From owner-embldatabank@net.bio.net Mon May 02 23:00:00 1994 Path: biosci!PC3Q.CORP.HARRIS.COM!pmc From: pmc@PC3Q.CORP.HARRIS.COM (Paul MacGyver Carman) Newsgroups: bionet.molbio.embldatabank Subject: Mailing List Date: 3 May 1994 07:30:48 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 18 Sender: daemon@net.bio.net Distribution: bionet Message-ID: <9405031014.aa20894@pc3q.pc3q.corp.harris.com> NNTP-Posting-Host: net.bio.net Would you please send more info on the Biology job/mailing list? Thanks! -Paul ******************************************************************************** * * * * Paul MacGyver Carman * He who devotes himself to learning * * Harris Corporate HQ * seeks from day to day to increase his knowledge. * * 1025 W. Nasa Blvd. MS 75 * He who devotes himself to knowing his true nature * * Melbourne, FL 32919 * seeks from day to day to diminish his doing. * * (407) 724-3205 * * * (407) 724-3888 (fax) * Lao Tzu * * pcarman@harris.com * "Tao Te Ching - The Way of Power" * * * * ******************************************************************************** From owner-embldatabank@net.bio.net Mon May 02 23:00:00 1994 Path: biosci!daresbury!trane.uninett.no!sunic!EU.net!chsun!elna.ethz.ch!usenet From: svuilleu@micro.biol.ethz.ch Newsgroups: bionet.molbio.embldatabank Subject: total number of bases? Date: 3 May 1994 19:41:02 GMT Organization: none Lines: 15 Distribution: world Message-ID: <2q69ce$ra0@elna.ethz.ch> NNTP-Posting-Host: b22-pro486-2.ethz.ch Hi all, I can't seem to find a reliable current estimate of the total number of bases in all the different sequences stored in readily accessible databases (genbank, embl...). Also, from the last genembl release, I gather there are now about 180'000 gene sequences available...Is that it? Guesses, insights and pointers? Thank you for your time Stéphane Vuilleumier Mikrobiologisches Institut ETH Zürich Switzerland svuilleu@micro.biol.ethz.ch From owner-embldatabank@net.bio.net Tue May 03 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!news.cac.psu.edu!news.tc.cornell.edu!travelers.mail.cornell.edu!cornell!batcomputer!ghost.dsi.unimi.it!univ-lyon1.fr!news From: duret@evoserv.univ-lyon1.fr (Laurent Duret) Newsgroups: bionet.molbio.embldatabank Subject: Re: total number of bases? Date: 4 May 1994 06:07:23 GMT Organization: Universite Claude Bernard - Lyon 1 Lines: 49 Distribution: world Message-ID: <2q7e2r$7f6@cismsun.univ-lyon1.fr> References: <2q69ce$ra0@elna.ethz.ch> Reply-To: duret@evoserv.univ-lyon1.fr NNTP-Posting-Host: evoserv.univ-lyon1.fr In article ra0@elna.ethz.ch, svuilleu@micro.biol.ethz.ch writes: > Hi all, > > I can't seem to find a reliable current estimate of the total > number of bases in all the different sequences stored in > readily accessible databases (genbank, embl...). Also, > from the last genembl release, I gather there are now about > 180'000 gene sequences available...Is that it? > Guesses, insights and pointers? > Thank you for your time > > Stéphane Vuilleumier > Mikrobiologisches Institut > ETH Zürich > Switzerland svuilleu@micro.biol.ethz.ch > The size of current releases of GenBank and EMBL is: GenBank Release 82 (15 April 1994): 180,589,455 bases; 169,896 sequences; EMBL Library Release 38 (March 1994): 179,346,566 bases; 171,787 sequences; The NCBI maintains a non-redundant database daily updated nr Non-redundant PDB+GBUpdate+GenBank+EmblUpdate+EMBL: 5:07 AM EDT May 3 1994: 184,980,203 bases; 173,749 sequences; For more information, you can subscribe to the NCBI newsletter: ============================================================================ For a free subscription to "NCBI News", the NCBI newsletter, send a request along with your name and postal mailing address to: info@ncbi.nlm.nih.gov ============================================================================ Laurent Duret ================================================================ Laboratoire de Biometrie, Genetique et Biologie des Populations Bat 741 - URA CNRS 243 Universite Claude Bernard - Lyon I 43, Bd du 11 Novembre 1918 69622 Villeurbanne cedex FRANCE Tel: +33 72.44.81.42 Fax: +33 78.89.27.19 E-mail: duret@biomserv.univ-lyon1.fr ================================================================ From owner-embldatabank@net.bio.net Tue May 03 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!EU.net!uknet!daresbury!not-for-mail From: Massimo Delledonne Newsgroups: bionet.molbio.embldatabank Subject: same sequence is different in EMBL and GENBANK Date: 4 May 1994 17:06:48 +0100 Lines: 75 Sender: daemon@mserv1.dl.ac.uk Distribution: bionet Message-ID: <2q8h6o$av8@mserv1.dl.ac.uk> Original-To: embl-db Hello netters, about 6 months ago we decide to amplify a protease inhibitor from soybean bowman birk family. With the GCG program I found, in the italian EMBnet node, t he sequence K01967 (GMBBI) with this title: "Soybean bowman-birk protease inhibitor, complete coding region" 13-JUN-1985 (Rel 06, Created) 22-APR-1990 (Rel. 23, Last updated, Version 1) looking at the electronic sequence and at the published sequence (Molecular clo ning and analysis of a gene coding for the Bowman-Birk protease inhibitor in so ybean. J. Biol. Chem. 259, 9883-9890 (1984)) cited in the record, I realized it was the sequence I was looking for. Then I designed the oligos to amplify the gene, but I was never able to amplify it .... I decided to try another region, may be the problem was a sequence error near the 3' of my 3' oligonucleotide (a little confusing as explanation, but don't try to improve my english .. no way) so I changed region ... result: nothing .. still not able to find any band of this about 300 bp fragment. PCR on the same DNA with primers for other protease inhibitors were ok, but Bow man-Birk..... Few months ago I've discovered the amazing world of internet, and the power of gopher .. Discovered merlot.welch.jhu.edu I found a way to go everywhere in the world without knowing any internet address ... A couple of days ago, I tried t o check for new bowman-birk sequences in genebank via gopher, and I discovered this terrible thing: 8-I Sequence number K01967 (the same of embl) name SOYCIIPI (different from GMBBI) definition: Soybean CII protease inhibitor gene, complete coding sequence PLN 1986 interesting, same number but different definition and different name ... I was sure to have found a different sequence ..... but ....never found this se quence in EMBL ... why ? ... Authors ... the same Title of the papers ...the same ... funny ... never found this sequence on tha t article .... mmmmhhhh .. interesting ...(same paper on the same volume at the same pages .... mumble mumble ... and then I've discovered the thing that made me very nervous (and that was miss ing in the EMBL sequence .... another paper: ERRATUM. Molecular cloning and analysis of a gene coding for the Bowman-Birk pr otease inhibitor in soybean. J. Biol. Chem. 260, 7806-7806 (1985) mumble mumble ... what happen? Are these the same sequence or not ? Ran to the library, got the erratum ... the original sequence was wrong :-( the gene is not a Bowman-birk gene anymore... and the sequence is very differen t at the 3' terminus of the fragment I was trying to amplify| That was the reas on| Now my question is: The GENEBANK sequence was uptade in 1986 The EMBL sequence was uptade in 1990 The GENBANK sequence is the correct one Who made the mistake ? The autors who submitted the correct version to Genbank and not to EMBL (but in this case why the EMBL sequence was updated in 1990) or: GENBANK submitted to EMBL an incorrect update ... or: EMBL made a mistake In any case I think it is really bad to have to check both the databases to be sure the sequence you are looking for is correct .... And .. how many sequences in both the databases have the same problem? Massimo Delledonne - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - %% %% Massimo Delledonne _%%%_____________________%%%_ Istituto di Genetica vegetale %%% () %% () %%% Universita' Cattolica S.C. Piacenza -ITALY- %% () ("") () %% Bitnet delle@ipcucsc ( )___%%___( ) Internet delle@imicilea.cilea.it ( ) ( ) "A wrong model is better than no model at all" (Goethe) (%%%%) From owner-embldatabank@net.bio.net Tue May 03 23:00:00 1994 Newsgroups: bionet.molbio.embldatabank Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!darwin.sura.net!fconvx.ncifcrf.gov!fcsparc6!toms From: toms@fcsparc6.ncifcrf.gov (Tom Schneider) Subject: Re: same sequence is different in EMBL and GENBANK Message-ID: Sender: usenet@ncifcrf.gov (C News) Nntp-Posting-Host: fcsparc6.ncifcrf.gov Organization: Frederick Cancer Research and Development Center References: <2q8h6o$av8@mserv1.dl.ac.uk> Distribution: bionet Date: Wed, 4 May 1994 22:01:43 GMT Lines: 30 In article <2q8h6o$av8@mserv1.dl.ac.uk> Massimo Delledonne writes: | The GENEBANK sequence was uptade in 1986 | The EMBL sequence was uptade in 1990 | The GENBANK sequence is the