From owner-chromosomes@net.bio.net Tue Aug 01 23:00:00 1995 Path: biosci!agate!howland.reston.ans.net!spool.mu.edu!usenet.eel.ufl.edu!news.gmi.edu!msunews!harbinger.cc.monash.edu.au!aggedor.rmit.EDU.AU!minyos.xx.rmit.EDU.AU!t9556457 From: t9556457@minyos.xx.rmit.EDU.AU (Chun Ming Chan) Newsgroups: bionet.genome.chromosomes Subject: Engineering Tomatoes Date: 1 Aug 1995 23:49:45 GMT Organization: Royal Melbourne Institute of Technology, Melbourne, Australia. Lines: 15 Message-ID: <3vmeip$qbm@aggedor.rmit.EDU.AU> NNTP-Posting-Host: minyos.xx.rmit.edu.au NNTP-Posting-User: t9556457 X-Newsreader: TIN [version 1.2 PL2] Hi all, The process of preventing the tomatoes from softening is to introducing an antisense gene against polygalactronase into the nucleus? I am very unclear on a few points, is the antisense gene genetically engineered into the DNA of the tomatoes by using the Agrobacterium method? How is the gene then "switch off"? As refered by the books --- " ... by switching the gene on and off..." Puzzled Ben From owner-chromosomes@net.bio.net Wed Aug 02 23:00:00 1995 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!newsfeed.internetmci.com!EU.net!Belgium.EU.net!chaos.kulnet.kuleuven.ac.be!idefix.CS.kuleuven.ac.be!infoserv.rug.ac.be!news From: pvanosta@allserv.rug.ac.be Newsgroups: bionet.genome.chromosomes Subject: WWW site Biomed - Chromosomes Date: 3 Aug 1995 11:29:38 GMT Organization: Centrum Medische Genetica, RUG, Belgium Lines: 86 Message-ID: <3vqbv2$ah4@infoserv.rug.ac.be> NNTP-Posting-Host: tsv03p03.rug.ac.be X-Newsreader: I have created a set of Webpages with pointers to various sites with information about "Medicine and Molecular Biology" and "Computers and Biocomputing", etc. , the server where the Webpages reside is located at the University of Gent in Belgium (Europe). The URL to start is: http:// allserv.rug.ac.be/~pvanosta/welcome.html This brings you to my homepage from where you can choose one of the other Webpages: "Homepage" Good starting points Search engines Under the hood Homepages of some of my friends "Medicine" General Medical information on the Web Medical Specialties Marfan Syndrome information Pharmacological information "Molecular Biology" General Molcular Biological information Information about DNA research Information about Protein research Materials and Methods in Molcular biology "Computers and Biocomputing" Links to Biocomputing information on the Web Webpages with information about Linkage analysis Information about Linux (cheap and powerful Unix for PC's) General Computer Information (software and hardware) "Libraries and Literature" Links to (Biomedical) libraries TOC's Journals Magazines Bookstores Literature on the Web Publishers "Countries and Culture" Travel information Governmental information Local information Art on the Internet "Everything you always wanted to kow about ..." Links to other interesting (but mostly less serious sites) Movies and Television, Recreation, Music, Humor, Astronomy, Astrology, Gastronomy, Sports, etc. I hope these Webpages will be useful to help people with finding information on the Internet. I will keep working on thes Webpages to improve them, adding links and changing outdated links, but I am doing this in my spare time, so it may take some days before changes are made. Information about new and interesting links are welcome of course. --------------------------------------------------------------------------------------------------- Peter VAN OSTA, MD Centrum Medische Genetica Universitair Ziekenhuis Gent (UZG) - 0 K 5 De Pintelaan 185 B-9000 Gent BELGIUM tel. +32-9-240 36 03 fax. +32-9-240 49 70 email: Peter.VanOsta@rug.ac.be WWW: http://allserv.rug.ac.be/~pvanosta/welcome.html From owner-chromosomes@net.bio.net Wed Aug 02 23:00:00 1995 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!ee.und.ac.za!ucthpx!pc14.mic.uct.ac.za!ant From: ant@molbiol.uct.ac.za (Anthony Smith) Newsgroups: bionet.genome.chromosomes Subject: Pseudomonas putida genome size? Date: Thu, 3 Aug 1995 09:58:18 GMT Organization: University of Cape Town Lines: 20 Message-ID: NNTP-Posting-Host: pc14.mic.uct.ac.za Greetings I am at present attempting to determine the copy numbers of a number of plasmids in P.putida but in order to get an accurate value I need to know the exact genome size of P.putida. Can anyone supply me with the size and/or a reference? Thanks for your help. Ant Smith Department of Microbiology University of Cape Town South Africa Ant@molbiol.uct.ac.za ---------------------------------------------------------------------- Anthony Smith Dept. Microbiology University of Cape Town South Africa Ant@molbiol.uct.ac.za From owner-chromosomes@net.bio.net Thu Aug 03 23:00:00 1995 Path: biosci!bcm!cs.utexas.edu!convex!news.duke.edu!godot.cc.duq.edu!newsfeed.pitt.edu!quadra950.pathology.pitt.edu!user From: mcgorry@med.pitt.edu (Michael Gorry) Newsgroups: bionet.genome.chromosomes,bionet.molbio.methds-reagnts Subject: Charon 4a flanking sequence Date: 4 Aug 1995 16:16:17 GMT Organization: Univ of Pittsburgh, Pathology Lines: 6 Message-ID: NNTP-Posting-Host: quadra950.pathology.pitt.edu Xref: biosci bionet.genome.chromosomes:755 bionet.molbio.methds-reagnts:31778 Can anyone help in finding the sequence for lambda charon 4a? We can't find it in genbank or any of the papers reviewed to date. -- Michael Gorry mcgorry@med.pitt.edu From owner-chromosomes@net.bio.net Sun Aug 06 23:00:00 1995 Path: biosci!bloom-beacon.mit.edu!usc!howland.reston.ans.net!news.nic.surfnet.nl!news.sara.nl!news.pi.net!news From: muze@pi.net (De Muze) Newsgroups: bionet.genome.chromosomes Subject: braekpoint chromosome 4q 27 Date: Sun, 30 Jul 1995 07:45:14 GMT Organization: Planet Internet Lines: 17 Message-ID: <3vedo0$sa8@neptunus.pi.net> NNTP-Posting-Host: maa27.pi.net X-Newsreader: Forte Free Agent v0.46 Lectori Salutem, what do you know about braekpoint chromosome 4q 27; does it code for any protein ? I try to find linkage with a special phenotype of a partial trisomy chromesome 4 , with invertion duplication 4q26:: 32 and 4q32:: -> I'm a medical student trying to write an article ! my name S. Frints ; RL- uni . -Maastricht -NL- Many thanks for your reply to this newsgroup or to my Emailadress. ##### Please send your reply to: hvingen@cuci.nl ###### From owner-chromosomes@net.bio.net Tue Aug 08 23:00:00 1995 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!swrinde!elroy.jpl.nasa.gov!sdd.hp.com!night.primate.wisc.edu!newsspool.doit.wisc.edu!news.doit.wisc.edu!news From: tshafron@students.wisc.edu (Tom Shafron) Newsgroups: bionet.genome.chromosomes Subject: Mapping Chromosomes Date: 9 Aug 1995 20:50:51 GMT Organization: University of Wisconsin, Madison Lines: 9 Message-ID: <40b73b$18ko@news.doit.wisc.edu> NNTP-Posting-Host: f181-133.net.wisc.edu Mime-Version: 1.0 Content-Type: Text/Plain; charset=ISO-8859-1 X-Newsreader: WinVN 0.99.5 Re; Article in NEw York Times Science section: Does anyone out there have anymore information about the mapping of the single celled organism's DNA, presented in the Times article Sunday July ~31? In the article, each segment of a particular single celled animal's DNA was mapped to determine the formation of protien synthesis within the cell as it is being formed. Any information wouyld be greatly appreciated. Brett Newblatt (I'm using my friend's account) From owner-chromosomes@net.bio.net Tue Aug 08 23:00:00 1995 Path: biosci!biosci!not-for-mail From: gnb@ix.netcom.com (GRAEME BELL) Newsgroups: bionet.genome.chromosomes,bionet.molbio.genome-program,sci.bio Subject: Need Genetic Patent Info. Date: 9 Aug 1995 11:59:00 -0700 Organization: Netcom Lines: 14 Sender: biohelp@net.bio.net Distribution: world Message-ID: <408uc0$nl5@ixnews7.ix.netcom.com> NNTP-Posting-Host: net.bio.net Xref: biosci bionet.genome.chromosomes:761 bionet.molbio.genome-program:1473 sci.bio:18203 I am currently writting a research paper that pertains to genetic patents; patents on sequeunced and unsequenced genes along with broad genetic patents. I am looking for any information eg. articles or refernces that could give me any information on genetic patents. Personal opinion sof qualified individuals (anyone besides myself) would also be greatly appreciated. In the article I plan