From owner-chromosomes@net.bio.net Mon Dec 01 22:00:00 1997 Path: biosci!agate!logbridge.uoregon.edu!news-peer.gip.net!news.gsl.net!gip.net!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!newsfeed.ecrc.net!newsfeed.nacamar.de!uni-erlangen.de!news.uni-erlangen.de!not-for-mail From: DJ Dirk Newsgroups: bionet.genome.chromosomes,sci.bio.technology Subject: Re: Length of Human DNA. Date: Tue, 02 Dec 1997 17:42:26 +0100 Organization: Regionales Rechenzentrum Erlangen, Germany Lines: 55 Message-ID: <34843A72.81D75542@bigfoot.de> References: <3478E0F5.D2A48114@hex21.com> <01bcfcd7$99e633a0$a28a08c3@default> Reply-To: dj_dirk@bigfoot.de NNTP-Posting-Host: root@proxy2.rrze.uni-erlangen.de Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 4.01 [de] (Win95; I) To: Ivan Moller X-Priority: 3 (Normal) Ivan Moller schrieb: > > How many nucleotides are in human DNA? > > And, is the number of nucleotides in human DNA constant across > humans > > Is that number close? 6 billion? Or are there much more or much > less? > > I read in a book that there were 200,000 genes in human DNA, and it > said > > 1000 nucleotides per gene, which has to be an approximation, right? > Since > 3 > > nucleotides gives you an amino acid, wouldn't the number of > nucleotides > in a > > gene have to be evenly divisible by 3? > > > > But by that calculation, 200 million base pairs approximately in a > human > > DNA? > > The correct size of the human genome is 2.8 bilion base pairs (two > nucleotides) > > Your calculation assumes that the DNA only consists of genes, like > pearls > on > a string, which is not correct. > Yes, the number of base pairs that encodes the protein is divisible by > 3. > > > > > How do we know that introns are non functional? Introns exist within > a > > gene, right? > > All we know is that they don't encode the final protein, as they are > spliced out of the messenger RNA, than encodes the protein. > > > Not junk outside of start and stop codons, right? > > No, it's inside the start and stop codon. I think you'll find further informations under: http://www.gene.com/ http://www.ornl.gov/TechResources/Human_Genome/home.html http://www.nhgri.nih.gov/HGP/ so far DJ Dirk From owner-chromosomes@net.bio.net Mon Dec 01 22:00:00 1997 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!europa.clark.net!4.1.16.34!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!baron.netcom.net.uk!netcom.net.uk!nntp.news.xara.net!xara.net!server5.netnews.ja.net!news.u-net.com!wbains.u-net.com!user From: william@wbains.u-net.com (William Bains) Newsgroups: bionet.genome.chromosomes,sci.bio.technology Subject: Re: Length of Human DNA. Date: 2 Dec 1997 16:53:29 GMT Organization: U-NET Ltd Lines: 13 Message-ID: References: <3478E0F5.D2A48114@hex21.com> <01bcfcd7$99e633a0$a28a08c3@default> NNTP-Posting-Host: wbains.u-net.com > > The correct size of the human genome is 2.8 bilion base pairs (two > nucleotides) > Bases OR base pairs - as the double helix is ... double, you can count all down one side (2.8 billion) or all down one side and up the other (2.8 billion pairs). Incidently, a more intuitive answer the the question 'what is the length of human DNA' is 'slightly under one meter' (this assumes all the chromosomes are linked end-to-end) From owner-chromosomes@net.bio.net Tue Dec 02 22:00:00 1997 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!europa.clark.net!192.174.65.44!newscore.univie.ac.at!03-newsfeed.univie.ac.at!fstgal00.tu-graz.ac.at!spaniel From: smith@umes07.avl.co.at (Search Spaniel) Newsgroups: bionet.genome.chromosomes Subject: Genetics-search the web quickly with Search Spaniel Date: Wed, 03 Dec 97 17:35:21 GMT Organization: Search Spaniel Lines: 4 Message-ID: <250108662@searchspaniel.com> NNTP-Posting-Host: isdn024.tu-graz.ac.at To Genetics-search the most search engines in the shortest time, use the internet's newest search engine - Search Spaniel at: http://www.searchspaniel.com/ From owner-chromosomes@net.bio.net Thu Dec 04 22:00:00 1997 Path: biosci!rutgers!uwm.edu!news-penn.gip.net!news-peer.gip.net!news.gsl.net!gip.net!