From owner-embldatabank@net.bio.net Wed Feb 09 22:00:00 1994 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!usenet.ins.cwru.edu!magnus.acs.ohio-state.edu!tchang From: tchang@magnus.acs.ohio-state.edu (Tien-Hsien Chang) Newsgroups: bionet.virology,bionet.molbio.genbank,bionet.molbio.embldatabank,gi Subject: q-beta and r17 sequences Date: 10 Feb 1994 21:26:37 GMT Organization: The Ohio State University Lines: 19 Message-ID: <2je8qd$gkc@charm.magnus.acs.ohio-state.edu> NNTP-Posting-Host: bottom.magnus.acs.ohio-state.edu Xref: biosci bionet.virology:374 bionet.molbio.genbank:1526 bionet.molbio.embldatabank:280 I have attempted to retrieve the complete sequence information of bacteriophages Q-beta and R17 without success. Does anyone know whether these two phage genomes have been completely sequenced? I am mainly interested in the complete sequence information of the COAT PROTEIN genes in both phages. I am also searching for sources where I can obtain these "cloned" genes. Your helps are much appreciated. Tien-Hsien Chang, Ph.D. Assistant Professor of Molecular Genetics The Ohio State University Columbus, OH 43210 (614)-292-0631 (614)-292-4466 [fax] tchang@magnus.acs.ohio-state.edu From owner-embldatabank@net.bio.net Fri Feb 11 22:00:00 1994 Path: biosci!daresbury!bioftp.unibas.ch!embl-heidelberg.de!embnet From: embnet@embl-heidelberg.de Newsgroups: bionet.molbio.embldatabank Subject: EMBL File Server News, Number 11 Message-ID: <1994Feb11.141749.164516@embl-heidelberg.de> Date: 11 Feb 94 14:17:49 +0100 Organization: EMBL, European Molecular Biology Laboratory Lines: 522 ------------------------------------------------------------------------------ | EMBL FILE SERVER News Number 11, Feb 10th 1994 | | | | European Molecular Biology Laboratory, Data Library & Computer Group, | | Postfach 10.2209, 69012 Heidelberg, Germany. | | Tel: +49 6221 387258 | | E-mail: NetHelp@EMBL-Heidelberg.DE Fax: +49 6221 387519 | ------------------------------------------------------------------------------ Contents: <1> Introduction <2> New Data Collections <3> Changes to Data Collections <4> Updates to Software Collection <5> Other Updates <6> Summary of Directories on the File Server <7> Getting Started ? <8> Network Addresses at EMBL <1> Introduction ------------ The EMBL File Server is a facility available on the EMBL computing system for external users to request files by electronic mail, anonymous FTP or Gopher, and to perform sequence similarity searches. The service is free. <2> New Data Collections -------------------- (a) New databases o BIO_CATAL - Catalogue of mol biol software, maintained by P. Rodriguez-Tome and D. Caterina, Rel. 2.1, Dec 93. [/pub/databases/bio_catal] o KABAT - Database of proteins of immunological interest, maintained by E. Kabat et al., Rel. 5, Aug 92. [/pub/databases/kabat] (Not available by email). o PRINTS - Database of protein signatures, maintained by T. Attwood and M. Beck, Rel. 4.0, Oct 93. [/pub/databases/prints] o SBASE - Protein domain database, maintained by S. Pongor and v. Skerl, Rel. 2.0, Dec 93. [/pub/databases/sbase] (Not available by email). o SRP - Signal recognition particle database, maintained by N. Larsen and C. Zwieb, Dec 93. [/pub/databases/srp] (Not available by email). (b) New directory /pub/databases/journal_toc This new directory contains the tables of content from various molecular biological journals. It is mirrored weekly from ncbi.nlm.nih.gov. Data in this directory is not available by email. <3> Changes to Data Collections --------------------------- (a) Due to their growing size, the Transcription Factor Database (TFD) and the Drosophila database (Flybase) are no longer available by email. They are still available by anonymous FTP or Gopher. (b) Some databases are now mirrored weekly from their site of origin: RLDB - ncbi.nlm.nih.gov Flybase - ftp.bio.indiana.edu SRP - iris.hct.utexas.edu <4> Updates to Software Collection ------------------------------ All DOS files are no longer stored in encoded form on the EMBL FTP server. Make sure you use BINARY mode to transfer them to your local computer. All files are self-extracting archives so there is no need for a un- compression program. Here is a list of new (N) molecular biological programs or updates (U): The full path specifications for these files on the EMBL ftp server are shown in square brackets. DOS: ---- BANDLEAD.UAA (N) Image processing and analysis of data from protein gel electrophoresis (M. Aharoni) [/pub/software/dos/bandlead.exe] DOLINK.UAA (N) Program to help manage genetic data and set up analyses (D. Curtis) [/pub/software/dos/dolink.exe] EASISTAT.UAA (U) Package for statistical analyses (D. Curtis), v2.1 [/pub/software/dos/estat21.exe] FASTMAP.UAA (N) Apprx. multipoint lod score calculation (D. Curtis) [/pub/software/dos/fstmap11.exe] FE51-A.UAA (N) FileExpress shareware database management system, FE51-B.UAA for use with DOLINK FE51-C.UAA [/pub/software/dos/fe51-A.zip etc.] FIRST.UAA (N) Finds a "good" order for markers based on the two-point lod scores between them (D. Curtis) [/pub/software/dos/first11.exe] FRAME.UUE (N) Identification of ORFs based on codon usage and GC content (G. Kleman) [/pub/software/dos/frame$.exe] GEPASI.UAA (U) Modelling of metabolic pathways (P. Mendes) [/pub/software/dos/gepasi.exe] GMAP.UUE (N) Search translationally silent restriction sites that have allowable mismatches (for gene synthesis) (G. Raghava) [/pub/software/dos/gmap$.exe] HTH.C (U) Prediction of helix-turn-helix regions (C. Halling) v1.0.5 [/pub/software/dos/hth.c] INTANA.UAA (N) Intron analyzer (M. Liss) [/pub/software/dos/intana$.exe] MACAWNTA.UAA (N) Multiple sequence editor for Alpha/NT (G. Schuler) [/pub/software/dos/macawNTa.exe] MACAWNTI.UAA (N) Multiple sequence editor for Intel/NT (G. Schuler) [/pub/software/dos/macawNTi.exe] MACAWWIN.UAA (N) Multiple sequence editor for MS Windows (G. Schuler) [/pub/software/dos/macawWin.exe] MCTETRD6.UUE (N) Excel spreadsheet for yeast tetrad analysis (J. Greene) [/pub/software/dos/mctetrd6.exe] PEDHLP14.UUE (U) Popup help for PEDRAW (D. Curtis) [/pub/software/dos/pedhlp14.exe] PEDRAW16.UAA (U) Pedigree drawing program (D. Curtis) [/pub/software/dos/pedraw16.exe] PROANAL.UAA (N) Analysis of relationship between protein structure and activity (Eroshkin and Zhilkin) [/pub/software/dos/proanal.exe] RASMOL.UAA (U) Visualisation of macromolecules using PDB files (R. Sayle), v2.2 [/pub/software/dos/rasmol.exe] SAR2PCIT.UUE (U) Converts SeqAnalRef to ProCite format (E. Sonnhammer), v1.1 [/pub/software/dos/s2p.exe] SAR2RIS.UUE (N) Converts SeqAnalRef to Reference Manager format (G. Hutchinson) [/pub/software/dos/sar2ris$.exe] SSCAN.UAA (U) Identification of known eukaryotic signals in DNA sequences (D. Prestridge), v3.3 [/pub/software/dos/sscan.exe] Only on FTP server: wingenie.exe (N) MS Windows interfaces to Internet mol biol servers (demo version) (A. Sivaprasad) [/pub/software/dos/wingenie.exe] Mac: ---- DBCONV.HQX (U) Transformation of line-oriented databases into tab- delimited format v3.2 (J. Valverde) [/pub/software/mac/dbconb.hqx] EMBL-EMAIL-SEARCH.HQX (N) HyperCard frontend to EMBL email servers (H. Lehvaslaiho) [/pub/software/mac/embl-email-search.hqx] EMBL-SEARCH.HQX (U) Database retrieval software for EMBL CD-ROM v2.4 (EMBL Data Library) [/pub/software/mac/embl-search.hqx] EMBL-SEARCH_SRC.HQX (U) Source code for EMBL-Search v2.4 [/pub/software/mac/embl-search_src.hqx] GDBACCESSOR.HQX (N) GDB front-end and database search client (C. Reed and T. Marr) [/pub/software/mac/gdbaccessor.hqx] HTH.HQX (U) Prediction of helix-turn-helix regions (C. Halling) (v1.0.5) [/pub/software/mac/hth.hqx] INFOTRAC_DEMO.HQX (N) Demo of FileMaker version of Transcription Factor Database (TFD) (W. Hoeck) [/pub/software/mac/infotrac_demo.hqx] LABHELPER.HQX (U) General laboratory tools for buffer preps etc. (T. Tzeng), v3.1 [/pub/software/mac/labhelper.hqx] MACCLADE304_DEMO.HQX (U) Demo of phylogenetic analysis program (W. Maddison) v3.04 [/pub/software/mac/macclade304_demo.hqx] MACCLADE304_UPDATE.HQX (U) MacClade updater to v3.04 (W. Maddison) [/pub/software/mac/macclade304_update.hqx] MACPATTERN.HQX (U) Protein pattern searching with PROSITE and BLOCKS database v3.2 (R. Fuchs) [/pub/software/mac/macpattern.hqx] MACSTAN.HQX (U) Random nucleotide sequence generator and analyzer (F. Gast), v1.8.5 [/pub/software/mac/macstan.hqx] MACTETRAD6.HQX (N) Excel spreadsheet for yeast tetrad analysis (J. Greene) [/pub/software/mac/mactetrad6.hqx] OLIGO.HQX (N) Calculation and storage of oligonucleotide data (H. Zabin) [/pub/software/mac/oligo.hqx] SEQSIMPRESENTER.HQX (N) Graphic display of similarities of long sequences (K. Froehlich) [/pub/software/mac/seqsimpresenter.hqx] STRAIGHTLINES.HQX (N) Curve-fitting of experimental data (M. Diaz) [/pub/software/mac/straightlines.hqx] STUFFITLITE.HQX (U) Compression/decompression/binhex program v3.0.7 (R. Lau) [/pub/software/mac/stuffitlite.hqx or stuffitlite.sea] TOPPPRED.HQX (U) Prediction of transmembrane segments and their topology (G. v. Heijne, M.G. Claros), v3.2 [/pub/software/mac/toppred.hqx] UU.HQX (N) UUdecoder/encoder with Mac interface (R. Valverde) [/pub/software/mac/uu.hqx] UNIX: ----- BLKSRCH.UUE (U) Block search analysis of protein sequences with the BLOCKS database (R. Fuchs), v.2.1 [/pub/software/unix/blocksearch.tar.Z] DBGET.UUE (N) Utility for downloading database entries from mail servers (R. Fuchs) [/pub/software/unix/dbget.tar.Z] HTH.C (U) Prediction of helix-turn-helix regions (C. Halling) v1.0.5 [/pub/software/unix/hth.c] MAILFASTA.SHAR (U) Script for using EMBL/GenBank Mail-FASTA servers v3.2 (T. deBoer) [/pub/software/unix/mailfasta.shar] MENUGCG.UUE (N) Menu interface to GCG package (M. Colet) [/pub/software/unix/menugcg.tar.Z] MSU.UUE (N) Configurable utility for accessing electronic mail servers (R. Fuchs) [/pub/software/unix/msu.tar.Z] PROFILE.UUE (N) Creation of sequence profiles for use with GCG ProfileSearch (J. Thompson) [/pub/software/unix/profile.tar.Z] RASMOL.UAA (U) Visualisation of macromolecules using PDB files (R. Sayle), v2.2 [/pub/software/unix/rasmol.tar.Z] SIGNAL.UAA (N) Prediction of signal sequence cleavage site (R. Colgrove) [/pub/software/unix/signal.tar.Z] SIGSCAN.UAA (U) Identification of known eukaryotic signals in DNA sequences (D. Prestridge), v3.3 [/pub/software/unix/sigscan.tar.Z] Only on FTP server: sigma (N) System for integrated genome map assembly (LANL) [/pub/software/unix/sigma.tar.Z] VAX: ---- ALPHAZOO.UAA (N) ZOO compression utility for Alpha systems [/pub/software/vax/alphazoo.uaa to .uac] BLKSRCH.UUE (U) Block search analysis of protein sequences with the BLOCKS database (R. Fuchs), v2.1 [/pub/software/vax/blksrch.uue] DBGET.UUE (N) Utility for downloading database entries from mail servers (R. Fuchs) [/pub/software/vax/dbget.uue] EGCG.UAA (U) EMBL extensions to GCG interface (P. Rice, R. Lopez et al.) [/pub/software/vax/egcg/] GCGMENU.UAA (U) Menu interface to GCG package (C. Gartmann) [/pub/software/vax/gcgmenu.uaa and gcgmenu.uab] GMAP.UUE (N) Search translationally silent restriction sites that have allowable mismatches (for gene synthesis) (G. Raghava) [/pub/software/vax/gmap.uue] HTH.C (U) Prediction of helix-turn-helix regions (C. Halling) v1.0.5 [/pub/software/vax/hth.c] MSU.UUE (N) Configurable utility for accessing electronic mail servers (R. Fuchs) [/pub/software/vax/msu.uue] PROFILE.UAA (N) Creation of sequence profiles for use with GCG ProfileSearch (J. Thompson) [/pub/software/vax/profile.uaa to .uab] SSCAN.UAA (U) Identification of known eukaryotic signals in DNA sequences (D. Prestridge), v3.3 [/pub/software/vax/sscan.uaa to .uad] <5> Other Updates ------------- (a) New sequence alignments in the ALIGN directory: DS13953.DAT - Somatic hypermutation in the immunoglobulin heavy chain VDJ DNA of germinal center B cells. Submitted by Dr Joshy Jacob, 1-Apr-1993 DS15369.DAT - Alignment of amino acid sequences of the G protein alpha units. Submitted by S. Yokoyama, 19-Aug-1993 DS16117.DAT - Comparative Analysis of Multiple Protein-Sequence Alignment Methods. Submitted by M. McClure, 17-Nov-1993 DS16863.DAT - Alignment of 5' UTS of mouse, human, bovine and rat homologues of the voltage-gated potassium channel gene, Kv1.4. Submitted by G. Gutman, 24-Jan-1994 DS16864.DAT - Alignment of 3' UTS of mouse, human, bovine and rat homologues of the voltage-gated potassium channel gene, Kv1.4. Submitted by G. Gutman, 24-Jan-1994 DS16865.DAT - Human and higher primates genomic sequences corresponding to M15530 cDNA. Phylogenetic evidence against the authenticity of a reported 12 kDa B-cellgrowth factor (BCGF) cDNA. Submitted by D. Labuda, 25-Jan-1994 <6> Summary of Directories on the File Server ----------------------------------------- directories with updated information are marked by an asterisk. Anonymous ftp NetServ -------------- --------- * EMBL Nucleotide Sequence Database /pub/databases/embl NUC (Rel. 37, Dec 93 + updates) * Eukaryotic Promotor Database /pub/databases/epd EPD (Rel. 37, Dec 93) * SwissProt Protein Sequence Database /pub/databases/swissprot PROT (Rel. 27, Oct 93 + updates) * Prosite pattern database /pub/databases/prosite PROSITE (Rel. 11, Oct 93) * PRINTS protein signature database /pub/databases/prints PRINTS (Rel. 4.0, Oct 93) * SBASE protein domain database /pub/databases/sbase SBASE (Rel. 2.0, Dec 93) * ENZYME database /pub/databases/enzyme ENZYME (Rel. 14, Oct 93) * Brookhaven Protein Databank not available PROTEINDATA (Rel. 65, Oct 93 + pre-release) * REBASE, Restriction Enzyme Database /pub/databases/rebase REBASE (Rel. 402, Feb 94) * RELIBRARY, Restriction Enzyme List /pub/databases/relibrary RELIBRARY (Feb 1994) METHYL, Effects of site-specific /pub/databases/methyl METHYL methylation on methylases and restriction enzymes (1991) tRNA sequence and gene sequence db /pub/databases/trna TRNA (1993) REPBASE - Prototypic sequences for /pub/databases/repbase REPBASE human repetitive DNA (Rel. 1.01 1992) * TFD, Transcription Factor Database /pub/databases/tfd unavailable (Ver 7.3, Sep 93) * ECD, E.coli Database /pub/databases/ecd ECD (Rel. 17, Dec 93) * FLYBASE, Drosophila Genetic Map db /pub/databases/flybase unavailable (Feb 94) LiMB, Listing of Mol. Biol. db's /pub/databases/limb LIMB (Rel. 3.0) * SEQANALREF, Seq. analysis refs /pub/databases/reflist REFLIST (Rel. 45, Nov 93) FANS_REF, Functional analysis refs /pub/databases/reflist REFLIST (Rel. 3.4, Apr 91) * Catalogue of molecular biological /pub/databases/bio_catal BIO_CATAL software (Rel. 2.1, Dec 93) Alu sequence database and alignment /pub/databases/alu ALU * Signal Recognition Particle database /pub/databases/srp SRP (Dec 1993) Haemophilia B database /pub/databases/haemb HAEMB (Rel. 2, Oct 1992) * Kabat Database of proteins of /pub/databases/kabat unavailable immunol. interest (Rel 5, Aug 92) Compilation of small RNA sequences /pub/databases/smallrna SMALLRNA (Oct 91) Berlin Databank of 5S rRNA and /pub/databases/berlin BERLIN 5S rRNA gene sequences (1991) Compilation of small ribosomal /pub/databases/rrna RRNA subunit RNA sequences (Jun 1993) CUTG, codon usage /pub/databases/cutg CUTG tabulated from GenBank rel. 69 3D_Ali, 3D alignment database /pub/databases/3d_ali 3D_ALI (Jun 1993) * RLDB, Reference Library Database /pub/databases/rldb unavailable (Feb 1994) * PKCDD, Protein Kinase Catalytic /pub/databases/pkcdd PKCDD Domain Database (December 1993) * CpG Islands Database /pub/databases/cpgisle CPGISLE (Release 2.0, Jan 1994) * Blocks database /pub/databases/blocks BLOCKS (Rel. 7.01, Dec 1993) HLA, Alignments of human HLA /pub/databases/hla HLA sequences (Jul 1993) TRANSTERM, Translational /pub/databases/transterm TRANSTERM Termination Signal Database (Apr 1993) * LISTA, Yeast coding sequences /pub/databases/lista LISTA (Rel. 3.1, Dec 1993) * HSSP, sequence-aligned protein /pub/databases/protein_extras/hssp families (Oct 1993) PROTEINDATA * FSSP, structure-aligned protein /pub/databases/protein_extras/fssp families (Oct 1993) unavailable DSSP, protein secondary structures /pub/databases/protein_extras/dssp (Feb 1993) PROTEINDATA * pdb_select, representative sets of /pub/databases/protein_extras/ 3D proteins (Dec 93) pdb_select Misfolded, database of deliberately /pub/database/protein_extras/misfolded misfolded protein models (Nov 92) unavailable Software: Software for MS-DOS computers /pub/software/dos DOS_SOFTWARE Software for Apple Macintosh /pub/software/mac MAC_SOFTWARE Software for UNIX /pub/software/unix UNIX_SOFTWARE Software for VAX/VMS /pub/software/vax VAX_SOFTWARE Other software /pub/software/misc MISC_SOFTWARE Miscellaneous: * Technical documents, submission and /pub/doc DOC order forms, etc. * Multiple DNA sequence alignments /pub/databases/embl/align ALIGN and consensus sequences Codon Usage tables /pub/databases/codonusage CODONUSAGE * Crystallographers' information /pub/databases/xray XRAY * Journals Tables of Content /pub/databases/journals_toc unavailable <7> Getting Started ? ----------------- For initial information, send standard electronic mail to the address: NetServ@EMBL-Heidelberg.DE containing just the word HELP on a line by itself. To use the anonymous ftp server, connect to the internet address FTP.EMBL-Heidelberg.DE using the username "anonymous" (without the quotes !) and giving your e-mail address as the password. Look in the directory /pub/help for various help files. To use the Gopher server, open a connection to Gopher.EMBL-Heidelberg.DE at the standard Gopher port 70. <8> Network Addresses at EMBL ------------------------- EMBL File Server (e-mail requests) NetServ@EMBL-Heidelberg.DE Anonymous FTP FTP.EMBL-Heidelberg.DE Gopher Server Gopher.EMBL-Heidelberg.DE BLITZ e-mail server Blitz@EMBL-Heidelberg.DE FASTA e-mail server FASTA@EMBL-Heidelberg.DE Quicksearch e-mail server Quick@EMBL-Heidelberg.DE Problems, feedback (human contact) NetHelp@EMBL-Heidelberg.DE EMBL Data Library enquiries DataLib@EMBL-Heidelberg.DE EMBL Data Library sequence submissions DataSubs@EMBL-Heidelberg.DE Software submissions and problems Software@EMBL-Heidelberg.DE From owner-embldatabank@net.bio.net Fri Feb 11 22:00:00 1994 Path: biosci!NET.BIO.NET!biosci-help From: biosci-help@NET.BIO.NET (BIOSCI Administrator) Newsgroups: bionet.molbio.embldatabank Subject: test of embl-db@net.bio.net Date: 12 Feb 1994 02:32:27 -0000 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 2 Sender: daemon@net.bio.net Distribution: bionet Message-ID: Reply-To: biosci-help@net.bio.net NNTP-Posting-Host: net.bio.net test of embl-db@net.bio.net From owner-embldatabank@net.bio.net Fri Feb 11 22:00:00 1994 Path: biosci!NET.BIO.NET!kristoff From: kristoff@NET.BIO.NET (David Kristofferson) Newsgroups: bionet.molbio.embldatabank Subject: IMPORTANT BIOSCI INFORMATION Date: 12 Feb 1994 10:00:28 -0000 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 244 Sender: daemon@net.bio.net Distribution: bionet Message-ID: <199402121000.CAA27758@net.bio.net> NNTP-Posting-Host: net.bio.net Three important items follow: BIOSCI archive searching by e-mail, the BIOSCI FAQ, and the BIOSCI User Address Directory form. If you have not yet listed yourself in our e-mail address directory, please take a few minutes to complete and return the form below. If your address information has changed since you listed yourself, please send us an updated form. Sincerely, Dave Kristofferson BIOSCI/bionet Manager kristoff@net.bio.net **** SEARCHING BIOSCI ARCHIVES WITH WAISMAIL **** E-mail users can search the BIOSCI archives by using our waismail e-mail server. For instructions send the message help to waismail@net.bio.net. Leave the Subject: line blank. Other methods of searching the archives via WAIS and gopher are described in the BIOSCI FAQ. **** BIOSCI FREQUENTLY ASKED QUESTIONS (FAQ) SHEET **** New users of BIOSCI/bionet may want to read the "Frequently Asked Questions" or "FAQ" sheet for BIOSCI. The FAQ provides details on how to participate in these forums and is available for anonymous FTP from net.bio.net [134.172.2.69] in pub/BIOSCI/biosci.FAQ or for retrieval by gopher to net.bio.net, port 70. It may also be requested by sending e-mail to biosci@net.bio.net (use plain English for your request). The FAQ is also posted on the first of each month to the newsgroup BIONEWS/bionet.announce immediately following the posting of the BIOSCI information sheet. **** BIOSCI USER ADDRESS DIRECTORY **** Please take this opportunity to add your name and address information to the BIOSCI User Address Database if you have not already done so. Below is the address form that we would like each reader of the BIOSCI/bionet newsgroups to complete and return if you would like to be listed in our database. The database serves as a directory that enables biologists, who are currently using (or even just reading) the BIOSCI newsgroups, to look up e-mail addresses and other information about our users. The address database is reindexed nightly for WAIS and waismail access (waismail is our WAIS e-mail server, more below) and will also be available for access via other gopher sites if they wish to permit it. The raw unindexed data is available for FTP from net.bio.net and is atomized sufficiently to allow import into your local RDBMS should you so desire. Please carefully follow the instructions for completing the form below and return it to either of the following two addresses (whichever is more convenient for you). Thanks in advance for taking the time to complete and return the form. Addresses for returning forms Location Network ----------------------------- -------- ------- biovote@net.bio.net U.S.A. Internet/BITNET biovote@daresbury.ac.uk U.K. JANET MAKING SURE THAT YOUR INFORMATION IS CURRENT This notice will be mailed bimonthly to each newsgroup. You should check our WAIS source or waismail e-mail server from time-to-time to see if your address information is still up-to-date. Send the message help to waismail@net.bio.net for instructions on using waismail. Leave the Subject: line in your message blank. Using Gopher to complete the form --------------------------------- If you don't want to use a text editor, you can also use Dan Jacobson's gopher site to fill out the address database form as follows. Otherwise skip this section on gopher and proceed to the instructions for filling out the form below. > To add yourself to the database just point your > gopher client at merlot.gdb.org