on addressing the positive and negative outcomes of patents in respect to the following subjects: scientific advancement (or hold-up), economics, and ethics eg. curing diseases vs. creating the perfect human. I have exhausted the libraries resources and I am hoping for some new information or other references. Thank you, (Enormously!) Karen Walczak (Biochemistry and Biology Undergrad) From owner-chromosomes@net.bio.net Tue Aug 08 23:00:00 1995 Path: biosci!rutgers!uwm.edu!newsspool.doit.wisc.edu!news.doit.wisc.edu!chronos.genetics.wisc.edu!user From: guy@genetics.wisc.edu (Guy Plunkett III) Newsgroups: bionet.genome.chromosomes,bionet.molbio.methds-reagnts Subject: Re: Charon 4a flanking sequence Date: Wed, 09 Aug 1995 12:26:16 -0600 Organization: University of Wisconsin Lines: 55 Message-ID: References: NNTP-Posting-Host: chronos.genetics.wisc.edu X-Newsreader: Yet Another NewsWatcher 2.0b30 Xref: biosci bionet.genome.chromosomes:760 bionet.molbio.methds-reagnts:31971 In article , mcgorry@med.pitt.edu (Michael Gorry) wrote: > Can anyone help in finding the sequence for lambda charon 4a? > We can't find it in genbank or any of the papers reviewed to date. Michael, I put the following information together a few months ago, based on the construction of Charon 4A. The vector has not been sequenced, so I cannot guarantee that the information is 100% correct... Left Arm, Charon 4A Sequence is from ECOLACZ (accession no. V00296), 3078>3001 EcoRI site is over-lined with +'s UPPER CASE is Left arm of Charon 4A lower case is lacZ stuffer DNA ++++++ TTATTATTATTTTTGACACCAGACCAACTGGTAATGGTAGCGACCGGCGCTCAGCTGGaattccgccgatactgacgg AATAATAATAAAAACTGTGGTCTGGTTGACCATTACCATCGCTGGCCGCGAGTCGACCTTAAggcggctatgactgcc Right Arm, Charon 4A Sequence is from ECOUVRB2 (accession no. X03722). 120>300 EcoRI site is over-lined with +'s UPPER CASE is Right arm of Charon 4A lower case is bio256 stuffer DNA ++++++ caggtagcgactcatgagtaaaccgttcaaactgAATTCCGCTTTTAAACCTTCTGGCGATCAGCCAGAGGCGATTCG gtccatcgctgagtactcatttggcaagtttgacttaaGGCGAAAATTTGGAAGACCGCTAGTCGGTCTCCGCTAAGC ACGTCTCGAAGAGGGGCTGGAAGATGGCCTGGCGCACCAGACGTTACTTGGCGTGACTGGCTCAGGGAAAACCTTCAC TGCAGAGCTTCTCCCCGACCTTCTACCGGACCGCGTGGTCTGCAATGAACCGCACTGACCGAGTCCCTTTTGGAAGTG CATTGCCAATGTCATTGCTGACCTT GTAACGGTTACAGTAACGACTGGAA Cheers, GUY -- Dr.Guy Plunkett III for the E. coli Genome Project Laboratory of Genetics University of Wisconsin Phone: (608) 262-2534 445 Henry Mall Fax: (608) 263-7459 Madison, WI 53706 Internet: guy@genetics.wisc.edu "Life is too short, and DNA too long." -- Michael Crichton, Jurassic Park From owner-chromosomes@net.bio.net Tue Aug 08 23:00:00 1995 Path: biosci!ns1.faseb.org!darwin.sura.net!mother.usf.edu!news From: tabibzadeh@rics.moffitt.usf.edu (SIAMAK TABIBZADEH) Newsgroups: bionet.genome.chromosomes Subject: Frontiers in Bioscience, an electronic journal and virtual library Date: 9 Aug 1995 16:30:24 GMT Organization: Moffitt Cancer Center at USF Lines: 40 Message-ID: <40anr0$rp6@mother.usf.edu> NNTP-Posting-Host: pc3160.moffitt.usf.edu Mime-Version: 1.0 X-Newsreader: WinVN 0.93.11 Frontiers in Bioscience, an electronic journal and virtual library An electronic journal and virtual library has been created in order to facilitate rapid dissemination of scientific data as well as to provide investigators with numerous online tools for use in their day-to-day research activities. The publication cost is minimized or completely eliminated. A section of the journal is dedicated to publishing manuscripts that contain real time events. Access to a large number of databases is quite easy from the journal. These include databases for analysis of scientific data, search strategies, dictionaries, atlases, tutorials, conferences, information on products of various manufacturers, links to online journals and many other valuable information. Access to the journal and these services is free. The staff members of the journal are in the process of creation of various databases. One such database on gene knockout is already online. The journal can be accessed at the following address on WWW: http://bayanet.com/bioscinece Although submission of data for publication in electronic platforms has just begun, this method of distribution of scientific information would certainly be the logical route of the future. The first volume of the journal to be published around Jan 1996 will contain excellent manuscripts. Please take a moment to examine the journal and consider to send manuscripts for publication in this new and novel forum. The address of the editorial office is as follows: Frontiers in Bioscience S Tabibzadeh, MD, Dept of Pathology University of South Florida 12901 Bruce B Downs Blvd Tampa, FL 33612 Tel: 813-979-7237 Fax: 813-979-3085 E-mail: tabibzadeh@rics.moffitt.usf.edu From owner-chromosomes@net.bio.net Tue Aug 08 23:00:00 1995 Path: biosci!ns1.faseb.org!darwin.sura.net!mother.usf.edu!news From: tabibzadeh@rics.moffitt.usf.edu (SIAMAK TABIBZADEH) Newsgroups: bionet.genome.chromosomes Subject: Frontiers in Bioscience, an electronic journal and virtual library Date: 9 Aug 1995 16:29:54 GMT Organization: Moffitt Cancer Center at USF Lines: 40 Message-ID: <40anq2$rp6@mother.usf.edu> NNTP-Posting-Host: pc3160.moffitt.usf.edu Mime-Version: 1.0 X-Newsreader: WinVN 0.93.11 Frontiers in Bioscience, an electronic journal and virtual library An electronic journal and virtual library has been created in order to facilitate rapid dissemination of scientific data as well as to provide investigators with numerous online tools for use in their day-to-day research activities. The publication cost is minimized or completely eliminated. A section of the journal is dedicated to publishing manuscripts that contain real time events. Access to a large number of databases is quite easy from the journal. These include databases for analysis of scientific data, search strategies, dictionaries, atlases, tutorials, conferences, information on products of various manufacturers, links to online journals and many other valuable information. Access to the journal and these services is free. The staff members of the journal are in the process of creation of various databases. One such database on gene knockout is already online. The journal can be accessed at the following address on WWW: http://bayanet.com/bioscinece Although submission of data for publication in electronic platforms has just begun, this method of distribution of scientific information would certainly be the logical route of the future. The first volume of the journal to be published around Jan 1996 will contain excellent manuscripts. Please take a moment to examine the journal and consider to send manuscripts for publication in this new and novel forum. The address of the editorial office is as follows: Frontiers in Bioscience S Tabibzadeh, MD, Dept of Pathology University of South Florida 12901 Bruce B Downs Blvd Tampa, FL 33612 Tel: 813-979-7237 Fax: 813-979-3085 E-mail: tabibzadeh@rics.moffitt.usf.edu From owner-chromosomes@net.bio.net Tue Aug 08 23:00:00 1995 Path: biosci!daresbury!nntp-trd.UNINETT.no!Norway.EU.net!EU.net!howland.reston.ans.net!newsjunkie.ans.net!news.agt.net!news.planet.eon.net!news From: brian fitzsimons Newsgroups: bionet.genome.chromosomes Subject: Information on medical research Date: 9 Aug 1995 02:20:05 GMT Organization: Public Live Access Network (PLAnet) Lines: 7 Message-ID: <40960l$m59@tigger.planet.eon.net> NNTP-Posting-Host: 204.209.176.228 Would you like to know about some of the latest research on painful knees? Living Wills? The Genetics of Cancer? Or other health concerns? Look up the new Alberta Heritage Foundation for Medical Research website. The AHFMR is dedicated to research and development in the medical and scientific fields. http://www.sas.ab.ca/ahfmr From owner-chromosomes@net.bio.net Wed Aug 09 23:00:00 1995 Path: biosci!ns1.faseb.org!darwin.sura.net!mother.usf.edu!news From: tabibzadeh@rics.moffitt.usf.edu (SIAMAK TABIBZADEH) Newsgroups: bionet.genome.chromosomes Subject: Frontiers in Bioscience, a journal and virtual library Date: 10 Aug 1995 14:17:11 GMT Organization: Moffitt Cancer Center at USF Lines: 40 Message-ID: <40d4d7$703@mother.usf.edu> NNTP-Posting-Host: pc3160.moffitt.usf.edu Mime-Version: 