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!newsfeed.ecrc.net!newsfeed.nacamar.de!uni-erlangen.de!winx03!news From: s88891@stud-mail.uni-wuerzburg.de (Mathias Holpert) Newsgroups: bionet.genome.chromosomes Subject: Re: chromosomes Date: Fri, 05 Dec 1997 19:12:03 GMT Organization: University of Wuerzburg, Germany Lines: 18 Message-ID: <3483f6b3.5852926@news.informatik.uni-wuerzburg.de> References: <34813638.2700@gold.tc.umn.edu> NNTP-Posting-Host: wex149.extern.uni-wuerzburg.de Mime-Version: 1.0 Content-Type: text/plain; charset=ISO-8859-1 Content-Transfer-Encoding: 8bit X-Newsreader: Forte Agent 1.5/32.451 On 30 Nov 1997 17:42:20 -0800, linst003@GOLD.TC.UMN.EDU (Tom Linstroth) wrote: >I need a list of common organisms with their number of chromosomes to >complete a homework assignment. My teacher has asked for 25 different >organisms. Will some kind person please help direct me to a source of >reference as everything I have seen on the net is too technical. Thanks > >JBL Now thatīs easy. If your teacher has only asked you for different organisms, simply take bacteria. Find a nice book with commom bacteria and copy down the names, starting with E. coli and going down the list. They should all have one chromosome.... :) Greetings Mathias From owner-chromosomes@net.bio.net Fri Dec 05 22:00:00 1997 Path: biosci!bloom-beacon.mit.edu!howland.erols.net!www.nntp.primenet.com!globalcenter0!news.primenet.com!news.primenet.com!not-for-mail From: Super Ninja Newsgroups: bionet.genome.chromosomes Subject: genes Date: 5 Dec 1997 23:39:00 -0700 Organization: Primenet Services for the Internet Lines: 3 Message-ID: <3488F259.BFA2E1D1@juno.com> X-Posted-By: @206.165.34.44 (areiman) X-Mailer: Mozilla 4.04 [en] (Win95; I) MIME-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit Isn't it true that only a small percentage of DNA is actually put to use? From owner-chromosomes@net.bio.net Sun Dec 07 22:00:00 1997 Path: biosci!agate!logbridge.uoregon.edu!newsfeed.internetmci.com!141.211.144.13!newsxfer3.itd.umich.edu!oleane!146.19.11.1.MISMATCH!newsfeed.eerie.fr!Cabal.CESspool!bofh.vszbr.cz!lyra.csx.cam.ac.uk!hgmp.mrc.ac.uk!not-for-mail From: Guy Newsgroups: bionet.genome.chromosomes Subject: Re: genes Date: Mon, 08 Dec 1997 13:45:11 +0000 Organization: MRC Human Genome Mapping Project Resource Centre Lines: 33 Message-ID: <348BF9E7.446B@hgmp.mrc.ac.uk> References: <348B808D.1E0A9FF4@geocities.com> NNTP-Posting-Host: fluorine.hgmp.mrc.ac.uk Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 3.0 (X11; I; IRIX 6.2 IP22) Super Ninja wrote: > > I heard that there's a lot of our DNA that we don't know it's purpose. > and since long term memory is stored protien, that this "useless" DNA > could possibly be memory that has beened passed on from older > generations. For instance, the long term memory that our oldest > ancestors stored during their lifetime, may now be stored in our DNA. > Could this really happen? Dear Super Ninja, Yes - now it all makes sense: The comparatively high gene density observed in some fish and their correspondingly low quota of junk DNA would account for their inability to remember very much. Guy. -- PS. Here is some freshly sequenced junk human DNA ready for analysis >junk.seq GCGAACTGTATAGAAAATACGTAAGAGGGATATCCGACAATAGCAAACAGCTAGCCACGA GAATGCGAAGAGGATGAAGACTGAACACACGAGTAAGGCCGCGAGGAAAAATGATGTATC GTAATATTAATAAGCGCGACCATTCAGAACTGAACACATGAGAACTGAACGCACGAATAA AGACAAATGGCCAACTGAGAAATGCCAATACGTGAGTGAGCGAACGATTAAACCCATGAA TAATTAATCTTCGAGTGACAGTTCTGATGTCACAGAATAAGCACATAGCTAGCCACCGAA AGATGACAAAATTAGACACACGAAAGAGAATGATGGGCCAGCTAAACACACGCCACGTGA GACGAATTTGAAGCGACGTAAGCGACATAGCACGCCTCGACCATAAATGGCAGCTGAAAC GAAGTAGAAAGAACGCACGAATTGGAAAGCAGCTAAGAAAACGGCTTGGCCAATGACTAA TGGCAAAACTAAACCCACGAATGATGGCAGAGGTTGGACTAGTGCGTACCATAAATAAAC TGAAACATAAACGAGACTGAGGAAAACTAAAGCATANNNACCTATTAGAGCATANNN