From owner-embldatabank@net.bio.net Tue Mar 01 22:00:00 1994 Newsgroups: bionet.molbio.embldatabank Path: biosci!daresbury!bioftp.unibas.ch!comp.bioz.unibas.ch!doelz From: doelz@comp.bioz.unibas.ch (Reinhard Doelz) Subject: Re: Help searching databases Message-ID: <1994Mar2.095205.285@comp.bioz.unibas.ch> Sender: usenet@comp.bioz.unibas.ch (NEWS transaction account) Nntp-Posting-Host: biox.embnet.unibas.ch Reply-To: doelz@urz.unibas.ch Organization: EMBnet Switzerland [BASEL] References: <0hQpzNO00iV7A3=HJY@andrew.cmu.edu> Date: Wed, 2 Mar 1994 09:52:05 GMT Lines: 175 In article <0hQpzNO00iV7A3=HJY@andrew.cmu.edu>, "Howard M. Bomze" writes: |> I need some help in searching through the sequence data bases for splice |> junctions. Does anybody know of any programs out there that I can Use |> to do this? I am trying to look at sequences next to splice junctions |> but in the EXON. I don't think this will be too hard but I don't know |> much about programing. Thanks in advance for any help. I am not sure what you mean with 'look at' sequences but I'll show you how to prepare a set of sequences with the SRS system from Thure Etzold. Start SRS [U] [S] (select a sequence query) /[D] SPLICE & JUNCTION /[T] SPLICE & JUNCTION /[C] SPLICE & JUNCTION (enter search terms SPLICE _and_ JUNCTION in Description, Title and Reference) /[S] [SPACE] [S] [E] [SPACE] (deselect Swissprot, select EMBL database, you might want to select more DNA databases) /[X] 2 combine search terms with OR The mask, now looks as follows: (if your terminal isn't good enough, the _ and | will be displayed as x and q's or similar, I'm afraid) _____________________________________________________________________________ [G] General [O] BuffOptions [U] Query [H] Help lqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqSequenceqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqk x ID [I]: x x Accession [N]: x x Definition [D]: SPLICE & JUNCTION x x Keywords [K]: x x Organism [O]: x x Authors [A]: x x Title [T]: SPLICE & JUNCTION x x Reference [R]: x x Comment [C]: SPLICE & JUNCTION x x Features [F]: SPLICE & JUNCTION x x separate keys by & (AND), | (OR), or ! (AND NOT) x x x x query (set) name [Q]: SQ1 select library(s) [S]: @ x x connect fields by AND (1) or OR (2) [X]: 1 x x do => ([Do]) abort => ([F10]) x mqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqj ______________________________________________________________________________ [RETURN] to do the query. There will be about 100 entries. Next, [O] [W] to view the query results, my screen looks like Info of Query "SQ1" Query Command(s): SQ1 = ( [SQ-DEF: SPLICE* & JUNCTION*] | [SQ-TIT: SPLICE* & JUNCTION*] | [SQ-CC: SPLICE* & JUNCTION*]) | [SQ-FTS: SPLICE* & JUNCTION*] > PARENT 86 entries from library "EMBL" 13 entries from library "EMBL_NEW" 10 entries from library "GENBANK" Created set of type "Seq-ID" has 109 members [Q] to leave this mode. Next, we need to find all exons. Again, a sequence query, [U] [S] /[F] EXON [RETURN] [O] [W] Query Command(s): SQ2 = ( [S2-FTS: EXON*]) 39185 entries from library "EMBL" 2499 entries from library "EMBL_NEW" 1713 entries from library "GENBANK" Created set of type "Seq-Ft-ID" has 43397 members [Q] to leave this query. Next, we combine the two by mapping the first on the second. [U] [X] SQ1 > SQ2 [RETURN] In SQ3, you'll find about 200 entries which are DNA exon sequences, described in other sections of the annotation with SPLICE and JUNCTION. You may want to copy this into your directory with [O] [C] (copy set output). Now as Exons might be rather short we set a minimum limit to 10 base pairs, and the screen will look as lqqqqqqqqqqqqqqqqqqqqqq Copy Sequence Feature qqqqqqqqqqqqqqqqqqqqqqqkN... x x x output directory: /bioy/scratch/doelz/ x x file name: x x sequence format [F]: @ x x x x begin [B]: 0 relative to begin (1) or end (2): 1 x x end [E]: 0 relative to begin (1) or end (2): 2 x x minimum length [M]: 10 maximum length: 0 x x x x reject if feature incomplete: Y x x reject if selected range incomplete: Y x x x x do => ([Do]) abort => ([F10]) x x x mqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqj As the copying process starts, you will see success messages and messages which indicate that the sequence does not meet the constraints (10 bp) or that the feature is incomplete (we ticked Y for Yes in this option). Finally, you will come up with about 80 sequences, conveniently written in GCG format (you might want PIR format as another option). The following is showing a sample entry on VMS: D$DAY:[DOELZ]CFCRE1_S2.GCG;1 FT repeat_region 1. .415 FT /note="mini-exon gene repeat Sequence extract of feature "CFCRE1_S2" Begin position: 0 added to BEGIN End position: 0 added to END Length constraints: min=10, max=0 D$DAY:[DOELZ]CFCRE1_S2.GCG Length: 415 Check: 4283 .. 1 AAGCTTCCGG AAACAACCGG CACAAATTTT GAGGCGGAAG CGCTGCTTTT TTTTGTGTCC 61 GGGGGGGTGC TCCTTGGGGT CCCCCTGTCC AGCCCCAGCC GGTCGCCCAC CACATAGGAA 121 TTTGCGAAGG ACCCCCAAAA ATCCCGGTCC CCGGGGCGAG TTGTCCCAAC TTTTTCAAAC 181 CTCATGAAGA GCTAGTTGCG TCATTGAAAA GTTCGTGTGC AGAAACCCCC TCCCCCACGT 241 TTGTACAATG GAAGAGTTTA CGATACAGGT TTTCTCACGG TTTTGAGGTG TTTTTTCGAA 301 AAACAAAAAA TATAGAGGTG TATAGCGCTT ATTTTTGACA CCCCCCTCAA AACATGCTGG 361 GGGTATAGGT CCTTCCAACT AACGCTATAT AAGTATCAGT TTCTGTACTT TATTG SRS is available as telnet hole and via anonymous FTP in full source. It is known to run well on VMS and various flavours of UNIX systems. GCG Version 8, expected later this year, is rumoured to contain a SRS system. Regards Reinhard DISCLAIMER Note that the software mentioned resembles Computer Program(s) which require a license in order to be run unless stated otherwise in a state- ment codistributed with the software. The use of the program(s) was men- tioned within a specific problem or example and must not be used to con- clude that other software products cannot possibly do a similar job. -- +---------------------------+-------------------------------------------+ | Dr. Reinhard Doelz | Tel. x41 61 2672247 Fax x41 61 2672078 | | Biocomputing | electronic Mail doelz@urz.unibas.ch | |Biozentrum der Universitaet+-------------------------------------------+ | Klingelbergstrasse 70 | EMBnet embnet@comp.bioz.unibas.ch | |CH 4056 Basel SWITZERLAND | Switzerland gopher.embnet.unibas.ch | +---------------------------+------------- http://beta.embnet.unibas.ch/ From owner-embldatabank@net.bio.net Tue Mar 01 22:00:00 1994 Path: biosci!bloom-beacon.mit.edu!gatech!howland.reston.ans.net!pipex!zaphod.crihan.fr!jussieu.fr!univ-lyon1.fr!news From: duret@evoserv.univ-lyon1.fr (Laurent Duret) Newsgroups: bionet.molbio.embldatabank,bionet.molbio.genbank,bionet.software Subject: Re: Help searching databases = ACNUC Date: 2 Mar 1994 07:43:18 GMT Organization: Universite Claude Bernard - Lyon 1 Lines: 58 Distribution: world Message-ID: <2l1g2m$nfs@cismsun.univ-lyon1.fr> References: <2l1fhv$nfs@cismsun.univ-lyon1.fr> Reply-To: duret@evoserv.univ-lyon1.fr NNTP-Posting-Host: evoserv.univ-lyon1.fr Xref: biosci bionet.molbio.embldatabank:295 bionet.molbio.genbank:1552 bionet.software:7438 >I need some help in searching through the sequence data bases for splice >junctions. >I am trying to look at sequences next to splice junctions >but in the EXON. M. Gouy has developped a database named ACNUC that allows such request (ref). ACNUC A RETRIEVAL SYSTEM FOR GENBANK, EMBL, AND NBRF/PIR ACNUC is a retrieval system for the nucleotide sequence databases GenBank or EMBL and for the protein sequence data base NBRF/PIR. ACNUC allows to select sequences from many criteria (keyword, taxonomy, bibliography, sequence length, molecule type, organelle etc...) from these 3 data bases, to translate protein-coding genes in protein, and to extract selected sequences in user files. ACNUC is unique in providing direct access to coding regions (e.g. protein coding regions, tRNA or rRNA coding regions) of DNA fragments present in GenBank and in EMBL (introns, exon, CDS, 3'UTR, mRNA, 5'UTR, tRNA, etc... described on the FEATURES). Notably, ACNUC allows to extract fragments adjacent to the extremities of a subsequence (CDS, intron, tRNA, exon, etc...). Therefore it is possible to