1.0 X-Newsreader: WinVN 0.93.11 Frontiers in Bioscience, a journal and virtual library An electronic journal and virtual library has been created in order to facilitate rapid dissemination of scientific data as well as to provide investigators with numerous online tools for use in their day-to-day research activities. The publication cost is minimized or completely eliminated. A section of the journal is dedicated to publishing manuscripts that contain real time events. Access to a large number of databases is quite easy from the journal. These include databases for analysis of scientific data, search strategies, dictionaries, atlases, tutorials, conferences, information on products of various manufacturers, links to online journals and many other valuable information. Access to the journal and these services is free. The staff members of the journal are in the process of creation of various databases. One such database on gene knockout is already online. The journal can be accessed at the following address on WWW: http://bayanet.com/bioscience Although submission of data for publication in electronic platforms has just begun, this method of distribution of scientific information would certainly be the logical route of the future. The first volume of the journal to be published around Jan 1996 will contain excellent manuscripts. Please take a moment to examine the journal and consider to send manuscripts for publication in this new and novel forum. The address of the editorial office is as follows: Frontiers in Bioscience S Tabibzadeh, MD, Dept of Pathology University of South Florida 12901 Bruce B Downs Blvd Tampa, FL 33612 Tel: 813-979-7237 Fax: 813-979-3085 E-mail: tabibzadeh@rics.moffitt.usf.edu From owner-chromosomes@net.bio.net Wed Aug 09 23:00:00 1995 Path: biosci!internet!biosci!not-for-mail From: biohelp (BIOSCI Administrator) Newsgroups: bionet.genome.chromosomes Subject: UNSUBSCRIBING, BIOSCI ARCHIVES, ADDRESS DATABASE & BIOSCI FAQ Date: 10 Aug 1995 02:01:08 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 347 Sender: daemon@net.bio.net Distribution: world Message-ID: <199508100900.CAA29243@net.bio.net> NNTP-Posting-Host: net.bio.net Four important items follow: How to cancel e-mail subscriptions to BIOSCI newsgroups, BIOSCI archive searching, the BIOSCI FAQ, and the BIOSCI User Address Directory form. If you have not yet listed yourself in our BIOSCI user directory, please take a few minutes to complete and return the form below. If your personal information has changed since you listed yourself, please send us a complete new updated form. We can not make manual revisions to existing entries. Sincerely, Dave Kristofferson BIOSCI/bionet Manager biosci-help@net.bio.net **** How to cancel a BIOSCI e-mail subscription **** If you want to cancel your e-mail subscription to this group, PLEASE DO NOT POST YOUR UNSUBSCRIBE REQUEST TO THE NEWSGROUP ADDRESS (NOR REPLY TO A MESSAGE POSTED TO THE NEWSGROUP)!!! This would send your request to all of the readers of the newsgroup, but it might still not be seen by the BIOSCI staff - thus you would annoy many people and possibly not accomplish your goal anyway. IF YOU ARE LOCATED IN THE AMERICAS OR PACIFIC RIM COUNTRIES, please send a message to biosci@net.bio.net Instructions on how to subscribe/unsubscribe will be returned automatically, so the contents of your message do not matter. IF YOU ARE LOCATED IN EUROPE, AFRICA OR CENTRAL ASIA, please send a message to MXT@dl.ac.uk containing the word help in the body of the message to retrieve e-mail server instructions. Any text placed on the Subject: line of your message will be ignored, so be sure to put the "help" command in the body of the message. If you need personal assistance, a BIOSCI staff member can be contacted at either of the following addresses. Please contact the address designated for your location. Support Address Location --------------- -------- biosci@daresbury.ac.uk Europe, Africa, and Central Asia biosci-help@net.bio.net Americas and the Pacific Rim **** SEARCHING BIOSCI ARCHIVES **** The easiest way to search the BIOSCI archives is to use Mosaic or another World Wide Web browser and connect to the BIOSCI WWW home page at URL http://www.bio.net/. Select the hypertext link to the BIOSCI archives. This gives you read access to all newsgroup messages and the ability to search the indexes described below. You can also use gopher software and connect over the Internet to net.bio.net, the U.S. BIOSCI computer. We maintain three indexes which are searchable from the main gopher menu on net.bio.net: (1) an index of all BIOSCI postings; (2) an index of individual journal article references from the Table of Contents postings on the BIO-JOURNALS newsgroup; and (3) an index of BIOSCI users including regular mail and e-mail addresses, phone/FAX numbers, research interests, and newsgroup participation. E-mail users can search the BIOSCI archives by using our waismail e-mail server. For instructions send the message help to waismail@net.bio.net. Leave the Subject: line blank (anything entered on the Subject: line is ignored). WAIS software can also be used to search the archives as described in the BIOSCI FAQ (see below). Finally, the BIOSCI archive files are accessible by anonymous FTP to net.bio.net [134.172.2.69] in the directory pub/BIOSCI. **** BIOSCI FREQUENTLY ASKED QUESTIONS (FAQ) SHEET **** New users of BIOSCI/bionet may want to read the "Frequently Asked Questions" or "FAQ" sheet for BIOSCI. The FAQ provides details on how to participate in these forums and fix problems that you might encounter in using the newsgroups. The FAQ and other BIOSCI documentation is available through our WWW home page at URL http://www.bio.net/. It is also available for anonymous FTP from net.bio.net [134.172.2.69] in pub/BIOSCI/doc/biosci.FAQ or for retrieval by gopher to net.bio.net, port 70. It may also be requested by sending the command info faq in the body of an e-mail message to the Internet address biosci-server@net.bio.net. Please do not enter the info faq command on the Subject: line of your message since the e-mail server ignores text on the Subject: line. The FAQ is also posted on the first of each month to the newsgroup BIONEWS/bionet.announce immediately following the posting of the BIOSCI information sheet. **** BIOSCI USER ADDRESS DIRECTORY **** Please take this opportunity to add your name and address information to the BIOSCI User Address Database if you have not already done so. Below is the address form that we would like each reader of the BIOSCI/bionet newsgroups to complete and return if you would like to be listed in our database. The database serves as a directory that enables biologists, who are currently using (or even just reading) the BIOSCI newsgroups, to look up e-mail addresses and other information about our users. The address database is reindexed nightly for WAIS, waismail, gopher, and WWW access (the URL is http://www.bio.net). If you have access to gopher, connect to net.bio.net to search the database. If you have access to WAIS, please use our WAIS source biologists-addresses.src. If you are not on the Internet, please use our waismail server (send the word "help" to waismail@net.bio.net to get instructions; any text on the Subject: line of your message will be ignored, so put the help command in the body of the mail message.). Please carefully follow the instructions for completing the form below and return it to either of the following two addresses (whichever is more convenient for you). Thanks in advance for taking the time to complete and return the form. Addresses for returning forms Location Network ----------------------------- -------- ------- biovote@net.bio.net U.S.A. Internet/BITNET biovote@daresbury.ac.uk U.K. JANET MAKING SURE THAT YOUR INFORMATION IS CURRENT This notice will be mailed bimonthly to each newsgroup. You should check your database entry from time-to-time to see if your address information is still up-to-date. Using Gopher to complete the form --------------------------------- If you don't want to use a text editor, you can also use Dan Jacobson's gopher site to fill out the address database form as follows. Otherwise skip this section on gopher and proceed