowing-ppp.clark.net!user From: kcowing@aibs.org (Keith L. Cowing) Newsgroups: bionet.genome,bionet.genome.arabidopsis,bionet.genome.chromosomes,bionet.protista,bionet.biology.n2-fixation Subject: CALL: Peer Review Panel Recruitment: American Institute of Biological Sciences Date: Thu, 02 Mar 1995 12:43:04 -0500 Organization: American Institute of Biological Sciences Lines: 176 Message-ID: NNTP-Posting-Host: kcowing-ppp.clark.net Mime-Version: 1.0 Content-Type: TEXT/PLAIN; charset=ISO-8859-1 Content-Transfer-Encoding: 8bit Xref: biosci bionet.genome.arabidopsis:3057 bionet.genome.chromosomes:477 bionet.protista:260 bionet.biology.n2-fixation:266 American Institute of Biological Sciences: 1995 Peer Review Panel Recruitment € AIBS PEER REVIEWS The American Institute of Biological Sciences (AIBS) performs scientific peer review of proposals submitted to various government agencies. AIBS peer review activity in 1994 involved the receipt and processing of almost 5,000 proposals. These proposals were reviewed by over 100 panels composed of more than 1,000 scientific and technical reviewers. Below is a listing of the types of topics for which we have convened panels in 1994 as well what we expect to handle in 1995. € ABOUT AIBS AIBS was established in 1947 by the National Academy of Sciences under federal charter and became an independent, member-governed nonprofit (501)(c)(3) organization in 1955. AIBS currently has 5,000 individual members and has 45 affiliated societies whose combined membership totals over 80,000. AIBS is chartered to: "further the advancement of the biological sciences and their application to human welfare, and to foster and encourage research and education in the biological, medical, environmental, and agriculture sciences." For more information about AIBS, you can check out our gopher (currently under construction) at gopher.aibs.org or point your browser at: gopher://gopher.aibs.org € WE NEED YOUR HELP! If you were a panelist in 1994 (or previous years) and are willing to serve again; would like to serve for the first time; or know someone who is interested in serving on a similar panel, we'd like to know. Also, if you know of other people who might be able to serve on any of the panels listed below, we'd certainly like to know about them too. € AIBS REVIEWER PROFILE [1.] Please provide the following personal information: Full Name: Title: Organization/institution: Address line 1: Address line 2: Address line 3: City: State: Zip Code: Work phone: Home phone: Fax: email: US citizen?: Gender: Date of Birth: Disability: [OPTIONAL]: Ethnic Background: [OPTIONAL]: [2.] Please provide the following information regarding your expertise: Discipline (primary): Specialty: Sub disciplines: Subspecialties: Training/experience: Computer Preference? Mac or PC? Newsgroup you read this on? [3.] Please provide us with a copy of your current CV/resume. A list of publications is sufficient, please do not send reprints. € HOW TO RECOMMEND OTHERS FOR CONSIDERATION If at all possible, have them follow the same procedure outline above. If that isn't possible, please provide us with a name, a means to contact these individuals, and any description you can of their skills and interests. €HOW TO SEND US THIS INFORMATION Send the personal information and your CV/resume (together or separately) to us via: Email: reston@aibs.org (flat text files or enclosures - Mac or PC formatted) FAX: 703-758-1222 Mail: AIBS, 10700 Parkridge Blvd., Suite 380, Reston, VA, USA, 22091 Telephone: 703-758-1212 for help or further information about AIBS peer review services. € CONFIDENTIALITY OF INFORMATION The information you provide will be kept in the AIBS Consultant Roster. This database is for internal AIBS use during the recruitment of peer review panelists. We do not sell names, personal information, or access to this system. AIBS employs confidentiality and conflict of interest practices similar to that employed by NIH and NSF. €ANTICIPATED AIBS PEER REVIEW PANEL TOPICS AND EXPERTISE NEEDED € Aquacultural endocrinology and physiology; sea food pathogens: diagnosis, assay, disease control € Aquaculture natural products, biomaterials, bioactivity, pharmacological uses € Aquaculture policy, education, information, communications, technology transfer € Biocomputing, biological modeling, nanotechnology € Bioethics € Biological and medical information systems, internet usage, biological database design, data analysis, biostatistics € Biomedical imaging technology: mammography, radiology, NMR, PET, ultrasound € Biomedical infrastructure: registry, laboratory/animal resources, € Bioprocessing, biotechnology € Cancer cell and tissue biology, molecular biology, immunology, interleukin and interferon therapies € Cancer detection & diagnosis; chemotherapy, medicinal chemistry, nuclear tracer chemistry € Cardiopulmonary physiology in microgravity , exercise physiology, cardiac deconditioning € Cellular genetics, immunology, intra- and inter-cellular communication € Conservation biology, endangered species, biological diversity, habitat destruction € Developmental and reproductive biology in microgravity: avian, mammalian, amphibian, reptilian, invertebrate € Electromagnetic interactions with living systems: effects, detection, protection € Endocrinology and regulatory physiology during spaceflight, chronobiology, circadian rhythms. growth factors, endocrinology of cancer € Environmental aspects of community planing: civil engineering, land use zoning € Environmental budget analysts/economics, demographics € Environmental law and policy: regulation, compliance, and enforcement € Environmental technology diffusion and transfer € Exobiology, origin and evolution of life, origin of biogenic compounds € Geographic information systems, satellite navigation and geodesy € Global Warming, Earth Observation System, Mission to Planet Earth € Gravitational biology, gravitropism, gravisensing, graviresponse € "Green" chemistry: process controls and feedback systems; "green" buildings € Health care delivery, community health, counseling, psychosocial factors, psychology, sociology, € Incinerator monitoring, biomass combustion systems, particulate control, indoor air pollution, NOx control € Infectious disease, vaccines, epidemiology, parasitology, virology, bacteriology, retrovirology/HIV € Life cycle analysis, recycling, continuous monitoring systems € Marine bioacoustics, cetacean science, marine mammals, fishing area depletion € Microgravity muscle physiology and sensorimotor integration, exercise countermeasures € Neurofibromatosis € Neuroscience and behavior, space motion sickness, space adaptation syndrome, vestibular structure and function in microgravity € NSCORT (NASA Centers of Specialized Research & Training) € Nutrition and metabolism, pregnancy and endocrinology € Operational medicine (military and space), telemedicine, trauma, surgery, rehabilitative medicine € Opportunities in science for ethnic minorities, women, senior citizens, and the disabled € PCR, genetic analysis, genetic engineering, genetically modified organisms € Pesticide use: monitoring, regulation, enforcement, alternatives € Plant biology in microgravity: genetics, development, growth, and propagation € Pollution, air, soil, and water: detection, monitoring, and prevention; clean up: in-situ subsurface treatment, biotechnology € Radiation environment during spaceflight: effects, detection, protection € Remote sensing (satellite and aircraft) for disease control, land use planning, habitat monitoring, pollution detection, climate change € Science education, undergraduate, graduate, postgraduate; curriculum design € Skeletal and biomineralization physiology in microgravity, calcium homeostasis, bone loss € Space human factors studies, ergonomics, performance, interpersonal relations € Space Shuttle Middeck, Spacelab research hardware, Space Station hardware, Russian Mir Space Station research, Biocosmos/Biosatellite research € Spacecraft life support systems: physicochemical and biological air/water/food regeneration € Spacesuit design and extravehicular activity (spacewalk) physiology € Toxicology, spacecraft air/water contamination, environmental health, occupational health, safety € Toxicology: drinking water systems , recycling systems, waste water systems € Vision hazards from laser use From owner-chromosomes@net.bio.net Thu Mar 02 22:00:00 1995 Path: biosci!MSCF.MED.UPENN.EDU!dnasequence From: dnasequence@MSCF.MED.UPENN.EDU (Vahe Bedian) Newsgroups: bionet.genome.chromosomes Subject: green