From owner-genbankb@hgmp.mrc.ac.uk Fri Mar 3 03:49:59 2000 Return-Path: Received: by mercury.hgmp.mrc.ac.uk (Postfix, from userid 110) id A4C5E17B05; Fri, 3 Mar 2000 03:49:58 +0000 (GMT) Received: by mercury.hgmp.mrc.ac.uk (Postfix, from userid 1) id 2B4D417AF0; Fri, 3 Mar 2000 03:49:56 +0000 (GMT) To: genbank@net.bio.net Newsgroups: bionet.molbio.genbank Date: 3 Mar 2000 03:41:30 -0000 From: Mark Cavanaugh Subject: GenBank Release 116.0 Available Message-Id: <20000303034956.2B4D417AF0@mercury.hgmp.mrc.ac.uk> Sender: owner-genbankb@hgmp.mrc.ac.uk Precedence: bulk GenBank Release 116.0 is now available via ftp from the National Center for Biotechnology Information: Ftp Site Directory Contents ---------------- --------- --------------------------------------- ncbi.nlm.nih.gov genbank GenBank Release 116.0 flatfiles ncbi-asn1 ASN.1 data used to create Release 116.0 Uncompressed, the Release 116.0 flatfiles require roughly 21350 MB (sequence files only) or 23300 MB (including the 'index' files). The ASN.1 version requires roughly 17967 MB. From the release notes: Release Date Base Pairs Entries 115 Dec 1999 4653932745 5354511 116 Feb 2000 5805414935 5691170 In the nine-week period between close-of-data for GenBank 115.0 and GenBank 116.0, GenBank grew by a record 1.151 billion basepairs. Close-of-data was 02/18/2000. Thirteen days were required to prepare this release. An unfortunate combination of events (production problems through the second week of February, followed by machine and disk crashes) has delayed 116.0 by two weeks. But the release date remains "February 15", chiefly as a convenience for recording growth stats. PLEASE NOTE: The author-name index file (gbaut.idx) for GenBank 116.0 will not be available until the middle of next week, due to software problems that arose today. Rather than delay GB 116.0 even further, we are making the release available without the index file. Our apologies for any inconvenience that this causes. For additional release information, see the README files in either of the directories mentioned above, and the release notes (gbrel.txt) in the genbank directory. Sections 1.3 and 1.4 of the release notes (Changes in Release 116.0 and Upcoming Changes) have been appended below. Release 116.0 data are currently available via NCBI's Entrez and Blast servers, and the 'query' email server. New GenBank cumulative update files (gbcu.flat.Z and gbcu.aso.Z), containing only those entries new/updated since the Release 116.0 close-of-data, should be available by 6:00am EST, March 3. Please note that the new CUs will be smaller than previous versions you might have obtained after Release 115.0 was posted. If you encounter problems while ftp'ing or uncompressing Release 116.0, please send email outlining your difficulties to info@ncbi.nlm.nih.gov . Mark Cavanaugh GenBank NCBI/NLM/NIH 1.3 Important Changes in Release 116.0 1.3.1 Organizational changes Due to database growth, the EST division is now being split into forty-seven pieces. Due to database growth, the GSS division is now being split into sixteen pieces. Due to database growth, the HTG division is now being split into fourteen pieces. Due to database growth, the PRI division is now being split into five pieces. 1.3.2 Replacement of organelle-related qualifiers with /organelle Starting with GenBank Release 116.0 (February, 2000), the various organelle-related qualifiers (/mitochondrion, /chromoplast, /chloroplast, /kinetoplast, etc) have been been incorporated into a single new qualifier, with a controlled value format. The definition of this qualifier is as follows: Qualifier /organelle="" Definition type of membrane-bound intracellular structure from which the sequence was obtained Value format mitochondrion, nucleomorph, plastid, mitochondrion:kinetoplast, plastid:chloroplast, plastid:apicoplast, plastid:chromoplast, plastid:cyanelle, plastid:leucoplast, plastid:proplastid Examples /organelle="mitochondrion" /organelle="nucleomorph" /organelle="plastid" /organelle="mitochondrion:kinetoplast" /organelle="plastid:chloroplast" /organelle="plastid:apicoplast" /organelle="plastid:chromoplast" /organelle="plastid:cyanelle" /organelle="plastid:leucoplast" /organelle="plastid:proplastid" Comments modifier text limited to values from controlled list Reminder: complete Feature Table documentation is available at this URL: http://www.ncbi.nlm.nih.gov/collab/FT/index.html 1.4 Upcoming Changes 1.4.1 Selenocysteine representation Selenocysteine residues within the protein translations of coding region features have been represented in GenBank via the letter 'X' and a /transl_except qualifier. At the May collaborative meeting, it was learned that IUPAC plans to adopt the letter 'U' for selenocysteine. DDBJ, EMBL, and GenBank will thus use this new amino acid abbreviation for its /translation qualifiers. Although a timetable for its appearance has not been finalized, we are mentioning this now because the introduction of a new residue abbreviation is a fairly fundamental change. If conversion efforts go smoothly, the new selenocysteine abbreviation will appear within a few months. Details about the use of 'U' will be made available via these release notes and the GenBank newsgroup as they become available. 1.4.2 Mutation and Allele features to be discontinued Agreement was reached at the May 1999 collaborative DDBJ/EMBL/GenBank meeting that the functionality provided by the variation, mutation, and allele features could be represented by just a single feature, variation. Submittors of sequence data are now being encouraged to use just the variation feature. With GenBank Release 117.0, all existing mutation and allele features will be converted to variation, and then mutation and allele features will no longer be legal feature keys. 1.4.3 VRL division will be split into multiple files The viral GenBank division (gbvrl.seq) will soon be split into multiple files, since its size is approaching 300MB. This is likely to occur by GenBank Release 117.0 (April 2000). The resulting files for VRL will be: gbvrl1.seq and gbvrl2.seq . 1.4.4 New REFERENCE type for on-line journals Agreement was reached at the May 1999 collaborative DDBJ/EMBL/GenBank meeting that an effort should be made to accomodate references which are published only on-line. Until specifications for such references are available from library organizations, GenBank will present them in a manner like this: REFERENCE 1 (bases 1 to 2858) AUTHORS Smith, J. TITLE Cloning and expression of a phospholipase gene JOURNAL Online Publication REMARK Online-Journal-name; Article Identifier; URL This format is still tentative; additional information about this new reference type will be made available via these release notes. --- - gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc - - GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/ - GENBANKB e-mail: messages sent to genbankb@net.bio.net - subscribe: e-mail biosci-server@net.bio.net with: subscribe genbankb - unsub: e-mail biosci-server@net.bio.net with: unsubscribe genbankb - GenBank on the WWW, see: http://www.ncbi.nlm.nih.gov/Genbank/ - problems with GENBANKB? E-mail moderator: francis@cmmt.ubc.ca From owner-genbankb@hgmp.mrc.ac.uk Mon Mar 6 23:35:24 2000 Return-Path: Received: by mercury.hgmp.mrc.ac.uk (Postfix, from userid 110) id D5DB717ACA; Mon, 6 Mar 2000 23:35:23 +0000 (GMT) Received: by mercury.hgmp.mrc.ac.uk (Postfix, from userid 1) id 13EEB17AC1; Mon, 6 Mar 2000 23:35:21 +0000 (GMT) To: genbank@net.bio.net Newsgroups: bionet.molbio.genbank Date: 6 Mar 2000 21:11:40 -0000 From: Mark Cavanaugh Subject: GB 116.0 : Corrupt ASN.1 file : gss1.aso.Z Message-Id: <20000306233521.13EEB17AC1@mercury.hgmp.mrc.ac.uk> Sender: owner-genbankb@hgmp.mrc.ac.uk Precedence: bulk The compressed version of one of the ASN.1 files used to build GenBank 116.0 was corrupted during a disk crash. No indication of failure was returned during the file's compression; so it was assumed to be intact and was installed on NCBI's ftp site last week. The problem manifests itself if you run NCBI's ASN.1 syntax checker on the file. EG: zcat gss1.aso.Z | asntool -m /some/path/to/asn.all -d stdin -t Bioseq-set [asntool] FATAL ERROR: stdinInput Bioseq-set.seq-set.E.seq.descr.E. Expected 00 after tag for comment [asntool] FATAL ERROR: stdinInput Bioseq-set.seq-set.E.seq.descr.E. Unable to match element in .E. We replaced the corrupted gss1.aso.Z with a new version at 4:10pm EST on Monday, March 6. Our apologies for any inconvenience that this might have caused. Mark Cavanaugh GenBank NCBI/NLM/NIH --- - gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc - - GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/ - GENBANKB e-mail: messages