to the instructions for filling out the form below. > To add yourself to the database just point your > gopher client at merlot.gdb.org and select the following: > > --> 14. Searching For Biologists/ > > --> 9. E-mail Addresses of Biosci-Bionet Users/ > > --> 1. Add (or Correct) Your Address to the BIOSCI User Address > Data.. > > > And fill out the form. or Rob Harper's gopher site in Europe as follows: > Europeans can point their gopher client at gopher.csc.fi and add their > information to the database. All entries will be mailed directly to > Dave for incorporation in a wais source. > > The path to the questionare is as follows. > > > 6. Information in English/ > > 5. Scientific and other topics/ > > 1. Finnish EMBnet BioBox/ > > 9. FAQ Files/ > > 5. Bionauts Address Database (questionaire) > IMPORTANT INSTRUCTIONS - PLEASE READ CAREFULLY Please enter all responses after the : on each line, leaving one (1) blank space after the : (i.e., before the start of your text). Please do NOT extend your responses past the end of each line (80 characters). PLEASE DO NOT alter any of the field identifiers such as "first name: ". If you have nothing to enter after a field identifier, PLEASE LEAVE IT - do not delete it even if there is no data on the line in question. Several lines are provided at the end of the form for comments, but, please adhere to the line length restriction. On the date: line, please enter the date in the DD-MM-YY format, e.g., 15-05-93 for 15 May 1993. This line will tell others when the information was last updated. Please be sure to include the 0's for single digit days or months, e.g., 15-05-93, not 15-5-93. Note that the "e-mail network: " line below is for specifying, e.g., "Internet," "BITNET," "EARN," "JANET," or whatever other network that your computer may be on. If you are uncertain about any field, please feel free to leave it blank, but please DO NOT DELETE the field identifier from the form! In the first field below, "New information or Update ...", please enter "N" if this is the first time that you have registered in the directory or "U" if you are correcting a listing that you sent to us previously. The comment: lines may be used for anything that you like but PLEASE DO NOT DELETE THEM FROM THE FORM OR ALTER THEM. One suggested use is to list the names of the newsgroups in which you participate. Please use the MAILING LIST name (see below - the latest version of the list can be requested from biosci@net.bio.net) instead of the USENET name even if you don't participate by e-mail. WAIS might get confused by the periods in the USENET names. This allows one to retrieve via WAIS or waismail the list of participants in a particular group. For example: comment: ARABIDOPSIS PLANT-BIOLOGY BIONEWS On the comment: lines use these names below ---- NOT the USENET names below MAILING LIST NAME USENET Newsgroup Name ----------------- --------------------- ACEDB-SOFT bionet.software.acedb AGEING bionet.molbio.ageing AGROFORESTRY bionet.agroforestry ARABIDOPSIS bionet.genome.arabidopsis ASCB bionet.prof-society.ascb BIOCAN bionet.prof-society.cfbs BIOFORUM bionet.general BIO-INFORMATION-THEORY bionet.info-theory BIONAUTS bionet.users.addresses BIONEWS bionet.announce BIO-JOURNALS bionet.journals.contents BIO-MATRIX bionet.molbio.bio-matrix BIOPHYSICAL-SOCIETY bionet.prof-society.biophysics BIOPHYSICS bionet.biophysics BIO-SOFTWARE bionet.software BIOTHERMOKINETICS bionet.metabolic-reg BIO-WWW bionet.software.www CARDIOVASCULAR-RESEARCH bionet.biology.cardiovascular CELEGANS bionet.celegans CELL-BIOLOGY bionet.cellbiol CHLAMYDOMONAS bionet.chlamydomonas CHROMOSOMES bionet.genome.chromosomes COMPUTATIONAL-BIOLOGY bionet.biology.computational CSM bionet.prof-society.csm CYTONET bionet.cellbiol.cytonet DROSOPHILA bionet.drosophila EMBL-DATABANK bionet.molbio.embldatabank EMF-BIO bionet.emf-bio EMPLOYMENT bionet.jobs EMPLOYMENT-WANTED bionet.jobs.wanted FASEB bionet.prof-society.faseb GDB bionet.molbio.gdb GENBANK-BB bionet.molbio.genbank GENETIC-LINKAGE bionet.molbio.gene-linkage GRASSES-SCIENCE bionet.biology.grasses HIV-MOLECULAR-BIOLOGY bionet.molbio.hiv HUMAN-GENOME-PROGRAM bionet.molbio.genome-program IMMUNOLOGY bionet.immunology INFO-GCG bionet.software.gcg JOURNAL-NOTES bionet.journals.note METHODS-AND-REAGENTS bionet.molbio.methds-reagnts MICROBIOLOGY bionet.microbiology MOLECULAR-EVOLUTION bionet.molbio.evolution MOLECULAR-MODELLING bionet.molec-model MOLLUSC-MOLECULAR-NEWS bionet.molbio.molluscs MYCOLOGY bionet.mycology NEUROSCIENCE bionet.neuroscience N2-FIXATION bionet.biology.n2-fixation PARASITOLOGY bionet.parasitology PHOTOSYNTHESIS bionet.photosynthesis PLANT-BIOLOGY bionet.plants POPULATION-BIOLOGY bionet.population-bio PROTEIN-ANALYSIS bionet.molbio.proteins PROTEIN-CRYSTALLOGRAPHY bionet.xtallography PROTISTA bionet.protista RAPD bionet.molbio.rapd SCIENCE-RESOURCES bionet.sci-resources STADEN bionet.software.staden STRUCTURAL-NMR bionet.structural-nmr TROPICAL-BIOLOGY bionet.biology.tropical URODELES bionet.organisms.urodeles VIROLOGY bionet.virology WOMEN-IN-BIOLOGY bionet.women-in-bio YEAST bionet.molbio.yeast ZBRAFISH bionet.organisms.zebrafish Listing newsgroups on the comment: line is optional, of course. Thanks again for your cooperation! --------------- please cut here and return portion below --------------- New information or Update to old record (enter N or U): date (DD-MM-YY): first name: middle initial: family name: job title: e-mail address: e-mail network: phone number: FAX number: institution: address1: address2: address3: city: state/province: country: postal code: research interest: research interest: comment: comment: comment: comment: comment: From owner-chromosomes@net.bio.net Thu Aug 10 23:00:00 1995 Newsgroups: bionet.genome.chromosomes Path: biosci!daresbury!bioftp.unibas.ch!news.vub.ac.be!idefix.CS.kuleuven.ac.be!reks.uia.ac.be!news From: przemko@reks.uia.ac.be (Przemko Subject: chromosomes in species Message-ID: <1995Aug11.082034.20944@reks.uia.ac.be> Sender: news@reks.uia.ac.be (USENET News System) Organization: University of Antwerp X-Newsreader: Date: Fri, 11 Aug 1995 08:20:34 GMT Lines: 8 Hi! I try to find an answer to the following question: what is number of chromosomes in various species (not just mouse, human, yeast or the likes). Is there any pattern of species/evolutionary relationship/chromosome number and/or size? What about syngeny of different chromosomes across species? ThankX Przemko From owner-chromosomes@net.bio.net Sat Aug 12 23:00:00 1995 Path: biosci!bloom-beacon.mit.edu!newsfeed.internetmci.com!news.sprintlink.net!news.missouri.edu!news From: doug davis Newsgroups: bionet.genome.chromosomes Subject: (no subject) Date: 13 Aug 1995 23:04:45 GMT Organization: University of Missouri - Columbia Lines: 13 Message-ID: <40m0ed$j3h@news.missouri.edu> NNTP-Posting-Host: 128.206.44.106 Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 1.1N (Macintosh; I; PPC) To: tshafron@students.wisc.edu X-URL: news:40b73b$18ko@news.doit.wisc.edu Brett- The bacterium Haemophilus influenzae was the subject of several articles in July 28 issue of Science. It's the first free-living organism whose genome has been completely sequenced. Maybe this is the micro-organism that the NY Times story referred to. Hope this is what you were looking for. Doug Davis ddavis@biosci.mbp.missouri.edu From owner-chromosomes@net.bio.net Mon Aug 14 23:00:00 1995 Path: biosci!GALAXY.GOV.BC.CA!PMACLEOD From: PMACLEOD@GALAXY.GOV.BC.CA ("Dr. Patrick Macleod 727-4461") Newsgroups: bionet.genome.chromosomes Subject: HELP Date: 14 Aug 1995 17:43:41 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 3 Sender: daemon@net.bio.net Distribution: world Message-ID: <01HU2KW42FPI0A3DI1@mr.gov.bc.ca> NNTP-Posting-Host: net.bio.net HELP From owner-chromosomes@net.bio.net Tue Aug 15 23:00:00 1995 Path: biosci!bcm!news.msfc.nasa.gov!newsfeed.internetmci.com!usenet.eel.ufl.edu!news.gmi.edu!msunews!harbinger.cc.monash.edu.au!g11-11.cc.monash.edu.au!s-vidot From: s-vidot@monash.edu.au Newsgroups: bionet.genome.chromosomes Subject: Help ME! On Genetic Engineering!! Date: Wed, 16 Aug 1995 00:57:54 GMT Organization: Monash University Lines: 10 Message-ID: NNTP-Posting-Host: g11-11.cc.monash.edu.au