systematically extract, for example, 50 nt downstream of introns end of human protein encoding genes (or according to any other criteria). ACNUC is known to run on Sun (SunOs or Solaris), IBM Risc workstations, SGI computers, Dec-alpha systems, and VAX/VMS systems. It should be easily installed on most unix platforms. Contact M. Gouy for help for other unix systems. ACNUC is distributed by anonymous ftp from the internet address: biom3.univ-lyon1.fr or, numerically, 134.214.92.37 The directory there is /pub/acnuc ref: M. Gouy et al. (1985) CABIOS 3:167-172 M. Gouy et al. (1984) Nucl. Acids Res. 12:121-127 Contact = M. Gouy: mgouy@evomol.univ-lyon1.fr Laurent Duret Laboratoire de Biometrie, Genetique et Biologie des Populations URA CNRS 243 Universite Claude Bernard - Lyon I 43, Bd du 11 Novembre 1918 F-69622 Villeurbanne cedex Tel: +33 72.44.81.42 E-mail: duret@biomserv.univ-lyon1.fr From owner-embldatabank@net.bio.net Tue Mar 01 22:00:00 1994 Path: biosci!daresbury!trane.uninett.no!sunic!pipex!zaphod.crihan.fr!jussieu.fr!univ-lyon1.fr!news From: duret@evoserv.univ-lyon1.fr (Laurent Duret) Newsgroups: bionet.molbio.embldatabank Subject: Re: Help searching databases = ACNUC Date: 2 Mar 1994 07:34:23 GMT Organization: Universite Claude Bernard - Lyon 1 Lines: 55 Distribution: world Message-ID: <2l1fhv$nfs@cismsun.univ-lyon1.fr> References: <0hQpzNO00iV7A3=HJY@andrew.cmu.edu> Reply-To: duret@evoserv.univ-lyon1.fr NNTP-Posting-Host: evoserv.univ-lyon1.fr >I need some help in searching through the sequence data bases for splice >junctions. >I am trying to look at sequences next to splice junctions >but in the EXON. M. Gouy has developped a database named ACNUC that allows such request (ref). ACNUC A RETRIEVAL SYSTEM FOR GENBANK, EMBL, AND NBRF/PIR ACNUC is a retrieval system for the nucleotide sequence databases GenBank or EMBL and for the protein sequence data base NBRF/PIR. ACNUC allows to select sequences from many criteria (keyword, taxonomy, bibliography, sequence length, molecule type, organelle etc...) from these 3 data bases, to translate protein-coding genes in protein, and to extract selected sequences in user files. ACNUC is unique in providing direct access to coding regions (e.g. protein coding regions, tRNA or rRNA coding regions) of DNA fragments present in GenBank and in EMBL (introns, exon, CDS, 3'UTR, mRNA, 5'UTR, tRNA, etc... described on the FEATURES). Notably, ACNUC allows to extract fragments adjacent to the extremities of a subsequence (CDS, intron, tRNA, exon, etc...). Therefore it is possible to systematically extract, for example, 50 nt downstream of introns end of human protein encoding genes (or according to any other criteria). ACNUC is known to run on Sun (SunOs or Solaris), IBM Risc workstations, SGI computers, Dec-alpha systems, and VAX/VMS systems. It should be easily installed on most unix platforms. Contact M. Gouy for help for other unix systems. ACNUC is distributed by anonymous ftp from the internet address: biom3.univ-lyon1.fr or, numerically, 134.214.92.37 The directory there is /pub/acnuc ref: M. Gouy et al. (1985) CABIOS 3:167-172 M. Gouy et al. (1984) Nucl. Acids Res. 12:121-127 Contact = M. Gouy: mgouy@evomol.univ-lyon1.fr Laurent Duret Laboratoire de Biometrie, Genetique et Biologie des Populations URA CNRS 243 Universite Claude Bernard - Lyon I 43, Bd du 11 Novembre 1918 F-69622 Villeurbanne cedex Tel: +33 72.44.81.42 E-mail: duret@biomserv.univ-lyon1.fr From owner-embldatabank@net.bio.net Sun Mar 06 22:00:00 1994 Newsgroups: bionet.molbio.proteins,bionet.general,bionet.molbio.embldatabank,bionet.molbio.gene-linkage,bionet.molbio.swiss-prot,bionet.software Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!torn!utnut!utcsri!newsflash.concordia.ca!sifon!VM1.MCGILL.CA From: BAEV Subject: Peptide Motif Search by e-mail Message-ID: <07MAR94.17195731.0096@VM1.MCGILL.CA> Lines: 8 Sender: usenet@MUSICA.MCGILL.CA Organization: McGill University Date: Mon, 7 Mar 1994 20:55:19 GMT Xref: biosci bionet.molbio.proteins:1509 bionet.general:8144 bionet.molbio.embldatabank:297 bionet.molbio.gene-linkage:295 