From owner-chromosomes@net.bio.net Sun Dec 07 22:00:00 1997 Path: biosci!daresbury!uninett.no!news.maxwell.syr.edu!newsfeed.ecrc.net!nntp.primenet.com!news.primenet.com!news.primenet.com!not-for-mail From: Super Ninja Newsgroups: bionet.genome.chromosomes Subject: genes Date: 7 Dec 1997 22:10:01 -0700 Organization: crime Lines: 7 Message-ID: <348B808D.1E0A9FF4@geocities.com> Reply-To: ulfyboy@geocities.com X-Posted-By: @206.165.34.80 (areiman) X-Mailer: Mozilla 4.04 [en] (Win95; I) MIME-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit I heard that there's a lot of our DNA that we don't know it's purpose. and since long term memory is stored protien, that this "useless" DNA could possibly be memory that has beened passed on from older generations. For instance, the long term memory that our oldest ancestors stored during their lifetime, may now be stored in our DNA. Could this really happen? From owner-chromosomes@net.bio.net Tue Dec 09 22:00:00 1997 Path: biosci!rutgers!nntp.upenn.edu!dsinc!news.voicenet.com!news-out.internetmci.com!newsfeed.internetmci.com!198.60.253.107!skin02.micron.net.!news01.micron.net!not-for-mail From: "Nazanin S. " Newsgroups: bionet.genome.chromosomes Subject: Re: genes Date: 10 Dec 1997 22:50:55 GMT Organization: Micron Internet Services Lines: 8 Message-ID: <01bd05bd$3757ca20$32d586cc@hphome> References: <3488F259.BFA2E1D1@juno.com> NNTP-Posting-Host: cboi083p15.boi.micron.net X-Newsreader: Microsoft Internet News 4.70.1161 Super Ninja wrote in article <3488F259.BFA2E1D1@juno.com>... > Isn't it true that only a small percentage of DNA is actually put to > use? > tell me about chromosome 14 and 22 > From owner-chromosomes@net.bio.net Wed Dec 10 22:00:00 1997 Path: biosci!webtv.net!uunet!in5.uu.net!newsfeed.internetmci.com!205.185.79.5!zdc!super.zippo.com!lotsanews.com!ix.netcom.com!news From: Michael Trubey Newsgroups: bionet.genome.chromosomes Subject: Re: genes Date: Wed, 10 Dec 1997 21:58:47 -0500 Organization: Netcom Lines: 11 Message-ID: <348F56E6.AF6FBE4F@ix.netcom.com> References: <3488F259.BFA2E1D1@juno.com> NNTP-Posting-Host: ath-ga2-18.ix.netcom.com Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-NETCOM-Date: Wed Dec 10 7:00:24 PM PST 1997 X-Mailer: Mozilla 4.01 [en] (Win95; I) X-Priority: 3 (Normal) Super Ninja wrote: > Isn't it true that only a small percentage of DNA is actually put to > use? I want to say that only 1% of the genome is exonic, but I can't find the reference to support my belief. Looking at the presence and differences in introns are one way to look at the evolution of gene families. -MT From owner-chromosomes@net.bio.net Wed Dec 10 22:00:00 1997 Path: biosci!rutgers!nntp.upenn.edu!news.misty.com!news-feed.inet.tele.dk!bofh.vszbr.cz!news.maxwell.syr.edu!news.idt.net!cam-news-hub1.bbnplanet.com!news.bbnplanet.com!prodigy.com!nntp.earthlink.net!usenet From: villowan@earthlink.net (Charlsie Patterson) Newsgroups: bionet.genome.chromosomes Subject: Senior/Assoc. Research Scientist Date: Tue, 09 Dec 1997 16:18:42 GMT Organization: EarthLink Network, Inc. Lines: 51 Message-ID: <66jr2e$i1a@ecuador.earthlink.net> NNTP-Posting-Host: 38.30.41.52 X-Newsreader: Forte Free Agent 1.0.82 My client company is a large established Pharmecuitical company looking to fill this position at the start of the new year. They offer excellent pay and benefits with excellent growth potential. They are agressively seeking to fill this position and will pay all fees associated with recruiting and placement of candidates. Contact me with your CV and any questions. Ms. Charlsie Patterson Technical and Bio-science Recruiter Global Staffing and Recruiting (919) 871-0070 Fax: (919) 871-0030 or email: techsearch@globals-r.com or villowan@earthlink.net Brief Description of the Position: Conduct assays to support the development and characterization of new biological products. The incumbent will also be part of a team that will interact closely with early stages of process