smear/auto. sequencing Date: 3 Mar 1995 08:08:42 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 32 Sender: daemon@net.bio.net Distribution: world Message-ID: <01HNP3T9YDV6000D4V@mail.med.upenn.edu> NNTP-Posting-Host: net.bio.net Hello, We have recently and suddenly run into the notorious green smear problem. It is intense on one side of the scan, and it switches sides when we pour the gel at the opposite corner of the plate assembly. This behaviour obviously suggested a residue on the plates that dissolves in the acrylamide/urea gel mix on the side we pour, and accumulates on the opposite side. We have not changed our detergent (dissolved alconox), and are very careful about rinsing the detergent off, but I would not rule that out as a possibe cause. I understand from ABI tech support that other labs have encountered the same problem, but possibly for different reasons. We would appreciate any advice you may have. Thanks, Vahe Bedian ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGAT University of Pennsylvania Department of Genetics DNA Sequencing Facility 455 Clinical Research Building, 422 Curie Blvd, Philadelphia, PA 19104-6145 Vahe Bedian, Ph.D. Technical Director Phone: 215-573-7407 Sabine Baxter, Research Specialist Fax: 215-573-5892 Tasha Adams, Research Specialist e-mail: DNASequence@mail.med.upenn.edu Charlotte Furey, Research Specialist FTP: DNASEQ.MED.UPENN.EDU ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGAT From owner-chromosomes@net.bio.net Thu Mar 02 22:00:00 1995 Path: biosci!daresbury!not-for-mail From: Newsgroups: bionet.genome.chromosomes Subject: FWD: AUTOMATED SEQUENCING ? Date: 3 Mar 1995 10:19:28 -0000 Lines: 26 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <3j6qfg$b8c@mserv1.dl.ac.uk> X-Mts: smtp X-Authentication-Warning: pluto: Host localhost didn't use HELO protocol Original-To: biochrom@dl.ac.uk Is there anyone out there who wants to discuss automated sequencing ? Problems etc If not, then why not ? *********************************************************************************** If there is anyone out there that missed my last posting on this matter I will repeat it , with appologies to those that are seeing this for the second time . I have recently started a newsgroup with the topic of automated-dna-sequencing , it has been running for 3 weeks and has about 150 members worldwide representing both research and commercial backgrounds . The aim of the group is to discuss problems , applications of the technology to share hints and tips that are of benefit to the rapidly expanding community of auotsequencing .If you would like further details or to join please email me at : cain@icr.ac.uk I look forward to joining those who are intrested , David Cain From owner-chromosomes@net.bio.net Fri Mar 03 22:00:00 1995 Path: biosci!agate!howland.reston.ans.net!torn!sator.eric.on.ca!usenet From: john@eric.on.ca. (John Stevens) Newsgroups: bionet.genome.chromosomes Subject: Re: AUTOMATED SEQUENCING ? Date: 4 Mar 1995 14:46:43 GMT Organization: The Eye Research Institute of Canada Lines: 16 Message-ID: <3j9ugj$c0m@sator.eric.on.ca> References: <3j57si$s1j@infa.central.susx.ac.uk> NNTP-Posting-Host: luke.eric.on.ca In article <3j57si$s1j@infa.central.susx.ac.uk> baff9@central.susx.ac.uk (Hoochie Coochie Man) writes: > Is there anyone out there who wants to discuss automated sequencing ? > > Problems etc > > If not, then why not ? > Sure why are you interested?? Its a very slow moving area it seems, and most of the problems are technology driven, not biological --oo-- j stevens From owner-chromosomes@net.bio.net Fri Mar 03 22:00:00 1995 Path: biosci!CMU.CHIANGMAI.AC.TH!mdbcs001 From: mdbcs001@CMU.CHIANGMAI.AC.TH (Wirote Tuntiwechapikul) Newsgroups: bionet.genome.chromosomes Subject: (none) Date: 3 Mar 1995 21:17:48 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 3 Sender: daemon@net.bio.net Distribution: world Message-ID: NNTP-Posting-Host: net.bio.net UNSUBSCRIBE BIOCHROM@NET.BIO.NET END From owner-chromosomes@net.bio.net Fri Mar 03 22:00:00 1995 Path: biosci!bcm!cs.utexas.edu!news.sprintlink.net!uunet!in1.uu.net!newstf01.news.aol.com!newsbf02.news.aol.com!not-for-mail From: quercus100@aol.com (Quercus100) Newsgroups: bionet.genome.chromosomes Subject: genetic eng.w/chimps Date: 3 Mar 1995 22:21:14 -0500 Organization: America Online, Inc. (1-800-827-6364) Lines: 5 Sender: root@newsbf02.news.aol.com Message-ID: <3j8mba$luh@newsbf02.news.aol.com> Reply-To: quercus100@aol.com (Quercus100) NNTP-Posting-Host: newsbf02.mail.aol.com I'm a high school teacher with an interest in genetic engineering and I was asked if anyone has ever, or does genetic engineering with humans and chimpanzees. I'd be curious to know also how much work has been done with the genome of chimpanzees. Thank you very much. email me at QUERCUS100@AOL.COM From owner-chromosomes@net.bio.net Fri Mar 03 22:00:00 1995 Path: biosci!CC.OWU.EDU!PDBURNAM From: PDBURNAM@CC.OWU.EDU Newsgroups: bionet.genome.chromosomes Subject: Number of Chromosomes in an Onion Date: 3 Mar 1995 16:19:43 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 14 Sender: daemon@net.bio.net Distribution: world Message-ID: <01HNL9S9YL9U004WKJ@CC.OWU.EDU> Reply-To: PDBURNAM@CC.OWU.EDU NNTP-Posting-Host: net.bio.net I am a librarian at Ohio Wesleyan University, and I have been trying to find a table of the number of chromosomes in different species. Precisely, I am trying to help a student find how many chromosomes there are in an onion. Does anyone have that information at their fingertips, or can you direct me to a source that would? I have tried reference materials, books, and government publications without success. Of course, he needs the information by tomorrow. Thank you in advance for any assistance rendered. Paul Burnam, Public Services Librarian Ohio Wesleyan University Libraries Delaware, OH 43015-2312 (614) 368-3240 Internet: PDBURNAM@CC.OWU.EDU From owner-chromosomes@net.bio.net Sun Mar 05 22:00:00 1995 Path: biosci!BH.KYUNGPOOK.AC.KR!dukim From: dukim@BH.KYUNGPOOK.AC.KR (Kim Dalung) Newsgroups: bionet.genome.chromosomes Subject: ms mutant Date: 5 Mar 1995 20:45:15 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 15 Sender: daemon@net.bio.net Distribution: world Message-ID: <9503060447.AA11373@bh.kyungpook.ac.kr> NNTP-Posting-Host: net.bio.net Hello, I am a graduate student in Korea and I am studying on the male sterility in Arabidopsis thaliana and I have some ms mutant lines. To test whether our ms mutant lines are alleles with others, I need to get Arbidopsis ms mutant series. If someone know E-mail address of Dr J. Dawson or Dr Mulligen BJ who have ms mutant series (msH, msZ, ms1, msK msY, msW Can. J. Bot Vol 71: 629-638, 1992), could you inform me their E-mail address Ilsun Jung Fax. 82-53-944-0516 E-mail address dukimΪPbh.kyungpook.ac.kr  From owner-chromosomes@net.bio.net Sun Mar 05 22:00:00 1995 Path: biosci!bloom-beacon.mit.edu!gatech!swrinde!pipex!lyra.csx.cam.ac.uk!sunsite.doc.ic.ac.uk!susx.ac.uk!baff9 From: baff9@central.susx.ac.uk (Hoochie Coochie Man) Newsgroups: bionet.genome.chromosomes Subject: Re: AUTOMATED SEQUENCING ? Date: 5 Mar 1995 23:58:59 GMT Organization: University of Sussex Lines: 22 Message-ID: <3jdj83$5cr@infa.central.susx.ac.uk> References: <3j57si$s1j@infa.central.susx.ac.uk> <3j9ugj$c0m@sator.eric.on.ca> NNTP-Posting-Host: solx1.central.susx.ac.uk X-Newsreader: TIN [version 1.2 PL2] John Stevens (john@eric.on.ca.) wrote: : In article <3j57si$s1j@infa.central.susx.ac.uk> baff9@central.susx.ac.uk : (Hoochie Coochie Man) writes: : > Is there anyone out there who wants to discuss automated sequencing ? : > : > Problems etc : > : > If not, then why not ? : > : Sure why are you interested?? : Its a very slow moving area it : seems, and most of the problems : are technology driven, not biological : --oo-- j stevens Maybe, but with advances in hardware ie the ABi 377, Then quantum leaps in old chemistries could be made ! From owner-chromosomes@net.bio.net Mon Mar 06 22:00:00 1995 Path: biosci!biosci!not-for-mail From: lstein@genome.wi.mit.edu (Lincoln Stein) Newsgroups: bionet.announce,bionet.genome.chromosomes Subject: RELEASE 5 OF WHITHEAD/MIT HUMAN PHYSICAL MAPPING DATA Date: 7 Mar 1995 09:51:07 -0800 Organization: Whitehead Institute for Biomedical Research Lines: 81 Sender: biohelp@net.bio.net Approved: bionews-moderator@net.bio.net Distribution: world Message-ID: <3jgt9u$kpk@senator-bedfellow.MIT.EDU> Reply-To: lstein@genome.wi.mit.edu NNTP-Posting-Host: net.bio.net Keywords: STS YAC contig CEPH megayac human Xref: biosci bionet.announce:1876 bionet.genome.chromosomes:488 ANNOUNCING: WHITEHEAD INSTITUTE/MIT CENTER FOR GENOME RESEARCH HUMAN GENOMIC MAPPING PROJECT DATA RELEASE 5 (FEBRUARY 1995) The fifth release of data from the Human Physical Mapping Project at the Whitehead Institute/MIT Genome Center, covering data generated through the end of February, 1995, is now available. This data release contains YAC screening data for 7525 sequence tagged sites (STSs) screened on the CEPH mega-YAC library. For each STS, we report addresses for the YACs found to contain the STS. From the data obtained so far, there are over 1000 contigs assembled using double linkage between STSs. The data is available electronically in two ways. ANONYMOUS FTP: The entire data release is available as a set of Microsoft Excel files and tab-delimited ascii files on our ftp server. Using an ftp client (such as "Fetch" on the Macintosh), connect to "ftp-genome.wi.mit.edu". Use "anonymous" as your user name, and give your e-mail address as your password. The data files are present in the directory /distribution/human_STS_releases/feb95. The contents are as follows: 02-95.INTRO.mswd.hqx - Description of the data release, Macintosh format. 