bionet.molbio.swiss-prot:1 bionet.software:7502 Dear colleagues...I would appreciate any suggestions on peptide motif search programs available on electronic mail (e-mail) servers around the world. Thank you in advance. Nikolai Baeff, M.D. McGill University, Canada mdnb@musica.mcgill.ca From owner-embldatabank@net.bio.net Mon Mar 07 22:00:00 1994 Path: biosci!bcm!cs.utexas.edu!uunet!netnews.jhuapl.edu!netnews.jhuapl.edu!not-for-mail From: vellani@netnews.jhuapl.edu (Thomas J. Vellani F2C x5714) Newsgroups: bionet.molbio.embldatabank Subject: subscription Date: 7 Mar 1994 23:17:11 -0500 Organization: Johns Hopkins University Applied Physics Lab Lines: 1 Message-ID: <2lgu87$g5h@aplcomm.jhuapl.edu> NNTP-Posting-Host: aplcomm.jhuapl.edu Pl From owner-embldatabank@net.bio.net Mon Mar 07 22:00:00 1994 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!gatech!news-feed-1.peachnet.edu!umn.edu!msus1.msus.edu!vax1.mankato.msus.edu!vengeance Newsgroups: bionet.molbio.embldatabank Subject: Omaha Project Message-ID: <1994Mar8.084440.2359@vax1.mankato.msus.edu> From: vengeance@vax1.mankato.msus.edu Date: 8 Mar 94 08:44:40 -0500 Organization: Mankato State University Lines: 9 I am trying to build a list of names and E-Mail addresses of people in the Omaha Nebraska area for a school related project. If you live in Omaha or go to school there or know someone that does and will be around for three months or more, please reply via E-Mail to Vengeance@vax1.mankato.msus.edu. Thank you very much! Ryan Krueger From owner-embldatabank@net.bio.net Sat Mar 12 22:00:00 1994 Newsgroups: bionet.molbio.embldatabank Path: biosci!agate!howland.reston.ans.net!vixen.cso.uiuc.edu!uwm.edu!news.doit.wisc.edu!psl.wisc.edu!news From: Rapu Lak Subject: how can I construct a subset of all the sequences? Message-ID: <1994Mar13.211036.9827@pslu1.psl.wisc.edu> X-Xxdate: Sun, 13 Mar 94 23:15:36 GMT Sender: news@pslu1.psl.wisc.edu (USENET News System) Organization: UW-Madison X-Useragent: Nuntius v1.1.1d17 Date: Sun, 13 Mar 94 21:10:36 GMT Lines: 47 This is the problem: We are interested in various questions about RNA. Many of these interests are about eukaryotic mRNA and specifically, the 3' ends, 3' UTRs, 3'-most exons and the 3'-most introns. I would like to construct a database that contains these data. But I know that I don't know how to do this. I imagine it is possible to search the entire DNA sequence database for all eukaryotic DNA sequences, and then search for ones that identify a translation STOP codon (from some annotation??), and then limit the search to those that also identify the site of the 3' most intron-exon boundary. Finally, from among these files identify those that also have a comment (annotation?) about the site of cleavage and polyadenylation. Then we would like to extract only the DNA sequence that corresponds to the last exon as well as the exon containing the translation stop codon (if they are different) and the sequence of the 3'UTR up to and including the site of cleavage and polyadenylation. So we want to identify the DNA sequence files that have this information and then create a new file that contains only the DNA sequence corresponding to the specific part of the mRNA we are interested in. I then imagine that we would have a large group of new files, each containing annotations to the site of the translation stop codon, maybe the translation reading frame, the site of cleavage and polyadenylation, .... (what else?). These files would define the database that we are interested in analyzing. Am I dreaming the impossible dream? I suppose I can ask at least one relevant question. Are there tools or some established programs for doing this kind of database search and database creation? I'd like to hear from people who have used such programs, from people who have written such programs, and from people who might be interested in trying such a program to actually create such a database for us. I would like to make contact with those of the "net" who are comfortable doing these kinds of manipulations and could possibly guide me to