scale up and with the QA development and establishment of numerous new assays. (i.e. robotics immunological and real time on-line assays) and advanced characterization of protein products. The incumbent will collaborate closely with projects in New Product Biochemistry, Pathogen Safety and Process Research Sections. The incumbent will work at the laboratory bench and have good oral and written communication skills to keep accurate experimental records, communicate research goals and results on a frequent schedule. Position Requirements: BS in Biochemistry, Analytical chemistry, or closely related field with at least 2 years of relevant job experience. Experience with operating and maintaining Hewlett Package HPLCs, BioSepara ProSys HPLCs and Beckman BioMek Robotics systems is desired. A demonstrated ability to keep clear records, recognize and implement needed experimental controls, communicate with team members, and meet time lines is required. A background with HPLC, enzymatic, and/or immunological assays is required. Experience with mass spectrometry, amino acid analysis, sequence analysis, peptide mapping, disulfide assignment and/or glycoprotien analysis is needed. GLP/GMP experience, analytical methods validation, experience in automation, robotics, on-line assays, a familiarity with the well-characterized biological concept From owner-chromosomes@net.bio.net Wed Dec 10 22:00:00 1997 Path: biosci!rutgers!nntp.upenn.edu!news.misty.com!news-feed.inet.tele.dk!bofh.vszbr.cz!newspeer.monmouth.com!cpk-news-hub1.bbnplanet.com!cam-news-hub1.bbnplanet.com!news.bbnplanet.com!prodigy.com!nntp.earthlink.net!usenet From: villowan@earthlink.net (Charlsie Patterson) Newsgroups: bionet.genome.chromosomes Subject: ]][[ Research Scientist/Senior Research Scientist Date: Thu, 11 Dec 1997 00:18:50 GMT Organization: EarthLink Network, Inc. Lines: 43 Message-ID: <66nbin$apj@argentina.earthlink.net> NNTP-Posting-Host: 38.30.41.73 X-Newsreader: Forte Free Agent 1.0.82 My client company is a large, well established pharmaceutical company, who is aggressively seeking to fill this position at the first of the year. It is in the area of research and development. They offer excellent compensation and benefit, as well as great growth potential. The client company will pay all fees associated with recruiting and placement of candidates. The position is located in North Carolina. Please refer to Job Listing B-9817 in all correspondence To submit your CV or have any questions answered, please contact: Ms. Charlsie Patterson Technical and Bio-Science Recruiter Global Staffing and Recruiting (919) 871-0070 Fax: (919) 871-0030 email: techsearch@globals-r.com and/or villowan@earthlink.net Brief Description of the Position: The incumbent will be a member of the Process Engineering Group of the Technology Department and will contribute to the development of new purification processes for plasma proteins. The process optimization work will center around unit operations as chromatography, membrane separation, and filtration. Major focuses will be the scale-up from macro-bench to pilot-scale and beyond. The incumbent will particularly interface with project engineering and play a major role in the realization projects of the new processes. Position Requirements: Requires a Ph.D./MS degree in Chemical Engineering: minimum experience of four plus years in process development or manufacturing, preferably in the pharmaceutical or biotechnology industries. Must be familiar with GLP/GMP rules and conditions. Experience in project engineering as well as working knowledge in protein chemistry is preferred PLEASE NOTE: A Hepatitis B immunization is required From owner-chromosomes@net.bio.net Wed Dec 10 22:00:00 1997 Path: biosci!agate!logbridge.uoregon.edu!newsfeed.internetmci.com!4.1.16.34!cpk-news-hub1.bbnplanet.com!cam-news-hub1.bbnplanet.com!news.bbnplanet.com!prodigy.com!nntp.earthlink.net!usenet From: villowan@earthlink.net (Charlsie