02-95.INTRO.txt - The same as ascii text 02-95.STS.YAC.sea.hqx - STS & YAC screening data, in MS-Excel format. 02-95.STS.YAC.txt - The same as tab-delimited text. 02-95.sequence - Full sequences of previously unpublished STSs. THE WORLD-WIDE WEB: You will need a World Wide Web client such as Mosaic (Unix, MS-Windows and Macintosh) or MacWeb (Macintosh). Instruct your client to connect to "http://www-genome.wi.mit.edu/". >From there, follow the "Human Physical Mapping Project" link. You will be able to browse and download the raw data set as well as to view doubly-linked contigs. A subset of the STSs (those for which we have chromosomal assignments) are also available through the Genome Database (GDB). QUESTIONS AND PROBLEMS. If users have any questions or problems, please contact us at human_STS_help@genome.wi.mit.edu We invite suggestions about how to make these data release most useful. DATA RELEASE POLICY AND CITATION. Data releases are scheduled every 90 days. At the end of each calendar quarter, all genomic mapping data are reviewed and prepared for distribution via CGR's electronic databases. Data releases typically occur within two weeks of the close of the quarter (i.e., in mid-January, mid-April, mid-July and mid-October). Releases are announced by electronic messages posted to the following two newsgroups: "bionet.genome.chromosomes" and "bionet.announce". Because the accelerated pace of mapping (currently 1500-2000 markers/month), we will be releasing interim releases every 30 days. This is the first such interim release. CGR's data release policy aims to ensure that scientific colleagues have immediate access to information that may assist them in the search for genes. Data releases do not constitute scientific publication of CGR's work, but rather provide scientists with a regular look into our lab notebooks. For projects aimed at the analysis of particular genes or subchromosomal regions, permission is hereby granted to use our data without the need for a formal collaboration, subject only to appropriate acknowledgment. For projects aimed at large-scale mapping of entire chromosomes or entire genomes, use of the data and markers should be on a collaborative basis. The information for the human genome mapping project should be cited as: Whitehead Institute/MIT Center for Genome Research, Human Physical Mapping Project, Data Release 5 (February 1995). -- ======================================================================== Lincoln D. Stein Whitehead Institute/MIT Genome Center lstein@genome.wi.mit.edu Cambridge, MA 02142 ======================================================================== From owner-chromosomes@net.bio.net Mon Mar 06 22:00:00 1995 Path: biosci!AQUARIUS.BEKKOAME.OR.JP!tishizuk From: tishizuk@AQUARIUS.BEKKOAME.OR.JP (Toshiharu Ishizuka) Newsgroups: bionet.genome.chromosomes Subject: Cytogenet Cell Genet Date: 6 Mar 1995 04:21:59 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 20 Sender: daemon@net.bio.net Distribution: world Message-ID: <199503061221.VAA15287@bekkoame.bekkoame.or.jp> Dear the netters Recently, we determined the chromosomal location of a gene. We would like to submit the result to the journal, Cytogenet Cell Genet. We intend to get the instruction for author to submission. However, this journal is not purchased by our university. Thus, we greatly appreciate if anybody teach me the address, FAX number of the publisher of the journal. Sorry for this poor question. Sincerely yours, Dr. Toshiharu Ishizuka Department of Biochemistry, Chiba University, School of Medicine 1-8-1, Inohana, Chuo-ku, Chiba, 260 JAPAN FAX +81-43-226-2041 E-mail QFH03407@niftyserve.or.jp tishizuk@aquarius.bekkoame.or.jp From owner-chromosomes@net.bio.net Mon Mar 06 22:00:00 1995 Path: biosci!rutgers!gatech!howland.reston.ans.net!news.sprintlink.net!uunet!in1.uu.net!world!decwrl!waikato!comp.vuw.ac.nz!canterbury.ac.nz!chmeds.ac.nz!mkennedy From: mkennedy@chmeds.ac.nz (Martin Kennedy) Newsgroups: bionet.genome.chromosomes Subject: Re: Cytogenet Cell Genet Message-ID: <1995Mar8.095724.942@chmeds.ac.nz> Date: 8 Mar 95 09:57:24 +1200 References: <199503061221.VAA15287@bekkoame.bekkoame.or.jp> Distribution: world Lines: 29 In article <199503061221.VAA15287@bekkoame.bekkoame.or.jp>, tishizuk@AQUARIUS.BEKKOAME.OR.JP (Toshiharu Ishizuka) writes: > Recently, we determined the chromosomal location of a gene. We > would like to submit the result to the journal, Cytogenet Cell Genet. We > intend to get the instruction for author to submission. However, this > journal is not purchased by our university. Thus, we greatly appreciate if > anybody teach me the address, FAX number of the publisher of the journal. > Sorry for this poor question. > Sincerely yours, > Dr. Toshiharu Ishizuka Cytogen Cell Genet Editor in Chief H.P.Klinger Sept of Molecular Genetics Albert Einstein College Bronx New York 10461 Fax (718) 430-2454 -- Cheers, Martin NNNN NN Martin A Kennedy (E-mail = mkennedy@chmeds.ac.nz) ZZZZZZZ NN NN NN Cytogenetic and Molecular Oncology Unit ZZZ NN NN NN Christchurch School of Medicine ZZZ NN NNNN Christchurch, New Zealand ZZZZZZZ Phone (64-3)364-0880 Fax (64-3)364-0750 From owner-chromosomes@net.bio.net Mon Mar 06 22:00:00 1995 Path: biosci!adam.cc.sunysb.edu!news.nysernet.net!news.sprintlink.net!howland.reston.ans.net!vixen.cso.uiuc.edu!usenet.ucs.indiana.edu!raven.bio.indiana.edu!user From: lwashing@sunflower.bio.indiana.edu (Lawrence Washington) Newsgroups: bionet.genome.chromosomes Subject: Re: AUTOMATED SEQUENCING ? Date: 7 Mar 1995 19:05:12 GMT Organization: Indiana University Lines: 34 Message-ID: References: <3j57si$s1j@infa.central.susx.ac.uk> <3j9ugj$c0m@sator.eric.on.ca> <3jdj83$5cr@infa.central.susx.ac.uk> NNTP-Posting-Host: raven.bio.indiana.edu In article <3jdj83$5cr@infa.central.susx.ac.uk>, baff9@central.susx.ac.uk (Hoochie Coochie Man) wrote: > John Stevens (john@eric.on.ca.) wrote: > : In article <3j57si$s1j@infa.central.susx.ac.uk> baff9@central.susx.ac.uk > : (Hoochie Coochie Man) writes: > : > Is there anyone out there who wants to discuss automated sequencing ? > : > > : > Problems etc > : > > : > If not, then why not ? > : > > > : Sure why are you interested?? > : Its a very slow moving area it > : seems, and most of the problems > : are technology driven, not biological > > > : --oo-- j stevens > > Maybe, but with advances in hardware ie the ABi 377, Then quantum leaps > in old chemistries could be made ! Well, yeah...But isn't it amazing that we are still using the same basic chemistry as they did years ago? One would eventually expect something radically new, a genuine breakthrough, not just incremental advances in technology. -- Lawrence Washington Indiana University Institute for Molecular and Cellular Biology From owner-chromosomes@net.bio.net Tue Mar 07 22:00:00 1995 Newsgroups: bionet.genome.chromosomes Path: biosci!bcm!cs.utexas.edu!swrinde!pipex!uknet!festival!leeds.ac.uk!news From: ianf@epid.leeds.ac.uk (Ian Findlay) Subject: SINGLE-CELL FLUORESCENT PCR SEMINAR Message-ID: <1995Mar8.164705.7540@leeds.ac.uk> Reply-To: mat4dft@leeds.ac.uk Organization: Epidemiology Date: Wed, 8 Mar 1995 16:47:04 +0000 (GMT) X-Newsreader: WinVN 0.92.1 Lines: 46 I am organising a seminar that users of this group may be interested in: Here goes: Title: Fluorescent PCR and