and select the following: > > --> 15. Searching For Biologists/ > > --> 9. E-mail Addresses of Biosci-Bionet Users/ > > --> 1. Add (or Correct) Your Address to the BIOSCI User Address > Data.. > > > And fill out the form. or Rob Harper's gopher site in Europe as follows: > Europeans can point their gopher client at gopher.csc.fi and add their > information to the database. All entries will be mailed directly to > Dave for incorporation in a wais source. > > The path to the questionare is as follows. > > ---> 10. Finnish EMBnet BioBox/ > > ---> 8. FAQ Files/ > > FAQ Files > > 1. EMBnet: Information. > 2. EMBnet: Internet resources guide. > 3. A Biologist's Guide to Internet Resources/ > 4. All FAQs (Frequently Asked Questions) Searches and Archives/ > --->5. Bionauts Address Database (questionaire) IMPORTANT INSTRUCTIONS - PLEASE READ CAREFULLY Please enter all responses after the : on each line, leaving one (1) blank space after the : (i.e., before the start of your text). Please do NOT extend your responses past the end of each line (80 characters) or alter any of the field identifiers such as "first name: ". Several lines are provided at the end of the form for comments, but, please adhere to the line length restriction. On the date: line, please enter the date in the DD-MM-YY format, e.g., 05-05-93 for 5 May 1993. This line will tell others when the information was last updated. Please be sure to include the 0's for single digit days or months, e.g., 05-05-93, not 5-5-93. Note that the "e-mail network: " line below is for specifying, e.g., "Internet," "BITNET," "EARN," "JANET," or whatever other network that your computer may be on. If you are uncertain about any field, please feel free to leave it blank, but please DO NOT DELETE the field identifier from the form! In the first field below, "New information or Update ...", please enter "N" if this is the first time that you have registered in the directory or "U" if you are correcting a listing that you sent to us previously. The comment: lines may be used for anything that you like but PLEASE DO NOT DELETE THEM FROM THE FORM OR ALTER THEM. One suggested use is to list the names of the newsgroups in which you participate. Please use the MAILING LIST name (see below - the latest version of the list can be requested from biosci@net.bio.net) instead of the USENET name even if you don't participate by e-mail. WAIS might get confused by the periods in the USENET names. This allows one to retrieve via WAIS or waismail the list of participants in a particular group. For example: comment: ARABIDOPSIS PLANT-BIOLOGY BIONEWS On the comment: lines use these names below ---- NOT the USENET names below MAILING LIST NAME USENET Newsgroup Name ----------------- --------------------- ACEDB-SOFT bionet.software.acedb AGEING bionet.molbio.ageing AGROFORESTRY bionet.agroforestry ARABIDOPSIS bionet.genome.arabidopsis BIOFORUM bionet.general BIO-INFORMATION-THEORY bionet.info-theory BIONAUTS bionet.users.addresses BIONEWS bionet.announce BIO-JOURNALS bionet.journals.contents BIO-MATRIX bionet.molbio.bio-matrix BIO-SOFTWARE bionet.software CHROMOSOMES bionet.genome.chromosomes COMPUTATIONAL-BIOLOGY bionet.biology.computational DROSOPHILA bionet.drosophila EMBL-DATABANK bionet.molbio.embldatabank EMPLOYMENT bionet.jobs GDB bionet.molbio.gdb GENBANK-BB bionet.molbio.genbank GENETIC-LINKAGE bionet.molbio.gene-linkage HIV-MOLECULAR-BIOLOGY bionet.molbio.hiv HUMAN-GENOME-PROGRAM bionet.molbio.genome-program IMMUNOLOGY bionet.immunology INFO-GCG bionet.software.gcg JOURNAL-NOTES bionet.journals.note METHODS-AND-REAGENTS bionet.molbio.methds-reagnts MOLECULAR-EVOLUTION bionet.molbio.evolution NEUROSCIENCE bionet.neuroscience N2-FIXATION bionet.biology.n2-fixation PHOTOSYNTHESIS bionet.photosynthesis PLANT-BIOLOGY bionet.plants POPULATION-BIOLOGY bionet.population-bio PROTEIN-ANALYSIS bionet.molbio.proteins PROTEIN-CRYSTALLOGRAPHY bionet.xtallography RAPD bionet.molbio.rapd SCIENCE-RESOURCES bionet.sci-resources TROPICAL-BIOLOGY bionet.biology.tropical VIROLOGY bionet.virology WOMEN-IN-BIOLOGY bionet.women-in-bio YEAST bionet.molbio.yeast Listing newsgroups on the comment: line is optional, of course. Thanks again for your cooperation! --------------- please cut here and return portion below --------------- New information or Update to old record (enter N or U): date (DD-MM-YY): first name: middle initial: family name: job title: e-mail address: e-mail network: phone number: FAX number: institution: address1: address2: address3: city: state/province: country: postal code: research interest: research interest: comment: comment: comment: comment: comment: From owner-embldatabank@net.bio.net Mon Feb 14 22:00:00 1994 Path: biosci!daresbury!not-for-mail From: "Peter J. Punt,MBL-TNO,Rijswijk,The Neth." Newsgroups: bionet.molbio.embldatabank Subject: genbank submission Date: 15 Feb 1994 09:08:49 -0000 Organization: Medical Biological Laboratory TNO Lines: 22 Sender: daemon@mserv1.dl.ac.uk Distribution: bionet Message-ID: <2jq3f1$s8r@mserv1.dl.ac.uk> Original-To: embl-db@dl.ac.uk L.S. Could you please send me all information required to submit new sequences to The EMBL-DATAbank. Sincerely, Peter J. Punt +--------------------------------------------------------------------------+ | Peter J. Punt Internet: punt@mbl.tno.nl | | TNO Food and Nutrition Research | Department of Molecular Genetics and Gene-Technology | Postbox 5815 | 2280 HV Rijswijk Phone (..) 31 15 843122 The Netherlands Fax (..) 