Patterson) Newsgroups: bionet.genome.chromosomes Subject: SR/PRINCIPAL R&D SCIENTIST B9710B Date: Thu, 11 Dec 1997 18:06:21 GMT Organization: EarthLink Network, Inc. Lines: 46 Message-ID: <66pa4a$5fj@bolivia.earthlink.net> NNTP-Posting-Host: 38.30.41.171 X-Newsreader: Forte Free Agent 1.0.82 My client company is a large, well established pharmaceutical company, who is aggressively seeking to fill this position and several others at the first of the year. It is in the area of research and development. They offer excellent compensation and benefit, as well as great growth potential. The client company will pay all fees associated with recruiting and placement of candidates. The position is located in North Carolina. Please refer to Job Listing B9710b in all correspondence To submit your CV or have any questions answered, please contact: Ms. Charlsie Patterson Technical and Bio-Science Recruiter Global Staffing and Recruiting (919) 871-0070 Fax: (919) 871-0030 email: techsearch@globals-r.com and/or villowan@earthlink.net Sr. Associate Research Scientist/Principal Associate Research Scientist-R & D Brief Description of the Position: This position is for a research scientist who will stabilize therapeutic plasma proteins using formulation and lypholization techniques. The incumbent will be a team member to develop new freeze dryer cycles and will have the opportunity to work with various other site projects. Position Requirements: MS in Life Sciences or Engineering with 2+ years or more of relevant pharmaceutical experience or equivalent combination of education and experience. The successful candidate must have extensive experience with protein biochemistry and methods of protein stabilization, be proficient with analytical equipment (DSC, FTIR, HPLC, nIR) and be able to interpret results. The ability to analyze data independently, as well as present the data within a team environment is a must. Computer experience and familiarity with various databases helpful. PLEASE NOTE: Hepatitis B immunization is required. From owner-chromosomes@net.bio.net Wed Dec 10 22:00:00 1997 Path: biosci!rutgers!nntp.upenn.edu!news.misty.com!news-feed.inet.tele.dk!bofh.vszbr.cz!news-xfer.netaxs.com!news.maxwell.syr.edu!ais.net!ameritech.net!uunet!in5.uu.net!server-b.cs.interbusiness.it!usenet From: "Pierky" Newsgroups: bionet.genome.chromosomes Subject: HELP for a CHILD suffering from "Syndrome of Costello" Date: Fri, 5 Dec 1997 18:41:49 +0100 Organization: Centro Servizi Interbusiness Lines: 10 Message-ID: <669e7d$ce4@server-b.cs.interbusiness.it> NNTP-Posting-Host: 151.99.209.179 X-Newsreader: Microsoft Outlook Express 4.71.1712.3 X-MimeOLE: Produced By Microsoft MimeOLE V4.71.1712.3 We desire to communicate with urgency where we can address us to have some immediate cures for a child of six years, suffering from "Syndrome of Costello". Please inform us of something news. E-Mail: pc.chiodi@mbox.thunder.it WEB: http://pierky.thunder.it/costello/ Phone: +39 0761 626601 Thanks! From owner-chromosomes@net.bio.net Thu Dec 11 22:00:00 1997 Path: biosci!daresbury!lyra.csx.cam.ac.uk!hgmp.mrc.ac.uk!venus.ebi.ac.uk!sterk From: sterk@venus.ebi.ac.uk (Peter Sterk) Newsgroups: bionet.genome.chromosomes Subject: Re: How much of the human genome has been sequenced. Date: 12 Dec 1997 15:23:52 GMT Organization: European Bioinformatics Institute (EMBL) - UK Lines: 32 Distribution: world Message-ID: <66rku8$eaq$1@niobium.hgmp.mrc.ac.uk> References: <652jf0$fal$1@nntp3.u.washington.edu> Reply-To: sterk@venus.ebi.ac.uk (Peter Sterk) NNTP-Posting-Host: venus.ebi.ac.uk X-Newsreader: mxrn 6.18-31 In article <652jf0$fal$1@nntp3.u.washington.edu>, roach@u.washington.edu (Jared Roach) writes: >Hello all, > I have updated my "How much of the human genome has been sequenced?" >web page. I calculate that we have sequenced 2.68% of the human genome as >of November 18, 1997. > My page is at: >http://weber.u.washington.edu/~roach/human_genome_progress2.html > >Best