From owner-chromosomes@net.bio.net Sun Apr 02 23:00:00 1995 Path: biosci!bloom-beacon.mit.edu!spool.mu.edu!howland.reston.ans.net!pipex!news.pavilion.co.uk!line03.kemp-du.pavilion.co.uk!user From: jpwscyto@pavilion.co.uk (Jon Waterman-Smith) Newsgroups: bionet.chlamydomonas,bionet.diagnostics,bionet.drosophila,bionet.general,bionet.genome.arabidopsis,bionet.genome.chrom22,bionet.genome.chromosomes Subject: LAUNCH OF FREE MAGS/WWW PAGES FOR BIONET... Date: 3 Apr 1995 09:48:11 GMT Organization: Pavilion Internet plc, Brighton, England Lines: 29 Message-ID: NNTP-Posting-Host: line03.kemp-du.pavilion.co.uk Xref: biosci bionet.chlamydomonas:502 bionet.diagnostics:55 bionet.drosophila:978 bionet.general:14454 bionet.genome.arabidopsis:3163 bionet.genome.chromosomes:529 Within the next 6 weeks a new series of magazines will be launched, which will have a hard copy available to interested parties, as well as a major publication series available on the web. The magazines will deal with many subject areas, and will have hypertext points imprinted into features, so the reader can access the WWW, and simply go to the relevant pages, following the same hypertext links as shown in the magazines. The future....... Our aim is to promote science, and scientific issues mainly in the field of bioscience. Both the magazines and the WWW pages will eventually have articles and links to publications, posters, and as many products and suppliers as we can get interested in publishing with us. So, if you know of anyone who would be interested in providing articles, publishing information to assist other scientists, or you work for a company who wants to advertise , and set up pages on the WWW, we aim to become the one stop point to leap off into the web, and other internet areas. Send me an email, and I'll keep you up to date on our progress. Also let me know if you want to register for the first issue of the first magazine to be published early May '95. Diagnostics, Biotechnology and Life-sciences will be the areas first targeted for publication. TO ALL INTERESTED ADVERTISERS - the deadline for the first issue will be in 3-4 weeks time. Please contact me urgently for more information - your advert will also secure you web space and hypertext links!!!!! I look forward to hearing from you all... Best wishes, Jon Waterman-Smith E-mail address..... jpwscyto@pavilion.co.uk From owner-chromosomes@net.bio.net Sun Apr 02 23:00:00 1995 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!vixen.cso.uiuc.edu!newsrelay.iastate.edu!news.iastate.edu!cgwu From: cgwu@iastate.edu (Chenggang Wu) Newsgroups: bionet.genome.chromosomes Subject: Help Date: 3 Apr 1995 15:31:15 GMT Organization: Iowa State University, Ames, Iowa (USA) Lines: 16 Message-ID: <3lp4c3$6eh@news.iastate.edu> NNTP-Posting-Host: pv02a6.vincent.iastate.edu Hi, I need help. I don't have reference in my hand. My questions are: How many chromosome number is in carrot? Is it diploid or triploid in carrot? Your early reply will be highly appreciate. My e-mail address: pli@iastate.edu Thanks in advance. Ping Li -- ChengGang Wu cgwu@iastate.edu From owner-chromosomes@net.bio.net Mon Apr 03 23:00:00 1995 Newsgroups: bionet.genome.chromosomes Path: biosci!bcm!cs.utexas.edu!swrinde!pipex!oleane!jussieu.fr!fdn.fr!uunet!newsflash.concordia.ca!CC.UMontreal.CA!bilinskr From: bilinskr@ERE.UMontreal.CA (Bilinski Robert) Subject: QC-PCR problem Message-ID: Keywords: quantitative competitive PCR, t(14;18) Sender: news@cc.umontreal.ca (Administration de Cnews) Organization: Universite de Montreal Date: Tue, 4 Apr 1995 03:39:37 GMT Lines: 35 Hello, i'm using a friend's account to write this, feel free to send him any and all replies (as well as posting them on the newsgroup for the benefit of others...). Oh... and i must warn you that my english is not the best in the world... I'm trying to develop a competitive PCR method to quantify cell characterized by translocation (14;18). I cloned a PCR product of a cell line harboring this translocation, and now I must purify it and dilute it to use it like an internal control. And I had some bugs with my plasmid's purification (I have ribonucleotides and my 260\280 D.O. are 1.7) I think i know why it's difficult for me to obtain a fonctionnnal dilution. It's probably due to missquantification of my plasmid DNA stock. Are there any other possible explanations for this phenomena? Could someone suggest a possible solution to this problem? Other usefull info: - I used a QIAGEN kit for maxiprep - I isolated the digested plasmid from agarose gel to obtain purer DNA but I failed in this attempt. (this was the solution i tried when i saw a RNA and ribonucleotide contamination in a DNA stock solution) I would appreciate any help anyone can offer... Thanks in advance Brigitte ps: i"m also looking for any ressources available for people doing PCR in the Montreal region (province of Quebec, Canada), or maybe the names of other researchers (or groups of) in the same field close by... I'm presently the only one in my research center involved in such work (HMR, affiliated with The Universite de Montreal) From owner-chromosomes@net.bio.net Mon Apr 03 23:00:00 1995 Newsgroups: bionet.microbiology,bionet.genome.chromosomes,bionet.genome.chrom22,bionet.general,bionet.emf-bio Path: biosci!ns1.faseb.org!darwin.sura.net!nih-csl!lhc!news From: recipon@ncbi.nlm.nih.gov (Herve Recipon) Subject: Improvements to BLAST databases Message-ID: <1995Apr4.160758.3529@nlm.nih.gov> Sender: news@nlm.nih.gov Reply-To: recipon@ncbi.nlm.nih.gov Organization: National Center for Biotechnology Information Date: Tue, 4 Apr 95 16:07:58 GMT Lines: 91 Xref: biosci bionet.microbiology:1910 bionet.genome.chromosomes:532 bionet.general:14484 bionet.emf-bio:230 As part of NCBI's ongoing efforts to provide BLAST users with access to the most up-to-date, comprehensive and useful databases, the following changes are planned for BLAST databases: 1) Closer synchronization between BLAST and other NCBI databases. 2) Separation of EST data from other non-redundant nucleotide sequences. 3) A new non-redundant protein sequence database. 4) Discontinued support for seldom-used or unmaintained databases. We expect to implement these changes in July 1995. More details about each proposed change are provided below. If you have any questions or concerns, please direct them to blast-help@ncbi.nlm.nih.gov Closer synchronization between BLAST and other databases: BLAST databases will be built from the same source data that are now used for Entrez, the Retrieve e-mail server and the daily updates. This means that sequences identified in a BLAST search will always be accessible from NCBI search services. As part of the project to improve synchrony among BLAST and other forms of the sequence databases, every sequence will have a unique identifier called the "gi" number. The gi number of an entry changes with each update to the sequence data, something not necessarily true for the accession number or locus name. This will allow Entrez or Retrieve users to be certain that they are retrieving exactly the same revision of the sequence identified by BLAST. Additionally a gi number allows easy automated retrieval of sequences from database interfaces. Retrieval by accession number or locus name will, of course, continue to be supported. The non-redundant BLAST nucleotide databases contain all of the data submitted to the international sequence database collaborators: GenBank, EMBL and DDBJ. Since data are quickly exchanged among the three, there is no need to search them individually. Therefore the option of specifying a specific database will be removed. Users may be assured of searching all publically available sequences, regardless of the database of origin. Separation of EST data: In order to give users more control over their BLAST searches, the EST division will be split off from the other GenBank divisions. This separation is necessitated by the phenomenal growth in the EST division, which will increase by about 4000 to 6000 sequences/week until the summer of 1996. Partitioning the non-redundant database will assure that non-EST matches are not masked by the tremendous number of EST sequences. Conversely it will be straightforward to search the EST division and be assured of only EST hits. While this change will require that some users modify their search strategy, we believe that the ability to better specify the contents of the database will make BLAST searches much more productive for most users. The reconfigured databases will retain the names "nr" and "dbest" so as not to break existing scripts. The "new" nr will also differ from the current non-redundant nucleotide database in having a common origin with Entrez and other NCBI source databases. New non-redundant protein sequence database: The protein sequences now available in Entrez will be searchable in a non-redundant database called "nr". This database will be comprised of pdb; swiss-prot; pir sequences not found in pdb or swiss-prot; prf not covered in pdb, swiss-prot or pir; and all conceptual translations from GenBank sequences not in any of the other databases. As with the non-redundant nucleotide database, the nr protein database will be derived from the same source as Entrez and other NCBI databases. A second new protein sequence database containing only sequences from swiss-prot and pdb will also be available. This database, called "spdb", will allow users to restrict searches to these two highly annotated sources. Discontinued support for databases: The Kabat, EPD, and TFD databases are either infrequently used or not regularly updated. Therefore BLAST access to these databases will be discontinued. --blast-help@ncbi.nlm.nih.gov From owner-chromosomes@net.bio.net Tue Apr 04 23:00:00 1995 Path: biosci!newshost.lanl.gov!news.ttu.edu!aurora.LaTech.edu!darwin.sura.net!udel!gatech!howland.reston.ans.net!news.sprintlink.net!psgrain!nntp.ski.mskcc.org!mac-93.k-g2.ski.mskcc.org!user From: d-burtrum@ski.mskcc.org,mrtour@stud.med.cornell.edu (michelle or doug......) Newsgroups: bionet.genome.chromosomes Subject: help in looking at gross chromatin structure... Date: Tue, 04 Apr 1995 14:07:31 -0500 Organization: Memorial Sloan-Kettering Cancer Center Lines: 19 Message-ID: NNTP-Posting-Host: mac-93.k-g2.ski.mskcc.org Our lab has a set of transgenic mice which overexpress a specific protein in the lymphoid tissues. Preliminary