correct one | | Who made the mistake ? The autors who submitted the correct version to Genbank | and not to EMBL (but in this case why the EMBL sequence was updated in 1990) | or: GENBANK submitted to EMBL an incorrect update ... | or: EMBL made a mistake | | In any case I think it is really bad to have to check both the databases to be | sure the sequence you are looking for is correct .... And .. how many sequences | in both the databases have the same problem? | | Massimo Delledonne Although horrifying, this is a perfect example of one of the reasons that "federations" of databases are likely to fail horribly. EMBL and GENBANK are supposed to work closely together! What will happen when we have 50 sequence databases and they DON'T even try to work together? People will be checking one database against the other and finding errors. If a database gets a reputation for handling data poorly, won't people simply stop using it? Tom Schneider National Cancer Institute Laboratory of Mathematical Biology Frederick, Maryland 21702-1201 toms@ncifcrf.gov From owner-embldatabank@net.bio.net Wed May 04 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!newsserver.jvnc.net!raffles.technet.sg!nuscc.nus.sg!mcbtansh From: mcbtansh@leonis.nus.sg (Tan Shyh Han) Newsgroups: bionet.molbio.embldatabank Subject: Sequence of Sp1 Transcription Factor Date: 5 May 1994 04:42:39 GMT Organization: National University of Singapore Lines: 4 Message-ID: <2q9tfv$95u@nuscc.nus.sg> NNTP-Posting-Host: leonis.nus.sg X-Newsreader: TIN [version 1.2 PL0] Does anyone know the full length sequence of the Sp1 sequence? I have searched the databases but the sequence posted by Kadonaga et al only contain about 3/4 of the 3' sequence. From owner-embldatabank@net.bio.net Wed May 04 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!pipex!lyra.csx.cam.ac.uk!bjd12 From: bjd12@cus.cam.ac.uk (Ben Davis) Newsgroups: bionet.general,bionet.molbio.embldatabank,bionet.molbio.proteins,bionet.software Subject: databases search - protein size Date: 5 May 1994 11:36:17 GMT Organization: U of Cambridge, England Lines: 18 Message-ID: <2qalnh$36h@lyra.csx.cam.ac.uk> NNTP-Posting-Host: grus.cus.cam.ac.uk X-Newsreader: TIN [version 1.2 PL2] Xref: biosci bionet.general:8904 bionet.molbio.embldatabank:318 bionet.molbio.proteins:1879 bionet.software:8099 Hi I'm trying to find a way of searching databases for proteins (ideally from E.Coli) with a mass in a given range (say between 10 and 18 kDa). Anyone got any suggestions ? Ben -- ______________________________________________________________________________ Ben Davis, MRC Protein Function and Design, Cambridge, UK ______________________________________________________________________________ "They can make me do it, but they can't make me do it with dignity." From owner-embldatabank@net.bio.net Wed May 04 23:00:00 1994 Path: biosci!daresbury!trane.uninett.no!sunic!EU.net!uknet!demon!news2.sprintlink.net!news.sprintlink.net!sundog.tiac.net!usenet.elf.com!rpi!batcomputer!ghost.dsi.unimi.it!univ-lyon1.fr!news From: duret@evoserv.univ-lyon1.fr (Laurent Duret) Newsgroups: bionet.molbio.embldatabank Subject: Re: databases search - protein size Date: 5 May 1994 15:53:44 GMT Organization: Universite Claude Bernard - Lyon 1 Lines: 182 Distribution: world Message-ID: <2qb4q8$j2v@cismsun.univ-lyon1.fr> References: <2qalnh$36h@lyra.csx.cam.ac.uk> Reply-To: duret@evoserv.univ-lyon1.fr NNTP-Posting-Host: evoserv.univ-lyon1.fr In article 36h@lyra.csx.cam.ac.uk, bjd12@cus.cam.ac.uk (Ben Davis) writes: > Hi > > I'm trying to find a way of searching databases for proteins (ideally from > E.Coli) with a mass in a given range (say between 10 and 18 kDa). > > Anyone got any suggestions ? > Manolo Gouy and co-workers has written a very good software named ACNUC that allows one to make such query: - select complete coding sequences from E. coli, which length is comprised between 250-500 nt (which roughly corresponds to 10 - 18 kDa when translated in aa) and then translate them into protein. example: (lines preceded by : are those entered by the user) ////////////////////////////////////////////////////////////////////////////////// :query **** ACNUC Data Base Content **** GenBank Release 82 (15 April 1994) 180,589,455 bases; 169,896 sequences; 90,795 subsequences; 69,376 references. Software by M. Gouy & M. Jacobzone, Laboratoire de biometrie, Universite Lyon I Command? (H for command list) :select Enter your selection criteria, or H(elp) (EX: sp=homo sapiens et k=globin@) :sp=escherichia coli et t=cds et no k=partial Sequence list named LIST1 contains 3988 seqs (among which 3889 subseqs) Command? (H for command list) :modify List name, or H(elp)? [default=LIST1] You can modify this sequence list according to: 1. Confirmation/Suppression of sequences from list 2. Sequence length 3. Sequence insertion date 4. Replace subsequences by seq containing them 5. Add subsequences of seq in list Enter your choice (1-5): :2 Give your length threshold: (ex: L>200 or L<1000) :l>250 There are now 3698 sequences in list: LIST1 Command? (H for command list) :modify List name, or H(elp)? [default=LIST1] You can modify this sequence list according to: 1. Confirmation/Suppression of sequences from list 2. Sequence length 3. Sequence insertion date 4. Replace subsequences by seq containing them 5. Add subsequences of seq in list Enter your choice (1-5): :2 Give your length threshold: (ex: L>200 or L<1000) :l<500 There are now 772 sequences in list: LIST1 Command? (H for command list) :extract List name, sequence, or accession #, or H(elp)? [default=LIST1] Name of file to write extracted sequences? (or GCG) :my_file Do you want: (1) Simple extraction (2) Translate into protein and extract (3) Fragments or adjacent sequences (4) Regions defined by sequence FEATURES (5) Regions adjacent to sequence FEATURES 2 Translating and extracting CB2PIL Translating and extracting EC2MIN.ILVH Translating and extracting EC2MIN.PE8 ... Translating and extracting U01159.TRBJ Number of extracted sequences: 772 Command? (H for command list) :stop STOP: End of ACNUC retrieval program ////////////////////////// end of the example ///////////////////////////// Thus GenBank (release 82) contains 772 E. coli complete coding sequence coding for proteins which size range between 10 - 18 kDa. These sequences are saved in the file named "my_file". You can also have access and save all GenBank information attached to these sequences. Here I only have GenBank, but ACNUC is also available for EMBL and PIR-NBRF. ACNUC allows many different requests with a relatively simple query language. ACNUC is distributed by anonymous ftp from the internet address: biom3.univ-lyon1.fr or, numerically, 134.214.92.37 The directory there is /pub/acnuc I include bellow the README file provided at this FTP site. I hope this helps, Laurent Duret ================================================================ Laboratoire de Biometrie, Genetique et Biologie des Populations Bat 741 - URA CNRS 243 Universite Claude Bernard - Lyon I 43, Bd du 11 Novembre 1918 69622 Villeurbanne cedex FRANCE Tel: +33 72.44.81.42 Fax: +33 78.89.27.19 E-mail: duret@biomserv.univ-lyon1.fr ================================================================ ============================= README ================================= ACNUC A RETRIEVAL SYSTEM FOR GENBANK, EMBL, AND NBRF/PIR ACNUC is a retrieval system for the nucleotide sequence databases GenBank or EMBL and for the protein sequence data base NBRF/PIR. ACNUC is known to run on Sun (SunOs or Solaris), IBM Risc workstations, SGI computers, Dec-alpha systems, and VAX/VMS systems. It should be easily installed on most unix platforms. Contact me for help for other unix systems. ACNUC allows to select sequences from many criteria from these 3 data bases, to translate protein-coding genes in protein, and to extract selected sequences in user files. ACNUC is unique in providing direct access to coding regions (e.g. protein coding regions, tRNA or rRNA coding regions) of DNA fragments present in GenBank and in EMBL. ACNUC is distributed by anonymous ftp from the internet address: biom3.univ-lyon1.fr or, numerically, 134.214.92.37 The directory there is /pub/acnuc ACNUC is available in two different formats: 1) Interfaced with the flat files as distributed by GenBank, EMBL, and NBRF/PIR. These flat files can be obtained from the data base distribution centers by ftp, by tape, or by cd-rom. 2) (NOT FOR NBRF/PIR) Interfaced with the GCG package. If the GCG package is installed on your site, then choose format 2) above because you will not duplicate the data base on your computer. You install a new database release for the GCG package yourself. Then you proceed to ACNUC installation that will access GCG files in read-only mode. If the GCG package is not installed on your site, choose format 1) above. If the database flatfiles are not already on your site, the acnuc installation procedure provides a procedure to get these files by ftp. Flat files are accessed by ACNUC in read-only mode. ACNUC is made of: 1) a data base, that can be in one of 2 formats as said above; 2) a retrieval program, named querydiv. 