Wishes, > Jared > Hi Jared, In collaboration with Stephan Beck from the Sanger Centre here in the UK, I have created a Genome Monitoring Table which is automatically updated weekly. For the calculations the most up-to-date version of the EMBL database is used as data source. The human data are calculated per chromosome and it's nice to see where most of the sequencing activity is. Like you did, HTG sequences are excluded, as a cut-off we chose 1,000 and 10,000 - I think our end-results are pretty close. The URL is http://www.ebi.ac.uk/~sterk/genome-MOT/. A short commentary will appear in Curr. Opinion Biotechnol. early next year. Regards, Peter Sterk From owner-chromosomes@net.bio.net Fri Dec 26 22:00:00 1997 Path: biosci!internet!biosci!not-for-mail From: biohelp (BIOSCI Administrator) Newsgroups: bionet.genome.chromosomes Subject: BIOSCI/bionet miniFAQ & Fundraiser Date: 27 Dec 1997 02:00:12 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 233 Sender: daemon@net.bio.net Distribution: world Message-ID: <199712271000.CAA01657@net.bio.net> NNTP-Posting-Host: net.bio.net (LAST REVISION: 30-JUL-95) This BIOSCI "miniFAQ" is designed to answer the questions that come up the *most frequently*. The main BIOSCI FAQ (Frequently Asked Questions) is accessible on the World Wide Web at URL http://www.bio.net/. If you can not find an answer to your question in this or other documentation, the BIOSCI technical support staff answers e-mail queries sent to biosci-help@net.bio.net We can only answer questions about the use of the newsgroups and mailing lists. We unfortunately do not have the staff to do Internet information searches or answer scientific questions. Please post those to the appropriate BIOSCI/bionet newsgroups. Contents: -------- 0) BIOSCI NEEDS YOUR SUPPORT!! 1) Using the WWW to access the BIOSCI/bionet newsgroups. 2) What to do about "spams," i.e., junk mail, ads, etc. 3) Examples of subscribing and unsubscribing to the mailing lists. 4) The BIOSCI user address and research interest directory. 0) BIOSCI NEEDS YOUR SUPPORT!! ------------------------------ BIOSCI's government funding has been expended, and we are now operating solely from advertising revenue that we have raised from our Web site at http://www.bio.net/. We need just a few minutes of your time to help us serve you. You can do two important things which will take very little time for you individually and will immensely help us continue to help you. First, please use our WWW system at http://www.bio.net/ to access the archives. You can post or reply to messages via your Web browser as described in item #1 below. Your usage helps attract sponsors. If you contact any of our sponsors, please be sure to thank them for supporting BIOSCI. It is critical for them to get this feedback if they are to continue their sponsorship for the long term. Second, if you work for a company or organization that provides products or services of interest to the biology community, please pass this message on to your marketing or marketing communications department or other appropriate group. Please ask them to help support BIOSCI by sponsoring our Web site and explain the uses and benefits of the system to the biology community. If they are interested, they can then contact us for further information at our tech support address, biosci-help@net.bio.net. 1) Using the WWW to access the BIOSCI/bionet newsgroups. -------------------------------------------------------- As of 10 December 1995, all BIOSCI/bionet full newsgroups are accessible through the World Wide Web (WWW) at URL http://www.bio.net. One can read and reply publicly or privately to both recent postings and archived messages through one's Web browser if it is configured properly to send e-mail. Each newsgroup is equipped with its own WAIS index. The main BIOSCI home page also has access to the BIO-JOURNALS Table of Contents database WAIS index and the BIOSCI user address database described in another item further below. 