success. Also, what and where are the relevant FAQs to this subject/problem? Have I posted this question to the appropriate newgroup? Please reply to me directly by email and I will post a SUMMARY of what comes my way. Rock Pulak UW-Biochemistry rapulak@macc.wisc.edu From owner-embldatabank@net.bio.net Sat Mar 12 22:00:00 1994 Newsgroups: bionet.molbio.embldatabank Path: biosci!agate!howland.reston.ans.net!vixen.cso.uiuc.edu!uwm.edu!news.doit.wisc.edu!psl.wisc.edu!news From: Rapu Lak Subject: how do I construct a subset of the total DNA sequence database? Message-ID: <1994Mar13.211708.9978@pslu1.psl.wisc.edu> X-Xxdate: Sun, 13 Mar 94 23:22:08 GMT Sender: news@pslu1.psl.wisc.edu (USENET News System) Organization: UW-Madison X-Useragent: Nuntius v1.1.1d17 Date: Sun, 13 Mar 94 21:17:08 GMT Lines: 47 This is the problem: We are interested in various questions about RNA. Many of these interests are about eukaryotic mRNA and specifically, the 3' ends, 3' UTRs, 3'-most exons and the 3'-most introns. I would like to construct a database that contains these data. But I know that I don't know how to do this. I imagine it is possible to search the entire DNA sequence database for all eukaryotic DNA sequences, and then search for ones that identify a translation STOP codon (from some annotation??), and then limit the search to those that also identify the site of the 3' most intron-exon boundary. Finally, from among these files identify those that also have a comment (annotation?) about the site of cleavage and polyadenylation. Then we would like to extract only the DNA sequence that corresponds to the last exon as well as the exon containing the translation stop codon (if they are different) and the sequence of the 3'UTR up to and including the site of cleavage and polyadenylation. So we want to identify the DNA sequence files that have this information and then create a new file that contains only the DNA sequence corresponding to the specific part of the mRNA we are interested in. I then imagine that we would have a large group of new files, each containing annotations to the site of the translation stop codon, maybe the translation reading frame, the site of cleavage and polyadenylation, .... (what else?). These files would define the database that we are interested in analyzing. Am I dreaming the impossible dream? I suppose I can ask at least one relevant question. Are there tools or some established programs for doing this kind of database search and database creation? I'd like to hear from people who have used such programs, from people who have written such programs, and from people who might be interested in trying such a program to actually create such a database for us. I would like to make contact with those of the "net" who are comfortable doing these kinds of manipulations and could possibly guide me to success. Also, what and where are the relevant FAQs to this subject/problem? Have I posted this question to the appropriate newgroup? Please reply to me directly by email and I will post a SUMMARY of what comes my way. Rock Pulak UW-Biochemistry rapulak@macc.wisc.edu From owner-embldatabank@net.bio.net Sun Mar 13 22:00:00 1994 Path: biosci!bcm!news.msfc.nasa.gov!europa.eng.gtefsd.com!howland.reston.ans.net!torn!utnut!utgpu!utcsri!newsflash.concordia.ca!canopus.cc.umanitoba.ca!frist From: frist@cc.umanitoba.ca () Newsgroups: bionet.molbio.embldatabank Subject: Re: how can I construct a subset of all the sequences? Date: 14 Mar 1994 19:32:42 GMT Organization: University of Manitoba, Winnipeg, Manitoba, Canada Lines: 209 Message-ID: <2m2e4q$gds@canopus.cc.umanitoba.ca> References: <1994Mar13.211036.9827@pslu1.psl.wisc.edu> NNTP-Posting-Host: antares.cc.umanitoba.ca In article <1994Mar13.211036.9827@pslu1.psl.wisc.edu> Rapu Lak writes: >This is the problem: > >We are interested in various questions about RNA. Many of these >interests are about eukaryotic mRNA and specifically, the 3' ends, >3' UTRs, 3'-most exons and the 3'-most introns. I would like to >construct a database that contains these data. But I know that I >don't