3) a set of index files that are distributed by ftp by us. The retrieval program is written in FORTRAN (with a few routines written in c). ACNUC is updated at each new GenBank, EMBL, and NBRF/PIR release. ACNUC installation is described in file install_acnuc.doc. M. Gouy Laboratoire de Biometrie Universite Claude Bernard 69622 VILLEURBANNE, France +33 72.44.81.42 E-mail: mgouy@evomol.univ-lyon1.fr ==================================== end of file ================================ From owner-embldatabank@net.bio.net Thu May 05 23:00:00 1994 Path: biosci!daresbury!bioftp.unibas.ch!embl-heidelberg.de!stoehr From: stoehr@embl-heidelberg.de (Peter Stoehr) Newsgroups: bionet.molbio.embldatabank Subject: Re: same sequence is different in EMBL and GENBANK Message-ID: <1994May6.172800.171123@eros.embl-heidelberg.de> Date: 6 May 94 17:27:59 +0100 References: <2q8h6o$av8@mserv1.dl.ac.uk> Distribution: bionet Organization: European Molecular Biology Laboratory Lines: 25 In article <2q8h6o$av8@mserv1.dl.ac.uk>, Massimo Delledonne writes: > Who made the mistake ? The autors who submitted the correct version to Genbank > and not to EMBL (but in this case why the EMBL sequence was updated in 1990) > or: GENBANK submitted to EMBL an incorrect update ... > or: EMBL made a mistake > > In any case I think it is really bad to have to check both the databases to be > sure the sequence you are looking for is correct .... And .. how many sequences > in both the databases have the same problem? > > Massimo Delledonne The entry concerned K01967 has been updated today in the EMBL database using the current version from GenBank (the originator). Clearly we missed the critical update which occurred back in 1986 and apologise sincerely that this has caused you such problems. Regards, Peter Stoehr EMBL Data Library ps I am not yet sure what the update was to the EMBL entry in 1990, but it wasn't this important one. From owner-embldatabank@net.bio.net Thu May 05 23:00:00 1994 Path: biosci!JHUVM.HCF.JHU.EDU!RCARPER%JHUHYG.BITNET From: RCARPER%JHUHYG.BITNET@JHUVM.HCF.JHU.EDU (robin carper) Newsgroups: bionet.molbio.embldatabank Subject: EMBL3 sequences Date: 6 May 1994 05:07:49 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 6 Sender: daemon@net.bio.net Distribution: bionet Message-ID: <199405061207.FAA28174@net.bio.net> NNTP-Posting-Host: net.bio.net Has anyone designed primers for up and downstream of the polylinker sites in EM BL3? or does anybody have the exact sequences available? I know that the lamb da 1059 from which the EMBLs were derived should be much the same as the sequen ce for lamda posted in GenBank, but... Does anyone have reliable primers for th e flanking sides? I am trying to amplify some EMBL3 inserts and would apprecia te any info. Stratagene does not have the sequence. Thanks. From owner-embldatabank@net.bio.net Thu May 05 23:00:00 1994 Newsgroups: bionet.molbio.embldatabank,bionet.molbio.genbank Path: biosci!daresbury!bioftp.unibas.ch!embnet From: embnet@comp.bioz.unibas.ch (EMBnet Switzerland) Subject: Re: total number of bases? Message-ID: <1994May4.211607.5649@comp.bioz.unibas.ch> Organization: EMBnet Switzerland [Basel] X-Newsreader: TIN [version 1.2 PL2] References: <2q69ce$ra0@elna.ethz.ch> <2q7e2r$7f6@cismsun.univ-lyon1.fr> Date: Wed, 4 May 1994 21:16:07 GMT Lines: 96 Xref: biosci bionet.molbio.embldatabank:322 bionet.molbio.genbank:1621 ... : > I can't seem to find a reliable current estimate of the total : > number of bases in all the different sequences stored in : > readily accessible databases (genbank, embl...). Also, Stephane, the number of sequences which you have on AEOLUS (your computer running GCG) should be the following: EMBL 894 bb.seq 16665 em_ba.seq 33315 em_est.seq 5676 em_fun.seq 10873 em_in.seq 5139 em_om.seq 5462 em_or.seq 5599 em_ov.seq 967 em_ph.seq 8005 em_pl.seq 30542 em_pr.seq 19695 em_ro.seq 5318 em_sy.seq 4872 em_un.seq 15649 em_vi.seq 3116 patent.seq 171787 total GENBANK exclusion set (GENBANK 82 - EMBL 38 with GCG) 212 gb_ba.seq 356 gb_est.seq 220 gb_in.seq 97 gb_om.seq 111 gb_ov.seq 0 gb_pat.seq 1 gb_ph.seq 223 gb_pl.seq 657 gb_pr.seq 250 gb_ro.seq 66 gb_st.seq 28 gb_sy.seq 17 gb_un.seq 274 gb_vi.seq 1 gbphg.seq 2513 total and the weekly updates from EMBnet Switzerland 901 gb_new.seq - all new GENBANK not in the EMBL updates 7717 xembl.seq - all really new EMBL entries 7250 xxembl.seq - all entries updated by EMBL wrt last release I wouldn't use the basepair numbers, though, as mentioned below, for statistics as the data are based on ACCESSION numbers and therefore get you a lot of redundancies. : The size of current releases of GenBank and EMBL is: : GenBank Release 82 (15 April 1994): 180,589,455 bases; 169,896 sequences; : EMBL Library Release 38 (March 1994): 179,346,566 bases; 171,787 sequences; : The NCBI maintains a non-redundant database daily updated : nr Non-redundant PDB+GBUpdate+GenBank+EmblUpdate+EMBL: : 5:07 AM EDT May 3 1994: 184,980,203 bases; 173,749 sequences; The HASSLE server of EMBnet Switzerland recalculates a 'nr' for both proteins and DNA on a weekly basis. Last saturday we had, based on EMBL with Genbank added, and EMBL updates with Genbank updates added, slightly less than the data reported above (but this was from April 30). (specifically to Stephane) Unfortunately, the host you use runs a TCP/IP product which doesn't support HASSLE at the moment (Wollongong), but times may come where you support UCX, Multinet, or TCPware. If you need an account on the EMBnet Switzerland UNIX cluster, let me know. (for all) HASSLE is available for most flavours of UNIX and the VMS emulations of IP mentioned above. Contact us for details - both customer and server mode are supported in full source. Services within EMBnet running via HASSLE are BLAST, (T)FASTA, PROFILE and S&W search (via the Biocellerator at EMBnet Israel at Weizmann/Rehovot) and MOWSE (from EMBnet UK at Daresbury). MEDFETCH is a first SRS type gateway to ENTREz-based Swissprot, and FETCH gets database entries in GCG format. Regards Reinhard Doelz EMBnet Switzerland -- +----------------------------------+-------------------------------------+ | EMBnet SWITZERLAND | RFC embnet@comp.bioz.unibas.ch | | Biocomputing | (small) FTP and GOPHER server | From owner-embldatabank@net.bio.net Thu May 05 23:00:00 1994 Newsgroups: bionet.molbio.embldatabank Path: biosci!daresbury!bioftp.unibas.ch!doelz From: doelz@comp.bioz.unibas.ch (Reinhard Doelz) Subject: Re: same sequence is different in EMBL and GENBANK Message-ID: <1994May5.062921.10972@comp.bioz.unibas.ch> Organization: EMBnet Switzerland [Basel] X-Newsreader: TIN [version 1.2 PL2] References: <2q8h6o$av8@mserv1.dl.ac.uk> Distribution: bionet Date: Thu, 5 May 1994 06:29:21 GMT Lines: 41 Tom Schneider (toms@fcsparc6.ncifcrf.gov) wrote: ... : In article <2q8h6o$av8@mserv1.dl.ac.uk> Massimo Delledonne : writes: ... : | Who made the mistake ? The autors who submitted the correct version to Genbank ... : Although horrifying, this is a perfect example of one of the reasons that : "federations" of databases are likely to fail horribly. EMBL and GENBANK are : supposed to work closely together! What will happen when we have 50 sequence : databases and they DON'T even try to work together? People will be checking : one database against the other and finding errors. If a database gets a : reputation for handling data poorly, won't people simply stop using it? I strongly argue against this. We have now PIR versus Swissprot, Los Alamos/NCBI/EMBL, not to mention pacific rim originating sources ... We MUST make the databases work together. We'll never cope with the flood otherwise. I am scared to read that you seem to suggest doing once again a new database or even ?stop? using a database because it were poor. Can we afford, fund, pay for this? Regards Reinhard PS: We have most of the databases available worldwide and crosscheck them, e.g. genbank vs EMBL, via standard programs like 'GCG' or 'nrdb' from GCG Inc, and NCBI, resp. Counting all, we get about 20 GByte needed for this effort. Justification being, we are an EMBnet node and try to deliver what people need. Your suggestion would be to shift all that to the users? END users? It might be useful to bring up oddities as above to these newsgroups but the direct partner to report database problems should be the database vendors. I found both GENBANK and EMBL staff very helpful (special Thanks to Peter Stoehr). Ther really appreciate detailed reports. -- +---------------------------+-------------------------------------------+ | Dr. Reinhard Doelz | Tel. x41 61 2672247 Fax x41 61 2672078 | | Biocomputing | electronic Mail doelz@urz.unibas.ch | |Biozentrum der