Single-Cell Analysis Date 15th May 1995. One day seminar from 9.30am to 6pm. Organisers: Ian Findlay, Phil Quirke, Andy Urquhart, Alan Handyside Venue: Weetwood Hall Hotel and Conference Centre, University of Leeds, Otley Road, Leeds, LS16 5PS. Costs: Registration is free for first 100 non-commercial delegates. Lunch, morning and afternoon refreshments will be provided. Sponsorship: Sponsorship of the Seminar will be provided by Perkin Elmer (Applied Biosystems Division). Accommodation: Accommodation for speakers will be provided within the Conference centre. Other delegates should arrange their accommodation separately either with the Conference Centre (Telephone 0113 230 6000) or elsewhere. Details of alternative accommodation can be provided on request. Provisional programme: 9.30am Welcome Introduction to fluorescence GeneScan technology (Dave Watts, Perkin-Elmer) Optimisation of key parameters affecting in situ PCR (Steve Picton, Perkin Elmer) New developments in DNA fragment analysis (Dave Watts, Perkin Elmer) Demonstration of fluorescent PCR/GeneScan technology (ABI) Lunch 12-1.15pm Applications of fluorescent PCR. Single-gene defects (Fraser Lewis) DNA fingerprinting + forensics (Andy Urquhart) Single-cell PCR, sexing, CF diagnosis and fingerprinting (Ian Findlay) Update on preimplantation diagnosis (Alan Handyside) Free communications Discussion As the number of delegates is limited, places will be allocated on a first-come first-served basis. As demand is likely to be high, it would be advantageous to register (free) as soon as possible. If you wish to present a free communication, please inform the organisers so that arrangements can be made as soon as possible. Registration and further details can be obtained from: Ian Findlay, Institute of Epidemiology, University of Leeds, 34, Hyde Terrace, Leeds, LS2 9LN. Telephone 0113 292 6459, fax 0113 292 6452 or preferably by email at ianf@epid.leeds.ac.uk. From owner-chromosomes@net.bio.net Tue Mar 07 22:00:00 1995 Path: biosci!rutgers!gatech!swrinde!pipex!sunsite.doc.ic.ac.uk!susx.ac.uk!baff9 From: baff9@central.susx.ac.uk (Hoochie Coochie Man) Newsgroups: bionet.genome.chromosomes Subject: Re: AUTOMATED SEQUENCING ? Date: 8 Mar 1995 08:54:46 GMT Organization: University of Sussex Lines: 43 Message-ID: <3jjrcm$1f@infa.central.susx.ac.uk> References: <3j57si$s1j@infa.central.susx.ac.uk> <3j9ugj$c0m@sator.eric.on.ca> <3jdj83$5cr@infa.central.susx.ac.uk> NNTP-Posting-Host: solx1.central.susx.ac.uk X-Newsreader: TIN [version 1.2 PL2] Lawrence Washington (lwashing@sunflower.bio.indiana.edu) wrote: : In article <3jdj83$5cr@infa.central.susx.ac.uk>, baff9@central.susx.ac.uk : (Hoochie Coochie Man) wrote: : > John Stevens (john@eric.on.ca.) wrote: : > : In article <3j57si$s1j@infa.central.susx.ac.uk> baff9@central.susx.ac.uk : > : (Hoochie Coochie Man) writes: : > : > Is there anyone out there who wants to discuss automated sequencing ? : > : > : > : > Problems etc : > : > : > : > If not, then why not ? : > : > : > : > : Sure why are you interested?? : > : Its a very slow moving area it : > : seems, and most of the problems : > : are technology driven, not biological : > : > : > : --oo-- j stevens : > : > Maybe, but with advances in hardware ie the ABi 377, Then quantum leaps : > in old chemistries could be made ! : Well, yeah...But isn't it amazing that we are still using the same basic : chemistry as they did years ago? One would eventually expect something : radically new, a genuine breakthrough, not just incremental advances in : technology. : -- : Lawrence Washington : Indiana University : Institute for Molecular : and Cellular Biology >Well the Hoochie Coochie Man says >IF IT AIN'T BUST, DON'T FIX IT ! >Regards, >HCM From owner-chromosomes@net.bio.net Thu Mar 09 22:00:00 1995 Path: biosci!daresbury!hgmp.mrc.ac.uk!news From: sjoseph@hgmp.mrc.ac.uk (Miss S.S. Joseph) Newsgroups: bionet.genome.chromosomes Subject: Re: SINGLE-CELL FLUORESCENT PCR SEMINAR Date: 10 Mar 1995 12:10:11 GMT Organization: UK HGMP Resource Centre Lines: 3 Message-ID: <3jpfj3$fd5@mercury.hgmp.mrc.ac.uk> References: <1995Mar8.164705.7540@leeds.ac.uk> Reply-To: sjoseph@hgmp.mrc.ac.uk NNTP-Posting-Host: iron.hgmp.mrc.ac.uk From owner-chromosomes@net.bio.net Thu Mar 09 22:00:00 1995 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!ix.netcom.com!netnews From: HAYTHORN@ix.netcom.com (Mark Haythorn) Newsgroups: bionet.genome.chromosomes Subject: Re: IMPORTANT OPPORTUNITY Date: 10 Mar 1995 22:22:26 GMT Organization: Netcom Lines: 41 Distribution: world Message-ID: <3jqjf2$8u7@ixnews4.ix.netcom.com> References: <9502097948.AA794801312@internet.organo.com> NNTP-Posting-Host: ix-pat1-27.ix.netcom.com In <9502097948.AA794801312@internet.organo.com> CDiCesare@organo.com ("DiCesare, Caroline") writes: > > >PLEASE LISTEN BEFOR YOU START FLAMING ME AND GET IGNORED SEVERLY. I >THOUGHT THESE THINGS WERE SCAMS ALSO BUT IN THE LAST WEEK I RECIEVED >$50,000 IN THE MAIL FROM PEOPLE AROUND THE WORLD. i DON'T KNOW ABOUT >PYRAMID SCHEMES OR ANYTHING LIKE THAT BUT I DO KNOW I MADE $50,000 AND >ALL I GAVE WAS 5. I WANT OTHER PEOPLE TO JOIN IN MY GOOD FORTUNE!!! > > >Received: by ccmail from netcom6.netcom.com >From BIOSCI-REQUEST@net.bio.net >X-Envelope-From: BIOSCI-REQUEST@net.bio.net >Received: from net.bio.net by netcom6.netcom.com (8.6.10/Netcom) > id BAA18252; Thu, 9 Mar 1995 01:47:17 -0800 >Received: (from daemon@localhost) by net.bio.net (8.6.10/8.6.6) id XAA20303 for employment-list; Wed, 8 Mar 1995 23:01:19 -0800 >Received: (from news@localhost) by net.bio.net (8.6.10/8.6.6) id XAA20299 for bionet-employment-arpanet; Wed, 8 Mar 1995 23:01:18 -0800 >To: employment@net.bio.net >From: HAYTHORN@ix.netcom.com (Mark Haythorn) <=== >Subject: IMPORTANT OPPORTUNITY >Message-ID: >Sender: news@dorite.use.com (News Admin) >Date: Wed, 8 Mar 1995 17:23:36 GMT >Approved: news@netcom > > I am NOT a participant nor do I endorse this kind of scam in ANY way!! There is a serious question as to how my name became associated into this document- it is being investigated. To all those who choose to flame ME- please re-think your target!! From owner-chromosomes@net.bio.net Fri Mar 10 22:00:00 1995 Path: biosci!adam.cc.sunysb.edu!news.nysernet.net!news.sprintlink.net!pipex!sunsite.doc.ic.ac.uk!susx.ac.uk!baff9 From: baff9@central.susx.ac.uk (Hoochie Coochie Man) Newsgroups: bionet.genome.chromosomes Subject: Automated sequencing problems Date: 11 Mar 1995 00:08:17 GMT Organization: University of Sussex Lines: 10 Message-ID: <3jqplh$ap@infa.central.susx.ac.uk> NNTP-Posting-Host: solx1.central.susx.ac.uk X-Newsreader: TIN [version 1.2 PL2] I'll tell you what's wrong...... My Mac is filling the HD with CRAP..... It's now midnight and I cant fix the damn thing ! Aaahhhh Anyone got any ideas ? From owner-chromosomes@net.bio.net Fri Mar 10 22:00:00 1995 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!news2.near.net!das-news2.harvard.edu!oitnews.harvard.edu!hsdndev!purdue!mozo.cc.purdue.edu!macg203d.bio.purdue.edu!user From: shall@bilbo.bio.purdue.edu (Stephen Hall) Newsgroups: bionet.genome.chromosomes Subject: Re: IMPORTANT OPPORTUNITY Date: Sat, 11 Mar 1995 14:37:39 -0800 Organization: Purdue University Lines: 27 Distribution: world Message-ID: References: <9502097948.AA794801312@internet.organo.com> <3jqjf2$8u7@ixnews4.ix.netcom.com> NNTP-Posting-Host: macg203d.bio.purdue.edu > >PLEASE LISTEN BEFOR YOU START FLAMING ME AND GET IGNORED SEVERLY. I > >THOUGHT THESE THINGS WERE SCAMS ALSO BUT IN THE LAST WEEK I RECIEVED > >$50,000 IN THE MAIL FROM PEOPLE AROUND THE WORLD. i DON'T KNOW ABOUT > >PYRAMID SCHEMES OR ANYTHING LIKE THAT BUT I DO KNOW I MADE $50,000 AND > >ALL I GAVE WAS 5. I WANT OTHER PEOPLE TO JOIN IN MY GOOD FORTUNE!!! > > > > I am NOT a participant nor do I endorse this kind of scam in ANY way!! > > There is a serious question as to how my name became associated into > this document- it is being investigated. > > To all those who choose to flame ME- please re-think your target!! Mr. Haythorn says he didn't do it. Well maybe not. But how did his address show up on the list? Someone responded that this type of posting is evidence that brothers and sisters shouldn't mate. But people like this (Haythorn's name omitted in this posting) and their families have worked at inbreeding for many generations. I mean they should feel a real sense of accomplishment that they have managed to bring the recessive mutation for idiocy into the homozygous state. From owner-chromosomes@net.bio.net Sat Mar 11 22:00:00 1995 Path: biosci!agate!newsxfer.itd.umich.edu!gatech!howland.reston.ans.net!newsserver.jvnc.net!news.caren.net!news.join.ad.jp!wnoc-tyo-news!wnoc-sfc-news!wnoc-kyo-news!hakozaki.karrn!kyu-cs!NewsWatcher-J!user From: umenotcm@mbox.nc.kyushu-u.ac.jp (Daisuke Umeno) Newsgroups: bionet.genome.chromosomes Subject: HISTON / Who is 'Your name'? Date: Mon, 13 Mar 1995 05:08:09 +0000 Organization: Takagi Lab. Chem. Sci. & Tech. Kyushu Univ. Lines: 25 Message-ID: NNTP-Posting-Host: 133.5.150.51 Mime-Version: 1.0 Content-Type: text/plain; charset=iso-2022-jp I posted qestion about HISTON OCTAMER in Feb. and got several kind mesages / info. Now, I 'm writing mail saying thanks. Among the kind people, somebody who is in Ohio State University gave me strong mesage but he didn't identified himself. I do wish to contact him, but know nothing about him except his Univ. All I have is; The date of the message; 2/17 His info.; From: username@osu.edu (Your Name) To: umenotcm@mbox.nc.kyushu-u.ac.jp (Daisuke Umeno) Subject: Re: help!! about histon Organization: The Ohio State University If you are the person who gave me the message(and named 'Your Name'), please give me a quick response again to me. I do wan't to contact you. regards, Daisuke Umeno Kyushu-Univ, japan -- Daisuke Umeno (umenotcm@mbox.nc.kyushu-u.ac.jp) Takagi Lab. Chem. Sci. & Tech. Kyushu Univ. Japan From owner-chromosomes@net.bio.net Sat Mar 11 22:00:00 1995 Path: biosci!agate!howland.reston.ans.net!newsserver.jvnc.net!news.caren.net!news.join.ad.jp!wnoc-tyo-news!wnoc-sfc-news!wnoc-kyo-news!hakozaki.karrn!kyu-cs!NewsWatcher-J!user From: umenotcm@mbox.nc.kyushu-u.ac.jp (Daisuke Umeno) Newsgroups: bionet.genome.chromosomes Subject: HISTONS / who is 'your name'? Date: Mon, 13 Mar 1995 05:11:31 +0000 Organization: Takagi Lab. Chem. Sci. & Tech. Kyushu Univ. Lines: 22 Message-ID: NNTP-Posting-Host: 133.5.150.51 Mime-Version: 1.0 Content-Type: text/plain; charset=iso-2022-jp I posted qestion about HISTON OCTAMER in Feb. and got several kind mesages / info. Now, I 'm writing mail saying thanks. Among the kind people, somebody who is in Ohio State University gave me strong mesage but he didn't identified himself. I do wish to contact him, but know nothing about him except his Univ. All I have is; The date of the message; 2/17 His info.; From: username@osu.edu (Your Name) To: umenotcm@mbox.nc.kyushu-u.ac.jp (Daisuke Umeno) Subject: Re: help!! about histon Organization: The Ohio State University If you are the person who gave me the message(and named 'Your Name'), please give me a quick response again to me. I do wan't to contact you. regards, -- Daisuke Umeno (umenotcm@mbox.nc.kyushu-u.ac.jp) Takagi Lab. Chem. Sci. & Tech. Kyushu Univ. Japan From owner-chromosomes@net.bio.net Sun Mar 12 22:00:00 1995 Path: biosci!agate!howland.reston.ans.net!newsjunkie.ans.net!newstf01.news.aol.com!newsbf02.news.aol.com!not-for-mail From: krolvera@aol.com (KROLVERA) Newsgroups: bionet.genome.chromosomes Subject: Cystic Fibrosis Date: 12 Mar 1995 21:25:43 -0500 Organization: America Online, Inc. (1-800-827-6364) Lines: 7 Sender: root@newsbf02.news.aol.com Message-ID: <3k0af7$cl@newsbf02.news.aol.com> Reply-To: krolvera@aol.com (KROLVERA) NNTP-Posting-Host: newsbf02.mail.aol.com I am a high school student studying hereditary diseases (cystic fibrosis) and am searching for information on genetic mapping and detailed information on the allele of the 7th chromosome and how it contributes to cystic fibrosis. I would like to know what is the specific problem of the codon contributing to the disease. You may e mail me either through AOL or at "golvera@dmso.dla.dtic.mil." Any information is greatly appreciated. Thank you. From owner-chromosomes@net.bio.net Sun Mar 12 22:00:00 1995 Path: biosci!agate!howland.reston.ans.net!news.sprintlink.net!pipex!news.IT.net!news From: Associazione Italiana Ricerca Handicap Newsgroups: bionet.genome.chromosomes Subject: looking for voluntary association Date: 13 Mar 1995 10:30:22 GMT Organization: ITnet Lines: 6 Message-ID: <3k16ru$6cm@dns.it.net> NNTP-Posting-Host: airh001.pn.itnet.it We are looking for voluntary associations all over the world whose aim is the research on genetic diseases or/and handicap prevention. Thanks in advance, Sarah Vallerino A.I.R.H. From owner-chromosomes@net.bio.net Sun Mar 12 22:00:00 1995 Newsgroups: bionet.genome.chromosomes Path: biosci!bloom-beacon.mit.edu!gatech!howland.reston.ans.net!cs.utexas.edu!uunet!news.iij.ad.jp!wnoc-tyo-news!news.u-tokyo.ac.jp!news.tisn.ad.jp!ap-a!inlink_81!shignak From: shignak@abr.affrc.go.jp (Shigeki 'LARGE' NAKAYAMA) Subject: Re: Number of Chromosomes in an Onion Sender: news@ap-a.cc.affrc.go.jp Message-ID: Date: Mon, 13 Mar 1995 09:29:49 GMT Content-Type: text/plain; charset=iso-2022-jp References: <01HNL9S9YL9U004WKJ@CC.OWU.EDU> Nntp-Posting-Host: inlink_81.abr.affrc.go.jp Mime-Version: 1.0 Organization: Natl Inst Agrobiol Resour, Tsukuba, Japan X-Newsreader: NewsWatcher-J 2.0b19J12 Lines: 13 Hi, Do you know the "Index to plant chromosome numbers" (published by Missouri Botanical Garden)? You can find chromosome number of almost all plants, published, in each book. Please ask to Missouri Botanical Garden. !(^_^)!|(-_^)||(-_-)|m(_ _)m<( )>w( - )w|(-_-)||(^_-)|!(^_^)! Shigeki Nakayama NIAR, Tsukuba, Japan shignak@ss.abr.affrc.go.jp !(^_^)!|(^_-)||(-_-)|w( - )w<( )>m(_ _)m|(-_-)||(-_^)|!(^_^)! P.S. Onion...Allium cepa L. (Liliaceae) is 2n=16. From owner-chromosomes@net.bio.net Sun Mar 12 22:00:00 1995 Path: biosci!bloom-beacon.mit.edu!hookup!news.moneng.mei.com!uwm.edu!news.alpha.net!solaris.cc.vt.edu!uunet!in1.uu.net!maple.enet.net!not-for-mail From: oceania@news.enet.net (Eric Klien) Newsgroups: bionet.genome.chromosomes,rec.food.veg,misc.health.diabetes Subject: ANNOUNCE: NEW WEB SITE - World Health Net Date: 13 Mar 1995 16:07:24 -0700 Organization: Evergreen Communications Phoenix, AZ Lines: 9 Message-ID: <3k2j7c$i70@pinyon.enet.net> NNTP-Posting-Host: pinyon.enet.net Xref: biosci bionet.genome.chromosomes:504 rec.food.veg:35703 misc.health.diabetes:14127 WEB SITE ANNOUNCMENT World Health Net has been launched! This multimedia web site is home of the latest and most innovative research therapies. At the time of its initial launch, the American Academy of Anti-Aging Medicine, American Longevity Research Institute, Life Resucitation Technologies, Inc., and Organ, Inc., had joined the site. Many medical resources plus a medical mailing list are available on this site. Its current address is http://oceania.org/world_health/ From owner-chromosomes@net.bio.net Mon Mar 13 22:00:00 1995 Path: biosci!rutgers!gatech!howland.reston.ans.net!nntp.crl.com!crl2.crl.com!not-for-mail From: labware@crl.com (John Brookes) Newsgroups: bionet.genome.chromosomes Subject: FOR SALE: Discount Lab Glassware Date: 13 Mar 1995 17:40:15 -0800 Organization: CRL Dialup Internet Access Lines: 9 Message-ID: <3k2s5v$1fg@crl2.crl.com> NNTP-Posting-Host: crl2.crl.com X-Newsreader: TIN [version 1.2 PL2] CyberGlass is offering Laboratory Glassware of all types for sale at discount prices: New............................30% off list price Used (like new condition)......40% off list price Please e-mail us for details! John Brookes From owner-chromosomes@net.bio.net Mon Mar 13 22:00:00 1995 Path: biosci!adam.cc.sunysb.edu!news.nysernet.net!news.sprintlink.net!uunet!in1.uu.net!nntp.cac.washington.edu!devos From: devos@u.washington.edu (Theo Devos) Newsgroups: bionet.software,bionet.genome.chromosomes Subject: clone database Date: 14 Mar 1995 18:19:27 GMT Organization: University of Washington, Seattle Lines: 24 Sender: devos@u.washington.edu Message-ID: <3k4mnf$kgs@nntp3.u.washington.edu> NNTP-Posting-Host: nntp2.u.washington.edu Xref: biosci bionet.software:11471 bionet.genome.chromosomes:506 I recently setup a 10,000 clone gridded cosmid library in microtiter plates. I am in the process of setting up a simple database to keep track of these clones, and would like input on the best approach using a PC system to do this. I would also like the flexibility of being able to upload (without too much manipulation) to one of the genome database systems already available, at some point in the future. Although initially the requirements of this system are minimal (ie just keeping track of clones) the library will eventually be used to develop cosmid contigs. In addition, the library is being made widely available, in return for identification of positive clones and karyotype information from CHEF filters provided with the library. The ultimate aim is to develop cosmid contigs for the entire