data suggests that the chromatin structure in transgenic tissues has been modified in some way such that the chromatin is more dense or has interrupted protein interaction... I need suggestions for many different ways to test this... microscopy, enzyme digestions or any other suggestions are greatly welcome. frazelled grad michelle mrtour@stud.med.cornell.edu -- db or Michelle From owner-chromosomes@net.bio.net Tue Apr 04 23:00:00 1995 Path: biosci!adam.cc.sunysb.edu!news.sprintlink.net!cs.utexas.edu!swrinde!pipex!uknet!daresbury!not-for-mail From: "rifat_h@icr.ac.uk" Newsgroups: bionet.genome.chromosomes Subject: Amersham Vistra Sequencing Robot Date: 5 Apr 1995 13:03:28 +0100 Lines: 10 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <3lu0ug$94e@mserv1.dl.ac.uk> X-Mts: smtp X-Authentication-Warning: jupiter: Host localhost didn't use HELO protocol Original-To: biochrom@dl.ac.uk Hi, Has anyone tried the Amersham Vistra Robot for automated DNA Sequencing, and if so what kind of success rate was achieved. I have tried the Taq terminator sequencing on with variable degree of success. Thanx. Rifat. From owner-chromosomes@net.bio.net Wed Apr 05 23:00:00 1995 Path: biosci!biosci!not-for-mail From: lstein@genome.wi.mit.edu (Lincoln Stein) Newsgroups: bionet.announce,bionet.genome.chromosomes Subject: RELEASE 6 OF WHITEHEAD/MIT HUMAN GENOMIC MAPPING PROJECT Date: 5 Apr 1995 10:34:29 -0700 Organization: Whitehead Institute for Biomedical Research Lines: 92 Sender: biohelp@net.bio.net Approved: bionews-moderator@net.bio.net Distribution: world Message-ID: <3lukb5$8nf@net.bio.net> Xref: biosci bionet.announce:1978 bionet.genome.chromosomes:535 ANNOUNCING: WHITEHEAD INSTITUTE/MIT CENTER FOR GENOME RESEARCH HUMAN GENOMIC MAPPING PROJECT DATA RELEASE 6 (MARCH 1995) Lines: 84 Message-ID: <3lsvks$rm9@senator-bedfellow.MIT.EDU> NNTP-Posting-Host: gonzo.wi.mit.edu The sixth release of data from the Human Physical Mapping Project at the Whitehead Institute/MIT Genome Center, covering data generated through the end of March, 1995, is now available. This data release contains YAC screening data for 8868 sequence tagged sites (STSs) screened on the CEPH mega-YAC library. For each STS, we report addresses for the YACs found to contain the STS. From the data obtained so far, there are over 1100 contigs assembled using double linkage between STSs. The data is available electronically in two ways. ANONYMOUS FTP: The entire data release is available as a set of Microsoft Excel files and tab-delimited ascii files on our ftp server. Using an ftp client (such as "Fetch" on the Macintosh), connect to ftp-genome.wi.mit.edu Use "anonymous" as your user name, and give your e-mail address as your password. The data files are present in the directory /distribution/human_STS_releases/mar95. The contents are as follows: 03-95.INTRO.mswd.hqx - Description of the data release, Macintosh format. 03-95.INTRO.txt - The same as ascii text 03-95.STS2YAC.sea.hqx - STS & YAC screening data, in MS-Excel format. 03-95.STS2YAC.txt - The same as tab-delimited text. 03-95.YAC2STS.txt - Inverse map of YAC to STS screening data 03-95.CONTIG2STS.txt - Doubly-linked contig information 03-95.sequence.txt - Full sequences of previously unpublished STSs. THE WORLD-WIDE WEB: You will need a World Wide Web client such as Mosaic (Unix, MS-Windows and Macintosh) or MacWeb (Macintosh). Instruct your client to connect to http://www-genome.wi.mit.edu/ >From there, follow the "Human Physical Mapping Project" link. You will be able to browse and download the raw data set as well as to view doubly-linked contigs. A subset of the STSs (those for which we have chromosomal assignments) are also available through the Genome Database (GDB). QUESTIONS AND PROBLEMS. If users have any questions or problems, please contact us at human_STS_help@genome.wi.mit.edu We invite suggestions about how to make these data release most useful. DATA RELEASE POLICY AND CITATION. Data releases are scheduled monthly. At the end of each month, all genomic mapping data are reviewed and prepared for distribution via CGR's electronic databases. Data releases typically occur within a week of the close of the month. Releases are announced by electronic messages posted to the following two newsgroups: "bionet.genome.chromosomes" and "bionet.announce". CGR's data release policy aims to ensure that scientific colleagues have immediate access to information that may assist them in the search for genes. Data releases do not constitute scientific publication of CGR's work, but rather provide scientists with a regular look into our lab notebooks. For projects aimed at the analysis of particular genes or subchromosomal regions, permission is hereby granted to use our data without the need for a formal collaboration, subject only to appropriate acknowledgment. For projects aimed at large-scale mapping of entire chromosomes or entire genomes, use of the data and markers should be on a collaborative basis. The information for the human genome mapping project should be cited as: Whitehead Institute/MIT Center for Genome Research, Human Physical Mapping Project, Data Release 6 (March 1995). -- ======================================================================== Lincoln D. Stein Whitehead Institute/MIT Genome Center lstein@genome.wi.mit.edu Cambridge, MA 02142 http://www-genome.wi.mit.edu/~lstein ======================================================================== From owner-chromosomes@net.bio.net Sun Apr 09 23:00:00 1995 Path: biosci!internet!biosci!not-for-mail From: biohelp (BIOSCI Administrator) Newsgroups: bionet.genome.chromosomes Subject: UNSUBSCRIBING, BIOSCI ARCHIVES, ADDRESS DATABASE & BIOSCI FAQ Date: 10 Apr 1995 02:00:27 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 347 Sender: daemon@net.bio.net Distribution: world Message-ID: <199504100900.CAA02375@net.bio.net> NNTP-Posting-Host: net.bio.net Four important items follow: How to cancel e-mail subscriptions to BIOSCI newsgroups, BIOSCI archive searching, the BIOSCI FAQ, and the BIOSCI User Address Directory form. If you have not yet listed yourself in our BIOSCI user directory, please take a few minutes to complete and return the form below. If your personal information has changed since you listed yourself, please send us a complete new updated form. We can not make manual revisions to existing entries. Sincerely, Dave Kristofferson BIOSCI/bionet Manager biosci-help@net.bio.net **** How to cancel a BIOSCI e-mail subscription **** If you want to cancel your e-mail subscription to this group, PLEASE DO NOT POST YOUR UNSUBSCRIBE REQUEST TO THE NEWSGROUP ADDRESS (NOR REPLY TO A MESSAGE POSTED TO THE NEWSGROUP)!!! This would send your request to all of the readers of the newsgroup, but it might still not be seen by the BIOSCI staff - thus you would annoy many people and possibly not accomplish your goal anyway. IF YOU ARE LOCATED IN THE AMERICAS OR PACIFIC RIM COUNTRIES, please send a message to biosci@net.bio.net Instructions on how to subscribe/unsubscribe will be returned automatically, so the contents of your message do not matter. IF YOU ARE LOCATED IN EUROPE, AFRICA OR CENTRAL ASIA, please send a message to MXT@dl.ac.uk containing the word help in the body of the message to retrieve e-mail server instructions. Any text placed on the Subject: line of your message will be ignored, so be sure to put the "help" command in the body of the message. If you need personal assistance, a BIOSCI staff member can be contacted at either of the following addresses. Please contact the address designated for your location. Support Address Location --------------- -------- biosci@daresbury.ac.uk Europe, Africa, and Central Asia biosci-help@net.bio.net Americas and the Pacific Rim **** SEARCHING BIOSCI ARCHIVES **** The easiest way to search the BIOSCI archives is to use Mosaic or another World Wide Web browser and connect to the BIOSCI WWW home page at URL http://www.bio.net/. Select the hypertext link to the BIOSCI archives. This gives you read access to all newsgroup messages and the ability to search the indexes described below. You can also use gopher software and connect over the Internet to net.bio.net, the U.S. BIOSCI computer. We maintain three indexes which are searchable from the main gopher menu on net.bio.net: (1) an index of all BIOSCI postings; (2) an index of individual journal article references from the Table of Contents postings on the BIO-JOURNALS newsgroup; and (3) an index of BIOSCI users including regular mail and e-mail addresses, phone/FAX numbers, research interests, and newsgroup participation. E-mail users can search the BIOSCI archives by using our waismail e-mail server. For instructions send the message help to waismail@net.bio.net. Leave the Subject: line blank (anything entered on the Subject: line is ignored). WAIS software can also be used to search the archives as described in the BIOSCI FAQ (see below). Finally, the BIOSCI archive files are accessible by anonymous FTP to net.bio.net [134.172.2.69] in the directory pub/BIOSCI. **** BIOSCI FREQUENTLY ASKED QUESTIONS (FAQ) SHEET **** New users of BIOSCI/bionet may want to read the "Frequently Asked Questions" or "FAQ" sheet for BIOSCI. The FAQ provides details on how to participate in these forums and fix problems that you might encounter in using the newsgroups. The FAQ and other BIOSCI documentation is available through our WWW home page at URL http://www.bio.net/. It is also available for anonymous FTP from net.bio.net [134.172.2.69] in pub/BIOSCI/doc/biosci.FAQ or for retrieval by gopher to net.bio.net, port 70. It may also be requested by sending the command info faq in the body of an e-mail message to the Internet address biosci-server@net.bio.net. Please do not enter the info faq command on the Subject: line of your message since the e-mail server ignores text on the Subject: line. The FAQ is also posted on the first of each month to the newsgroup BIONEWS/bionet.announce immediately following the posting of the BIOSCI information sheet. **** BIOSCI USER ADDRESS DIRECTORY **** Please take this opportunity to add your name and address information to the BIOSCI User Address Database if you have not already done so. Below is the address form that we would like each reader of the BIOSCI/bionet newsgroups to complete and return if you would like to be listed in our database. The database serves as a directory