Universitaet+-------------------------------------------+ From owner-embldatabank@net.bio.net Thu May 05 23:00:00 1994 Path: biosci!agate!msuinfo!harbinger.cc.monash.edu.au!newshost.anu.edu.au!helios!ingrid From: ingrid@helios.anu.edu.au (Ingrid Jakobsen) Newsgroups: bionet.molbio.embldatabank Subject: Re: same sequence is different in EMBL and GENBANK Date: 6 May 1994 08:07:36 GMT Organization: Australian National University Lines: 49 Sender: ingrid@helios (Ingrid Jakobsen) Distribution: bionet Message-ID: <2qcts8$a2i@manuel.anu.edu.au> References: <2q8h6o$av8@mserv1.dl.ac.uk> NNTP-Posting-Host: 150.203.7.83 In article <2q8h6o$av8@mserv1.dl.ac.uk>, Massimo Delledonne writes: (Sad story deleted about EMBL and GenBank entries being diffent for the same Accession Number) |> |> Now my question is: |> |> |> |> The GENEBANK sequence was uptade in 1986 |> The EMBL sequence was uptade in 1990 |> The GENBANK sequence is the correct one |> |> Who made the mistake ? The autors who submitted the correct version to Genbank |> and not to EMBL (but in this case why the EMBL sequence was updated in 1990) |> or: GENBANK submitted to EMBL an incorrect update ... |> or: EMBL made a mistake |> |> In any case I think it is really bad to have to check both the databases to be |> sure the sequence you are looking for is correct .... And .. how many sequences |> in both the databases have the same problem? |> |> Massimo Delledonne I can sympathise totally. It has also been my experience that there are discrepancies between EMBL and GenBank, and you are quite right, you should be able to get the right answer from just one database. From what I have seen, the problem is usually with the EMBL entry. If the authors send corrections to GenBank, it is updated but EMBL isn't always, while I haven't seen corrections in EMBL not found in GenBank yet. I have also seen duplicate entries eliminated from GenBank, but kept on EMBL, and sequences withdrawn because corrections showed them to be identical to previous sequences, but retained on EMBL. So my solution in general is to stick to GenBank, and not use EMBL. I know this is a sad thing to say, but as Massimo has also found out, it just doesn't seem as up-to-date. I don't know which side of the Atlantic the problem is on: GenBank not sending information on, or EMBL not using it. Unforturnately, I still run into the problem regularly, because the "non-redundant" database for blast includes EMBL entries not on GenBank - which usually means old, erroneous sequence or duplicates of other sequences, which GenBank have obviously gone to some trouble to eliminate from their own database. Ingrid From owner-embldatabank@net.bio.net Sat May 07 23:00:00 1994 Newsgroups: bionet.molbio.embldatabank,bionet.molbio.genbank,bionet.molbio.proteins Path: biosci!daresbury!bioftp.unibas.ch!doelz From: doelz@comp.bioz.unibas.ch (Reinhard Doelz) Subject: Different entry is same sequence (Re: same sequence is different in EMBL and GENBANK) Message-ID: <1994May8.084902.4583@comp.bioz.unibas.ch> Organization: EMBnet Switzerland [Basel] X-Newsreader: TIN [version 1.2 PL2] References: <2q8h6o$av8@mserv1.dl.ac.uk> <2qcts8$a2i@manuel.anu.edu.au> Distribution: bionet Date: Sun, 8 May 1994 08:49:02 GMT Lines: 194 Xref: biosci bionet.molbio.embldatabank:325 bionet.molbio.genbank:1622 bionet.molbio.proteins:1900 My apologies... this is a bit long but try to read it carefully. Ingrid Jakobsen (ingrid@helios.anu.edu.au) wrote: : In article <2q8h6o$av8@mserv1.dl.ac.uk>, Massimo Delledonne writes: : (Sad story deleted about EMBL and GenBank entries being diffent : for the same Accession Number) ... and some other remarks deleted ... : I have also seen duplicate entries eliminated from GenBank, but kept : on EMBL, and sequences withdrawn because corrections showed them to be : identical to previous sequences, but retained on EMBL. : So my solution in general is to stick to GenBank, and not use EMBL. I know : this is a sad thing to say, but as Massimo has also found out, it just : doesn't seem as up-to-date. I don't know which side of the Atlantic the : problem is on: GenBank not sending information on, or EMBL not using it. Just as a matter of fairness, blaming anyone on examples won't help, and deducing that EMBL is bad is presumably a valued view in the states but if I claim GENBANK is bad the US wouldn't tolerate it either :-) It is that the both talk to each other on computer basis. Computer parsing programs are a mess, in particular as both databases don't agree entirely on their formats; i.e. parsing extends to mapping and voila - there are problems. The following example is an annecdote I just came accross where both databases have a duplicate. The entry GGCOL8 in EMBL (15 April 1994, updated 20-April 1994) is LOCUS CHKC1A206 (1-Jun-1984) in GENBANK. However, Entry GGCOL8 (9-Jun 1982, updated 6-Jul 1989) with LOCUS GGCOL8 (6-Jul 89) is only with one Accession number more; J00827 being the first and V00400 being the additional one. Both entries refer to a journal Cell 22, 887-892 (1980) - i.e., EMBL seems to take 14 years before they do a mistake, whereas GENBANK takes only 5 years. The sequences are entirely identical. I use the GENBANK format here to show differences: < AUTHORS Yamada,Y., Avvedimento,E.V., Mudryj,M., Ohkubo,H., Vogeli,G., > AUTHORS Yamada,Y., Avvedimento,E., Mudryj,M., Ohkubo,H., Vogeli,G., < amplification of a dna segment containing an exon of 54 bp > amplification of a DNA segment containing an exon of 54 bp I guess (or at least hope) that these are not the reason for the duplication. The problem comes in the feature table! For the sake of completion I use EMBL format here, in truncated form: FT intron <1. .8 | FT source 1. .70 FT /note="collagen | FT /organism="Gallu FT prim_transcript <1. .>70 | FT CDS 9. .62 FT /note="collagen | FT /note="exon 6" FT exon 9. .62 | FT /number=42 | FT /note="collagen | FT exon 9. .62 | FT /note="collagen | FT putative" | FT intron 63. .>70 | FT /note="collagen | FT source 1. .70 | FT /organism="Gallu | One entry says /note="collagen helipeptide, exon 42 (AA 37 to 54); and the other says /note="exon 6" --- from the SAME reference. In one entry, it tells CDS, in the other, there is no CDS. Why? Simply because in one entry there is CDS from 9 to 62, and mat_peptide in the other entry: (GENBANK format again) < mat_peptide 9..62 < /partial < /codon_start=1 < /note="collagen helipeptide, 2 (AA 37 to 54)" > CDS 9..62 > /note="exon 6; NCBI gi: 63306." > /codon_start=1 > /translation="GPQGPRGPPGPPGKAGED" So what is the difference between a mat_peptide and a CDS? The gbrel.txt from release 82 tells us CDS Sequence coding for amino acids in protein (includes stop codon) mat_peptide Mature peptide coding region (does not include stop codon) and ftable.doc from EMBL CDS Sequence coding for amino acids in protein exon Region that codes for part of spliced mRNA OK, so far the documentation; but GENBANK's precise definition is contra- dictory here as once it is _with_ and once _without_ stop codon. Well; it ist't quite so as the last three nucleotides are coding D as stated in the translation: /translation="GPQGPRGPPGPPGKAGED" I haven't analyzed this systematically but I am afraid that inconsistencies like this make database provider's life difficult. As human intervention is extremely expensive (manpower) and we (customers) don't want to pay the prediction that it will become worse in the future is a safe guess. You rely on BLAST searching? Fine. I used the peptide as described above and seqrched the 'nr' dataset which we do in-house on all protein databases available. The entry scoring Score = 108 (49.3 bits), Expect = 1.1e-08, P = 1.1e-08 Identities = 18/18 (100%), Positives = 18/18 (100%) if looked up in the result, is located at position 8 (as the only entirely matching entry - other irrelevant matches lead the score) and does NOT occur in either SWISSPROT nore PIR database, but only in PATCHX (Pfeiffer, MIPS Martinsried). Entry: patchx:M25963 ; There, we read: LOCUS CHKCOLA07 DEFINITION Chicken alpha-2 collagen gene type I gene, exons 13-15 ACCESSION M25963 SOURCE ORGANISM Gallus gallus REFERENCE 1 AUTHORS Boedtker,H., Finer,M. and Aho,S. TITLE The structure of the chicken alpha-2 collagen gene JOURNAL Ann. N. Y. Acad. Sci. 460, 85-116 (1985) FEATURES CDS join(M25956:1548. .1617,M25956:3513. .3523, M25956:4131. .4148,M25956:4783. .4818,M25959:182. .265, M25961:205. .261,M25962:609. .653,M25962:755. .808, M25962:1118. .1171,M25962:1539. .1592,M25962:2078. .2131, M25962:2345. .2398,6. .50,287. .340,439. .483) /partial /note="alpha-collagen type I;; NCBI gi: 211605." /codon_start=1 Note that there's now talking on entry M25963, with both EMBL and GENBANK versions, and this is exon 13-15, whereas the original source talked about exon 42, and exon 6, respectively. A DNA comparison reveals. Ggcol8 x M25963 May 8, 1994 10:23 .. . . . 