2) What to do about "spams," i.e., junk mail, ads, etc. ------------------------------------------------------- BIOSCI is a set of parallel USENET newsgroups (the "bionet" groups), mailing lists, and a hypermail archive at URL http://www.bio.net/. The same postings are distributed on all media (except for a small number of mailing-list-only groups at net.bio.net). Unfortunately it is becoming a despicable practice on the Internet (by a few people out to make a fast buck) to do automated mass postings to thousands of newsgroups and mailing lists. These attempts to grab free advertising are refered to as "spams" in the usual, somewhat boneheaded, net terminology. USENET is more susceptible to this practice, and many spams originate on the USENET groups and then are passed on to the mailing lists. However, spammers also get lists of mailing addresses and hit these too, so neither medium is immune. What should you do personally if you get junk mail? --------------------------------------------------- Just delete it and move on without reading it further. Filing a protest is becoming increasingly useless because spammers are often disguising the addresses where the messages are sent from. Unless you really understand Internet mail systems, your attempt at protest by sending replies to the message will often end up being sent to the address of an innocent person that the spammer is victimizing. What can BIOSCI/bionet do to protect its newsgroups? ---------------------------------------------------- The only solution currently available is to moderate the newsgroup. If this newsgroup is already moderated, then you are in good shape. Moderation protects the USENET distribution from about 95% of the spams that are being sent to date and protects the mailing lists completely. Moderation means, however, that someone has to take the time to review each message before it goes out. We have set up software here that simply allows the moderator to forward to an address at net.bio.net messages that (s)he wishes to have distributed. This takes no more time than that needed to read the message and pass it on, say about 1 min. per message. Most newsgroups currently have a discussion leader who is responsible for their newsgroup. The discussions leaders and their e-mail addresses are listed in the BIOSCI Information Sheet which is available on the Web at http://www.bio.net/. If a newsgroup is being hit with too many junk postings, please contact the discussion leader for that group and see if there is interest in moderating the group. Please do not assume that by simply posting a complaint to the newsgroup itself, anyone on the BIOSCI staff will act on your complaint. With close to 100 newsgroups to run, the BIOSCI staff has to rely on the discussion leaders of each newsgroup to report problems directly to us at biosci-help@net.bio.net. We will moderate any of our newsgroups if the discussion leader tells us that the readership of the group wishes to do so and if a moderator is willing to do the work. For most BIOSCI/bionet groups, this entails only a few minutes of work each day. Moderating a newsgroup will resolve probably 95% of the junk postings on the USENET distribution. Unfortunately there are easy ways for determined spammers to override the moderation mechanism on USENET, but we can protect our e-mail subscribers from unwanted postings if the newsgroup is moderated. You can also access our newsgroups over the WWW at URL http://www.bio.net. While this Web interface will not stop spammers from trying to post to the groups, this will give you yet another way, besides using USENET news, to keep the junk out of your personal mail files. For those of you with local USENET news systems, the Web interface will also give you faster access to new newsgroups and recent postings. 