genome. Your comments, tips, suggestions etc will be greatly appreciated _________________________________________________________________________ Theo deVos Phone 206-284-8846 #405 Seattle Biomedical Research Institute Fax 206-284-0313 Suite #200, #4 Nickerson St. Seattle WA, 98109 email devos@u.washington.edu From owner-chromosomes@net.bio.net Mon Mar 13 22:00:00 1995 Path: biosci!adam.cc.sunysb.edu!news.nysernet.net!news.sprintlink.net!howland.reston.ans.net!usc!comserv-b-26.usc.edu!user From: YOUR-USERNAME@usc.edu Newsgroups: bionet.genome.chromosomes Subject: gene translocation mechanisms Date: Tue, 14 Mar 1995 14:51:19 +0600 Organization: University of Southern California, Los Angeles, CA Lines: 4 Sender: slroth@comserv-b-26.usc.edu Message-ID: NNTP-Posting-Host: comserv-b-26.usc.edu I need help in understanding the different theories on translocations. I am specifically looking for information on single strand vs. double strand exchanges, kinase activity, frameshifts and oncyogenesis. Please send responses to slroth@chaph.usc.edu. Thanks. From owner-chromosomes@net.bio.net Tue Mar 14 22:00:00 1995 Path: biosci!bcm!cs.utexas.edu!news.sprintlink.net!vaxa.hofstra.edu!vaxa.hofstra.edu!k12gncrb Newsgroups: bionet.genome.chromosomes Subject: Cold Spring Harbor experience Message-ID: <1995Mar14.232936.1@vaxa> From: k12gncrb@vaxa.hofstra.edu (B.C.) Date: 14 Mar 95 23:29:36 EST Organization: Hofstra University Nntp-Posting-Host: vaxd.hofstra.edu Lines: 20 Hello I am in high school and yesturday my Bio AP class was lucky enough to goto the COLD SPRING HARBOR BIOLOGICAL LABORATORIES and conduct an experiment there. We conducted an experiment much like the one Griffith did bacl about half a century aga and we caused E-Coli to accept a plasmid coded with a gene for Ampacillin resistance. It was great. It was much like his experiments where he injected bacteria in to live micee, noticing that the s 9smooth) strain killed them and the R (rough) strain did not. Eventually he discoverd that Dead S and live R would cause the mouse to die. Form this he was able to hypothesize that some material was being transformed -later Wastson and Crick found it to be DNA. Thus e the first transformat s were noticed and since then they have aded in Diabetes research and Tumor thepy. (SORRY for my spelling but I do not have the funcition of c delete on my computer!) that is all there is! bc From owner-chromosomes@net.bio.net Wed Mar 15 22:00:00 1995 Path: biosci!bcm!cs.utexas.edu!news.sprintlink.net!vaxa.hofstra.edu!vaxa.hofstra.edu!k12gncrb Newsgroups: bionet.genome.chromosomes Subject: NEED HELP ON EPIDERMOLYSIS BALOSA SIMPLEX Message-ID: <1995Mar15.234446.1@vaxa> From: k12gncrb@vaxa.hofstra.edu (B.C.) Date: 15 Mar 95 23:44:46 EST Organization: Hofstra University Nntp-Posting-Host: vaxd.hofstra.edu Lines: 19 Hi I am a high school student and have a genetic disorder called Epidermolysis Balosa Simplex I am very interested in Genetics and plan to major in it and was e wondering if anyone would have any specific information on this disorder. I would like to the the (sorry about that)- I would like to know that facts about it like if it is sex-linked or deals with complementarity and epistasis or what. If it is gene-linked with any others and information like that. Thanks a lok Dealing with the phenotype- I look normal but if my skin expreiences alot of friction or/and heat I develope a large amount of blisters that do not calous and must be lanced. (Most appear on my feet in the summer but some also on my hands from writing when it is humid ou) What would the genyotype be and when (sorry0_ what would my parents genyotyps need to be for me to have this. I know that it is very rare. Thanks for all your help Brandon From owner-chromosomes@net.bio.net Wed Mar 15 22:00:00 1995 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!vixen.cso.uiuc.edu!usenet.ucs.indiana.edu!raven.bio.indiana.edu!user From: lwashing@sunflower.bio.indiana.edu (Lawrence Washington) Newsgroups: bionet.genome.chromosomes Subject: Re: AUTOMATED SEQUENCING ? Date: 16 Mar 1995 16:55:24 GMT Organization: Indiana University Lines: 38 Message-ID: References: <3j57si$s1j@infa.central.susx.ac.uk> <3j9ugj$c0m@sator.eric.on.ca> <3jdj83$5cr@infa.central.susx.ac.uk> <3jjrcm$1f@infa.central.susx.ac.uk> NNTP-Posting-Host: raven.bio.indiana.edu > > : Well, yeah...But isn't it amazing that we are still using the same basic > : chemistry as they did years ago? One would eventually expect something > : radically new, a genuine breakthrough, not just incremental advances in > : technology. > > : -- > : Lawrence Washington > >Well the Hoochie Coochie Man says > > >IF IT AIN'T BUST, DON'T FIX IT ! > > >Regards, > > >HCM Dear Mr. Coochie, It IS busted. It NEEDS fixing. By this I truly mean no disrespect to Sanger and the other gods who walk like men. Dideoxy/PAGE has been very very good to us. Its longevity is testimony to its brilliance, it is a foundation of molecular biology. But even with "automated" sequencers (one of which I am a grateful owner) it is a labor intensive, messy, time consuming and very expensive proposition. For the massive sequencing projects, ongoing and proposed, costs will be unspeakable without some simple, wonderful new way of doing it. Sanger's idea (and Maxam and Gilbert's for that matter) was published in 1977. In that year there were no oligo synthesizers, no PCR, no personal computers and very few scientists named after blues songs. -- Lawrence Washington Indiana University Institute for Molecular and Cellular Biology From owner-chromosomes@net.bio.net Wed Mar 15 22:00:00 1995 Path: biosci!bcm!cs.utexas.edu!news.sprintlink.net!pipex!lyra.csx.cam.ac.uk!sunsite.doc.ic.ac.uk!susx.ac.uk!baff9 From: baff9@central.susx.ac.uk (A Edwards) Newsgroups: bionet.genome.chromosomes Subject: Re: AUTOMATED SEQUENCING ? Date: 16 Mar 1995 22:45:38 GMT Organization: University of Sussex Lines: 20 Message-ID: <3kaf2i$e0n@infa.central.susx.ac.uk> References: <3j57si$s1j@infa.central.susx.ac.uk> <3j9ugj$c0m@sator.eric.on.ca> <3jdj83$5cr@infa.central.susx.ac.uk> <3jjrcm$1f@infa.central.susx.ac.uk> NNTP-Posting-Host: solx1.central.susx.ac.uk X-Newsreader: TIN [version 1.2 PL2] Lawrence Washington (lwashing@sunflower.bio.indiana.edu) wrote: Lawrence, Have you seen any of the stuff performed in the USSR (as it was) and Czeclosovakia (as it was) regarding sequencing using an array of oligos bound to silicone plates ? I don't know what's going on with it now, but it looked exciting stuff ! Does anyone else know owt about it ? By the way this is the Hoochie man, but computing services made me change my name to something boring....... My proper name ! Better ? Take care, Adrian (yawn) Edwards From owner-chromosomes@net.bio.net Thu Mar 16 22:00:00 1995 Path: biosci!rutgers!gatech!howland.reston.ans.net!vixen.cso.uiuc.edu!usenet.ucs.indiana.edu!raven.bio.indiana.edu!user From: lwashing@sunflower.bio.indiana.edu (Lawrence Washington) Newsgroups: bionet.genome.chromosomes Subject: Re: AUTOMATED SEQUENCING ? Date: 17 Mar 1995 21:08:27 GMT Organization: Indiana University Lines: 27 Message-ID: References: <3j57si$s1j@infa.central.susx.ac.uk> <3j9ugj$c0m@sator.eric.on.ca> <3jdj83$5cr@infa.central.susx.ac.uk> <3jjrcm$1f@infa.central.susx.ac.uk> <3kaf2i$e0n@infa.central.susx.ac.uk> NNTP-Posting-Host: raven.bio.indiana.edu AE, AKA HCM, > Have you seen any of the stuff performed in the USSR (as it was) and > Czeclosovakia (as it was) regarding sequencing using an array of oligos > bound to silicone plates ? > > I don't know what's going on with it now, but it looked exciting stuff ! > > Does anyone else know owt about it ? > > Adrian (yawn) Edwards Hmmmm...this rings a faint bell from years back. Something about statistically analyzing the order in which the unknown fragments bound to the oligo array??? Someone out there must remember. What DID become of this? Does anyone know of a review of alternative sequencing theories, or legitimate speculation on the future? Interesting subject. Lawrence -- Lawrence Washington Indiana University Institute for Molecular and Cellular Biology From owner-chromosomes@net.bio.net Thu Mar 16 22:00:00 1995 Path: biosci!rutgers!gatech!howland.reston.ans.net!vixen.cso.uiuc.edu!usenet.ucs.indiana.edu!raven.bio.indiana.edu!user From: lwashing@sunflower.bio.indiana.edu (Lawrence Washington) Newsgroups: bionet.genome.chromosomes Subject: Re: Automated sequencing problems Date: 17 Mar 1995 21:19:50 GMT Organization: Indiana University Lines: 20 Message-ID: References: <3jqplh$ap@infa.central.susx.ac.uk> NNTP-Posting-Host: raven.bio.indiana.edu In article <3jqplh$ap@infa.central.susx.ac.uk>, baff9@central.susx.ac.uk (Hoochie Coochie Man) wrote: > I'll tell you what's wrong...... > > My Mac is filling the HD with CRAP..... > > It's now midnight and I cant fix the damn thing ! > > Aaahhhh > > Anyone got any ideas ? Hey, you could be using OS/2, so stop yer whining -- Lawrence Washington Indiana University Institute for Molecular and Cellular Biology From owner-chromosomes@net.bio.net Sat Mar 18 22:00:00 1995 Path: biosci!agate!sunsite.doc.ic.ac.uk!susx.ac.uk!baff9 From: baff9@central.susx.ac.uk (A Edwards) Newsgroups: bionet.genome.chromosomes Subject: Re: AUTOMATED SEQUENCING ? Date: 19 Mar 1995 00:13:55 GMT Organization: University of Sussex Lines: 13 Message-ID: <3kft03$al@infa.central.susx.ac.uk> References: <3j57si$s1j@infa.central.susx.ac.uk> <3j9ugj$c0m@sator.eric.on.ca> <3jdj83$5cr@infa.central.susx.ac.uk> <3jjrcm$1f@infa.central.susx.ac.uk> <3kaf2i$e0n@infa.central.susx.ac.uk> NNTP-Posting-Host: solx1.central.susx.ac.uk X-Newsreader: TIN [version 1.2 PL2] Lawrence, Yeah, you got the one I was thinking of ! I don't know anymore about it, except that they were working on 8mers in Cz. and 11mers in USSR. The amount of computing power needed to work all that out must be immense ! Take care anyway, Adie From owner-chromosomes@net.bio.net Sat Mar 18 22:00:00 1995 Path: biosci!bloom-beacon.mit.edu!gatech!swrinde!pipex!sunsite.doc.ic.ac.uk!susx.ac.uk!baff9 From: baff9@central.susx.ac.uk (A Edwards) Newsgroups: bionet.genome.chromosomes Subject: Re: Automated sequencing problems Date: 19 Mar 1995 00:15:05 GMT Organization: University of Sussex Lines: 29 Message-ID: <3kft29$am@infa.central.susx.ac.uk> References: <3jqplh$ap@infa.central.susx.ac.uk> NNTP-Posting-Host: solx1.central.susx.ac.uk X-Newsreader: TIN [version 1.2 PL2] Lawrence Washington (lwashing@sunflower.bio.indiana.edu) wrote: : In article <3jqplh$ap@infa.central.susx.ac.uk>, baff9@central.susx.ac.uk : (Hoochie Coochie Man) wrote: : > I'll tell you what's wrong...... : > : > My Mac is filling the HD with CRAP..... : > : > It's now midnight and I cant fix the damn thing ! : > : > Aaahhhh : > : > Anyone got any ideas ? : Hey, you could be using OS/2, so stop yer whining : -- : Lawrence Washington : Indiana University : Institute for Molecular : and Cellular Biology HCM....... Fair comment, sorry ! AE From owner-chromosomes@net.bio.net Sun Mar 19 22:00:00 1995 Path: biosci!bcm!cs.utexas.edu!news.sprintlink.net!howland.reston.ans.net!news2.near.net!das-news2.harvard.edu!fas-news.harvard.edu!mito!robison From: robison@mito.harvard.edu (Keith Robison) Newsgroups: bionet.genome.chromosomes Subject: Re: human genome project, where? Date: 20 Mar 1995 15:09:13 GMT Organization: Harvard University, Cambridge, Massachusetts Lines: 15 Message-ID: <3kk5qp$h65@decaxp.harvard.edu> References: NNTP-Posting-Host: mito.harvard.edu X-Newsreader: TIN [version 1.2 PL2] You'll find a number of Web sites for the genome project in http://www-bprc.mps.ohio-state.edu/cgi-bin/hpp?genetics.html the work is being carried out at hundreds of universities, government labs, and companies around the world. Keith Robison Harvard University Department of Cellular and Developmental Biology Department of Genetics / HHMI robison@mito.harvard.edu From owner-chromosomes@net.bio.net Sun Mar 19 22:00:00 1995 Path: biosci!bcm!cs.utexas.edu!news.sprintlink.net!howland.reston.ans.net!news2.near.net!das-news2.harvard.edu!fas-news.harvard.edu!mito!robison From: robison@mito.harvard.edu (Keith Robison) Newsgroups: bionet.genome.chromosomes Subject: Re: AUTOMATED SEQUENCING ? Date: 20 Mar 1995 15:07:28 GMT Organization: Harvard University, Cambridge, Massachusetts Lines: 53 Message-ID: <3kk5ng$h65@decaxp.harvard.edu> References: <3j57si$s1j@infa.central.susx.ac.uk> <3j9ugj$c0m@sator.eric.on.ca> <3jdj83$5cr@infa.central.susx.ac.uk> <3jjrcm$1f@infa.central.susx.ac.uk> <3kaf2i$e0n@infa.central.susx.ac.uk> NNTP-Posting-Host: mito.harvard.edu X-Newsreader: TIN [version 1.2 PL2] Lawrence Washington (lwashing@sunflower.bio.indiana.edu) wrote: : AE, AKA HCM, : > Have you seen any of the stuff performed in the USSR (as it was) and : > Czeclosovakia (as it was) regarding sequencing using an array of oligos : > bound to silicone plates ? : > : > I don't know what's going on with it now, but it looked exciting stuff ! : > : > Does anyone else know owt about it ? : > : > Adrian (yawn) Edwards : Hmmmm...this rings a faint bell from years back. Something about : statistically analyzing the order in which the unknown fragments bound to : the oligo array??? Someone out there must remember. What DID become of : this? : Does anyone know of a review of alternative sequencing theories, or : legitimate speculation on the future? Interesting subject. This stuff is still an unproven idea. A significant concern is how complex (i.e. how big) a sequence can be analyzed in this manner. I believe most of the schemes for this can de novo sequence a fragment of 2 (4?) to the N, where N is the length of the oligo on the array. So, you'd still need to carve the entire genome into kilobase-sized chunks, which is one of the major costs for conventional sequencing. One place where these arrays might be more promising is resequencing -- i.e. diagnostics. One array could test many regions of the genome. Affymax/Affymetrix (I forget which does what) has built a chip capable of scanning the human mitochondrial genome in such a fashion. To find literature, try searching some of the following names Fodor Pevzner Drmanac Don't write off gel-based methods yet -- they may well give us the first sequence of the human genome. No other method has yet generated significant de novo sequence data. Keith Robison Harvard University Department of Cellular and Developmental Biology Department of Genetics / HHMI robison@mito.harvard.edu From owner-chromosomes@net.bio.net Sun Mar 19 22:00:00 1995 Path: biosci!agate!newsxfer.itd.umich.edu!gatech!howland.reston.ans.net!pipex!uknet!comlab.ox.ac.uk!oxuniv!oxpath!awalley Newsgroups: bionet.genome.chromosomes Subject: Alternatives to Sanger sequencing Message-ID: <1995Mar20.113147.1@molbiol.ox.ac.uk> From: awalley@molbiol.ox.ac.uk Date: 20 Mar 95 11:31:47 GMT Organization: Oxford University Molecular Biology Data Centre Nntp-Posting-Host: oxpath Nntp-Posting-User: awalley Lines: 10 Hi, Don't know anything about Russian work but Professor Southern (Yes, as in blotting) is workin on alternative sequencing strategies here in Oxford. He is using immobilised arrays of oligos on a solid support. Sory but I don't know much about the exact mechanism of the system. I believe he has just signed a deal with ABI to develop the system further though. Dr. Andrew Walley, Oxford, UK From owner-chromosomes@net.bio.net Sun Mar 19 22:00:00 1995 Path: biosci!bloom-beacon.mit.edu!news2.near.net!news.delphi.com!usenet From: Matt Rung Newsgroups: bionet.genome.chromosomes Subject: human genome project, where? Date: Sun, 19 Mar 95 21:46:02 -0500 Organization: Delphi (info@delphi.com email, 800-695-4005 voice) Lines: 5 Message-ID: NNTP-Posting-Host: bos1c.delphi.com what universities are conducting research on this project? also, what are their ftp addresses? thanks... -matt From owner-chromosomes@net.bio.net Tue Mar 21 22:00:00 1995 Newsgroups: bionet.genome.chromosomes Path: biosci!bcm!cs.utexas.edu!news.sprintlink.net!alfa02.medio.net!netnews.nwnet.net!ns1.nodak.edu!badlands!schnurr From: schnurr@badlands.NoDak.edu (Jeffrey P Schnurr) Subject: Female sterility gene? Sender: usenet@ns1.nodak.edu (Usenet login) Message-ID: Date: Wed, 22 Mar 1995 18:28:55 GMT Nntp-Posting-Host: badlands.nodak.edu Organization: North Dakota Higher Education Computing Network X-Newsreader: TIN [version 1.2 PL2] Lines: 28 From ns1.nodak.edu!badlands!schnurr Wed Mar 22 12:21:44 1995 Newsgroups: bionet.plants Path: ns1.nodak.edu!badlands!schnurr From: schnurr@badlands.NoDak.edu (Jeffrey P Schnurr) Subject: Female sterility gene? Sender: usenet@ns1.nodak.edu (Usenet login) Message-ID: Date: Tue, 21 Mar 1995 19:05:13 GMT Nntp-Posting-Host: badlands.nodak.edu Organization: North Dakota Higher Education Computing Network X-Newsreader: TIN [version 1.2 PL2] Lines: 9 Does anyone know who, if anyone, is working on sequencing and cloning of a female sterility gene? If so, please forward the info. necessary to contact that individual. Thank you Jeff Schnurr NDSU, Fargo, ND From owner-chromosomes@net.bio.net Tue Mar 21 22:00:00 1995 