15 CAAGGTCCTCGTGGTCCCCCTGGTCCTCCAGGAA 48 || ||| |||| |||| ||||||| ||||| 284 CAGGGTGCTCGCGGTCTCCCTGGTGAGAGAGGAA 317 Oh well, interesting... Why don't you try a BLAST at home and see ? ... on DNA? CONCLUSION ========== I think we all agree that databases are non-optimal. On the other hand, if you see those guys working, they don't feel lazy, nor do they enjoy being reminded that they do produce low-quality data. (I won't talk on proteins here but the situation there is even worse). The data need better MAINTENANCE! We could spend another XX M$ on both sides of the atlantic to have a staff of workers clean up the past, and cope with the flood of the future. But still, this wouldn't help. I think that there's something severely wrong with responsibilities. The researchers don't do what they should, namely take care of their own entries or areas, and correct the entries as appropriate. And, for the future, the genome projects should adopt slightly more responsibility for what they produce. Just dumping thousands of low-quality data entries to the databases, generated by robots, and complain afterwards doesn't help. The funding agencies must understand that a genome project is USELESS (read: wasted money) if the data are not integrated well into the data sets. The coordinators of the projects must refer from cooking their own little databases as they comlain the loudest on the unability of the general database providers. We certainly don't need hundreds of small databases but rather one set which is complete, and high quality. ?We ? Who are 'We' that we tolerate these duplications without doing something ourselves? A change in culture is needed. Regards Reinhard Doelz EMBnet Switzerland -- +---------------------------+-------------------------------------------+ | Dr. Reinhard Doelz | Tel. x41 61 2672247 Fax x41 61 2672078 | | Biocomputing | electronic Mail doelz@urz.unibas.ch | |Biozentrum der Universitaet+-------------------------------------------+ From owner-embldatabank@net.bio.net Sun May 08 23:00:00 1994 Path: biosci!agate!doc.ic.ac.uk!daresbury!bioftp.unibas.ch!embl-heidelberg.de!stoehr From: stoehr@embl-heidelberg.de (Peter Stoehr) Newsgroups: bionet.molbio.embldatabank Subject: Re: same sequence is different in EMBL and GENBANK Message-ID: <1994May9.094735.171140@eros.embl-heidelberg.de> Date: 9 May 94 09:47:35 +0100 References: <2q8h6o$av8@mserv1.dl.ac.uk> <2qcts8$a2i@manuel.anu.edu.au> Distribution: bionet Organization: European Molecular Biology Laboratory Lines: 19 In article <2qcts8$a2i@manuel.anu.edu.au>, ingrid@helios.anu.edu.au (Ingrid Jakobsen) writes: > I can sympathise totally. It has also been my experience that there are > discrepancies between EMBL and GenBank, and you are quite right, you should > be able to get the right answer from just one database. .. or at least the *same* answer. I did a quick check and find about 0.9% different, approx. 166673 out of 168107 entries with the same primary accession number are identical in NCBI-GenBank and current EMBL. I used GenBank rel. 82 so the numbers may have reduced a little since. Anyway, the total of 1434 entries which are out of synch is of course too many, and I hope we can fix these in the next few days. Regards, Peter Stoehr EMBL Data Library From owner-embldatabank@net.bio.net Sun May 08 23:00:00 1994 Newsgroups: bionet.molbio.embldatabank Path: biosci!agate!howland.reston.ans.net!europa.eng.gtefsd.com!darwin.sura.net!fconvx.ncifcrf.gov!fcsparc6!toms From: toms@fcsparc6.ncifcrf.gov (Tom Schneider) Subject: Re: same sequence is different in EMBL and GENBANK Message-ID: Sender: usenet@ncifcrf.gov (C News) Nntp-Posting-Host: fcsparc6.ncifcrf.gov Organization: Frederick Cancer Research and Development Center References: <2q8h6o$av8@mserv1.dl.ac.uk> <1994May5.062921.10972@comp.bioz.unibas.ch> Distribution: bionet Date: Mon, 9 May 1994 16:50:45 GMT Lines: 67 In article <1994May5.062921.10972@comp.bioz.unibas.ch> doelz@comp.bioz.unibas.ch (Reinhard Doelz) writes: | Tom Schneider (toms@fcsparc6.ncifcrf.gov) wrote: | ... | : In article <2q8h6o$av8@mserv1.dl.ac.uk> Massimo Delledonne | : writes: | ... | : | Who made the mistake ? The autors who submitted the correct version to Genbank | ... | : Although horrifying, this is a perfect example of one of the reasons that | : "federations" of databases are likely to fail horribly. EMBL and GENBANK are | : supposed to work closely together! What will happen when we have 50 sequence | : databases and they DON'T even try to work together? People will be checking | : one database against the other and finding errors. If a database gets a | : reputation for handling data poorly, won't people simply stop using it? | | I strongly argue against this. We have now PIR versus Swissprot, | Los Alamos/NCBI/EMBL, not to mention pacific rim originating sources ... | We MUST make the databases work together. We'll never cope with the | flood otherwise. I am scared to read that you seem to suggest doing | once again a new database or even ?stop? using a database because it were | poor. Can we afford, fund, pay for this? The GenBank advisors (of which I was one) were trying to get a unified database 10 years ago. The hope was that GenBank and EMBL could have identical formats. This was not politically possible because both sides wanted control. So the two worked together, hopefully having the same data. As we see now this hasn't worked very well. It means that people writing programs have to handle two different formats, and it means that the two databases drift apart. I was not proposing that people choose a database, but rather that many databases have chosen to work against one another rather than with each other. Instead of a single unified database we are aiming to have a database for every chromosome of every species... Under that ridiculous circumstance, the several databases which attempt to gather all the data under one format will be in competition for use by researchers use. Darwin has something to say about that. Do I like this circumstance? No. Can we afford to have a bunch of databases pulling in different directions? No. | PS: We have most of the databases available worldwide and crosscheck | them, e.g. genbank vs EMBL, via standard programs like 'GCG' or 'nrdb' | from GCG Inc, and NCBI, resp. Are you doing this and not telling the databases how to become closer to one another? If your effort at crosschecking were to be fed back into the databases you wouldn't have to do it at every release. You would also save a lot of effort by others who probably have to do the same thing. | Counting all, we get about 20 GByte needed | for this effort. Justification being, we are an EMBnet node and try | to deliver what people need. Your suggestion would be to shift all that | to the users? END users? It might be useful to bring up oddities as | above to these newsgroups but the direct partner to report database | problems should be the database vendors. I found both GENBANK and EMBL | staff very helpful (special Thanks to Peter Stoehr). Ther really appreciate | detailed reports. As you say in another posting, the end users have to become more involved. But end users cannot make the overall database consistent. Tom Schneider National Cancer Institute Laboratory of Mathematical Biology Frederick, Maryland 21702-1201 toms@ncifcrf.gov From owner-embldatabank@net.bio.net Sun May 08 23:00:00 1994 Path: biosci!agate!dog.ee.lbl.gov!ihnp4.ucsd.edu!swrinde!cs.utexas.edu!howland.reston.ans.net!pipex!doc.ic.ac.uk!daresbury!bioftp.unibas.ch!embl-heidelberg.de!stoehr From: stoehr@embl-heidelberg.de (Peter Stoehr) Newsgroups: bionet.molbio.embldatabank Subject: Re: same sequence is different in EMBL and GENBANK Message-ID: <1994May9.140233.171147@eros.embl-heidelberg.de> Date: 9 May 94 14:02:32 +0100 References: <2q8h6o$av8@mserv1.dl.ac.uk> <2qcts8$a2i@manuel.anu.edu.au> <1994May9.094735.171140@eros.embl-heidelberg.de> Distribution: bionet Organization: European Molecular Biology Laboratory Lines: 11 In article <1994May9.094735.171140@eros.embl-heidelberg.de>, stoehr@embl-heidelberg.de (Peter Stoehr) writes: > Anyway, the total of 1434 entries which are out of synch is of course too > many, and I hope we can fix these in the next few days. Sorry, I miscounted. There are 717 in error, not 1434. Regards, Peter Stoehr EMBL Data Library From owner-embldatabank@net.bio.net Sun May 08 23:00:00 1994 Newsgroups: bionet.molbio.embldatabank Path: biosci!agate!howland.reston.ans.net!pipex!doc.ic.ac.uk!daresbury!bioftp.unibas.ch!doelz From: doelz@comp.bioz.unibas.ch (Reinhard Doelz) Subject: Different entry is same sequence (Re: same sequence is different in EMBL and GENBANK) Message-ID: <1994May9.131929.1805@comp.bioz.unibas.ch> Organization: EMBnet Switzerland [Basel] X-Newsreader: TIN [version 1.2 PL2] Distribution: bionet Date: Mon, 9 May 1994 13:19:29 GMT Lines: 194 My apologies... this is a bit long but try to read it carefully. Ingrid Jakobsen (ingrid@helios.anu.edu.au) wrote: : In article <2q8h6o$av8@mserv1.dl.ac.uk>, Massimo Delledonne writes: : (Sad story deleted about EMBL and GenBank entries being diffent : for the same Accession Number) ... and some other remarks deleted ... : I have also seen duplicate entries eliminated from GenBank, but kept : on EMBL, and sequences withdrawn because corrections showed them to be : identical to previous sequences, but retained on EMBL. : So my solution in general is to stick to GenBank, and not use EMBL. I know : this is a sad thing to say, but as Massimo has also found out, it just : doesn't seem as up-to-date. I don't know which side of the Atlantic the : problem is on: GenBank not sending information on, or EMBL not using it. Just as a matter of fairness, blaming anyone on examples won't help, and deducing that EMBL is bad is presumably a valued view in the states but if I claim GENBANK is bad the US wouldn't tolerate it either :-) It is that the both talk to each other on computer basis. Computer parsing programs are a mess, in particular as both databases don't agree entirely on their formats; i.e. parsing extends to mapping and voila - there are problems. The following example is an annecdote I just came accross where both databases have a duplicate. The entry GGCOL8 in EMBL (15 April 1994, updated 20-April 1994) is LOCUS CHKC1A206 (1-Jun-1984) in GENBANK. However, Entry GGCOL8 (9-Jun 1982, updated 6-Jul 1989) with LOCUS GGCOL8 (6-Jul 89) is only with one Accession number more; J00827 being the first and V00400 being the additional one. Both entries refer to a journal Cell 22, 887-892 (1980) - i.e., EMBL seems to take 14 years before they do a mistake, whereas GENBANK takes only 5 years. The sequences are entirely identical. I use the GENBANK format here to show differences: < AUTHORS Yamada,Y., Avvedimento,E.V., Mudryj,M., Ohkubo,H., Vogeli,G., > AUTHORS Yamada,Y., Avvedimento,E., Mudryj,M., Ohkubo,H., Vogeli,G., < amplification of a dna segment containing an exon of 54 bp > amplification of a DNA segment containing an exon of 54 bp I guess (or at least hope) that these are not the reason for the duplication. The problem comes in the feature table! For the sake of completion I use EMBL format here, in truncated form: FT intron <1. .8 | FT source 1. .70 FT /note="collagen | FT /organism="Gallu FT prim_transcript <1. .>70 | FT CDS 9. .62 FT /note="collagen | FT /note="exon 6" FT exon 9. .62 | FT /number=42 | FT /note="collagen | FT exon 9. .62 | FT /note="collagen | FT putative" | FT intron 63. .>70 | FT /note="collagen | FT source 1. .70 | FT /organism="Gallu | One entry says /note="collagen helipeptide, exon 42 (AA 37 to 54); and the other says /note="exon 6" --- from the SAME reference. In one entry, it tells CDS, in the other, there is no CDS. Why? Simply because in one entry there is CDS from 9 to 62, and mat_peptide in the other entry: (GENBANK format again) < mat_peptide 9..62 < /partial < /codon_start=1 < /note="collagen helipeptide, 2 (AA 37 to 54)" > CDS 9..62 > /note="exon 6; NCBI gi: 63306." > /codon_start=1 > /translation="GPQGPRGPPGPPGKAGED" So what is the difference between a mat_peptide and a CDS? The gbrel.txt from release 82 tells us CDS Sequence coding for amino acids in protein (includes stop codon) mat_peptide Mature peptide coding region (does not include stop codon) and ftable.doc from EMBL CDS Sequence coding for amino acids in protein exon Region that codes for part of spliced mRNA OK, so far the documentation; but GENBANK's precise definition is contra- dictory here as once it is _with_ and once _without_ stop codon. Well; it ist't quite so as the last three nucleotides are coding D as stated in the translation: /translation="GPQGPRGPPGPPGKAGED" I haven't analyzed this systematically but I am afraid that inconsistencies like this make database provider's life difficult. As human intervention is extremely expensive (manpower) and we (customers) don't want to pay the prediction that it will become worse in the future is a safe guess. You rely on BLAST searching? Fine. I used the peptide as described above and seqrched the 'nr' dataset which we do in-house on all protein databases available. The entry scoring Score = 108 (49.3 bits), Expect = 1.1e-08, P = 1.1e-08 Identities = 18/18 (100%), Positives = 18/18 (100%) if looked up in the result, is located at position 8 (as the only entirely matching entry - other irrelevant matches lead the score) and does NOT occur in either SWISSPROT nore PIR database, but only in PATCHX (Pfeiffer, MIPS Martinsried). Entry: patchx:M25963 ; There, we read: LOCUS CHKCOLA07 DEFINITION Chicken alpha-2 collagen gene type I gene, exons 13-15 ACCESSION M25963 SOURCE ORGANISM Gallus gallus REFERENCE 1 AUTHORS Boedtker,H., Finer,M. and Aho,S. TITLE The structure of the chicken alpha-2 collagen gene JOURNAL Ann. N. Y. Acad. Sci. 460, 85-116 (1985) FEATURES CDS join(M25956:1548. .1617,M25956:3513. .3523, M25956:4131. .4148,M25956:4783. .4818,M25959:182. .265, M25961:205. .261,M25962:609. .653,M25962:755. .808, M25962:1118. .1171,M25962:1539. .1592,M25962:2078. .2131, M25962:2345. .2398,6. .50,287. .340,439. .483) /partial /note="alpha-collagen type I;; NCBI gi: 211605." /codon_start=1 Note that there's now talking on entry M25963, with both EMBL and GENBANK versions, and this is exon 13-15, whereas the original source talked about exon 42, and exon 6, respectively. A DNA comparison reveals. Ggcol8 x M25963 May 8, 1994 10:23 .. . . . 15 CAAGGTCCTCGTGGTCCCCCTGGTCCTCCAGGAA 48 || ||| |||| |||| ||||||| ||||| 284 CAGGGTGCTCGCGGTCTCCCTGGTGAGAGAGGAA 317 Oh well, interesting... Why don't you try a BLAST at home and see ? ... on DNA? CONCLUSION ========== I think we all agree that databases are non-optimal. On the other hand, if you see those guys working, they don't feel lazy, nor do they enjoy being reminded that they do produce low-quality data. (I won't talk on proteins here but the situation there is even worse). The data need better MAINTENANCE! We could spend another XX M$ on both sides of the atlantic to have a staff of workers clean up the past, and cope with the flood of the future. But still, this wouldn't help. I think that there's something severely wrong with responsibilities. The researchers don't do what they should, namely take care of their own entries or areas, and correct the entries as appropriate. And, for the future, the genome projects should adopt slightly more responsibility for what they produce. Just dumping thousands of low-quality data entries to the databases, generated by robots, and complain afterwards doesn't help. The funding agencies must understand that a genome project is USELESS (read: wasted money) if the data are not integrated well into the data sets. The coordinators of the projects must refer from cooking their own little databases as they comlain the loudest on the unability of the general database providers. We certainly don't need hundreds of small databases but rather one set which is complete, and high quality. ?We ? Who are 'We' that we tolerate these duplications without doing something ourselves? A change in culture is needed. Regards Reinhard Doelz EMBnet Switzerland -- +---------------------------+-------------------------------------------+ | Dr. Reinhard Doelz | Tel. x41 61 2672247 Fax x41 61 2672078 | | Biocomputing | electronic Mail doelz@urz.unibas.ch | |Biozentrum der Universitaet+-------------------------------------------+ From owner-embldatabank@net.bio.net Sun May 08 23:00:00 1994 Newsgroups: bionet.molbio.embldatabank,bionet.molbio.genbank,bionet.molbio.proteins Path: biosci!agate!library.ucla.edu!europa.eng.gtefsd.com!darwin.sura.net!fconvx.ncifcrf.gov!fcsparc6!toms From: toms@fcsparc6.ncifcrf.gov (Tom Schneider) Subject: Re: Different entry is same sequence (Re: same sequence is different in EMBL and GENBANK) Message-ID: Sender: usenet@ncifcrf.gov (C News) Nntp-Posting-Host: fcsparc6.ncifcrf.gov Organization: Frederick Cancer Research and Development Center References: <2q8h6o$av8@mserv1.dl.ac.uk> <2qcts8$a2i@manuel.anu.edu.au> <1994May8.084902.4583@comp.bioz.unibas.ch> Distribution: bionet Date: Mon, 9 May 1994 17:00:50 GMT Lines: 57 Xref: biosci bionet.molbio.embldatabank:330 bionet.molbio.genbank:1623 bionet.molbio.proteins:1906 In article <1994May8.084902.4583@comp.bioz.unibas.ch> doelz@comp.bioz.unibas.ch (Reinhard Doelz) writes: | I haven't analyzed this systematically but I am afraid that inconsistencies | like this make database provider's life difficult. It makes the database user's life extremely difficult. | As human intervention | is extremely expensive (manpower) and we (customers) don't want to pay the | prediction that it will become worse in the future is a safe guess. Yes, unless action is taken soon eventually there will be a crisis. | I think we all agree that databases are non-optimal. On the other hand, | if you see those guys working, they don't feel lazy, nor