3) Examples of subscribing and unsubscribing to the mailing lists. ------------------------------------------------------------------ PLEASE NOTE: The BIOSCI management does NOT act on subscription/unsubscription requests that are posted improperly to the newsgroups and mailing lists. People who do this only bother everyone on the lists to no avail. Please be sure to follow the proper procedures below. Gory details are in the BIOSCI Information sheets on the Web at http://www.bio.net. Below we give an example utilizing the METHODS-AND-REAGENTS list at both of our two BIOSCI sites: Users in the Americas and Pacific Rim countries who use the BIOSCI ------------------------------------------------------------------ node at computer net.bio.net: ---------------------------- A) Determine the "listname" which is the <=8 character mail address ^^^^^^^^^^^^^ for the group. These can be found in the BIOSCI Info. Sheet. For the METHODS-AND-REAGENTS group the mailing address is methods@net.bio.net. The listname is the portion of the address to the left of the @ sign, i.e., "methods". The listname is used with the "subscribe" and "unsubscribe" commands illustrated below. B) Mail all commands in the body of a mail message addressed to biosci-server@net.bio.net. Do NOT send commands to the newsgroup posting addresses! Leave the Subject: line blank, any text on it will be ignored. C) In the body of your message put one or more of the following commands with an "end" command on the last line, e.g., subscribe methods unsubscribe methods end Do NOT put your e-mail address or other text on these lines. The server only allows you to cancel your subscription if the address on your mail header matches the address on our mailing list. Please ask for help at biosci-help@net.bio.net if your address has changed, e.g., if you know you are on the list but the server tells you that you are not a member. Users in Europe, Africa, and Central Asia who use the BIOSCI node at -------------------------------------------------------------------- computer daresbury.ac.uk (also known as dl.ac.uk): ------------------------------------------------- To subscribe and unsubscribe to/from the BIOSCI lists, you need to specify the full USENET newsgroup name with "bionet-news." prepended. The USENET newsgroup names are listed in the BIOSCI Information sheet on the Web at http://www.bio.net/. For the METHODS-AND-REAGENTS list the USENET newsgroup name is bionet.molbio.methds-reagnts, thus the appropriate commands are sub bionet-news.bionet.molbio.methds-reagnts unsub bionet-news.bionet.molbio.methds-reagnts These commands are included in a message addressed to mxt@dl.ac.uk, NOT to the newsgroup mailing addresses. As usual, include the text in the body of the message as text on the Subject: line is ignored. To unsubscribe from all the lists at the UK node, use unsub bionet-news Please note that if the address in the list is different than the one in your mail message header, you will not be able to unsubscribe by this method. If you have problems, please mail biosci@daresbury.ac.uk. 4) The BIOSCI user address and research interest directory. ----------------------------------------------------------- Please take this opportunity to add your name, address, and research interest information to the BIOSCI User Address Database if you have not already done so. You can fill out the address form directly through our Web page at URL http://www.bio.net/adrform.html. The address database is reindexed nightly for WWW access (the URL is http://www.bio.net/). If you are not directly on the Internet but can reach it by e-mail, please use our waismail server to access the user directory. waismail use is described above. You can also request a user address form by e-mail from biosci-help@net.bio.net. Please check your database entry from time-to-time to see if your address information is still up-to-date. Because of our limited personnel resources, we ask that you resubmit a *complete* form to revise your entry; we only replace complete entries and do not have resources to edit old forms.