that enables biologists, who are currently using (or even just reading) the BIOSCI newsgroups, to look up e-mail addresses and other information about our users. The address database is reindexed nightly for WAIS, waismail, gopher, and WWW access (the URL is http://www.bio.net). If you have access to gopher, connect to net.bio.net to search the database. If you have access to WAIS, please use our WAIS source biologists-addresses.src. If you are not on the Internet, please use our waismail server (send the word "help" to waismail@net.bio.net to get instructions; any text on the Subject: line of your message will be ignored, so put the help command in the body of the mail message.). Please carefully follow the instructions for completing the form below and return it to either of the following two addresses (whichever is more convenient for you). Thanks in advance for taking the time to complete and return the form. Addresses for returning forms Location Network ----------------------------- -------- ------- biovote@net.bio.net U.S.A. Internet/BITNET biovote@daresbury.ac.uk U.K. JANET MAKING SURE THAT YOUR INFORMATION IS CURRENT This notice will be mailed bimonthly to each newsgroup. You should check your database entry from time-to-time to see if your address information is still up-to-date. Using Gopher to complete the form --------------------------------- If you don't want to use a text editor, you can also use Dan Jacobson's gopher site to fill out the address database form as follows. Otherwise skip this section on gopher and proceed to the instructions for filling out the form below. > To add yourself to the database just point your > gopher client at merlot.gdb.org and select the following: > > --> 14. Searching For Biologists/ > > --> 9. E-mail Addresses of Biosci-Bionet Users/ > > --> 1. Add (or Correct) Your Address to the BIOSCI User Address > Data.. > > > And fill out the form. or Rob Harper's gopher site in Europe as follows: > Europeans can point their gopher client at gopher.csc.fi and add their > information to the database. All entries will be mailed directly to > Dave for incorporation in a wais source. > > The path to the questionare is as follows. > > > 6. Information in English/ > > 5. Scientific and other topics/ > > 1. Finnish EMBnet BioBox/ > > 9. FAQ Files/ > > 5. Bionauts Address Database (questionaire) > IMPORTANT INSTRUCTIONS - PLEASE READ CAREFULLY Please enter all responses after the : on each line, leaving one (1) blank space after the : (i.e., before the start of your text). Please do NOT extend your responses past the end of each line (80 characters). PLEASE DO NOT alter any of the field identifiers such as "first name: ". If you have nothing to enter after a field identifier, PLEASE LEAVE IT - do not delete it even if there is no data on the line in question. Several lines are provided at the end of the form for comments, but, please adhere to the line length restriction. On the date: line, please enter the date in the DD-MM-YY format, e.g., 15-05-93 for 15 May 1993. This line will tell others when the information was last updated. Please be sure to include the 0's for single digit days or months, e.g., 15-05-93, not 15-5-93. Note that the "e-mail network: " line below is for specifying, e.g., "Internet," "BITNET," "EARN," "JANET," or whatever other network that your computer may be on. If you are uncertain about any field, please feel free to leave it blank, but please DO NOT DELETE the field identifier from the form! In the first field below, "New information or Update ...", please enter "N" if this is the first time that you have registered in the directory or "U" if you are correcting a listing that you sent to us previously. The comment: lines may be used for anything that you like but PLEASE DO NOT DELETE THEM FROM THE FORM OR ALTER THEM. One suggested use is to list the names of the newsgroups in which you participate. Please use the MAILING LIST name (see below - the latest version of the list can be requested from biosci@net.bio.net) instead of the USENET name even if you don't participate by e-mail. WAIS might get confused by the periods in the USENET names. This allows one to retrieve via WAIS or waismail the list of participants in a particular group. For example: comment: ARABIDOPSIS PLANT-BIOLOGY BIONEWS On the comment: lines use these names below ---- NOT the USENET names below MAILING LIST NAME USENET Newsgroup Name ----------------- --------------------- ACEDB-SOFT bionet.software.acedb AGEING bionet.molbio.ageing AGROFORESTRY bionet.agroforestry ARABIDOPSIS bionet.genome.arabidopsis ASCB bionet.prof-society.ascb BIOCAN bionet.prof-society.cfbs BIOFORUM bionet.general BIO-INFORMATION-THEORY bionet.info-theory BIONAUTS bionet.users.addresses BIONEWS bionet.announce BIO-JOURNALS bionet.journals.contents BIO-MATRIX bionet.molbio.bio-matrix BIOPHYSICAL-SOCIETY bionet.prof-society.biophysics BIOPHYSICS bionet.biophysics BIO-SOFTWARE bionet.software BIOTHERMOKINETICS bionet.metabolic-reg BIO-WWW bionet.software.www CARDIOVASCULAR-RESEARCH bionet.biology.cardiovascular CELEGANS bionet.celegans CELL-BIOLOGY bionet.cellbiol CHLAMYDOMONAS bionet.chlamydomonas CHROMOSOMES bionet.genome.chromosomes COMPUTATIONAL-BIOLOGY bionet.biology.computational CSM bionet.prof-society.csm CYTONET bionet.cellbiol.cytonet DROSOPHILA bionet.drosophila EMBL-DATABANK bionet.molbio.embldatabank EMF-BIO bionet.emf-bio EMPLOYMENT bionet.jobs EMPLOYMENT-WANTED bionet.jobs.wanted FASEB bionet.prof-society.faseb GDB bionet.molbio.gdb GENBANK-BB bionet.molbio.genbank GENETIC-LINKAGE bionet.molbio.gene-linkage GRASSES-SCIENCE bionet.biology.grasses HIV-MOLECULAR-BIOLOGY bionet.molbio.hiv HUMAN-GENOME-PROGRAM bionet.molbio.genome-program IMMUNOLOGY bionet.immunology INFO-GCG bionet.software.gcg JOURNAL-NOTES bionet.journals.note METHODS-AND-REAGENTS bionet.molbio.methds-reagnts MICROBIOLOGY bionet.microbiology MOLECULAR-EVOLUTION bionet.molbio.evolution MOLECULAR-MODELLING bionet.molec-model MOLLUSC-MOLECULAR-NEWS bionet.molbio.molluscs MYCOLOGY bionet.mycology NEUROSCIENCE bionet.neuroscience N2-FIXATION bionet.biology.n2-fixation PARASITOLOGY bionet.parasitology PHOTOSYNTHESIS bionet.photosynthesis PLANT-BIOLOGY bionet.plants POPULATION-BIOLOGY bionet.population-bio PROTEIN-ANALYSIS bionet.molbio.proteins PROTEIN-CRYSTALLOGRAPHY bionet.xtallography PROTISTA bionet.protista RAPD bionet.molbio.rapd SCIENCE-RESOURCES bionet.sci-resources STADEN bionet.software.staden STRUCTURAL-NMR bionet.structural-nmr TROPICAL-BIOLOGY bionet.biology.tropical URODELES bionet.organisms.urodeles VIROLOGY bionet.virology WOMEN-IN-BIOLOGY bionet.women-in-bio YEAST bionet.molbio.yeast ZBRAFISH bionet.organisms.zebrafish Listing newsgroups on the comment: line is optional, of course. Thanks again for your cooperation! --------------- please cut here and return portion below --------------- New information or Update to old record (enter N or U): date (DD-MM-YY): first name: middle initial: family name: job title: e-mail address: e-mail network: phone number: FAX number: institution: address1: address2: address3: city: state/province: country: postal code: research interest: research interest: comment: comment: comment: comment: comment: From owner-chromosomes@net.bio.net Sun Apr 09 23:00:00 1995 Path: biosci!rutgers!uwm.edu!vixen.cso.uiuc.edu!howland.reston.ans.net!pipex!uunet!news.inhouse.compuserve.com!news.production.compuserve.com!news From: John Leslie <74740.247@CompuServe.COM> Newsgroups: bionet.general,bionet.genome.arabidopsis,bionet.genome.chromosomes Subject: Need guests for radio program Date: 9 Apr 1995 14:43:17 GMT Organization: World Radio Inc. Lines: 6 Message-ID: <3m8rq5$km$3@mhadf.production.compuserve.com> Xref: biosci bionet.general:14561 bionet.genome.arabidopsis:3183 bionet.genome.chromosomes:537 I am the host of a syndicated radio program. We interview 9 guests each weekend. Would you make an interesting guest? Please E-Mail me. -- Jan L Kokochak From owner-chromosomes@net.bio.net Sun Apr 09 23:00:00 1995 Path: biosci!adam.cc.sunysb.edu!news.sprintlink.net!pipex!sunic!sunic.sunet.se!news.funet.fi!news.csc.fi!cscslip.csc.fi!user From: engelhar@csc.fi (Peter Engelhardt) Newsgroups: bionet.genome.chromosomes Subject: Where to find Abs to topo II? Followup-To: bionet.genome.chromosomes Date: Tue, 11 Apr 1995 01:03:53 +0200 Organization: Dept. of Virology, Univ. of Helsinki Lines: 15 Message-ID: NNTP-Posting-Host: cscslip.csc.fi I am looking after Abs to nonhistones specially to topoisomerase II. Could somebody inform me if they are available and where? I should also be interested in Abs to histones. Peter Engelhardt, Ph D Research Fellow Department of Virology, P.O.Box 21 (Haartmaninkatu 3) SF-00014 University of Helsinki, Finland Tel: EM-laboratory+358-0-4346507 (direct) CSC computer facilities +358-0-4573229 Fax: +358-0-4346491 From owner-chromosomes@net.bio.net Mon Apr 10 23:00:00 1995 Path: biosci!rutgers!gatech!howland.reston.ans.net!pipex!lyra.csx.cam.ac.uk!NewsWatcher!user From: rwf@mole.bio.cam.ac.uk (Robert Feakes) Newsgroups: bionet.genome.chromosomes,bionet.molbio.genome-program Subject: Online Automated DNA Sequencing Troubleshooting Guide Date: 11 Apr 1995 12:51:54 GMT Organization: Dept. of Genetics, Univ. of Cambridge. UK. Lines: 31 Message-ID: NNTP-Posting-Host: png-mac14.gen.cam.ac.uk Xref: biosci bionet.genome.chromosomes:539 bionet.molbio.genome-program:1334 Following discussions with people at a number of sites I am trying to establish an online automated DNA sequencing troubleshooting guide. This will be done using the WWW and ftp. Users may submit sequencing sample files showing the problems they are having, which may be in template preparation, sequence interpretation or washing the glass plates, for example. Others will then download the sample file and then offer suggestions as to what may be the problem. Hopefully this will over time build up into a resource containing details of many of the common and not so common problems encountered in automated sequencing. I should say that my experience so far has been with ABI373As and so anyone using other machines who has any suggestions for how this might be better handled with respect to those machines should say so. This initial proposal is to help me get some idea of the level of interest in the guide and also to gather suggestions as to its structure and content. For