know how to do this. > This is exactly the type of task that the XYLEM package was designed to do. Fristensky B. (1994) Feature Expresssions: creating and manipulating sequence datasets. NAR 21:5997-6003. >I imagine it is possible to search the entire DNA sequence database >for all eukaryotic DNA sequences, and then search for ones that >identify a translation STOP codon (from some annotation??), and >then limit the search to those that also identify the site of the >3' most intron-exon boundary. Finally, from among these files >identify those that also have a comment (annotation?) about the >site of cleavage and polyadenylation. I'll start with the assumption that you are only interested in those GenBank entries that have the various features you have described annotated (That will be a lot fewer than you might think.) Using FINDKEY in XYLEM, you could identify entries that contain the information you need by searching for feature keys like "polyA_signal", "prim_transcript" or "3'UTR". For example, the GenBank Primate division has 466 entries containing the "3'UTR" feature key. FINDKEY will give you a list of LOCUS names, whose corresponding entries could then be retrieved by FETCH. This dataset could be further trimmed by inspection (simply delete unsuitable names from the namefile and do a fetch on your original dataset to generate a refined dataset. Another way to do this part would be to search for the same keywords by sending a request to the email server at NCBI. Then we would like to >extract only the DNA sequence that corresponds to the last exon as >well as the exon containing the translation stop codon (if they are >different) and the sequence of the 3'UTR up to and including the >site of cleavage and polyadenylation. So we want to identify the >DNA sequence files that have this information and then create a new >file that contains only the DNA sequence corresponding to the >specific part of the mRNA we are interested in. I then imagine >that we would have a large group of new files, each containing >annotations to the site of the translation stop codon, maybe the >translation reading frame, the site of cleavage and >polyadenylation, .... (what else?). These files would define the >database that we are interested in analyzing. > I'm not entirely sure what you want to do here, but here's an example of what the FEATURES program can do. Here is an abbreviated version of one of the GenBank entries retrieved from the primate division using the keyword 3'UTR: LOCUS ALOEGLOBIM 1691 bp ds-DNA PRI 10-JAN-1994 DEFINITION Alouatta seniculus epsilon-globin gene, complete cds. ACCESSION L25367 FEATURES Location/Qualifiers 5'UTR 1..144 /note="putative" exon 1..236 /number=1 /note="putative" intron 237..359 /number=1 /note="putative" exon 360..582 /number=2 /note="putative" intron 583..1391 /number=2 /note="putative" exon 1392..1691 /number=3 /note="putative" 3'UTR 1521..1691 /note="putative" source 1..1691 /organism="Alouatta seniculus" /dev_stage="adult" /sequenced_mol="DNA" /sex="female" /tissue_type="lymphocyte" CDS join(145..236,360..582,1392..1520) /note="putative; NCBI gi: 440091." /product="epsilon-globin" /codon_start=1 If you ask FEATURES to extract all 3'UTR sequences that are annotated in the dataset, you get three files: a message file, a sequence file, and an expression file. The results from the first three of the 466 entries in the dataset are shown below: message file ----------- GETOB Version 1.2 2 Jan 1994 AGMA13GT:3'UTR1 1 371 /product="alpha-1,3-galactosyltransferase" /gene="alpha-1.3GT" //---------------------------------------------- ALOA13GT:3'UTR1 1 371 /product="alpha-1,3-galactosyltransferase" /gene="alpha-1.3GT" //---------------------------------------------- ALOEGLOBIM:3'UTR1 1521 1691 /note="putative" //---------------------------------------------- sequence file ------------- >AGMA13GT:3'UTR1 tttgaggtcaagccagagaagaggtggcaacacatcagcatgatgcatgt gaagatcatcagggagcacatcttggcccacatccaacacgaggtcgact tcctcttctgcatggatgtagaccaggtcttccaagacaattttggggtg gacaccctaggccagtcagtggatcagctacagccctggtggtacaaggc