do they enjoy | being reminded that they do produce low-quality data. (I won't talk | on proteins here but the situation there is even worse). The data need | better MAINTENANCE! Yes | We could spend another XX M$ on both sides of the atlantic to have a | staff of workers clean up the past, and cope with the flood of the future. | But still, this wouldn't help. I think that there's something severely | wrong with responsibilities. The researchers don't do what they should, namely | take care of their own entries or areas, and correct the entries as appropriate. BINGO! | And, for the future, the genome projects should adopt slightly more | responsibility for what they produce. Just dumping thousands of low-quality | data entries to the databases, generated by robots, and complain afterwards | doesn't help. The funding agencies must understand that a genome project | is USELESS (read: wasted money) if the data are not integrated well into the | data sets. The coordinators of the projects must refer from cooking their | own little databases as they comlain the loudest on the unability of the | general database providers. We certainly don't need hundreds of small databases | but rather one set which is complete, and high quality. | ?We ? BINGO! | Who are 'We' that we tolerate these duplications without doing something | ourselves? A change in culture is needed. Duplication should not be tolerated, that's why it is the first principle in my database philosophy paper. (anonymous ftp from ftp.ncifcrf.gov/pub/delila/philgen* but in revision at the moment. If you would like me to tell you when the next revision is out, please send me a note.) Tom Schneider National Cancer Institute Laboratory of Mathematical Biology Frederick, Maryland 21702-1201 toms@ncifcrf.gov From owner-embldatabank@net.bio.net Mon May 09 23:00:00 1994 Path: biosci!agate!spool.mu.edu!torn!nott!uotcsi2!mgcheo.med.uottawa.ca!sbaird From: sbaird@mgcheo.med.uottawa.ca (Stephen Baird) Newsgroups: bionet.molbio.embldatabank,bionet.molbio.genbank,bionet.molbio.proteins Subject: Re: Different entry is same sequence (Re: same sequence is different in EMBL and GENBANK) Followup-To: bionet.molbio.embldatabank,bionet.molbio.genbank,bionet.molbio.proteins Date: 10 May 1994 04:11:51 GMT Organization: Department of Computer Science, University of Ottawa Lines: 34 Distribution: bionet Message-ID: <2qn1i7$l92@csi0.csi.uottawa.ca> References: <1994May8.084902.4583@comp.bioz.unibas.ch> NNTP-Posting-Host: mgcheo.med.uottawa.ca X-Newsreader: TIN [version 1.1 PL8] Xref: biosci bionet.molbio.embldatabank:331 bionet.molbio.genbank:1624 bionet.molbio.proteins:1912 Reinhard Doelz (doelz@comp.bioz.unibas.ch) wrote (with a lot deleted): : We could spend another XX M$ on both sides of the atlantic to have a : staff of workers clean up the past, and cope with the flood of the future. : But still, this wouldn't help. I think that there's something severely : wrong with responsibilities. The researchers don't do what they should, namely : take care of their own entries or areas, and correct the entries as appropriate. : And, for the future, the genome projects should adopt slightly more : responsibility for what they produce. Just dumping thousands of low-quality : data entries to the databases, generated by robots, and complain afterwards : doesn't help. : Regards : Reinhard Doelz I like the idea that researchers should be responsible for their entries in the databases (unfortunately not all of us have organized/clean/up-to-date lab benches or offices and database entries might reflect that). I was wondering what one should do when a competitor duplicates your entry or a complete cDNA is sequenced for which there is a EST database entry. How can the best sequences prevail. |--------------------------------------------------------------------| | Stephen Baird sbaird@mgcheo.med.uottawa.ca | | Molecular Genetics tel: 613-738-3925 | | Children's Hospital of Eastern Ontario fax: 613-738-4833 | | 415 Smyth Rd. | | Ottawa, Ontario | | Canada | | K1H 8M8 | |--------------------------------------------------------------------| From owner-embldatabank@net.bio.net Wed May 11 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!spool.mu.edu!umn.edu!msus1.msus.edu!vax1.mankato.msus.edu!vax1.mankato.msus.edu!nntp Newsgroups: bionet.molbio.methds-reagnts,bionet.molbio.genbank,bionet.molbio.embldatabank Subject: Sequence alignment help needed Message-ID: <1994May11.105414.5810@vax1.mankato.msus.edu> From: MOL13@VAX1.Mankato.MSUS.edu Date: Wed, 11 May 94 10:43:20 PDT Nntp-Posting-Host: 134.29.9.240 X-Newsreader: NEWTNews & Chameleon -- TCP/IP for MS Windows from NetManage MIME-Version: 1.0 Content-Type: TEXT/PLAIN; charset=US-ASCII Lines: 18 Xref: biosci bionet.molbio.methds-reagnts:14177 bionet.molbio.genbank:1627 bionet.molbio.embldatabank:332 Our group needs help in performing multiple sequence alignments of sequences for alpha and beta adrenergic receptors across a number of species. Although we have some software packages for doing this from the EMBL server, as novices using these programs we are having trouble getting any meaningful results. Our goal is to secure such data to aid us in the design of a number of PCR primer pairs. Any help would be greatly appreciated. Please E-mail me at my below address. Thanks. Mark Lyte Department of Biological Sciences Mankato State University E-mail: MOL13@VAX1.Mankato.MSUS.edu From owner-embldatabank@net.bio.net Mon May 16 23:00:00 1994 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!agate!msuinfo!harbinger.cc.monash.edu.au!newshost.anu.edu.au!helios!ingrid From: ingrid@helios.anu.edu.au (Ingrid Jakobsen) Newsgroups: bionet.molbio.embldatabank Subject: Re: Different entry is same sequence (Re: same sequence is different in EMBL and GENBANK) Date: 17 May 1994 06:44:02 GMT Organization: Australian National University Lines: 202 Sender: ingrid@helios (Ingrid Jakobsen) Distribution: bionet Message-ID: <2r9p3j$sa7@manuel.anu.edu.au> References: <1994May9.131929.1805@comp.bioz.unibas.ch> NNTP-Posting-Host: 150.203.7.83 I hope I am just being paranoid this week, but what you wrote feels somewhat like a flame, and I feel I have to defend myself in a few places. My apologies if this is all old hat now, but this post only arrived at our site yesterday: In article <1994May9.131929.1805@comp.bioz.unibas.ch>, doelz@comp.bioz.unibas.ch (Reinhard Doelz) writes: |> |> My apologies... this is a bit long but try to read it carefully. I have done that, and I get the feeling you didn't do me the courtesy of reading what I wrote carefully. My post was much shorter. |> |> Ingrid Jakobsen (ingrid@helios.anu.edu.au) wrote: |> |> : I have also seen duplicate entries eliminated from GenBank, but kept |> : on EMBL, and sequences withdrawn because corrections showed them to be |> : identical to previous sequences, but retained on EMBL. |> |> : So my solution in general is to stick to GenBank, and not use EMBL. I know |> : this is a sad thing to say, but as Massimo has also found out, it just |> : doesn't seem as up-to-date. I don't know which side of the Atlantic the |> : problem is on: GenBank not sending information on, or EMBL not using it. |> |> Just as a matter of fairness, blaming anyone on examples won't help, and I didn't blame anyone based on examples. I concluded that EMBL was less reliable than GenBank based on examples, sure, but I was careful to say that I didn't know where the blame actually lay. It may be that EMBL overall is more reliable than GenBank. In that case, I have seen a very unrepresentative sample because in every case I have seen the GenBank entry is "better" - more recently corrected or whatever. I didn't make this decision based on some idea that GenBank ought to be better, I went and chased down the original references. |> deducing that EMBL is bad is presumably a valued view in the states but |> if I claim GENBANK is bad the US wouldn't tolerate it either :-) I should point out that I am not located in the states, I am based in Australia. Most Australian researchers have no idea which database their "loyalities" should be with, EMBL or Genbank or DDBJ. I went into this with absolutely no opinion either way, as I mentioned, I reached my personal decision after considerable running to and from the library. I would also like to point out that I find the current situation with two US databases ridiculous, and I admire the fact that numerous countries can co-operate on EMBL. This is much more sensible in my opinion. |> It is that the both talk to each other on computer basis. Computer parsing |> programs are a mess, in particular as both databases don't agree entirely |> on their formats; i.e. parsing extends to mapping and voila - there are |> problems. The following example is an annecdote I just came accross where |> both databases have a duplicate. |> |> The entry GGCOL8 in EMBL (15 April 1994, updated 20-April 