example, one important aspect if an archive is to be established is a suitable classification system to enable users to find the files they want quickly. An initial system might be by sequencing chemistry with sub-categories by type of template, for example. I am very keen for this to go ahead and would welcome expressions of interest and any suggestions. I would also welcome responses from people willing to run "mirror" sites, particularly in the US and Japan, to reduce traffic and the load on our server. Robert Feakes rwf@mole.bio.cam.ac.uk From owner-chromosomes@net.bio.net Wed Apr 12 23:00:00 1995 Newsgroups: bionet.genome.chromosomes,bionet.molbio.genome-program Path: biosci!rutgers!gatech!newsfeed.pitt.edu!uunet!newsflash.concordia.ca!news.mcgill.ca!clouso.crim.ca!athena.ulaval.ca!dietcola.rsvs.ulaval.ca!user From: Luc.Simon@rsvs.ulaval.ca (Luc Simon) Subject: Re: Online Automated DNA Sequencing Troubleshooting Guide Message-ID: Sender: news@athena.ulaval.ca Nntp-Posting-Host: dietcola.rsvs.ulaval.ca Organization: Universite Laval References: Date: Thu, 13 Apr 1995 17:40:08 GMT Lines: 25 Xref: biosci bionet.genome.chromosomes:540 bionet.molbio.genome-program:1335 In article , rwf@mole.bio.cam.ac.uk (Robert Feakes) wrote: > Following discussions with people at a number of sites I am trying to > establish an online automated DNA sequencing troubleshooting guide. > ... Great idea!! > I am very keen for this to go ahead and would welcome expressions of > interest and any suggestions. > > I would also welcome responses from people willing to run "mirror" sites, > particularly in the US and Japan, to reduce traffic and the load on our > server. > I am willing to set up a mirror here as soon as you have something going on your side of the pool! -- Luc Simon Universite Laval Ste-Foy, Quebec From owner-chromosomes@net.bio.net Wed Apr 12 23:00:00 1995 Path: biosci!biosci!not-for-mail From: andrewt@r-node.io.org (Andrew Thomas) Newsgroups: bionet.cellbiol,bionet.general,bionet.genome.chromosomes,bionet.immunology,bionet.microbiology,bionet.molbio.methds-reagnts,bionet.molbio.proteins,bionet.molec-model,bionet.mycology,bionet.plants,bionet.software,bionet.virology Subject: SURVEY - Things we'd like to see (commercial) Date: 13 Apr 1995 14:44:34 -0700 Organization: Sakura Software Inc., Mississauga, Ontario, Canada Lines: 178 Sender: biohelp@net.bio.net Distribution: world Message-ID: <3mk602$3vm@net.bio.net> NNTP-Posting-Host: net.bio.net Xref: biosci bionet.cellbiol:2072 bionet.general:14638 bionet.genome.chromosomes:541 bionet.immunology:3823 bionet.microbiology:1994 bionet.molbio.methds-reagnts:27180 bionet.molbio.proteins:4282 bionet.molec-model:320 bionet.mycology:1936 bionet.plants:6388 bionet.software:11785 bionet.virology:2246 I am posting this for a business consulting company. It is a questionnaire on the subject of lab techniques, equipment and software in the biotechnology field, with an eye toward introducing prducts into those areas where respondents feel there are weaknesses. This is your chance to complain about everything from overpriced equipment to ergonomic disfunction :-). Please send responses to one of the two addresses below: couper@magi.com andrewt@io.org Thanks in advance, Andrew Thomas ------------------------------------------------------------- April 5, 1995 ADP & Associates 42 Rideau River Lane Ottawa, Ontario K1S 0X1 TEL: (613)526-5609 email: couper@magi.com We are a business consulting company conducting a market study on behalf of a research and development group interested in expanding into biotechnology. Our client is specialized in the creation of new and innovative scientific equipment. The object of this survey is to get the direct input of the actual users of the intended technology. Our client is constantly looking to develop products that will simplify your work, save you time, improve safety and reduce your operating costs. In the questionnaire we have tried to find a balance where the questions will simultaneously cover all our respondants areas of interest and be specific enough for their particular needs. We have also tried to keep it as short as possible. Should you find that our questionnaire does not adequately address your interests, please feel free to add your comments at the end. All of your comments are valuable to us and all of your ideas have potential. Our client is capable of producing products with a varying range of complexity, from the most rudimentary test-tubes to specialized automation hardware and computer software. Should your suggestion be a starting point for an actual product, you will qualify for an idea/development bonus of $500.00 We would like to take this opportunity to thank you for your valuable input. If you have any questions or require further information please feel free to contact us at the above address or telephone number. If you would like to be kept informed of our client's product development, please print your name, address and FAX number at the bottom of the questionnaire. Yours truly, A. Douglas Palmer. -------------------------------------------------------------- Questionnaire 1. What are the three most time consuming tasks or procedures carried out in your laboratory? 2. Is equipment used in performing these tasks? [Yes/No] If so, what? If not, what would you like to see made available? 3. What types of equipment or tools for research, production or management would you like to see made available to you (not currently available on the market)? 1. 2. 3. 4. 5. What improvements (not available on the market) to your current equipment would you like to see? Please describe. 4. What types of equipment or tools, which you are not currently using, would you purchase if it were priced lower? What type of equipment or tools do you feel you are paying too much for? 5. What dangerous activities do you regularly perform? Could they be made safer with better tools or equipment? 6. What are some of the more "menial" tasks performed in your laboratory? (tasks which use up valuable personnel hours, taking away from research). 7. Could your daily operations be improved by the use of specialized computer software? [Yes/No] What should this software be capable of achieving? Please provide as much detail as you feel appropriate. Log book Data Manipulation Data Analysis Database Graphics Product interfaces Simulation and Prediction Control and Monitoring of Equipment Other 8. What are your fields of expertise? Please indicate as many as appropriate. (Please be as specific as you can). Biochemistry Microbiology Genetic Research Virology Plant Research Animal Research Medical Research Pharmaceuticals Other. 9. Is your research primarily market oriented or investigative? 10. What is the size of your laboratory (number of personnel)? 1 - 5 6 - 10 11 - 15 16 - 20 > 20 11. Which trade publications do you read? 1. 2. 3. 4 5 12. If you have any other comments or suggestions please feel free to put them here. Name: Work Address: FAX #: email address: -- Andrew Thomas - President, Sakura Software Inc. Watch for SCADALisp - Real-time control and UI language for QNX/UNIX For information, email andrewt@io.org From owner-chromosomes@net.bio.net Thu Apr 13 23:00:00 1995 Newsgroups: bionet.general,bionet.genome.arabidopsis,bionet.genome.chromosomes Path: biosci!adam.cc.sunysb.edu!news.sprintlink.net!crash!pzcc.bitenet!news From: Bruno Novi Subject: Re: Need guests for radio program Organization: CTS Network Services (CTSNET), San Diego, CA Date: Fri, 14 Apr 1995 05:42:56 GMT Message-ID: References: <3m8rq5$km$3@mhadf.production.compuserve.com> Sender: news@crash.cts.com (news subsystem) Nntp-Posting-Host: brunging.cts.com Lines: 1 Xref: biosci bionet.general:14649 bionet.genome.arabidopsis:3193 bionet.genome.chromosomes:544 What kind of guests are you looking for? I word at San Diego State University, and I may be able to help. Please e-mail me more info on your program. Where it is broadcast from, where it goes, who is the audience, what type of guests have you had in the past (like who?), etc. Be happy to help out. Please use my e-mail address at the university: gjulian@mail.sdsu.edu From owner-chromosomes@net.bio.net Thu Apr 13 23:00:00 1995 Path: biosci!rutgers!rockyd!cmcl2!usenet From: Gary Welz Newsgroups: bionet.genome.chromosomes Subject: Is the genome like a computer program? Date: 14 Apr 1995 01:04:34 GMT Organization: New York University Lines: 23 Message-ID: <3mkhn2$s4a@cmcl2.NYU.EDU> NNTP-Posting-Host: stuporduck.cs.nyu.edu Mime-Version: 1.0 Content-Type: text/plain; charset=iso-8859-1 Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 1.1b3 (Macintosh; I; 68K) To: gary@setn.org X-URL: news:bionet.genome.chromosomes I'm writing a speculative article about the large scale structure of the genome. Does anyone besides me think that an organism's genome can be regarded as a computer program? I mean that its structure can be presented as a flowchart with genes as objects connected by logical terms like "and" and "or?" Of course, conditional activity in the genome - the analog of the "while" loop - has been studied for some time. One development that might support this point of view is the recent demonstration (reported in last week's Science) that the eyeless gene can be inserted into various parts of the chromosome of a fly and cause it to have eyes grow on different parts of its body. Is eyeless a free standing genetic object that can be plugged into any syntactically correct sequence and function as though it belonged there naturally? If so, what is the nature of the programming language that makes this possible? Dr. Gene Stanley and others at Boston U. and Harvard Medical School have done statistical analyses of non-coding DNA sequences (published in Physical Review Letters a few months ago) that suggest that there may be linguistic structures, i.e. words within them. Are some of these non-coding sequences the terms of the genetic programming language? If this is interesting to you, or if you think its bogus, let me know. Mr. Gary Welz Dept. of Mathematics John Jay College, CUNY From owner-chromosomes@net.bio.net Thu Apr 13 23:00:00 1995 Newsgroups: bionet.genome.chromosomes Path: biosci!lhc!news From: makalow@ncbi.nlm.nih.gov (Wojtek Makalowski) Subject: mouse chromosomes Message-ID: <1995Apr14.031435.28399@nlm.nih.gov> Sender: news@nlm.nih.gov Reply-To: makalow@ncbi.nlm.nih.gov Organization: NLM/NCBI Date: Fri, 14 Apr 95 03:14:35 GMT Lines: 7 Hi, I'm looking for physical (Mb) and genetic (cM) parameters of mouse genome. Any suggestion of reference will be appreciated, Wojtek Makalowski From owner-chromosomes@net.bio.net Thu Apr 13 23:00:00 1995 Path: biosci!GDB.ORG!rrobbins From: rrobbins@GDB.ORG (Robert Robbins) Newsgroups: bionet.genome.chromosomes Subject: Re: Is the genome like a computer program? Date: 14 Apr 1995 06:41:43 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 206 Sender: daemon@net.bio.net Distribution: world Message-ID: References: <3mkhn2$s4a@cmcl2.NYU.EDU> NNTP-Posting-Host: net.bio.net Gary, This is an area to which I have given some thought (and in fact have even written about it a bit and have added a discussion of the subject to a course I teach at Johns Hopkins). The genome is like a mass storage device (with properties not shared by current electronic mass-storage devices), but the programs that it encodes differ significantly from current computer technology. Each parent contributes one set of mass-storage devices (23 chromosomes) so that the resulting single cell has two full sets of the programs (that may, and do, differ from each other). Although the genetic code is without doubt a digital code, the level of parallelism that exists in the expression of these codes is such that many aspects of the system have more in common with an analog system than with a digital one. If we assume that the transcription of a gene, followed by the synthesis of an enzyme is the spawning of an executing process, then each single cell has millions of programs executing in a truly parallel (i.e., independent execution, no time sharing) mode. By the time the single cell produced by the union of sperm and egg has grown into an adult, there are probably well in excess of 10**13 cells, each with two copies of the mass-storage devices, and each running somewhere in excess of 10**5 to 10**6 processes in parallel. Many of the spawned processes affect the launching of other processes, so the level of feed-back control is high. Hormones produced in one cell may affect the expression of genes (i.e., the launching of processes) in other cells, so in principle the processes running in any of the 10**13 cells could affect the launching o processes in any of the other 10**13 cells. Proteins may interact with each other, so processes may affect processes, and there is certainly a lot of inter-process interaction. Taken all together then, the expression of the human genome involves the simultaneous expression and (potential) interaction of something probably in excess of 10**18 parallel processes. Given this, it is not likely that intuitions derived from an understanding of the operation of programs on present computer architectures will generalize well to the expression of the genome. Differences also exist in the mass-storage devices as well. The genome can be thought of as a mass-storage device based on a linked-list architecture, rather than a physical platter. All addressing is associative, with multiple read heads scanning the device in parallel, looking for specific START LOADING HERE signals. When such a signal is encountered, the read head starts transcribing DNA and continues doing so until a STOP LOADING HERE signal is encountered. [The resulting transcript is like a *.EXE file, rather than a *.COM file. On Intel systems, *.COM files are perfect memory images that may be loaded verbatim into memory and then execute when control is passed to the first byte. *.EXE files, on the other hand, are a mixture of instructions to the loader and instructions to be executed. After the loader instructions are executed, the program (now different from that stored on the mass-storage device) is placed in memory and control passed to it.] Genome programs execute on a virtual machine that is defined by some of the genomic programs that are executing. Thus, in trying to understand the genome, we are trying to reverse engineer binaries for an unknown CPU, in fact for a virtual CPU whose properties are encoded in the binaries we are trying to reverse engineer. We do know that "genomic op codes" are probabilistic, rather than deterministic. That is, when control hits a particular op code, there is a certain probability that a certain action will occur. This applies to the associative addresses on the mass storage device as well. Intuitions from current hardware suggests that this would make for intermittent, jerky behavior of the system. However, in such a massively parallel system, probabilistic op codes actually smooth out the behavior of the system by providing some buffering capacity (in the chemical, not computer I/O, sense of buffering). I could go on, but I hope my general point is made. I offer some additional comments below in response to your specific inquiries. On 14 Apr 1995, Gary Welz wrote: > I'm writing a speculative article about the large scale structure of the genome. Does anyone besides me think > that an organism's genome can be regarded as a computer program? I mean that its structure can be presented as > a flowchart with genes as objects connected by logical terms like "and" and "or?" Of course, conditional > activity in the genome - the analog of the "while" loop - has been studied for some time. Flow charts describe the behavior of a non-parallel machine. Although some aspects of a massively parallel system can be expressed (metaphorically) as a flow chart of linearly executing steps, care must be taken in interpreting that flow chart. > One development that might support this point of view is the recent demonstration (reported in last week's > Science) that the eyeless gene can be inserted into various parts of the chromosome of a fly and cause it to > have eyes grow on different parts of its body. Is eyeless a free standing genetic object that can be plugged > into any syntactically correct sequence and function as though it belonged there naturally? If so, what is the > nature of the programming language that makes this possible? The expression of single processes (like MAKE HUMAN GROWTH HORMONE or MAKE HUMAN INSULIN) are fairly free-standing and can be inserted into almost any syntactic interpreter, with the result that the desired protein is in fact synthesized. This is the heart of much of the bio-tech industry. However, the parallel nature of genomic expression is such that major developmental steps, like making eyes, involve so many processes acting in concert that individual processes cannot be seen as free standing. This may seem to contradict the findings you mention above, but explaining the subtleties involve would require more time and space than is available here. > Dr. Gene Stanley and others at Boston U. and Harvard Medical School have done statistical analyses of > non-coding DNA sequences (published in Physical Review Letters a few months ago) that suggest that there may be > linguistic structures, i.e. words within them. Are some of these non-coding sequences the terms of the genetic > programming language? There is an entire body of literature that treats the linguistic properties of DNA. If you are really interested, you should read a lot of it before jumping to quick interpretations. However, you should also bear in mind that DNA involves the coding of a "language" on a mass-storage device, it is not the direct expression of a language. As an analogy, consider the differences that programs designed to detect linguistic features would exhibit of they were run first against, say, War and Peace as straight ASCII text and then second, against the byte stream obtained from a hard disk on which War and Peace was stored as, say, a WordPerfect file with all of the embedded WordPerfect formatting codes and with lots of file fragmentation thrown in. I expect that the program would detect linguistic features when run against the byte stream from the hard disk, but they would be neither a clean set of features of English nor a clean set of features from WordPerfect formatting codes, but rather a mixture of the two, with some confusion thrown in due to the disk fragmentation. > > If this is interesting to you, or if you think its bogus, let me know. I think it's really interesting, but I also think that we need to be careful not to oversimplify the analogies. When I was the program officer for Database Activities in Biology at NSF, I had many inquiries from computer scientists who had acquired a Scientific-American-article level of appreciation of genetics and who assumed that the well-known table showing the determination of the sequence of amino-acids in proteins by the sequence of nucleotides in DNA was more or less equivalent to the table of op codes for some CPU. This level of understanding led to some very simplistic proposals. A not-that-bad-reversal of the analogy would have someone thinking that an understanding of the ASCII code (41h = A, 42h = B, etc) is all that would be required to understand the workings of, say, an Intel Paragon or a Cray-4. At the same time, I think that bringing computer-science insights to bear on the challenge of understanding genome operation has some potentially huge payoffs. For example, it would be really interesting to think about the file-allocation-table system for a mass storage device that behaves like a redundant linked list, with only associative addressing (i.e., no physical addressing by sector-offset, but instead only addressing by offsets from recognizable landmarks). It would also be interesting to think about the computational properties that might emerge in a system with probabilistic op codes and with as much parallelism as biological computers. Bob ================================================================= Robert J. Robbins Bioinformation Infrastructure Program Office of Health and Environmental Research ER-72 GTN United States Department of Energy 19901 Germantown Road Germantown, MD 20874-1290 robbins@er.doe.gov (301) 903-6488 (secretary / Joanne Corcoran) (301) 903-8521 (fax) ================================================================= also, Robert J. Robbins Laboratory for Applied Bioinformatics Johns Hopkins University 2024 E. Monument Street Baltimore, MD 21205 rrobbins@gdb.org (410) 955-9705 (office secretary) (410) 614-0434 (fax) ================================================================= From owner-chromosomes@net.bio.net Fri Apr 14 