agatcctgaggactttacctaggaaaggcagaaagagtcagcagcatgca ttccatttggccagggggatttttattaccacacagccatgtttggagga acacccattcaggttctcaacatcccccaggagtgctttaaaggaatcct cctggaaaagaaaaatgacat >ALOA13GT:3'UTR1 tttgaggtcaagccagagaagaggtggcaacacatctgcatgatgggtat gaagaccatcggggagcacatcttggcccacatccaacacgaggtcgact tcctcttctgcatggatgtggaccaggtcttccaagaccattttggggtg gacaccctgggccagtcagtggctcagctacaggcctggtggtacaaggc agctcctgataactttacctatgagaggcggaaacagtcggcagcatata ttccatttggccagggggatttttattaccacgcagccatttttggagga acacccattcaggttctcaacatcacccaggagtgctttaagggaatcct cctggacaagaaaaatgacat >ALOEGLOBIM:3'UTR1 gttatctcccagtttgccagtgttcctgtgaccctgacacccttcttctg cacatgaatactgggcttggccttgagaggaaggtttctgtttaataaag tacattttcttcagtaatcaaaaattgcaacttcatcttctccatcttgt actcttgtgctaaaggaaaag expression file --------------- >AGMA13GT:3'UTR1 @M73307:1..371 >ALOA13GT:3'UTR1 @M73311:1..371 >ALOEGLOBIM:3'UTR1 The message file is a log of how each feature was extracted, with accompanying qualifier lines to help in evaluation of results. The sequence file contains the region of each sequence that was extracted. The expression file is identical to the sequence file, with the exception that sequence is replaced by the expression that was evaluated to create the sequence. (The expression comes from the Feature Table). At this point, you can go through the message file and, if need be, delete unwanted sequences from the expression file. The expression file can then be run back through FEATURES to created a corrected sequence file. One of the great things about FEATURES is that even things that aren't annotated in the GenBank entries can be extracted. For example, if an entry had CDS ending at position 1028 and polyA_site annotated at position 1101, but no 3'UTR, you could create the desired sequence fragment with the expression accession#:1028..1101 Obviously, you could do the same thing to generate the exon or intron datasets you describe above. For example, re-run FEATURES on the same dataset, extracting 'exon' features. To make a 3'exon file, edit out all but the last exon for each gene in the expression file, and run the edited expression file back through FEATURES. >Please reply to me directly by email and I will post a SUMMARY of >what comes my way. > I'm posting to the newsgroup, because I think there will be many who would be interested in doing comparable things. > >Rock Pulak >UW-Biochemistry >rapulak@macc.wisc.edu I should mention that at present, FEATURES only works on GenBank flat file entries, and not on EMBL entries. XYLEM can be obtained by anonymous FTP to the directory 'psgendb' at ftp.cc.umanitoba.ca [130.179.16.24]. =============================================================================== Brian Fristensky | Department of Plant Science | A question is like a knife that slices University of Manitoba | through the stage backdrop and gives us Winnipeg, MB R3T 2N2 CANADA | a look at what lies hidden behind. frist@cc.umanitoba.ca | Office phone: 204-474-6085 | Milan Kundera, THE UNBEARABLE LIGHTNESS FAX: 204-261-5732 | OF BEING =============================================================================== From owner-embldatabank@net.bio.net Tue Mar 15 22:00:00 1994 Path: biosci!daresbury!bioftp.unibas.ch!citi2.fr!jussieu.fr!univ-lyon1.fr!swidir.switch.ch!scsing.switch.ch!sun.rediris.es!news.uam.es!anu.iib.uam.es!user From: JRValverde@Enlil.iib.uam.es (J. R. Valverde) Newsgroups: bionet.molbio.embldatabank Subject: Program to update the databases Followup-To: bionet.molbio.embldatabank Date: Wed, 16 Mar 1994 17:53:31 +0100 Organization: IIB - CSIC Lines: 12 Distribution: world Message-ID: NNTP-Posting-Host: anu.iib.uam.es Hi there, I've learned that there is a program that automatically handles the updates of the EMBL databases on VAXen with the GCG package. It seems that this program has been written to support UCX and MultiNet. I'd like to know if someone has ported the program to CMU/IP. And if not, where can I contact the authors or find the source code so that I can make the port myself. Thanks jr From owner-embldatabank@net.bio.net Fri Mar 18 