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!gatech!newsfeed.pitt.edu!uunet!in1.uu.net!noc.near.net!saturn.caps.maine.edu!news From: michael@saturn.caps.maine.edu (Leahcim) Newsgroups: bionet.genome.chromosomes Subject: Junk genes Date: 22 Mar 1995 02:38:41 GMT Organization: University of Maine System Lines: 25 Message-ID: <3ko2jh$11la@saturn.caps.maine.edu> NNTP-Posting-Host: slip42.tserva1.caps.maine.edu X-Newsreader: WinVN 0.92.6+ Hullo. I am a sophmore at Gardiner Area High School in Maine, and we have recently been doing a section on Genetics. I have been assigned a research project, due sometime this spring, and one topic that came to mind is the 5 w's (what where why when how) of Junk genes. Or at least thats what my teacher calls them. She also said I might find information under "nonsense genes" or "no sense genes". On asking another Biology teacher on the correct terminology for these genes, I got the answer "anti-codon". I have searched the world wide web (and soon gopher, but the servers were busy as usual) for all of these terms, and have not found anything that looks like what I want. If anyone can a) tell me the correct term for these genes, b) give me any info on these genes, and c) send me in the right direction to find information on these genes, I would be greatly appreciative. I also have to have an "alternate" means of research, meaning experiments, surveys, etc. If any of you can suggest an "alternate" means of research, I would like that. Matter of fact, in case this idea falls through, I would appreciate any ideas for a research topic. I am sorry if I have posted my problems to the wrong newgroup, I thought this one seemed appropriate. So please keep the flames to a minimum. And thanks in advance for any help I might get. Michael michael@saturn.caps.maine.edu From owner-chromosomes@net.bio.net Wed Mar 22 22:00:00 1995 Path: biosci!rutgers!gatech!swrinde!pipex!sunsite.doc.ic.ac.uk!susx.ac.uk!baff9 From: baff9@central.susx.ac.uk (A Edwards) Newsgroups: bionet.genome.chromosomes Subject: Re: Alternatives to Sanger sequencing Date: 22 Mar 1995 23:56:16 GMT Organization: University of Sussex Lines: 8 Message-ID: <3kqdf0$m2t@infa.central.susx.ac.uk> References: <1995Mar20.113147.1@molbiol.ox.ac.uk> NNTP-Posting-Host: solx1.central.susx.ac.uk X-Newsreader: TIN [version 1.2 PL2] Well please spillo some more of the metaphorical beans and avail us of what he is up to ! You just can't keep people in suspens like that ! Take care, Adrian From owner-chromosomes@net.bio.net Sat Mar 25 22:00:00 1995 Path: biosci!bloom-beacon.mit.edu!gatech!newsfeed.pitt.edu!uunet!news.delphi.com!usenet From: Matt Rung Newsgroups: bionet.genome.chromosomes Subject: Human genome project... Date: Sun, 26 Mar 95 17:44:27 -0500 Organization: Delphi (info@delphi.com email, 800-695-4005 voice) Lines: 7 Message-ID: <5qz5-er.mrung@delphi.com> NNTP-Posting-Host: bos1g.delphi.com i am making a report for school on the human genome project. does anyone have any articles, reports, or anything else of interest? please include the source of the article... thanks -matt From owner-chromosomes@net.bio.net Sun Mar 26 23:00:00 1995 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!news.sprintlink.net!EU.net!uknet!comlab.ox.ac.uk!oxuniv!ayoung From: ayoung@vax.oxford.ac.uk (Geordie +1865 740 011) Newsgroups: bionet.genome.chromosomes Subject: version 1.4 of GAS now available Message-ID: <1995Mar27.182612.30645@oxvaxd> Date: 27 Mar 95 18:26:12 BST Organization: Oxford University VAX 6620 Lines: 67 The GAS program has now been updated to Version 1.4, which is available via anonymous ftp from ftp.well.ox.ac.uk in directory pub/genetics/gas. The main additions to the previous version are: General: * improved allele binning algorithms in read( alsize... ) * internal help facility * additional inheritance and validity checks for data input * `newlocus' command for making transformations and creating new loci * barchart display of allele size data * additional categories available for select()/delete() commands * allele renumbering * ability to read pedigree data in `makeped' format Sib-Pair Tests: * Elston-Hageman algorithm (EH) for quantitative loci, both IBD and IBS * non-parametric version of EH for IBD and IBS Association Tests: * Genotype Relative Risk * Empirical Logistic Method * Relative Predispositional Effect Bug-fixes: * `weight' parameter in sibstate() had no effect, corrected in 1.3 * memory allocation in edit( twogen ) caused failures in DOS, corrected in 1.4 The manual has been expanded (it now includes references to some of the analytical routines) and additional example files have been included to demonstrate the new features of the program. Directions for unpacking the program and documentation are in the file `README' in pub/genetics/gas. Only users who obtained GAS version 1.2 via ftp will recieve an update message, so please pass on the upgraded package to any GAS users who obtained the program via yourself. Alan Y. ------------------------------------------------------------------------------ Many of the analysis modules and other features of GAS will be covered at the 14th Wellcome Summer School, held this year in Oxford. For details of this email: wss@umds.ac.uk ------------------------------------------------------------------------------ -- ------------------------------------------------------------------------------- ___ / \ / | / Alan Young @ uk.ac.ox.vax /____/ / ___ __ |___/ / / / / | / | / "The bigger they are, / \_/\__\__/|_/ /_________/ the harder they fall on you." From owner-chromosomes@net.bio.net Mon Mar 27 23:00:00 1995 Path: biosci!agate!howland.reston.ans.net!news.sprintlink.net!uunet!in1.uu.net!fdn.fr!jussieu.fr!u-psud.fr!zaphod.crihan.fr!usenet From: DIAZ@cgmvax.cgm.cnrs-gif.fr Newsgroups: bionet.plants,bionet.molbio.yeast,bionet.molbio.genome-program,bionet.molbio.gdb,bionet.molbio.evolution,bionet.info-theory,bionet.genome.chromosomes,bionet.drosophila,bionet.celegans Subject: Reports on genome projects. Date: Tue, 28 Mar 95 12:09:45 PDT Organization: CRIHAN, Mont-Saint-Aignan (France) Lines: 12 Message-ID: <3l8nq5$41c@zaphod.crihan.fr> NNTP-Posting-Host: cgmpcy.cgm.cnrs-gif.fr Mime-Version: 1.0 Content-Type: TEXT/PLAIN; charset=US-ASCII X-Newsreader: NEWTNews & Chameleon -- TCP/IP for MS Windows from NetManage Xref: biosci bionet.plants:6198 bionet.molbio.yeast:2682 bionet.molbio.genome-program:1296 bionet.molbio.gdb:314 bionet.molbio.evolution:2581 bionet.info-theory:3290 bionet.genome.chromosomes:526 bionet.drosophila:962 bionet.celegans:338 I am trying to get information on the current genome projects. I am particularly interested on reports of the current status of the sequencing projects. I would like to have some addresses were I could find such an information because I have tried on the net but this search has revealed itself completely NULL... Thanks to everyone who could help me. Yolande DIAZ PS : Send the answers to : DIAZ@CGMVAX.CGM.CNRS-GIF.FR From owner-chromosomes@net.bio.net Tue Mar 28 23:00:00 1995 Path: biosci!biosci!not-for-mail From: biohelp@net.bio.net (BIOSCI Administrator) Newsgroups: bionet.molbio.genome-program,bionet.molbio.evolution,bionet.genome.chromosomes Subject: Progress Reports... Date: 28 Mar 1995 17:18:59 -0800 Organization: CRIHAN, Mont-Saint-Aignan (France) Lines: 8 Distribution: world Message-ID: <3l6cvd$2ph@zaphod.crihan.fr> NNTP-Posting-Host: net.bio.net Xref: biosci bionet.molbio.genome-program:1300 bionet.molbio.evolution:2584 bionet.genome.chromosomes:527 I am interested on the genome projects and I would like to have email adresses were I could get progress reports of any of these sequencing project, that is on coli, subtilis, arabidopsis, human, mouse, etc... I thank you for any help you could give me.... My email address is : DIAZ@cgmvax.cgm.cnrs-gif.fr Yolande Diaz. From owner-chromosomes@net.bio.net Fri Mar 31 23:00:00 1995 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!news.cac.psu.edu!news.pop.psu.edu!hudson.lm.com!newsfeed.pitt.edu!uunet!in1.uu.net!newstf01.news.aol.com!newsbf02.news.aol.com!not-for-mail From: drt5861@aol.com (DRT5861) Newsgroups: bionet.genome.chromosomes Subject: SOLID-PHASE SEQUENCING Date: 31 Mar 1995 15:58:42 -0500 Organization: America Online, Inc. (1-800-827-6364) Lines: 2 Sender: root@newsbf02.news.aol.com Message-ID: <3lhqe2$ogm@newsbf02.news.aol.com> Reply-To: drt5861@aol.com (DRT5861) NNTP-Posting-Host: newsbf02.mail.aol.com HAS ANYONE OUT THERE USED THE NEW PHARMACIA SOLID-PHASE SEQUENCING TECHNIQUE? I WANT TO KNOW IF ITS AS EASY AS IT SEEMS.