X-Newsreader: Trumpet for Windows [Version 1.0 Rev A] Help me. I'm a student at High school and I'm currently doing an assignment on genetic engineering. My topic is insulin production using recombinant DNA. I'm specificly looking for any information on the steps involved in this genetic engineering of artificial production of human insulin through recombination of the E.Coli bacterium. If anybody has some articles or material they can help me with, could you please reply or E-mail me at: s-vidot@pfs01.cc.monash.edu.au Mary. From owner-chromosomes@net.bio.net Tue Aug 15 23:00:00 1995 Path: biosci!bcm!news.msfc.nasa.gov!newsfeed.internetmci.com!news.sprintlink.net!in1.uu.net!newsflash.concordia.ca!canopus.cc.umanitoba.ca!tribune.usask.ca!news.sasknet.sk.ca!rover.ucs.ualberta.ca!news.ucalgary.ca!srv1.freenet.calgary.ab.ca!blood From: djnb Newsgroups: bionet.genome.chromosomes Subject: Klinefelter's Syndrome Date: Tue, 15 Aug 1995 10:46:36 -0600 Organization: Calgary Free-Net Lines: 10 Message-ID: NNTP-Posting-Host: blood@srv1.freenet.calgary.ab.ca Mime-Version: 1.0 Content-Type: TEXT/PLAIN; charset=US-ASCII I need to find current information with respect to the Klinefelter's Syndrome (47XXY) - primarily with respect to the clinical and medical problems and the social educational needs of children and adults with the syndrome. I need this info ASAP. Is there a support group or site on the net for people with the syndrome or parents of children with the syndrome? Thanks. From owner-chromosomes@net.bio.net Wed Aug 16 23:00:00 1995 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!tank.news.pipex.net!pipex!oleane!jussieu.fr!news-rocq.inria.fr!news2.EUnet.fr!ceph.cephb.fr!linehan From: linehan@ceph.cephb.fr (Paul Linehan) Newsgroups: bionet.genome.chromosomes Subject: genetic engineering Date: 17 Aug 1995 12:50:52 +0200 Organization: Fondation J. Dausset - CEPH Lines: 18 Distribution: world Message-ID: <40v6uc$2o5@ceph.cephb.fr> NNTP-Posting-Host: ceph.cephb.fr there is a book (author unknown to me) called "Invisible Frontiers" which describes the history of the cloning of the insulin gene. Aimed at the educated layman (sorry person), it gives a reasonable insight into the biology. Paul... From owner-chromosomes@net.bio.net Thu Aug 17 23:00:00 1995 Newsgroups: bionet.genome.chromosomes Path: biosci!lhc!borduas!francis From: francis@borduas.nlm.nih.gov (Francis Ouellette) Subject: Re: (no subject) Message-ID: <1995Aug14.033716.4734@nlm.nih.gov> Sender: news@nlm.nih.gov Organization: National Library of Medicine X-Newsreader: TIN [version 1.2 PL2] References: <40m0ed$j3h@news.missouri.edu> Date: Mon, 14 Aug 95 03:37:16 GMT Lines: 23 doug davis (ddavis@biosci.mbp.missouri.edu) wrote: > The bacterium Haemophilus influenzae was the subject of several > articles in July 28 issue of Science. It's the first free-living > organism whose genome has been completely sequenced. Maybe this > is the micro-organism that the NY Times story referred to. > Hope this is what you were looking for. You can look at the URL below for the sequences in GenBank, and a link to TIGR's page where the work was done. http://www.ncbi.nlm.nih.gov/ regards, francis -- | B.F. Francis Ouellette | GenBank | | francis@ncbi.nlm.nih.gov From owner-chromosomes@net.bio.net Thu Aug 17 23:00:00 1995 Newsgroups: bionet.genome.chromosomes Path: biosci!bcm!cs.utexas.edu!news.sprintlink.net!EU.net!ieunet!maths.tcd.ie!news.tcd.ie!acer.gen.tcd.ie!dbarton From: dbarton@acer.gen.tcd.ie (Dr David E Barton) Subject: Re: Klinefelter's Syndrome Message-ID: Sender: usenet@news.tcd.ie (TCD News System ) Organization: Irish National Centre for Medical Genetics Date: Fri, 18 Aug 1995 09:06:38 GMT Lines: 20 djnb wrote: >I need to find current information with respect to the Klinefelter's >Syndrome (47XXY) - primarily with respect to the clinical and medical >problems and the social educational needs of children and adults with the >syndrome. I need this info ASAP. TRY OMIM: http://gdbwww.gdb.org/omim/omimq This provides a text query into OMIM, a full text database of information on human genetic disorders. | David Barton | National Centre for Medical Genetics | Our Lady's Hospital for Sick Children | Crumlin, Dublin 12, Ireland. | Tel +353 1 455 0515 Fax 455 8873 From owner-chromosomes@net.bio.net Fri Aug 18 23:00:00 1995 Path: biosci!bloom-beacon.mit.edu!news.moneng.mei.com!howland.reston.ans.net!news-e1a.megaweb.com!newstf01.news.aol.com!newsbf02.news.aol.com!not-for-mail From: leroyc1013@aol.com (LeroyC1013) Newsgroups: bionet.genome.chromosomes Subject: Re: Klinefelter's Syndrome Date: 19 Aug 1995 00:44:58 -0400 Organization: America Online, Inc. (1-800-827-6364) Lines: 11 Sender: root@newsbf02.news.aol.com Message-ID: <413q8a$jde@newsbf02.news.aol.com> References: Reply-To: leroyc1013@aol.com (LeroyC1013) NNTP-Posting-Host: newsbf02.mail.aol.com You can find volumes of information by contacting K.S. and Associates P.O. Box 119 Roseville, CA 95678 They send out a great newsletter that is published every 2 mos. Our 18 yr. old has K.S., and this newsletter has been ouf great help for him and for us. There is a conference on K.S. in Oct. in Washington D.C. I am not aware of any K.S. newsgroups at this time, but would love to see one started. From owner-chromosomes@net.bio.net Sat Aug 19 23:00:00 1995 Path: biosci!agate!howland.reston.ans.net!gatech!newsfeed.internetmci.com!news.compuserve.com!news.production.compuserve.com!news From: Othmar J. Dill <100143.2047@CompuServe.COM> Newsgroups: bionet.genome.chromosomes Subject: Position available: Genotoxicology Date: 20 Aug 1995 09:49:12 GMT Organization: medcon Kontraktlabor GmbH Lines: 26 Message-ID: <4170eo$350$1@mhade.production.compuserve.com> Position available: Genome - Toxicologist! A German CRO is currently looking for a scientist, who is experienced in Gen-Toxicology and Mutations. This includes the detection of chromosomal abnormalities like: chromosomal deletions, relocations, breaks a.s.o.. The candidate should have a working knowledge on cytogenetics and in mutation research to measure the effect of drugs and chemicals onto the genome of mammalian organisms. This will include detection of micronucleus formation and other in vitro techniques. The company is located in Northern Germany. An adequate salary will be negotiated. Please contact for further informations: medcon Kontraktlabor GmbH Othmar J Dill, PH.D. Suedkampen 31 29664 Walsrode Germany Tel.: +49 5166 590 Fax: +49 5166 5026 e-mail: 100447.246@compuserve.com -- Othmar Dill From owner-chromosomes@net.bio.net Sun Aug 20 23:00:00 1995 Path: biosci!bcm!news.msfc.nasa.gov!newsfeed.internetmci.com!howland.reston.ans.net!tank.news.pipex.net!pipex!lyra.csx.cam.ac.uk!news From: Ian Dunham Newsgroups: bionet.software.acedb,bionet.molbio.genome-program,bionet.genome.chromosomes Subject: HUMAN CHROMOSOME 22 ACEDB DATABASE Date: 21 Aug 1995 17:21:14 GMT Organization: University of Cambridge, England Lines: 171 Message-ID: <41afaa$6ai@lyra.csx.cam.ac.uk> NNTP-Posting-Host: rock.sanger.ac.uk Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 1.1N (X11; I; OSF1 V3.0 alpha) X-URL: news:bionet.software.acedb#412ha4$r8m@ixnews4.ix.netcom.com Xref: biosci bionet.software.acedb:690 bionet.molbio.genome-program:1482 bionet.genome.chromosomes:780 ================================== HUMAN CHROMOSOME 22 ACEDB DATABASE ================================== The first release of the human chromosome 22 physical mapping database (22ace) from the Sanger Centre is now available by ftp from ftp.sanger.ac.uk in directory pub/human/chr22/physical_map. The database is implemented in version 4_1 of ACEDB, the graphical database manager, developed for the nematode genome project. The database includes all the YAC and cosmid physical map data from the Sanger Centre chromosome 22 mapping group, presented in context with reagent details, relevant DNA sequences, bibliography, and so on. We are using the database to store the information generated as the Sanger Centre's part of a joint project to sequence chromosome 22 and further releases will present physical map and sequence progress, in its full genomic context. Details of how to obtain the database, and more description of its contents are contained in