31 15 843989 +--------------------------------------------------------------------------+ From owner-embldatabank@net.bio.net Tue Feb 15 22:00:00 1994 Newsgroups: bionet.software,bionet.molbio.genbank,bionet.molbio.embldatabank,bionet.molbio.pir,bionet.molbio.proteins Path: biosci!parc!decwrl!ames!agate!howland.reston.ans.net!cs.utexas.edu!uunet!hearst.acc.Virginia.EDU!murdoch!dayhoff.med.Virginia.EDU!wrp From: wrp@dayhoff.med.Virginia.EDU (William R. Pearson) Subject: New FASTA versions available Message-ID: Sender: usenet@murdoch.acc.Virginia.EDU Organization: University of Virginia Date: Sat, 12 Feb 1994 16:55:29 GMT Lines: 29 Xref: biosci bionet.software:7267 bionet.molbio.genbank:1535 bionet.molbio.embldatabank:285 bionet.molbio.pir:3 bionet.molbio.proteins:1364 A new release of the FASTA program package, version 1.7, is now available from virginia.EDU in pub/fasta as fasta17.shar(.Z). This version replaces the "rdf2" and "rss" programs with "prdf" and "prss", which calculate more accurate estimates for the statistical significance of a similarity score based on the scores of randomly shuffled sequences. The earlier "rdf2" and "rss" programs calculated a "z-value," which is not very informative if the distribution of similarity scores is not normal. Sequence similarity scores for random sequences are distributed according to the extreme value distribution, which is quite different from the normal distribution, especially for high scores. Prss and prdf estimate the parameters of the extreme value distribution and use these parameters to calculate the probability that a score as good or better than the unshuffled sequence score will be obtained. I appreciate the help of Stephen Altschul, who showed me the error of calculating "z-values", and the help of Phil Green, who provided the extreme value distribution estimation routine. Statistical estimates based on the extreme value distribution are usually more conservative than earlier estimates based on "z-values." In addition, a bug in the alignment routines that caused error messages and core dumps on some machines has been fixed. This bug has also been fixed in version 1.6. The new 1.6 version is available as fasta16c32.shar(.Z). Bill Pearson From owner-embldatabank@net.bio.net Mon Feb 21 22:00:00 1994 Path: biosci!daresbury!trane.uninett.no!nntp.uio.no!usenet From: rushing@titan.ksc.nasa.gov (Sam Rushing) Newsgroups: bionet.software,bionet.molbio.genbank,bionet.molbio.embldatabank,bionet.molbio.pir,bionet.molbio.proteins Subject: Re: New FASTA versions available Date: 22 Feb 1994 20:35:11 GMT Organization: NASA, Kennedy Space Center Lines: 31 Message-ID: <2kdq9v$ceb@hermod.uio.no> References: NNTP-Posting-Host: biotek08.uio.no X-Newsreader: WinVN version 0.80 Xref: biosci bionet.software:7328 bionet.molbio.genbank:1540 bionet.molbio.embldatabank:286 bionet.molbio.pir:4 bionet.molbio.proteins:1413 In article , wrp@dayhoff.med.Virginia.EDU (William R. Pearson) says: > > A new release of the FASTA program package, version 1.7, is >now available from virginia.EDU in pub/fasta as fasta17.shar(.Z). > > This version replaces the "rdf2" and "rss" programs with >"prdf" and "prss", which calculate more accurate estimates for the >statistical significance of a similarity score based on the scores of >randomly shuffled sequences. The earlier "rdf2" and "rss" programs >calculated a "z-value," which is not very informative if the >distribution of similarity scores is not normal. Sequence similarity >scores for random sequences are distributed according to the extreme >value distribution, which is quite different from the normal >distribution, especially for high scores. Prss and prdf estimate the >parameters of the extreme value distribution and use these parameters >to calculate the probability that a score as good or better than the >unshuffled sequence score will be obtained. I appreciate the help of >Stephen Altschul, who showed me the error of calculating "z-values", >and the help of Phil Green, who provided the extreme value >distribution estimation routine. > > Statistical estimates based on the extreme value distribution >are usually more conservative than earlier estimates based on >"z-values." > >In addition, a bug in the alignment routines that caused error >messages and core dumps on some machines has been fixed. This bug has >also been fixed in version 1.6. The new 1.6 version is available as >fasta16c32.shar(.Z). > >Bill Pearson From owner-embldatabank@net.bio.net Mon Feb 21 22:00:00 1994 Path: biosci!daresbury!trane.uninett.no!nntp.uio.no!usenet From: rushing@titan.ksc.nasa.gov (Sam Rushing) Newsgroups: bionet.software,bionet.molbio.genbank,bionet.molbio.embldatabank,bionet.molbio.pir,bionet.molbio.proteins Subject: Re: New FASTA versions available Date: 22 Feb 1994 20:36:27 GMT Organization: NASA, Kennedy Space Center Lines: 33 Message-ID: <2kdqcb$ceb@hermod.uio.no> References: NNTP-Posting-Host: biotek08.uio.no X-Newsreader: WinVN version 0.80 Xref: biosci bionet.software:7329 bionet.molbio.genbank:1541 bionet.molbio.embldatabank:287 bionet.molbio.pir:5 bionet.molbio.proteins:1414 In article , wrp@dayhoff.med.Virginia.EDU (William R. Pearson) says: > > A new release of the FASTA program package, version 1.7, is >now available from virginia.EDU in pub/fasta as fasta17.shar(.Z). >Question 1 Is this an Mac version or PC version? > This version replaces the "rdf2" and "rss" programs with >"prdf" and "prss", which calculate more accurate estimates for the >statistical significance of a similarity score based on the scores of >randomly shuffled sequences. The earlier "rdf2" and "rss" programs >calculated a "z-value," which is not very informative if the >distribution