sent to genbankb@net.bio.net - subscribe: e-mail biosci-server@net.bio.net with: subscribe genbankb - unsub: e-mail biosci-server@net.bio.net with: unsubscribe genbankb - GenBank on the WWW, see: http://www.ncbi.nlm.nih.gov/Genbank/ - problems with GENBANKB? E-mail moderator: francis@cmmt.ubc.ca From owner-genbankb@hgmp.mrc.ac.uk Thu Mar 9 00:31:08 2000 Return-Path: Received: by mercury.hgmp.mrc.ac.uk (Postfix, from userid 110) id 5C75117B2C; Thu, 9 Mar 2000 00:31:07 +0000 (GMT) Received: by mercury.hgmp.mrc.ac.uk (Postfix, from userid 1) id F40A417B24; Thu, 9 Mar 2000 00:31:04 +0000 (GMT) To: genbank@net.bio.net Newsgroups: bionet.molbio.genbank Date: Wed, 8 Mar 2000 16:21:40 -0500 (EST) From: Tatiana Tatusov Subject: Chlamydia complete genomes Message-Id: <20000309003104.F40A417B24@mercury.hgmp.mrc.ac.uk> Sender: owner-genbankb@hgmp.mrc.ac.uk Precedence: bulk Complete genomes of Chlamydia muridarum (Chlamydia trachomatis MoPn) and Chlamydophila pneumoniae AR39 (synonym: Chlamydia pneumoniae AR39) have been published. AUTHORS Read,T.D., Brunham,R.C., Shen,C., Gill,S.R., Heidelberg,J.F., White,O., Hickey,E.K., Peterson,J., Utterback,T., Berry,K., Bass,S., Linher,K., Weidman,J., Khouri,H., Craven,B., Bowman,C., Dodson,R., Gwinn,M., Nelson,W., DeBoy,R., Kolonay,J., McClarty,G., Salzberg,S.L., Eisen,J. and Fraser,C.M. TITLE Genome sequences of Chlamydia trachomatis MoPn and C. pneumoniae AR39 JOURNAL Nucleic Acids Res. 28, 1397-1406 (2000) Sequence data can be found at NCBI ftp site: ftp://ncbi.nlm.nih.gov/genbank/genomes/bacteria/CtraM/ ftp://ncbi.nlm.nih.gov/genbank/genomes/bacteria/CpneuA --------------------- Tatiana Tatusova, PhD National Center for Biotechnology Information National Library of Medicine National Institutes of Health Bethesda, MD 20894, USA Voice: (301)435-5756 Fax: (301)480-9241 email tatiana@ncbi.nlm.nih.gov --- - gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc - - GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/ - GENBANKB e-mail: messages sent to genbankb@net.bio.net - subscribe: e-mail biosci-server@net.bio.net with: subscribe genbankb - unsub: e-mail biosci-server@net.bio.net with: unsubscribe genbankb - GenBank on the WWW, see: http://www.ncbi.nlm.nih.gov/Genbank/ - problems with GENBANKB? E-mail moderator: francis@cmmt.ubc.ca From owner-genbankb@hgmp.mrc.ac.uk Fri Mar 31 22:56:27 2000 Return-Path: Received: by mercury.hgmp.mrc.ac.uk (Postfix, from userid 110) id 870E417B2A; Fri, 31 Mar 2000 22:56:26 +0100 (BST) Received: by mercury.hgmp.mrc.ac.uk (Postfix, from userid 1) id 6777F17B21; Fri, 31 Mar 2000 22:56:25 +0100 (BST) To: genbank@net.bio.net Newsgroups: bionet.molbio.genbank Date: 31 Mar 2000 17:55:49 +0100 From: Mark Cavanaugh Subject: GenBank : Error in GbUpdate file nc0331.flat Message-Id: <20000331215625.6777F17B21@mercury.hgmp.mrc.ac.uk> Sender: owner-genbankb@hgmp.mrc.ac.uk Precedence: bulk Greetings GenBank Users, GenBank Update file nc0331.flat.Z, installed on NCBI's ftp server at 03:34am (EST) on March 31, 2000, contained a truncated record: LOCUS AP001552 150120 bp DNA PLN 30-MAR-2000 DEFINITION Oryza sativa geneomic DNA, chromosome 1, PAC clone:P0029D06. ACCESSION AP001552 VERSION AP001552.1 GI:7363267 .... 79861 gtaaaatgag aaaacaaaaa tatattgctt ctgtttcgtt tgactttttt cttagtcaat 79921 gttttttaga tttgactaag tttatagaaa caatggcaat atttaaaaca ctaaLOCUS AC022333 173907 bp DNA PRI 30-MAR-2000 DEFINITION Homo sapiens Chr3 NOVECTOR RP11-64O13 () complete sequence. ACCESSION AC022333 This problem has been fixed, and a new patched version of nc0331.flat.Z was installed at 11:42am (EST) on March 31. The ASN.1 version of the update (nc0331.aso.Z) was not affected. If your processing of this update was incomplete due to the truncated record, we suggest that you obtain the new version of the file and re-process. Our apologies for any inconvenience that this data error has caused. Mark Cavanaugh GenBank NCBI/NLM/NIH --- - gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc - - GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/ - GENBANKB e-mail: messages sent to genbankb@net.bio.net - subscribe: e-mail biosci-server@net.bio.net with: subscribe genbankb - unsub: e-mail biosci-server@net.bio.net with: unsubscribe genbankb - GenBank on the WWW, see: http://www.ncbi.nlm.nih.gov/Genbank/ - problems with GENBANKB? E-mail moderator: francis@cmmt.ubc.ca