the README file which is included below. Many thanks go to the following for their work in helping to get this database together, The Sanger Centre chromosome 22 mapping group - John Collins, Charlotte Cole, Luc Smink, Charmain Garrett, Kathy Evans, Joanne Fay, Lisa O'Neill, Margaret Leversha, Simon Gregory. Gareth Maslen, Kate Rice, Richard Durbin, Simon Kelley and Cari Soderlund on informatics. Callum Bell, Bruce Roe, Tom Hudson and all those at the Philadelphia and Whitehead Institute genome centers for provision of data. For further information, please feel free to contact Ian Dunham at -------------------------------------------------------------------------- \ // Ian Dunham Tel: 01223 494948 \ Sanger Centre FAX: 01223 494919 // Hinxton Hall \ Hinxton // Cambridge Email: id1@sanger.ac.uk \ CB10 1RQ idunham@hgmp.mrc.ac.uk // www: http://www.sanger.ac.uk/~id1 ========================================================================== README File ----------- This is the release version of the human chromosome 22 version of ACEDB. The database uses the current release of the ACEDB code, ACEDB 4_1 which can also be obtained independently from this site in directory pub/acedb. The database contains - The YAC physical map of chromosome 22 as determined by the chromosome 22 mapping group at the Sanger Centre - Current progress on cosmid mapping and sequencing from the Sanger Centre - YAC/STS assignments from the Philadelphia Genome Center and the Whitehead Institute as described in Bell et al., Hum Mol Genet 4, 59-69 (1995) and Hudson et al., Genomics 24, 588-592 (1994) - Thanks to Callum Bell and all those at these institutes for providing these data in electronic form. See also their WWW sites as detailed in the database for more information. - Current progress on cosmid mapping and sequencing from the Sanger Centre - Information on all probes and STS markers used in the YAC map plus many others - DNA sequences from chromosome 22 including cosmid from the Sanger Centre submitted to EMBL - Representations of genetic maps of the chromosome and hybrid mapping data, including bin assignments from The Philadelphia Genome Center and the Whitehead Institute (Bell et al., Hum Mol Genet 4, 59-69 (1995) and Hudson et al., Genomics 24, 588-592 (1994) and hybrid data generated at the Sanger Centre - An extensive bibliography - Addresses of laboratories involved in chromosome 22 mapping - Representations of the CEPH mega, ICRF and ICI YAC libraries, and the flow sorted chromosome 22 cosmid library (LL22NC03) - OMIM data on diseases and loci on the chromosome To use the database get the file 22db.tar.Z by ftp. Uncompress the file in the directory of your choice - I suggest your root directory. i.e. > uncompress 22db.tar.Z then extract the tar file to form a subdirectory tree rooted on the directory 22db. i.e. > tar -xvf 22db.tar In the directory 22db/bin you will find subdirectories containing binary executables for DEC ALPHA, SunOS, Solaris and SGI. To run the database set the environment variable ACEDB to the directory 22db i.e. > setenv ACEDB 22db and run the executable you require i.e. for DEC ALPHA 22db/bin/ALPHA/ace4_1.ALPHA The database should now run. It is possible to run the same database from machines with the different operating systems and to have a script to do this. Here is an example of a script we use where the database is held in directory ~id1/22db. -----------------------------begin script---------------------- #!/bin/csh setenv ACEDB ~id1/22db echo -n "ACEDB home directory : " echo $ACEDB echo switch (`ostype`) case "OSF1": ~id1/22db/bin/ALPHA/ace4_1.ALPHA breaksw case "SunOS": ~id1/22db/bin/SunOS/ace4_1.SUN breaksw case "Irix": ~id1/22db/bin/SGI/ace4_1.SGI breaksw case "Solaris": ~id1/22db/bin/SOL/ace4_1.SOLARIS breaksw endsw ----------------------------end---------------------------------- To view the physical map of the chromosome double click on Maps and the full YAC map will be presented in scrollable form. I should stress that this is a direct copy of the laboratory database we use and as such may not contain some of the information you deem necessary. Please feel free to send me comments so that I can improve the database and correct any mistakes. If you need further information about the final release please contact me as well. Also included in the directory pub/human/chr22/physical_map/sam are the sam solution files that we used to construct the YAC map. To use these you must also pick up the latest version of the program sam, written by Cari Soderlund, from the directory pub/sam (At least version 2.5 is required). -------------------------------------------------------------------------- \ // Ian Dunham Tel: 01223 494948 \ Sanger Centre FAX: 01223 494919 // Hinxton Hall \ Hinxton // Cambridge Email: id1@sanger.ac.uk \ CB10 1RQ idunham@hgmp.mrc.ac.uk // www: http://www.sanger.ac.uk/~id1 ========================================================================== Ian Dunham 21 August 1995 From owner-chromosomes@net.bio.net Sun Aug 20 23:00:00 1995 Path: biosci!EXTRA.NCHGR.NIH.GOV!benton From: benton@EXTRA.NCHGR.NIH.GOV (David Benton) Newsgroups: bionet.genome.chromosomes Subject: Re: HUMAN CHROMOSOME 11 Date: 21 Aug 1995 10:17:45 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 15 Sender: daemon@net.bio.net Distribution: world Message-ID: <9508211717.AA17895@extra.nchgr.nih.gov> NNTP-Posting-Host: net.bio.net The chromosome 11 maps developed by Glen Evans and coworkers are available at: http://mcdermott.swmed.edu/datapage/datapage.html Sincerely, David Benton, Ph.D. Director, Genome Informatics Program National Center for Human Genome Research NIH From owner-chromosomes@net.bio.net Sun Aug 20 23:00:00 1995 Path: biosci!agate!howland.reston.ans.net!tank.news.pipex.net!pipex!in2.uu.net!newsflash.concordia.ca!news.mcgill.ca!q-05.das.mcgill.ca!user From: b2d6@musicb.mcgill.ca (Nick Giannoukakis) Newsgroups: bionet.genome.chromosomes Subject: Re: HUMAN CHROMOSOME 11 Date: 21 Aug 1995 16:42:42 GMT Organization: McGill University Lines: 26 Message-ID: References: NNTP-Posting-Host: q-05.das.mcgill.ca In article , cichon@uni-muenster.de (Christoph Cichon) wrote: > Dear netters! > > We are looking for a complete map of human chromosome 11, including the > position of dinucleotide (short tandem) repeats in relation to specific > loci on this chromosome. > > We would appreciate your help in finding a www-sites from which we could > receive this information. > > Thank you very much! > > Christoph Cichon PhD > Institut fuer Infektiologie > Von-Esmarch-Str. 56 > D-48149 Muenster, FRG > e-mail: cichon@uni-muenster.de You can try the Genome Data Base at Johns Hopkins. The URL for the main page is http://www.gdb.org Good luck. Nick. From owner-chromosomes@net.bio.net Sun Aug 20 23:00:00 1995 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!xlink.net!news.dfn.de!uni-muenster.de!ifimac02.uni-muenster.de!user From: cichon@uni-muenster.de (Christoph Cichon) Newsgroups: bionet.genome.chromosomes Subject: HUMAN CHROMOSOME 11 Date: Mon, 21 Aug 1995 16:09:51 +0100 Organization: ZMBE - Institut fuer Infektiologie Lines: 16 Message-ID: NNTP-Posting-Host: ifimac02.uni-muenster.de Dear netters! We are looking for a complete map of human chromosome 11, including the position of dinucleotide (short tandem) repeats in relation to specific loci on this chromosome. We would appreciate your help in finding a www-sites from which we could receive this information. Thank you very much! Christoph Cichon PhD Institut fuer Infektiologie Von-Esmarch-Str. 56 D-48149 Muenster, FRG e-mail: cichon@uni-muenster.de From owner-chromosomes@net.bio.net Sun Aug 20 23:00:00 1995 Path: biosci!bloom-beacon.mit.edu!panix!usenet From: Gary Welz Newsgroups: bionet.genome.chromosomes Subject: Accessing "Is a Genome Like a Computer Program" Date: 21 Aug 1995 02:27:01 GMT Organization: SETN Lines: 22 Message-ID: <418qtl$mv7@news1.panix.com> NNTP-Posting-Host: gwelz.dialup.access.net Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 1.1N (Macintosh; I; 68K) X-URL: news:bionet.genome.chromosomes Readers, A few weeks ago I announced the online publication of my article "Is a Genome Like a Computer Program" in The X Advisor. At that time I gave a URL for