of similarity scores is not normal. Sequence similarity >scores for random sequences are distributed according to the extreme >value distribution, which is quite different from the normal >distribution, especially for high scores. Prss and prdf estimate the >parameters of the extreme value distribution and use these parameters >to calculate the probability that a score as good or better than the >unshuffled sequence score will be obtained. I appreciate the help of >Stephen Altschul, who showed me the error of calculating "z-values", >and the help of Phil Green, who provided the extreme value >distribution estimation routine. > > Statistical estimates based on the extreme value distribution >are usually more conservative than earlier estimates based on >"z-values." > >In addition, a bug in the alignment routines that caused error >messages and core dumps on some machines has been fixed. This bug has >also been fixed in version 1.6. The new 1.6 version is available as >fasta16c32.shar(.Z). > >Bill Pearson From owner-embldatabank@net.bio.net Tue Feb 22 22:00:00 1994 Path: biosci!SPEEDY.COACADE.UV.MX!evargas From: evargas@SPEEDY.COACADE.UV.MX (Enrique Vargas) Newsgroups: bionet.molbio.embldatabank Subject: Databases access Date: 23 Feb 1994 17:25:22 -0000 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 15 Sender: daemon@net.bio.net Distribution: bionet Message-ID: <9402222243.AA01428@speedy.speedy.coacade.uv.mx> NNTP-Posting-Host: net.bio.net Hi! Can somebody tell me if there is a method for access databases as Genbank, EMBL, PIR,... etc., selecting from the sequence list a given one of a protein family (e.g. Immunoglobulins), INSTEAD OF perform a search? Your help will be greatly appreciated. ******************************************************************************* * Enrique Vargas-Madrazo * evargas@speedy.coacade.uv.mx * ******************************************************************************* * Laboratorio de Biologia Molecular * Phone number: (28)125757 * * e Inmunologia Teorica. * FAX number: (28)125757 * ******************************************************************************* * Instituto de Investigaciones Biologicas * Universidad Veracruzana * * * Xalapa, Veracruz; Mexico. * ******************************************************************************* From owner-embldatabank@net.bio.net Wed Feb 23 22:00:00 1994 Path: biosci!daresbury!doc.ic.ac.uk!uknet!pipex!howland.reston.ans.net!vixen.cso.uiuc.edu!sdd.hp.com!nigel.msen.com!math.fu-berlin.de!news.th-darmstadt.de!zib-berlin.de!news.belwue.de!news.dfn.de!news.dfn.de!immunbio.mpg.de!immunbio.mpg.de!news Newsgroups: bionet.molbio.embldatabank Subject: Re: Databases access Message-ID: <1994Feb23.214420.100@immunbio.mpg.de> From: GARTMANN@IMMUNBIO.MPG.DE (Christoph Gartmann) Date: 23 Feb 94 21:44:19 +0100 References: <9402222243.AA01428@speedy.speedy.coacade.uv.mx> Distribution: world Organization: Max-Planck-Institut fuer Immunbiologie Nntp-Posting-Host: mpi1.immunbio.mpg.de X-News-Reader: VMS NEWS 1.24In-Reply-To: evargas@SPEEDY.COACADE.UV.MX's message of 23 Feb 1994 17:25:22 -0000Lines: 22 Lines: 22 In <9402222243.AA01428@speedy.speedy.coacade.uv.mx> evargas@SPEEDY.COACADE.UV.MX writes: > Can somebody tell me if there is a method for access databases as > Genbank, EMBL, PIR,... etc., selecting from the sequence list a given one > of a protein family (e.g. Immunoglobulins), INSTEAD OF perform a search? There is a gopher hole to Thure Etzold's SRS (Sequence Retrieval System) on the Norwegian Embnet Node in Oslo. It should be reachable via telnet as well. Telnet to "biomed.uio.no" and login as "SRS". There you may perform complex queries to several databases, extract the results (sequences found) as files and they will be mailed back to you. Regards Christoph Gartmann +----------------------------------------------------------------------------+ | Max-Planck-Institut fuer Phone : +49-761-5108-465 Fax: -221 | | Immunbiologie PSI : PSI%(0262)45050160374::GARTMANN | | Postfach 1169 Internet: gartmann@immunbio.mpg.de | | D-79011 Freiburg, FRG | +----------- Do you know MENUE, the user environment for OpenVMS? -----------+ From owner-embldatabank@net.bio.net Wed Feb 23 22:00:00 1994 Path: biosci!daresbury!not-for-mail From: semerz@lmcp.jussieu.fr (Michel Semertzidis) Newsgroups: bionet.molbio.embldatabank Subject: OMEGA_2 data bank announcement Date: 24 Feb 1994 10:13:26 -0000 Lines: 78 Sender: daemon@mserv1.dl.ac.uk Distribution: bionet Message-ID: <2khuk6$hs3@mserv1.dl.ac.uk> Original-To: acedb@dl.ac.uk, bio-info@dl.ac.uk, bio-soft@dl.ac.uk, bionews@dl.ac.uk OMEGA_2 data bank for Mac is now at the genome.inserm-vjf.fr (192.134.32.20) /pub/OMEGA. Log in as `anonymous' and enter your email address as your password. OMEGA_2 data bank is a compilation of recent structural information on proteins. OMEGA_2 data bank was compiled by Michel T. SEMERTZIDIS*, Sylvia DEPLANQUE and Jean-Paul MORNON Département des Macromolécules Biologiques, Laboratoire de Minéralogie - Cristallographie, Université Pierre et Marie Curie (Paris 6) et Denis Diderot (Paris 7), CNRS URA 09, Tour 16, 4 place Jussieu, CASE 115, F-75252 Paris Cedex 05, FRANCE E-mail: "semerz@lmcp.jussieu.fr" *To whom correspondence should be addressed Suggested citations for use of this data bank are: Michel T. SEMERTZIDIS, Sylvia DEPLANQUE and Jean-Paul MORNON (1993) "OMEGA: A 3D Databank for Protein Structures (a complement to PDB)", CABIOS 9, 667-670. RELEASE 1: JUNE, 1993: 401 proteins. RELEASE 2: JANUARY, 1994: 537 proteins. ABSTRACT OMEGA is a compilation of recent structural