23:00:00 1995 Path: biosci!agate!howland.reston.ans.net!pipex!uunet!newsflash.concordia.ca!news.mcgill.ca!test-air From: popa0206@po-box.mcgill.ca (G. Dellaire) Newsgroups: bionet.genome.chromosomes Subject: Re: Is the genome like a computer program? Date: 15 Apr 1995 19:35:42 GMT Organization: fringe Lines: 41 Message-ID: <3mp3g2$dvs_003@news.mcgill.ca> References: <3mkhn2$s4a@cmcl2.NYU.EDU> NNTP-Posting-Host: a-12.das.mcgill.ca X-Newsreader: News Xpress Version 1.0 Beta #3 In article , rrobbins@GDB.ORG (Robert Robbins) wrote: > >Taken all together then, the expression of the human genome involves the >simultaneous expression and (potential) interaction of something probably >in excess of 10**18 parallel processes. Just curious, but how do you account then for the fact of imprinting and silencing of those parallel sets of instructions (i.e. alleles) such that you only actually have one "program" running. This would bring to light the idea of gene dosage, and what analog in informatics would pertain to such a mechanism? >There is an entire body of literature that treats the linguistic >properties of DNA. If you are really interested, you should read a lot of >it before jumping to quick interpretations. However, you should also bear >in mind that DNA involves the coding of a "language" on a mass-storage >device, it is not the direct expression of a language. On this point, it is becoming widely accepted that the actual structure of genome and not just the linear sequence may "encode" sets of instructions for the "reading and accessing" of this genetic code. Best illustrated by large changes in genomic structure that affects the accessiblity of of various regions of the genome to be "read" during development at specific times and silenced afterwards. Therefore, a second level of language is the overall code itself. Sort of like the letters make up words (commands for the program), and different gene are like sentences... thus context is important for understanding the code. The context is provided by the supporting paragraphs which could represent genetic domains with in the genome (context can be spatial, what tissue; or temporal, what time of development). And the overall story provides an impression and message in itself. G. Dellaire Exp. Medicine Mcgill Red Cross Montreal E-mail popa206@po-box.mcgill.ca From owner-chromosomes@net.bio.net Fri Apr 14 23:00:00 1995 Path: biosci!agate!howland.reston.ans.net!news.sprintlink.net!uunet!newsflash.concordia.ca!news.mcgill.ca!test-air From: popa0206@po-box.mcgill.ca (G. Dellaire) Newsgroups: bionet.genome.chromosomes Subject: How do we explain Gene Families? Date: 15 Apr 1995 19:11:00 GMT Organization: fringe Lines: 41 Message-ID: <3mp21o$dvs_002@news.mcgill.ca> NNTP-Posting-Host: a-12.das.mcgill.ca X-Newsreader: News Xpress Version 1.0 Beta #3 It is a prevalent theory, and one that comparative mapping is based on, that in the past during the evolution of vertebrates a series of whole genome duplications had occured. The best guess would be 2-3 times, for example explaining the presence of four HOX gene clusters... i.e. one precursor gene that was duplicated in one tetraploidization and then two upon the second tetraploidization to produce 4 genes. Now it is very attractive to say that this is a valid model as it explains very easily the many gene families found on different chromosomes. In plants there would be no need to question the mechanism as plants (such as wheat) can survive great changes in there genome without leading to death of the individual plant. Unfortunately animals are not so hardy when it comes to polyploidy and wide spread mutation of the genome. Remember, we are dealing with a process that would have to be resolved in one generation. Tetraploidy occurs... now you have the problem of two identical sets of chromosomes, to ensure proper disjunction during mitosis and meiosis diploidization (or differentiation) of the two sets of homologs must occur. In addition the tetraploidization must occur in the zygote at an early stage as fertilization requires two compatible gametes, and it is unlikely that two separate duplications could occur in both gametes (and identically resolved) prior to fertilization. Therefore, how could the individual zygote survive such a process of chromosome differentiation (which would include inversions, deletions and translocations) without suffering so many lethal mutations that it would kill the organism. Although single events of duplication by gene conversion, primed by DSB's near repeated elements (alus and line-1 sequences for example) could account for a relatively "safe" mode of gene duplication, the shear number of duplicated gene families and the fact that they are usually in 2's and 4's makes the whole genome duplication theory more attractive, even though improbable. Perhaps there could be some compromise... any thoughts and comments are welcome G. Dellaire Exp. Med. Mcgill Red Cross, Montreal e-mail popa0206@po-box.mcgill.ca From owner-chromosomes@net.bio.net Fri Apr 14 23:00:00 1995 Path: biosci!agate!howland.reston.ans.net!news.sprintlink.net!uunet!newstf01.news.aol.com!newsbf02.news.aol.com!not-for-mail From: lumz34@aol.com (Lumz34) Newsgroups: bionet.genome.chromosomes Subject: HIGH SCHOOL HOMEWORK HELP Date: 15 Apr 1995 12:03:52 -0400 Organization: America Online, Inc. (1-800-827-6364) Lines: 5 Sender: root@newsbf02.news.aol.com Message-ID: <3moqp8$d5o@newsbf02.news.aol.com> Reply-To: lumz34@aol.com (Lumz34) NNTP-Posting-Host: newsbf02.mail.aol.com I need a list of common organisms with their number of chromosomes to complete a homework assignment. My teacher has asked for 25 different organisms. Will some kind person please help direct me to a source of reference as everything I have seen on the net is too technical. Thanks lumz34@aol.com From owner-chromosomes@net.bio.net Fri Apr 14 23:00:00 1995 Path: biosci!GDB.ORG!rrobbins From: rrobbins@GDB.ORG (Robert Robbins) Newsgroups: bionet.genome.chromosomes Subject: Re: Is the genome like a computer program? Date: 15 Apr 1995 14:44:25 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 50 Sender: daemon@net.bio.net Distribution: world Message-ID: References: <3mp3g2$dvs_003@news.mcgill.ca> NNTP-Posting-Host: net.bio.net On 15 Apr 1995, G. Dellaire wrote: > In article , > rrobbins@GDB.ORG (Robert Robbins) wrote: > > >Taken all together then, the expression of the human genome involves the > >simultaneous expression and (potential) interaction of something probably > >in excess of 10**18 parallel processes. > > Just curious, but how do you account then for the fact of imprinting and > silencing of those parallel sets of instructions (i.e. alleles) such that > you only actually have one "program" running. This would bring to light > the idea of gene dosage, and what analog in informatics would pertain to > such a mechanism? Note that I was referring to "processes", not to programs. One program on disk can result in many simultaneous processes being launched on a parallel machine. Indeed, I would consider each mRNA to be a process, and each active enzyme also a process. With regard to the selective silencing of some copies of some programs, whether because of imprinting, or dosage compensation, or differentiation, or some other cause, these could be interpreted simply as examples of the behavior of the 10**13 virtual machines (i.e., cells) in which the programs on "disk" are being executed. > On this point, it is becoming widely accepted that the actual structure of > genome and not just the linear sequence may "encode" sets of instructions > for the "reading and accessing" of this genetic code. Best illustrated > by large changes in genomic structure that affects the accessiblity of > of various regions of the genome to be "read" during development at specific > times and silenced afterwards. > > Therefore, a second level of language is the overall code itself. Sort of > like the letters make up words (commands for the program), and different > gene are like sentences... thus context is important for understanding the > code. The context is provided by the supporting paragraphs which could represent > genetic domains with in the genome (context can be spatial, what tissue; > or temporal, what time of development). And the overall story provides an > impression and message in itself. This is a good point and demonstrates the multiple levels of subtlety and conflation that must be taken into acciunt when trying to do linguisitic analysis of DNA sequences. The storage medium, DNA, has local chemical and mechanical properties that are affected by the information encoded in those local regions (melting points, etc.). From owner-chromosomes@net.bio.net Mon Apr 17 23:00:00 1995 Path: biosci!bcm!cs.utexas.edu!swrinde!pipex!oleane!jussieu.fr!univ-lyon1.fr!ghost.dsi.unimi.it!news.unige.it!moana.ibf.unige.it!diaspro From: diaspro@moana.ibf.unige.it (Alberto Diaspro) Newsgroups: bionet.genome.chromosomes Subject: acondroplasia Date: 18 Apr 1995 08:30:49 GMT Organization: Univ. of Genoa, Italy Lines: 21 Message-ID: <3mvtbp$o4l@alpha.cisi.unige.it> NNTP-Posting-Host: moana.ibf.unige.it X-Newsreader: TIN [version 1.2 PL2] --r colleaugues, Dear colleagues, I am searching again in order to find something related with the localization og the gene of acondroplasia. I am interested in a research project that utilizes the optical fluorescence microscope (confocal or wiede-field<) . My twin-interest is due to the fact that i love microscopy and i have an acondrolasic sister. Bye Alby ------------------------------------- Alberto DIASPRO Institute of Biophysics University of Genova Via Giotto, 2 16153 Genova - Italy e-mail: diaspro@moana.ibf.unige.it (home: Via Lomellini 4-6 16124 Genova) -------------------------------------- From owner-chromosomes@net.bio.net Mon Apr 17 23:00:00 1995 Path: biosci!rutgers!gatech!howland.reston.ans.net!ee.und.ac.za!quagga.ru.ac.za!ucthpx!itu1.sun.ac.za!f445.fisan.sun.ac.za!agc From: agc@GERGA.SUN.AC.ZA (Mnr. A.G. Christoffels, (Mediese Biochemie)) Newsgroups: bionet.genome.chromosomes Subject: HRC intronic sequence Date: 18 Apr 1995 14:40:59 GMT Organization: University of Stellenbosch, South Africa Lines: 4 Message-ID: NNTP-Posting-Host: 146.232.70.24 Hi, I am looking for any information on the intronic sequence of Histidine- rich Calcium protein other than that appearing in Genomics 9: 1991. I would appreciate any references etc. From owner-chromosomes@net.bio.net Wed Apr 19 23:00:00 1995 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!spool.mu.edu!vms.csd.mu.edu!2B16SALZBREN From: 2b16salzbren@vms.csd.mu.edu Newsgroups: bionet.genome.chromosomes Subject: research.paper Date: 20 Apr 1995 03:12:17 GMT Organization: Marquette University - Computer Services Lines: 16 Message-ID: <0098F22B.18C51BB4@vms.csd.mu.edu> Reply-To: 2b16salzbren@vms.csd.mu.edu NNTP-Posting-Host: vmsf.csd.mu.edu I.The genetic aspect of weight loss A)genetic factors of metabolic rate (ie. hereditary) ting tissues D)sex-linkage or any autosomal linkage of these or any other genes relat ed to weight loss. E)case studies of families and the weight of each family member. (espec ially families with genetic disorders) F)do certain genetic disorders contribute to susceptibility to weight lo ss? G)genes responsible for enzymatic levels (enzymes which act on fats, sugars, proteins, and other injested foods. H)comparison of genetic vs. environmental factors on weight levels and w eight loss. I hope someone out there can help me a little. I have a feeling this paper will turn out to be pretty interesting. Thanks. 