the article. Since my posting The X Advisor has begun requiring readers to subscribe and obtain a password to see all articles. Subscription for the online version is free. (A print version is also available for a reasonable charge.) You can subscribe to The X Advisor and see my article by going to The X Advisor Issue #2 Table of Contents page and filling out a simple form. Subscribing is free and instantaneous. Then you can then scroll down the page and view the article in my monthly column which is called "Peripheral Visions." My apologies to all who tried to access the article but were unable to get into it. regards, Gary From owner-chromosomes@net.bio.net Tue Aug 22 23:00:00 1995 Path: biosci!bcm!news.msfc.nasa.gov!newsfeed.internetmci.com!usenet.eel.ufl.edu!noc.netcom.net!ix.netcom.com!netnews From: cordes1@ix.netcom.com (Charles H. Cordes ) Newsgroups: bionet.genome.chromosomes Subject: Project: Scarlet Tanager Date: 23 Aug 1995 00:38:08 GMT Organization: Netcom Lines: 5 Message-ID: <41dt9g$e00@ixnews5.ix.netcom.com> NNTP-Posting-Host: ix-orl3-25.ix.netcom.com I am doing my first Biology project in high school, and I am having great difficulty in finding data. My subject is the bird species of Scarlet Tanager. How many chromosomes does this species have? Also, are cells in birds similar to those of all animals? Any help you can send me is appreciated. My fax number is (407)299-9013. Thank you. From owner-chromosomes@net.bio.net Tue Aug 22 23:00:00 1995 Path: biosci!daresbury!nntp-trd.UNINETT.no!Norway.EU.net!EU.net!newsfeed.internetmci.com!news.sprintlink.net!in1.uu.net!newstf01.news.aol.com!newsbf02.news.aol.com!not-for-mail From: schiller01@aol.com (Schiller01) Newsgroups: bionet.genome.chromosomes Subject: Cyanine fluorescent dyes for life science research Date: 23 Aug 1995 09:59:42 -0400 Organization: America Online, Inc. (1-800-827-6364) Lines: 18 Sender: root@newsbf02.news.aol.com Message-ID: <41fc8e$k87@newsbf02.news.aol.com> Reply-To: schiller01@aol.com (Schiller01) NNTP-Posting-Host: newsbf02.mail.aol.com Amersham Life Science now carries a line of multicolor fluorescent reagents and directly labeled biologicals for the use in immunoassays, confocal microscopy, flow cytometry, FISH, etc. These products are tagged with the Cyanine dyes, which are highly fluorescent, highly photostable, pH insensitive and water soluble fluorescent molecules. Amersham's current line of Cyanine reagents includes, Protein/Oligo labeling kits, labeled secondary antibodies, labeled Avidin and Streptavidin, labeled deoxynucleotides, Nick Translation labeling kits, Centromeric chromosome probes, Whole Chromosome Paints, and 5-Packs and bulk reactive dye. The colors available are Cy2 (green), Cy3 (orange), Cy3.5 (scarlet), Cy5 (far-red), Cy5.5 (near infrared) and soon to come Cy7 (near infrared). For more information, please contact Gerald Schiller at Biological Detection Systems/Amersham Life Science at 800-826-7001 ext. 218 or by E-mail at Schiller01@AOL.com. From owner-chromosomes@net.bio.net Wed Aug 23 23:00:00 1995 Path: biosci!bcm!cs.utexas.edu!news.sprintlink.net!tank.news.pipex.net!pipex!oleane!jussieu.fr!infobiogen.fr!news From: bruno@infobiogen.fr (Bruno Urbero) Newsgroups: bionet.genome.chromosomes Subject: Re: braekpoint chromosome 4q 27 Date: Thu, 24 Aug 1995 10:10:46 GMT Organization: INFOBIOGEN : INFOrmatique appliquée à l'étude des BIOmolécules et des GENomes. Lines: 41 Message-ID: <41hiv8$lik@lovelace.infobiogen.fr> References: <3vedo0$sa8@neptunus.pi.net> NNTP-Posting-Host: junior.infobiogen.fr Mime-Version: 1.0 Content-Type: text/plain; charset=iso-8859-1 Content-Transfer-Encoding: 8bit X-Newsreader: Forte Free Agent 1.0.82 muze@pi.net (De Muze) wrote: >Lectori Salutem, >what do you know about braekpoint chromosome 4q 27; does it code >for any protein ? >I try to find linkage with a special phenotype of a partial trisomy >chromesome 4 , with invertion duplication 4q26:: 32 and 4q32:: -> >I'm a medical student trying to write an article ! >my name S. Frints ; RL- uni . -Maastricht -NL- >Many thanks for your reply to this newsgroup or to my Emailadress. >##### Please send your reply to: hvingen@cuci.nl ###### The breakpoint 4q27 has a locus symbol B4P16 and is defined by 4q27, CY194, t(4;16)(q27;p13.3). The assignation method was "Cytogenetic Rearrangement Contributing Directly to Phenotype" This has been discribed by Callen DF in 1994. All these data are in GDB (Genome Data Base) which is available in several places (Baltimore, Paris,...). Its free for academic use. If you need details feel free to contact me Bruno Urbero /------------------------------------------------------------\ | Bruno URBERO, Ph.D. Editorial Assistant of the GDB | |------------------------------------------------------------| | INFOBIOGEN | Tel : 33 (1) 45 59 52 52 | | Centre de BioInformatique | Tel : 33 (1) 49 58 36 36 | | UMS 825 CNRS - SC 13 INSERM | Fax : 33 (1) 45 59 52 50 | | 7, rue Guy Moquet - BP 8 | Fax : 33 (1) 49 58 36 89 | | 94801 VILLEJUIF Cedex | | | FRANCE | E-mail : bruno@infobiogen.fr | \------------------------------------------------------------/ From owner-chromosomes@net.bio.net Wed Aug 23 23:00:00 1995 Path: biosci!rutgers!oitnews.harvard.edu!news.dfci.harvard.edu!usenet From: margaret shirra Newsgroups: bionet.genome.chromosomes Subject: chromosome breaks in cancer Date: 24 Aug 1995 18:02:20 GMT Organization: Dana-Farber Cancer Institute Lines: 10 Message-ID: <41ierc$h1t@cisunix1.dfci.harvard.edu> NNTP-Posting-Host: 155.52.20.24 Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 1.1N (Macintosh; I; 68K) X-URL: news:bionet.genome.chromosomes Our protein has been localized to a portion of chromosome 12 (human). Is there a list on the net (or do I need to go to the books) of human cancers which have been associated with breaks or rearrangements on a particular region of a chromosome. Thank you for your reply shirra@mbcrr.harvard.edu From owner-chromosomes@net.bio.net Sun Aug 27 23:00:00 1995 Path: biosci!TERRA.COLORADO.EDU!cindy From: cindy@TERRA.COLORADO.EDU (Cindy Orser) Newsgroups: bionet.genome.chromosomes Subject: VACANCY Date: 28 Aug 1995 14:59:23 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 7 Sender: daemon@net.bio.net Distribution: world Message-ID: NNTP-Posting-Host: net.bio.net Postdoctoral position is available immediately to study the molecular basis of microbial dehalogenation rxns. Candidate should have a Ph.D. with background in molecular biology and/or protein purification. Salary is very competitive and commensurate with level of experience. This is a one year position. The university of colorado is an equal opportunity/affirmative action employer. If interested, please contact C. Orser at Cindy@terra.colorado.edu From owner-chromosomes@net.bio.net Sun Aug 27 23:00:00 1995 Path: biosci!TERRA.COLORADO.EDU!cindy From: cindy@TERRA.COLORADO.EDU (Cindy Orser) Newsgroups: bionet.genome.chromosomes Subject: (none) Date: 28 Aug 1995 11:00:59 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 1 Sender: daemon@net.bio.net Distribution: world Message-ID: NNTP-Posting-Host: net.bio.net I would like information on posting a job vacancy.....Thank you! C. Orser From owner-chromosomes@net.bio.net Sun Aug 27 23:00:00 1995 Path: biosci!agate!news.duke.edu!godot.cc.duq.edu!hudson.lm.com!news.psc.edu!nntp.sei.cmu.edu!bb3.andrew.cmu.edu!casaba.srv.cs.cmu.edu!perlin From: perlin+@J.GP.CS.CMU.EDU (Mark Perlin) Newsgroups: bionet.genome.chromosomes Subject: chromosome 11 map Date: 28 Aug 1995 15:50:53 GMT Organization: Carnegie-Mellon University, School of Computer Science Lines: 24 Message-ID: <41sokt$210@casaba.srv.cs.cmu.edu> NNTP-Posting-Host: j.gp.cs.cmu.edu Originator: perlin@J.GP.CS.CMU.EDU (1) An excellent map of chromosome 11 markers (including > 100 highly polymorphic STRs) was described in: James, M.R., Richard III, C.W., Schott, J.