1994) is LOCUS |> CHKC1A206 (1-Jun-1984) in GENBANK. However, Entry GGCOL8 (9-Jun 1982, updated |> 6-Jul 1989) with LOCUS GGCOL8 (6-Jul 89) is only with one Accession number |> more; J00827 being the first and V00400 being the additional one. |> |> Both entries refer to a journal Cell 22, 887-892 (1980) - i.e., EMBL seems |> to take 14 years before they do a mistake, whereas GENBANK takes only 5 years. In other words, your opinion of the databases is also based on examples, or in fact only _one_ example. So why can't I have my opinion on the databases based on the number of examples I have seen? And I merely decided that GenBank was more reliable than EMBL, you seem to claim from one example that GenBank generally takes five years to make mistakes. I am prepared to believe that computer parsing may be the problem, I have no experience with it. It just suggests to me that we are looking at a big waste of resources with each side trying to duplicate the work of the other. I don't think the problem can be dealt with unfortunately, as I don't think either side is going to let the other become the major database provider. |> I haven't analyzed this systematically but I am afraid that inconsistencies |> like this make database provider's life difficult. As human intervention |> is extremely expensive (manpower) and we (customers) don't want to pay the |> prediction that it will become worse in the future is a safe guess. I can only agree with this. But consider the expense of the "manpower" wasted as thousands of researchers waste their time on faulty database entries, as exemplified by Massimo Delledone, whose bad experience started the whole discussion. |> |> You rely on BLAST searching? |> Fine. I used the peptide as described above and seqrched the 'nr' dataset |> which we do in-house on all protein databases available. |> |> The entry scoring |> Score = 108 (49.3 bits), Expect = 1.1e-08, P = 1.1e-08 |> Identities = 18/18 (100%), Positives = 18/18 (100%) |> |> if looked up in the result, is located at position 8 (as the only |> entirely matching entry - other irrelevant matches lead the score) The reason is that the entries were sorted by Poisson probabilities, rather than high scores, which is always a problem when searching with short sequences. As far as I can remember, that option can be reset. The leading matches incidentally are also collagen genes, which hardly makes them "irrelevant". and |> does NOT occur in either SWISSPROT nore PIR database, but only in PATCHX |> (Pfeiffer, MIPS Martinsried). Entry: patchx:M25963 ; There, we read: |> LOCUS CHKCOLA07 |> DEFINITION Chicken alpha-2 collagen gene type I gene, exons 13-15 |> ACCESSION M25963 |> SOURCE |> ORGANISM Gallus gallus |> REFERENCE 1 |> AUTHORS Boedtker,H., Finer,M. and Aho,S. |> TITLE The structure of the chicken alpha-2 collagen gene |> JOURNAL Ann. N. Y. Acad. Sci. 460, 85-116 (1985) |> FEATURES |> CDS join(M25956:1548. .1617,M25956:3513. .3523, |> M25956:4131. .4148,M25956:4783. .4818,M25959:182. .265, |> M25961:205. .261,M25962:609. .653,M25962:755. .808, |> M25962:1118. .1171,M25962:1539. .1592,M25962:2078. .2131, |> M25962:2345. .2398,6. .50,287. .340,439. .483) /partial |> /note="alpha-collagen type I;; NCBI gi: 211605." |> /codon_start=1 |> |> |> Note that there's now talking on entry M25963, with both EMBL and GENBANK |> versions, and this is exon 13-15, whereas the original source talked about |> exon 42, and exon 6, respectively. |> |> A DNA comparison reveals. |> |> Ggcol8 x M25963 May 8, 1994 10:23 .. |> |> . . . |> 15 CAAGGTCCTCGTGGTCCCCCTGGTCCTCCAGGAA 48 |> || ||| |||| |||| ||||||| ||||| |> 284 CAGGGTGCTCGCGGTCTCCCTGGTGAGAGAGGAA 317 |> |> |> Oh well, interesting... Why don't you try a BLAST at home and see ? |> ... on DNA? What are you trying to say here? I had a look at the DNA sequences and it is in fact M25962 CHKCOLA06 (which is exons 7 to 12, marginally closer to exon 6) which contains the match to GGCOL8. The reason you get M25963 in the protein search is because that is the entry that contains the amino acid translation of all the entries listed under CDS above. The PATCHX (and incidentally Genpept) use this accession number because that is the entry where the translation was put. You can find M25962 and M25963 on EMBL too, with the same notation, it just doesn't provide the translation, which might be a good thing, or a bad thing, you decide... |> |> CONCLUSION |> ========== |> |> I think we all agree that databases are non-optimal. On the other hand, |> if you see those guys working, they don't feel lazy, nor do they enjoy |> being reminded that they do produce low-quality data. (I won't talk |> on proteins here but the situation there is even worse). The data need |> better MAINTENANCE! |> We could spend another XX M$ on both sides of the atlantic to have a |> staff of workers clean up the past, and cope with the flood of the future. |> But still, this wouldn't help. I think that there's something severely |> wrong with responsibilities. The researchers don't do what they should, namely |> take care of their own entries or areas, and correct the entries as appropriate. |> And, for the future, the genome projects should adopt slightly more |> responsibility for what they produce. Just dumping thousands of low-quality |> data entries to the databases, generated by robots, and complain afterwards |> doesn't help. The funding agencies must understand that a genome project |> is USELESS (read: wasted money) if the data are not integrated well into the |> data sets. The coordinators of the projects must refer from cooking their |> own little databases as they comlain the loudest on the unability of the |> general database providers. We certainly don't need hundreds of small databases |> but rather one set which is complete, and high quality. |> ?We ? |> |> Who are 'We' that we tolerate these duplications without doing something |> ourselves? A change in culture is needed. I agree with this whole-heartedly, I think researchers should take far more responsibility for their entries than they do at the moment. It is a huge problem which I don't really want to go into here But I don't think your conclusion has anything to do with the issue being discussed here. The problem was not with authors failing to take responsibility for their data at all, but rather problems between the two databases. Many entries have problems with the notation, the authors not seeming to know what exon they've just sequenced is only one of the problems, but despite that, in most cases the actual sequences held by both databases are the same. What concerned Massimo and myself was that this is not always the case. I am heartened to see that Peter Stoer from EMBL <1994May9.094735.171140@ eros.embl-heidelberg.de> thinks it is a problem worth fixing. Thank you. Ingrid From owner-embldatabank@net.bio.net Tue May 17 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!pipex!doc.ic.ac.uk!daresbury!bioftp.unibas.ch!rc1.vub.ac.be!rc4!mphilipe From: mphilipe@rc1.vub.ac.be (Philippe M.) Newsgroups: bionet.molbio.embldatabank Subject: Different sequence is same entry Date: 18 May 1994 13:30:23 GMT Organization: Brussels Free Universities (VUB/ULB), Belgium Lines: 2 Message-ID: <2rd59f$fc1@rc1.vub.ac.be> NNTP-Posting-Host: rc4.vub.ac.be Summary: Different sequence with same number Keywords: Embl meca X-Newsreader: TIN [version 1.2 PL2] I have encountered a problem when comparing the coding sequence of the meca gene of B. subtilis (em_ba:bsmeca l06059) with the meca gene of S. aureus (em_ba:samecapb x52593). I used the software fasta. It provided two alignment results, one with the first part of the sameca sequence and one with the end of the sameca sequence. Can the problem be caused by the presence of the old as well as the revesed sequences of the sameca gene under the same id number? J.Thonnard From owner-embldatabank@net.bio.net Fri May 27 23:00:00 1994 Newsgroups: bionet.molbio.embldatabank,embnet.net-dev Path: biosci!agate!howland.reston.ans.net!xlink.net!scsing.switch.ch!swidir.switch.ch!univ-lyon1.fr!jussieu.fr!citi2.fr!bioftp.unibas.ch!doelz From: doelz@comp.bioz.unibas.ch (Reinhard Doelz) Subject: BASEL temporary downtime Message-ID: <1994May28.143220.27837@comp.bioz.unibas.ch> Organization: EMBnet Switzerland [Basel] X-Newsreader: TIN [version 1.2 PL2] Date: Sat, 28 May 1994 14:32:20 GMT Lines: 14 Due to testing of the emergency power plant the services of Basel University are interrupted at WEDNESDAY, June 1st, 1994 2:00 - 6:00 pm MDT EMBnet Switzerland services (Interactive login, HASSLE, GOPHER, WWW, FTP) are unavailable at this time. We apologize for the inconvenience. -- +---------------------------+-------------------------------------------+ | Dr. Reinhard Doelz | Tel. x41 61 2672247 Fax x41 61 2672078 | | Biocomputing | electronic Mail doelz@urz.unibas.ch | |Biozentrum der Universitaet+-------------------------------------------+