2b16salzbren@vms.csd.mu.edu From owner-chromosomes@net.bio.net Wed Apr 19 23:00:00 1995 Path: biosci!MH1.MCC.AC.UK!MBFRWGB From: MBFRWGB@MH1.MCC.AC.UK (MBFRWGB) Newsgroups: bionet.genome.chromosomes Subject: Robotic Instruments Date: 20 Apr 1995 03:57:59 -0700 Organization: Manchester University Lines: 9 Sender: daemon@net.bio.net Distribution: world Message-ID: <1B87C23E9E@mail1.mcc.ac.uk> NNTP-Posting-Host: net.bio.net We are interested in purchasing a robotic colony picker and grider. We will be gratefull if we receive comments regarding this instruments (specially HYBAID'S) so that we can decide if it is a sensible aquisition. Thanks very much Dr. Roger Gerke-Bonet From owner-chromosomes@net.bio.net Wed Apr 19 23:00:00 1995 Path: biosci!rutgers!gatech!swrinde!pipex!sunsite.doc.ic.ac.uk!yama.mcc.ac.uk!usenet From: rgerke-b@mh1.mcc.ac.uk (Stopford Building Computer User) Newsgroups: bionet.molbio.genome-program,bionet.genome.chromosomes,bionet.molbio.gene-linkage,bionet.diagnostics,bionet.cellbiol,bionet.cellbiol.cytonet Subject: Robotic colony pickers or griders Date: 20 Apr 1995 14:12:13 GMT Organization: Manchester University Lines: 13 Message-ID: <3n5q3t$8ei@yama.mcc.ac.uk> NNTP-Posting-Host: rger.sbc.man.ac.uk Mime-Version: 1.0 X-Newsreader: WinVN 0.99.2 Xref: biosci bionet.molbio.genome-program:1342 bionet.genome.chromosomes:555 bionet.molbio.gene-linkage:651 bionet.diagnostics:88 bionet.cellbiol:2112 bionet.cellbiol.cytonet:212 Does anyone can probide me with comments or information regarding the Hybaid robotic colony picker or the grider. We are contemplating buying one and we will apreciate very much any comments. Please respond by e-mail to rgerke-b@mh1.mcc.ac.uk Thank you very much Roger Gerke-Bonet From owner-chromosomes@net.bio.net Wed Apr 19 23:00:00 1995 Path: biosci!rutgers!oitnews.harvard.edu!fas-news.harvard.edu!nucleus!robison From: robison@nucleus.harvard.edu (Keith Robison) Newsgroups: bionet.genome.chromosomes Subject: Re: research.paper Date: 20 Apr 1995 12:33:44 GMT Organization: Harvard University, Cambridge, Massachusetts Lines: 40 Message-ID: <3n5kb8$ei2@decaxp.harvard.edu> References: <0098F22B.18C51BB4@vms.csd.mu.edu> NNTP-Posting-Host: nucleus.harvard.edu X-Newsreader: TIN [version 1.2 PL2] Look in On-Line Mendelian Inheritance in Man (OMIM) E-mail mailserv@gdb.org Gopher gopher.gdb.org WWW http://gdbwww.gdb.org/ It is a standard textbook on human genetic disease. You might also try searching biosequence databases for the gene "obese" Look in http://golgi.harvard.edu/sequences.html Good luck! Keith Robison Harvard University Department of Cellular and Developmental Biology Department of Genetics / HHMI robison@mito.harvard.edu 2b16salzbren@vms.csd.mu.edu wrote: : I.The genetic aspect of weight loss : A)genetic factors of metabolic rate (ie. hereditary) : ting : tissues : D)sex-linkage or any autosomal linkage of these or any other genes relat ed to weight loss. : E)case studies of families and the weight of each family member. (espec ially families with genetic disorders) : F)do certain genetic disorders contribute to susceptibility to weight lo ss? : G)genes responsible for enzymatic levels (enzymes which act on fats, sugars, proteins, and other injested foods. : H)comparison of genetic vs. environmental factors on weight levels and w eight loss. : I hope someone out there can help me a little. I have a feeling this paper will turn out to be pretty interesting. : Thanks. : 2b16salzbren@vms.csd.mu.edu From owner-chromosomes@net.bio.net Thu Apr 20 23:00:00 1995 Path: biosci!biosci!not-for-mail From: noordewi@cs.rutgers.edu (Michiel) Newsgroups: bionet.biology.computational,bionet.general,bionet.genome.arabidopsis,bionet.info-theory,bionet.software,bionet.genome.chromosomes Subject: CFP: Workshop on Gene-Finding and Gene Structure Prediction Date: 21 Apr 1995 16:58:58 -0700 Organization: Rutgers University LCSR Lines: 105 Sender: biohelp@net.bio.net Approved: comp-bio-moderator@net.bio.net Distribution: world Message-ID: <3n99uj$1lk@binnacle.rutgers.edu> NNTP-Posting-Host: net.bio.net Xref: biosci bionet.biology.computational:617 bionet.general:14767 bionet.genome.arabidopsis:3211 bionet.info-theory:3333 bionet.software:11863 bionet.genome.chromosomes:557 CALL FOR PAPERS Workshop on Gene-Finding and Gene Structure Prediction October 13-14, 1995 University of Pennsylvania Philadelphia, PA SCOPE The Workshop on Gene-Finding and Gene Structure Prediction will be concerned with the increasingly important activity in computational biology of discovering protein-encoding genes in otherwise uncharacterized primary sequence data. This has traditionally been done in genomic sequence by discriminating likely coding regions based on a variety of statistical analyses and by detection of landmark sequences such as splice junctions. Recent approaches have involved combination of such evidence using rule-based and/or connectionist architectures, and have dealt in a variety of ways with the combinatorial problem of exon assembly (dynamic programming, clustering, etc.) The recent profusion of expressed-sequence data and related techniques has also raised new issues and opportunities. In this workshop we will explore topics such as compositional measures of exonic tendency (including approaches founded in statistics, information theory, and signal processing), the effects of genome heterogeneity, the role of models of biological signals and processes, dealing with incomplete and error-prone sequence data, algorithmic and probabilistic techniques, and similarity-based gene prediction. Problems of interest include detecting coding sequences and assembling gene models from large-scale genomic sequence, collections of expressed sequence fragments, and sets of putative exons from a region. Practical issues of interest include dataset and performance metric standardization, annotation of genome databases, and software interoperability. SPONSORS The workshop is part of the DIMACS Special Year on Mathematical Support for Molecular Biology, and is sponsored by DIMACS, SmithKline Beecham Pharmaceuticals, and the Penn Computational Biology Research Training Program (funded by the National Science Foundation). It will be held at the Penn Tower Hotel and Conference Center, in close proximity to the facilities of the Computational Biology and Informatics Laboratory and the Human Genome Center for Chromosome 22. PRESENTATIONS A number of invited talks are planned, and in addition short papers and posters are solicited from participants. Anyone wishing to present should plan to submit a one-page abstract giving sufficient detail to allow the work to be evaluated for relevance and originality. The Program Committee will make decisions as to which submissions are appropriate, and whether they should be presented in oral or poster form. Authors will be asked to submit papers for an informal workshop proceedings, and certain of these may then be selected by the Program Committee to appear in revised form in a volume to appear later. This will be published by the American Mathematical Society, which issues Proceedings from DIMACS workshops, based on refereed, camera-ready papers submitted within a few months after the conference. The schedule is as follows; NOTE THE REVISED DEADLINES: June 1, 1995 One-page abstracts due July 1, 1995 Notification to authors September 1, 1995 Final short papers due October 13-14, 1995 Workshop Abstracts should be mailed to the address given at the bottom of this announcement. Limited travel funds will be available for presenters who would otherwise be unable to attend. They should indicate this in a cover letter, stating also whether they are a student, woman, or minority. ORGANIZING COMMITTEE David Searls, University of Pennsylvania, Chair Jim Fickett, Los Alamos National Laboratory, Co-Chair Gary Stormo, University of Colorado, Boulder, Co-Chair Mick Noordewier, Rutgers University, Co-Chair PROGRAM COMMITTEE Howard Bilofsky, SmithKline Beecham Pharmaceuticals Jean-Michel Claverie, CNRS-E.P.91 Information Genetique et Structurale Misha Gelfand, Institute of Protein Research, Russian Academy of Sciences Roderic Guigo, Institut Municipal d'Investigacio Medica, Barcelona David Haussler, University of California at Santa Cruz Stephen Mount, University of Maryland Pavel Pevzner, Penn State University Bruce Roe, University of Oklahoma Victor Solovyev, Baylor College of Medicine Ed Uberbacher, Oak Ridge National Laboratory Owen White, Institute for Genome Research FURTHER INFORMATION To express interest in the Workshop and to receive further mailings directly, send e-mail to dsearls@cbil.humgen.upenn.edu, or contact David Searls Department of Genetics, CRB475 University of Pennsylvania School of Medicine 422 Curie Boulevard Philadelphia, PA 19104-6145 Voice: (215)573-3107 FAX: (215)573-3111 From owner-chromosomes@net.bio.net Thu Apr 20 23:00:00 1995 Path: biosci!bcm!news.tamu.edu!bloom-beacon.mit.edu!mojo.eng.umd.edu!cs.umd.edu!news.umbc.edu!haven.umd.edu!purdue!lerc.nasa.gov!magnus.acs.ohio-state.edu!infoserver.bgsu.edu!m32-109.bgsu.edu!user From: mikeh@bgnet.bgsu.edu (Michael A. Halbisen) Newsgroups: bionet.genome.chromosomes Subject: looking for grad