22:00:00 1994 Newsgroups: bionet.software,bionet.molbio.embldatabank Path: biosci!daresbury!bioftp.unibas.ch!comp.bioz.unibas.ch!doelz From: doelz@comp.bioz.unibas.ch (Reinhard Doelz) Subject: Re: EMBL db updates Message-ID: <1994Mar19.192645.5785@comp.bioz.unibas.ch> Sender: usenet@comp.bioz.unibas.ch (NEWS transaction account) Nntp-Posting-Host: biox.embnet.unibas.ch Reply-To: doelz@urz.unibas.ch Organization: EMBnet Switzerland [BASEL] References: Date: Sat, 19 Mar 1994 19:26:45 GMT Lines: 92 Xref: biosci bionet.software:7652 bionet.molbio.embldatabank:304 In article , JRValverde@Enlil.iib.uam.es (J. R. Valverde) writes: |> Hi to you all, |> |> I've learned that there is the possibility of automatically updating |> the EMBL databases in EMBnet using a special program that handles and |> automates all file transfers. The program is called NDT and has been invented and implemented by Peter Gad, Uppsala, Swedish EMBnet node. As you are (guessing from the mail address) in Madrid, Spain, the good news for you are that the spanish EMBnet node at the Centro Nacional de Biotecnologia runs a daily updated EMBL database already. The contact is: Jose-Maria Carazo, Carazo@Samba.cnb.uam.es, Tel.: +341-585-4505 . |> |> It seems that this program is only supported for VMS systems running |> UCX or MultiNet as the TCP/IP carriers. |> Pardon me but I would like to extend your statement to a more general apology of the current developer's situation. Both Peter and myself do development on a basis of academic environments, which implies that we are not directly funded to develop software on all-of-the-possible platforms but rather are employed to make it run here and at our site. If we give it away then this is a matter of goodwill. The current zoo of operating systems you could possibly want to support is about 50. We have only about 5 configu- rations in-house. So, making a relase means to do a lot (factor 10) more validation work for a given program. This is, bluntly speaking, impossible. |> Now, my question: anyone knows if there is any version supporting the |> CMU/IP package? And if not, does anyone know where can I get (if it is |> freely available) the sources so that I can try to port the program to |> CMU/IP? |> Peter Gad is 'master of the code' and there should be only versions maintained by himself. |> If it is not available, does anyone know who the authors are and how |> can I contact them? |> The 'Nodes of EMBnet' database tells you more: --> 4. EMBNet BioInformation Resource Switzerland/ --> 1. About EMBnet/ --> 7. Index of 'The Nodes of EMBnet' database Words to search for: gad --> 1. sweden ..t BioInformation Resource Switzerland/About EMBnet/nodes/. 2. EMBnet News ..et BioInformation Resource Switzerland/About EMBnet/. Contact person(s): Peter Gad Electronic Mail contact(s): gad@perrier.embnet.se Tel.: +46-18-174016 , Fax.: +46-18-551759 Let me add a final word wrt updating: The transfer of the data is only half of the problem; as you need to integrate the data into your environment. We are currently running an EMBnet project on describing the routines of the data trans- fer procedures, and the integration work. The report will be available at the time where the project is finished. Regards Reinhard DISCLAIMER Note that the software mentioned resembles Computer Program(s) which require a license in order to be run unless stated otherwise in a state- ment codistributed with the software. The use of the program(s) was men- tioned within a specific problem or example and must not be used to con- clude that other software products cannot possibly do a similar job. -- +---------------------------+-------------------------------------------+ | Dr. Reinhard Doelz | Tel. x41 61 2672247 Fax x41 61 2672078 | | Biocomputing | electronic Mail doelz@urz.unibas.ch | |Biozentrum der Universitaet+-------------------------------------------+ | Klingelbergstrasse 70 | EMBnet embnet@comp.bioz.unibas.ch | |CH 4056 Basel SWITZERLAND | Switzerland gopher.embnet.unibas.ch | +---------------------------+------------- http://beta.embnet.unibas.ch/