-J., Yousry, C., Clark, K., Bell, J., Hazan, J., Dubay, C., Vignal, A., Agrapart, M., Imai, T., Nakamura, Y., Polymeropoulos, M., Weissenbach, J., Cox, D.R., and Lathrop, G.M. (1994). A radiation hybrid map of 506 STS markers spanning human chromosome 11. Nature Genetics, 8(1): 70-76. and is available electronically via: ftp.well.ox.ac.uk :: pub/genetics/rh11 (2) A physical map of nonchimeric clones (350kb YACs) that is integrated with Michael James' radiation hybrid map is: Perlin, M.W., Duggan, D.J., Davis, K., Farr, J.E., Findler, R.B., Higgins, M.J., Nowak, N.J., Evans, G.A., Qin, S., Zhang, J., Shows, T.B., James, M.R., and Richard III, C.W. (1995). Rapid construction of integrated maps using inner product mapping: YAC coverage of human chromosome 11. Genomics, 28(2): 315-327. This map will soon be available via WWW and FTP. Contact "perlin@cmu.edu" for more information. From owner-chromosomes@net.bio.net Mon Aug 28 23:00:00 1995 Path: biosci!daresbury!nntp-trd.UNINETT.no!Norway.EU.net!EU.net!howland.reston.ans.net!vixen.cso.uiuc.edu!uwm.edu!fnnews.fnal.gov!lakesis.fapesp.br!bee08.uspnet.usp.br!bee.uspnet.usp.br!spider.usp.br!flopes From: Fernando Lopes Alberto Newsgroups: bionet.genome.chromosomes Subject: Conversion Date: Fri, 25 Aug 1995 00:57:24 -0500 Organization: Universidade de Sao Paulo / Brasil Lines: 7 Message-ID: NNTP-Posting-Host: spider.usp.br Mime-Version: 1.0 Content-Type: TEXT/PLAIN; charset=US-ASCII Could someone, geneticist, give me detailed explanation and indicate pertinent literature on the idea of genic conversion? Thanks in advance, Fernando Lopes Alberto, MD Ribeirao Preto School of Medicine University of Sao Paulo, Brazil. From owner-chromosomes@net.bio.net Mon Aug 28 23:00:00 1995 Path: biosci!bcm.tmc.edu!cs.utexas.edu!news.sprintlink.net!EU.net!news2.EUnet.fr!ceph.cephb.fr!linehan From: linehan@ceph.cephb.fr (Paul Linehan) Newsgroups: bionet.genome.chromosomes Subject: Conversion Date: 29 Aug 1995 13:19:18 +0200 Organization: Fondation J. Dausset - CEPH Lines: 15 Distribution: world Message-ID: <41ut3m$d2o@ceph.cephb.fr> NNTP-Posting-Host: ceph.cephb.fr take a look at Fundamentals of Molecular Evolution by Li and Graur. Good intro to this sort of material. Regards. Paul... From owner-chromosomes@net.bio.net Tue Aug 29 23:00:00 1995 Path: biosci!rutgers!uwm.edu!vixen.cso.uiuc.edu!howland.reston.ans.net!newsfeed.internetmci.com!info.ucla.edu!library.ucla.edu!nntp.club.cc.cmu.edu!clpgh.org!kaplanr From: kaplanr@clpgh.org (Richard Kaplan) Newsgroups: bionet.genome.chromosomes Subject: Microcephaly Message-ID: <1995Aug29.101538.4016@clp2> Date: 29 Aug 95 10:15:38 -5 Organization: Carnegie Library of Pittsburgh Lines: 12 I am trying a stab in the dark here as well as some other sites. I have a two year old son with microcephaly and global developmental delays; he's probably 60-70% delayed with no medical problems. My wife and I are trying to determine if there is research going on concerning microcephaly, beyond its relationship to mental retardation. Our son for all intents and purposes is retarded, but ther is no name or ailment that he has. He's had two chromosomal analysis done, including one for fragile-x and they've come back negative. Any help, suggestions, or names would be helpful. Thanks for your time. Richard Kaplan kaplanr@clpgh.org From owner-chromosomes@net.bio.net Tue Aug 29 23:00:00 1995 Path: biosci!daresbury!bioftp.unibas.ch!citi2.fr!jussieu.fr!univ-lyon1.fr!swidir.switch.ch!swsbe6.switch.ch!scsing.switch.ch!news.rccn.net!iris02.itqb.unl.pt!doom.itqb.unl.pt!amartins From: amartins@doom.itqb.unl.pt (Alexandra Martins) Newsgroups: bionet.molbio.methds-reagnts,bionet.molbio.genbank,bionet.genome.chromosomes,bionet.molbio.embldatabank Subject: Vero cells transfection/internal control Date: 30 Aug 1995 18:35:45 GMT Organization: Instituto Gulbenkian de Ciencia Lines: 11 Message-ID: <422b21$ql3@iris02.itqb.unl.pt> NNTP-Posting-Host: doom.itqb.unl.pt Keywords: Transfection, monkey cells, transient expression X-Newsreader: TIN [version 1.2 PL2] Xref: biosci bionet.molbio.methds-reagnts:32857 bionet.molbio.genbank:2103 bionet.genome.chromosomes:792 bionet.molbio.embldatabank:538 Dear netters, I am doing transient expression experiments using Vero cells (green monkey kidney cells) and I need to probe the cellular DNA with an endogeneous cellular gene. Can anyone provide me the sequence of a Vero gene with a known copy number? Thanks in advance, Alexandra Martins From owner-chromosomes@net.bio.net Tue Aug 29 23:00:00 1995 Path: biosci!daresbury!not-for-mail From: rifat_h Newsgroups: bionet.genome.chromosomes Subject: Mini-preps for fluorescent sequencing of low copy plasmids Date: 30 Aug 1995 22:36:28 +0100 Lines: 18 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <422lks$6um@mserv1.dl.ac.uk> X-Mts: smtp X-Authentication-Warning: jupiter.icr.ac.uk: Host localhost didn't use HELO protocol Original-To: biochrom@dl.ac.uk Hi, I would be grateful if anyone could inform me if there is a way of carrying out reliable mini template DNA preps for automated fluorescent sequencing of low copy plasmids. I have tried Qiagen, Promega Wizard 373A and small scale Alkaline Lysis/PEG but with very low success rate. If anyone has been using a reliable mini-prep method for low copy plasmid sequencing, then I would appreciate it very much if he/she could contact me. The above kits and the Alkaline lysis PEG work well with high copy plasmid but with low copy plasmid starting from 10ml culture and increasing Soln I, II and III does not seem to make a difference towards the template prep. Thanks. Rifat. email : rifat_h@icr.ac.uk From owner-chromosomes@net.bio.net Wed Aug 30 23:00:00 1995 Path: biosci!bcm.tmc.edu!cs.utexas.edu!howland.reston.ans.net!spool.mu.edu!newspump.wustl.edu!crcnews.unl.edu!aux.marc.usda.gov!news From: Broom Newsgroups: bionet.genome.chromosomes Subject: Re: Cyanine fluorescent dyes for life science research Date: 31 Aug 1995 21:42:06 GMT Organization: USDA ARS Meat Animal Research Center Lines: 10 Message-ID: <425abe$8mv@aux.marc.usda.gov> References: <41fc8e$k87@newsbf02.news.aol.com> NNTP-Posting-Host: powermap.marc.usda.gov Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 1.1N (Macintosh; I; PPC) To: schiller01@aol.com X-URL: news:41fc8e$k87@newsbf02.news.aol.com Dear Dr. Schiller, I am very interested in the Cyanine reagents. I am working in FISH with bovine chromosomes mainly and I wish to have more information about the possibilites of these dyes. Thanks in advance. Nestor Lopez From owner-chromosomes@net.bio.net Thu Aug 31 23:00:00 1995 Path: biosci!ns1.faseb.org!lamarck.sura.net!newsfeed.internetmci.com!tank.news.pipex.net!pipex!dispatch.news.demon.net!demon!sunsite.doc.ic.ac.uk!hgmp.mrc.ac.uk!sanger.ac.uk!pmr From: pmr@sanger.ac.uk (Peter Rice) Newsgroups: bionet.genome.chromosomes Subject: Re: Microcephaly Date: 01 Sep 1995 15:16:35 GMT Organization: The Sanger Centre Lines: 28 Message-ID: References: <1995Aug29.101538.4016@clp2> NNTP-Posting-Host: unst.sanger.ac.uk In-reply-to: kaplanr@clpgh.org's message of 29 Aug 95 10:15:38 -5 In article <1995Aug29.101538.4016@clp2> kaplanr@clpgh.org (Richard Kaplan) writes: >I am trying a stab in the dark here as well as some other sites. I have a two >year old son with microcephaly and global developmental delays; he's probably >60-70% delayed with no medical problems. My wife and I are trying to determine >if there is research going on concerning microcephaly, beyond its relationship >to mental retardation. Our son for all intents and purposes is retarded, but >ther is no name or ailment that he has. He's had two chromosomal analysis >done, including one for fragile-x and they've come back negative. Any help, >suggestions, or names would be helpful. Thanks for your time. There is (or recently was) an organization to help parents with children who have microcephaly. I guess there is one in the USA too. I don't have the details, but could probably dig up an address somewhere if you need it. Perhaps one of the easier-to-find organizations (diabetes genetics counselling or pre-natal groups for example) would have a list of addresses for other organizations. If your concern is whether another child could have it, then yes - I have heard of a family with two affected children. Doesn't apply in all cases, of course. -- ------------------------------------------------------------------------ Peter Rice | Informatics Division E-mail: pmr@sanger.ac.uk | The Sanger Centre Tel: (44) 1223 494967 | Hinxton Hall, Hinxton, Fax: (44) 1223 494919 | Cambs, CB10 1RQ URL: http://www.sanger.ac.uk/~pmr/ | England