school in Biotech Date: Fri, 21 Apr 1995 12:11:11 -0500 Organization: Bowling Green State University Lines: 14 Message-ID: NNTP-Posting-Host: m32-109.bgsu.edu Hi, I'm currently a junior chemistry major who is looking to apply to grad school this fall. However, I've been encountering some difficulty finding information on which schools have good Biotechnology programs. If anyone has some suggestions on a good grad school (for Ph.D) for Biotechnology, please let me know. I am mostly interested in projects that involve using molecular biology to genetically engeneer microbes to produce ( or do ) new things, such as making oil eating bacteria (as opposed to pharmacology). Any and all suggestions will be appreciated. Michael A. Halbisen mikeh@bgnet.bgsu.edu From owner-chromosomes@net.bio.net Mon Apr 24 23:00:00 1995 Path: biosci!bloom-beacon.mit.edu!gatech!swrinde!howland.reston.ans.net!news2.near.net!das-news2.harvard.edu!fas-news.harvard.edu!golgi!robison From: robison@golgi.harvard.edu (Keith Robison) Newsgroups: bionet.genome.chromosomes Subject: Re: Fragile X Syndrome Date: 25 Apr 1995 12:17:32 GMT Organization: Harvard University, Cambridge, Massachusetts Lines: 29 Message-ID: <3nip8s$4e@decaxp.harvard.edu> References: <3nhvbi$2ap@newsbf02.news.aol.com> NNTP-Posting-Host: golgi.harvard.edu X-Newsreader: TIN [version 1.2 PL2] ARF123 (arf123@aol.com) wrote: : I am seeking additional information on Fragile X Syndrome. Prefer recent : as possible. Post here or e-mail at ARF123@AOL.com Look in On-Line Mendelian Inheritance in Man (OMIM) E-mail mailserv@gdb.org Gopher gopher.gdb.org WWW http://gdbwww.gdb.org/ It is a standard textbook on human genetic disease. The National Organization for Rare Disorders (NORD) has patient-oriented information on various diseases. You can get to both NORD and OMIM via http://golgi.harvard.edu/htbin/biopages?nord|omim Good luck! Keith Robison Harvard University Department of Cellular and Developmental Biology Department of Genetics / HHMI robison@mito.harvard.edu From owner-chromosomes@net.bio.net Mon Apr 24 23:00:00 1995 Path: biosci!bloom-beacon.mit.edu!gatech!newsjunkie.ans.net!newstf01.news.aol.com!newsbf02.news.aol.com!not-for-mail From: arf123@aol.com (ARF123) Newsgroups: bionet.genome.chromosomes Subject: Fragile X Syndrome Date: 25 Apr 1995 00:55:14 -0400 Organization: America Online, Inc. (1-800-827-6364) Lines: 2 Sender: root@newsbf02.news.aol.com Message-ID: <3nhvbi$2ap@newsbf02.news.aol.com> Reply-To: arf123@aol.com (ARF123) NNTP-Posting-Host: newsbf02.mail.aol.com I am seeking additional information on Fragile X Syndrome. Prefer recent as possible. Post here or e-mail at ARF123@AOL.com From owner-chromosomes@net.bio.net Mon Apr 24 23:00:00 1995 Path: biosci!news.cs.umb.edu!oitnews.harvard.edu!fas-news.harvard.edu!lipid!robison From: robison@lipid.harvard.edu (Keith Robison) Newsgroups: bionet.genome.chromosomes Subject: Re: Genome Map Date: 25 Apr 1995 02:41:01 GMT Organization: Harvard University, Cambridge, Massachusetts Lines: 36 Message-ID: <3nhnft$oqb@decaxp.harvard.edu> References: <3nhf2n$pg8@newsbf02.news.aol.com> NNTP-Posting-Host: lipid.harvard.edu X-Newsreader: TIN [version 1.2 PL2] Justin2401 (justin2401@aol.com) wrote: : Any one know where (internet address, etc...) I could get a fairly up to : date map of the human genome? You might start with URL's contained at the following two URLs: http://www-bprc.mps.ohio-state.edu/cgi-bin/hpp?genetics.html http://golgi.harvard.edu/htbin/biopages?genome|chromosome|map will list a lot of genome-related (not all human!) sites, many of which have maps. One "problem" with human genome maps is that there are many different types of maps, based on different techniques. For example, a physical map shows the location of DNA fragments or DNA landmarks, whereas a recombinational map shows the observed degree of genetic linkage between markers (which also differs somewhat by which parent the chromosome is inherited from). And, of course, these are both broad categories which encompass different techniques. As you might guess, one challenge of genomics is figuring out ways to either experimentally or computationally merge maps developed with different techniques or in different experiments. There are a number of sites at the above URL's which present integrated maps or give you access to experimental map integrators. Enjoy!!! Keith Robison Harvard University Department of Cellular and Developmental Biology Department of Genetics / HHMI robison@mito.harvard.edu From owner-chromosomes@net.bio.net Mon Apr 24 23:00:00 1995 Path: biosci!bloom-beacon.mit.edu!gatech!howland.reston.ans.net!newsjunkie.ans.net!newstf01.news.aol.com!newsbf02.news.aol.com!not-for-mail From: justin2401@aol.com (Justin2401) Newsgroups: bionet.genome.chromosomes Subject: Genome Map Date: 24 Apr 1995 20:17:27 -0400 Organization: America Online, Inc. (1-800-827-6364) Lines: 6 Sender: root@newsbf02.news.aol.com Message-ID: <3nhf2n$pg8@newsbf02.news.aol.com> Reply-To: justin2401@aol.com (Justin2401) NNTP-Posting-Host: newsbf02.mail.aol.com Any one know where (internet address, etc...) I could get a fairly up to date map of the human genome? Any help welcome.... Justin Fulmer justin2401@aol.com From owner-chromosomes@net.bio.net Tue Apr 25 23:00:00 1995 Path: biosci!bcm!cs.utexas.edu!swrinde!pipex!wendy.ibmpcug.co.uk!kate.ibmpcug.co.uk!reservoir!shane Newsgroups: bionet.genome.chromosomes Message-ID: <194@reservoir.win-uk.net> Reply-To: shane@reservoir.win-uk.net (Shane McKee) From: shane@reservoir.win-uk.net (Shane McKee) Date: Wed, 26 Apr 1995 15:57:48 GMT Subject: Chromosomal loss from the early zygote. Lines: 28 Hi. My query relates to the loss of chromosomes from the first few divisions of the zygote. In Down syndrome, there are three basic types (with some modifications). Firstly, you have the standard trisomy 21 (~95% of cases). Second, you have translocations, in which an extra 21 is stuck to another chromosome (~3%). Third, there are mosaics, in which some body cells are normal, and some have trisomy 21. Now, concerning mosaics, there are two basic ways I can figure of them coming into being. The first way is that they start out as a normal zygote, and in one of the early rounds of mitosis, one of the cell lines gains a Chr21. The second way is to start with three 21s, and lose one in one of the cell lines. Work with Prader-Willi & Angelman, among other syndromes, suggests that in some cases 'extra' chromosomes may be lost during mitosis, leading to uniparental disomy for some chromosomes, in which both copies of a chromosome in a zygote come from the same parent. My question is, has any work been done on the factors which cause the loss of extra chromosomes during mitosis? I figure that it may be possible to mitigate the effects of Down Syndrome if 'treatment' to lose an excess 21 were initiated early in pregnancy. Has anyone any thoughts on the matter? Thanks, Shane Shane McKee (JHO, RVH, Belfast) | / Art becomes science when Shane@reservoir.win-uk.net --O-- you start trying to figure AGACTGCGCTTGCTTTACACATTTCTTCTC / | out what the heck you're doing From owner-chromosomes@net.bio.net Thu Apr 27 23:00:00 1995 Path: biosci!adam.cc.sunysb.edu!news.sprintlink.net!noc.netcom.net!ix.netcom.com!netnews From: Ray12@ix.netcom.com (RAY SHELLEY) Newsgroups: bionet.genome.chromosomes Subject: need info Date: 28 Apr 1995 04:48:32 GMT Organization: Netcom Lines: 6 Distribution: world Message-ID: <3nps30$66l@ixnews3.ix.netcom.com> NNTP-Posting-Host: ix-ir7-26.ix.netcom.com Can sombody please tell me where I can find info on the 18th chromosome on the internet. Specifically disorders. Please E-mail at ray@ix.netcom.com. Thanks Ray. From owner-chromosomes@net.bio.net Sat Apr 29 23:00:00 1995 Newsgroups: bionet.genome.chromosomes Path: biosci!bloom-beacon.mit.edu!gatech!howland.reston.ans.net!torn!nott!cunews!freenet.carleton.ca!FreeNet.Carleton.CA!av533 From: av533@FreeNet.Carleton.CA (Anatole Niala) Subject: Gender selection Message-ID: Sender: av533@freenet3.carleton.ca (Anatole Niala) Reply-To: av533@FreeNet.Carleton.CA (Anatole Niala) Organization: The National Capital FreeNet Date: Sun, 30 Apr 1995 00:49:06 GMT Lines: 7 I am probably not in the best News Group and apologize for the interruption, but I am looking for a forum where information on Ericsson's and other human gender selection methods is circulated and discussed. Thanks From owner-chromosomes@net.bio.net Sat Apr 29 23:00:00 1995 Path: biosci!bloom-beacon.mit.edu!gatech!howland.reston.ans.net!ix.netcom.com!netnews From: chrisdon@ix.netcom.com (Christopher Donahue) Newsgroups: bionet.genome.chromosomes Subject: Trisomy 13 or Padua (Patua) Syndrome Date: 30 Apr 1995 00:49:05 GMT Organization: Netcom Lines: 7 Distribution: world Message-ID: <3numq1$k39@ixnews4.ix.netcom.com> NNTP-Posting-Host: ix-tf4-24.ix.netcom.com I am seeking info on this very rare genetic anomoly. If anyone has any information, or knows where I could find info I would greatly appreciate it. Thanks in advance. Chris Donahue chrisdon@ix.netcom.com From owner-chromosomes@net.bio.net Sat Apr 29 23:00:00 1995 Path: biosci!bloom-beacon.mit.edu!gatech!howland.reston.ans.net!news2.near.net!das-news2.harvard.edu!fas-news.harvard.edu!nucleus!robison From: robison@nucleus.harvard.edu (Keith Robison) Newsgroups: bionet.genome.chromosomes Subject: Re: Trisomy 13 or Padua (Patua) Syndrome Date: 30 Apr 1995 15:32:26 GMT Organization: Harvard University, Cambridge, Massachusetts Lines: 32 Distribution: world Message-ID: <3o0aia$85e@decaxp.harvard.edu> References: <3numq1$k39@ixnews4.ix.netcom.com> NNTP-Posting-Host: nucleus.harvard.edu X-Newsreader: TIN [version 1.2 PL2] Christopher Donahue (chrisdon@ix.netcom.com) wrote: : I am seeking info on this very rare genetic anomoly. If anyone has any : information, or knows where I could find info I would greatly : appreciate it. Thanks in advance. Look in On-Line Mendelian Inheritance in Man (OMIM) E-mail mailserv@gdb.org Gopher gopher.gdb.org WWW http://gdbwww.gdb.org/ It is a standard textbook on human genetic disease. The National Organization for Rare Disorders (NORD) has patient-oriented information on various diseases. You can get to both NORD and OMIM via http://golgi.harvard.edu/htbin/biopages?nord|omim Good luck! Keith Robison Harvard University Department of Cellular and Developmental Biology Department of Genetics / HHMI robison@mito.harvard.edu