information on proteins derived from X-ray crystallography or NMR and published in journals referenced by Current Contents. To date, 401 entries have been included ( 334 X-ray, 28 NMR, 5 NMR + X-ray, 5 electron microscopy, 3 neutron scattering, 2 neutron diffraction, 1 electron microscopy + X-ray, 12 model, 11 miscellaneous ), with 5-10 new proteins being added each week. OMEGA can be accessed on Macintosh and is interrogated through 32 key words (space group, resolution, secondary structure, number of residues, etc). This pool of proteins could be used for various purposes, including searches for proteins with a particular set of secondary structures. OMEGA will be continuously updated (every 6 months) and may later include all proteins already reported in the PDB, as well as structures reported in journals with smaller readerships. We would greatly appreciate any ideas for improving future releases. We also apologize in advance for any errors or omissions that may appear in the database, and would be grateful to be informed of any errors. We also welcome submission for entry in OMEGA of any new publication related to the determination of a protein structure, as well as the citing of this paper as a reference for the OMEGA databank. We would appreciate receiving reprints of publications making use of OMEGA. ACKNOWLEDGEMENTS: This work was supported by the Universités Paris 6 and Paris 7, CNRS, INSERM (contrats 889009 et 910912), and Fondation pour la Recherche Médicale. M.T.S. has a Ph.D. grant from the French government (MRE). !!! The first time you will use omega it will take some time for special 4D decompression !!! TTGATTGCTAAACACTGGGCGGCGAATCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG MICHEL T. SEMERTZIDIS Internet: SEMERZ@LMCP.JUSSIEU.FR University of Paris 6 Bitnet: CNRS URA 09, CASE 115 Phone: Tour 16, 4 place Jussieu, Fax: 75252 Paris Cedex 05, System managers do it with PRIVILEGES! F R A N C E DISCLAIMER:As always,I speak only for myself,and,usually,only to myself. LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu From owner-embldatabank@net.bio.net Wed Feb 23 22:00:00 1994 Path: biosci!UICVM.UIC.EDU!LIMARMG%BRUFMG From: LIMARMG%BRUFMG@UICVM.UIC.EDU (Roberto lima) Newsgroups: bionet.molbio.embldatabank Subject: subscription Date: 24 Feb 1994 18:38:14 -0000 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 20 Sender: daemon@net.bio.net Distribution: bionet Message-ID: <199402241834.KAA10644@net.bio.net> NNTP-Posting-Host: net.bio.net Dear Sir, I am working with PCR techniques typing domestic animals (speccially dairy cattle) from different breeds . It's very important for me to have access to some informations about some genes already cloned. I would really appreciatte participating in this group which I believe will be very important in my researches. As soon as possible, please send me a message of my request. Best regards! Yours sincerely, Roberto Lima ******************************************************************************* ROBERTO LIMA VETERINARY SCHOOL- UNIVERSIDADE FEDERAL DE MINAS GERAIS BELO HORIZONTE _ BRAZIL BITNET: LIMARMG@BRUFMG INTERNET: LIMARMG@VM1.LCC.UFMG.BR From owner-embldatabank@net.bio.net Mon Feb 28 22:00:00 1994 Path: biosci!daresbury!trane.uninett.no!sunic!EU.net!howland.reston.ans.net!usenet.ins.cwru.edu!magnus.acs.ohio-state.edu!cis.ohio-state.edu!news.sei.cmu.edu!bb3.andrew.cmu.edu!andrew.cmu.edu!hb10+ From: "Howard M. Bomze" Newsgroups: bionet.molbio.embldatabank Subject: Help searching databases Date: Tue, 1 Mar 1994 10:31:37 -0500 Organization: Doctoral student, Biology, Carnegie Mellon, Pittsburgh, PA Lines: 11 Message-ID: <0hQpzNO00iV7A3=HJY@andrew.cmu.edu> NNTP-Posting-Host: po2.andrew.cmu.edu I need some help in searching through the sequence data bases for splice junctions. Does anybody know of any programs out there that I can Use to do this? I am trying to look at sequences next to splice junctions but in the EXON. I don't think this will be too hard but I don't know much about programing. Thanks in advance for any help. Howard From owner-embldatabank@net.bio.net Mon Feb 28 22:00:00 1994 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!news.moneng.mei.com!uwm.edu!msuinfo!netnews.upenn.edu!news.cc.swarthmore.edu!news From: kshinka1@swarthmore.edu (Kanade Shinkai) Newsgroups: bionet.molbio.embldatabank Subject: Using BLAST via the Internet Date: 1 Mar 1994 21:40:54 GMT Organization: Swarthmore College Lines: 19 Sender: kshinka1@oak.cc.swarthmore.edu Message-ID: <2l0cp6$j6f@larch.cc.swarthmore.edu> NNTP-Posting-Host: mac04.martin1.swarthmore.edu Mime-Version: 1.0 Content-Type: text/plain; charset=US-ASCII Content-Transfer-Encoding: 7bit X-Posted-From: InterNews 1.0.1b11@mac04.martin1.swarthmore.edu X-Authenticated: kshinka1 on POP host oak.cc.swarthmore.edu Hello All, We have a short invertebrate nucleotide sequence that we wish to run against the various nucleotide data bases available on the Internet. We are aware that methods exists for doing this via e-mail (e.g., NCBI-BLAST, FASTA, QUICKSEARCH, etc.) but have no experience doing this. We have downloaded the help files which explain how to format search queries. However, we are not familiar with the theoretical bases for these algorithms, and, therefore, do not understand the meaning of the various parameters used, and how they relate to more straight-forward sequence properties such as homology. Can anyone recommend how we should procede from here? Please send replies directly via e-mail, as we don't frequently peruse this group. Thanks ahead of time for the help. Cheers, Kanade Shinkai