From owner-genbankb@hgmp.mrc.ac.uk  Thu Sep  5 10:38:19 2002
Return-Path: <owner-genbankb@hgmp.mrc.ac.uk>
Received: from localhost (localhost [127.0.0.1])
	by mercury.hgmp.mrc.ac.uk (Postfix) with SMTP id 4CEA217C4F
	for <genbankb-outgoing>; Thu,  5 Sep 2002 10:38:18 +0100 (BST)
Received: from localhost (localhost [127.0.0.1])
	by mercury.hgmp.mrc.ac.uk (Postfix) with ESMTP id AB97517C51
	for <genbankb-list@hgmp.mrc.ac.uk>; Thu,  5 Sep 2002 10:38:15 +0100 (BST)
Received: by mercury.hgmp.mrc.ac.uk (Postfix, from userid 60001)
	id AE53F17C4E; Thu,  5 Sep 2002 10:38:11 +0100 (BST)
To: genbank@net.bio.net
Newsgroups: bionet.molbio.genbank
Date: 4 Sep 2002 21:19:52 +0100
From: Mark Cavanaugh <cavanaug@ncbi.nlm.nih.gov>
Subject: Corrupted File : gbcon.aso : GB 131.0
Message-Id: <20020905093811.AE53F17C4E@mercury.hgmp.mrc.ac.uk>
X-Razor-id: 730eef0cbc89e531a2f98a461b5a1e0148ddfc57
Sender: owner-genbankb@hgmp.mrc.ac.uk
Precedence: bulk

Greetings GenBank Users,

The ASN.1 version of the CON division for GenBank Release 131.0 :

	ftp://ftp.ncbi.nih.gov/ncbi-asn1/gbcon.aso.gz

was corrupt. NCBI Toolkit applications processing this file would have
coredumped, or reported errors similar to :

	FATAL ERROR: gbcon.asoInput
	Bioseq-set.seq-set.E.seq.inst.hist.assembly.E.<type>

As yet we do not know the cause of the corruption, but we suspect
a bad disk (hardware fault).

A repaired version of gbcon.aso.gz was installed on our FTP site
at 4:12pm EDT on Wednesday, September 4, 2002.

Thus far we have not discovered any other corrupted files. But if
this changes, we will make additional announcements and repairs.

Our apologies for any inconvenience that this has caused.

Mark Cavanaugh
GenBank
NCBI/NCBI/NLM

---


- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/       
- GENBANKB e-mail: messages sent to genbankb@net.bio.net
- subscribe: e-mail biosci-server@net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server@net.bio.net with: unsubscribe genbankb      
- GenBank on the WWW, see:  http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis@cmmt.ubc.ca                  



From owner-genbankb@hgmp.mrc.ac.uk  Thu Sep  5 10:38:36 2002
Return-Path: <owner-genbankb@hgmp.mrc.ac.uk>
Received: from localhost (localhost [127.0.0.1])
	by mercury.hgmp.mrc.ac.uk (Postfix) with SMTP id 0D46317BE9
	for <genbankb-outgoing>; Thu,  5 Sep 2002 10:38:35 +0100 (BST)
Received: from localhost (localhost [127.0.0.1])
	by mercury.hgmp.mrc.ac.uk (Postfix) with ESMTP id C1DC417C4E
	for <genbankb-list@hgmp.mrc.ac.uk>; Thu,  5 Sep 2002 10:38:25 +0100 (BST)
Received: by mercury.hgmp.mrc.ac.uk (Postfix, from userid 60001)
	id CD48D17BE9; Thu,  5 Sep 2002 10:38:06 +0100 (BST)
To: genbank@net.bio.net
Newsgroups: bionet.molbio.genbank
Date: 30 Aug 2002 22:48:07 +0100
From: Mark Cavanaugh <cavanaug@ncbi.nlm.nih.gov>
Subject: GenBank Release 131.0 Now Available
Message-Id: <20020905093806.CD48D17BE9@mercury.hgmp.mrc.ac.uk>
X-Razor-id: 3c882c0d8d8a090d9ca1852558a614c8133f4c6c
Sender: owner-genbankb@hgmp.mrc.ac.uk
Precedence: bulk

Greetings GenBank Users,

  GenBank Release 131.0 is now available via ftp from the National Center
for Biotechnology Information (NCBI):

  Ftp Site           Directory   Contents
  ----------------   ---------   ---------------------------------------
  ftp.ncbi.nih.gov   genbank     GenBank Release 131.0 flatfiles
                     ncbi-asn1   ASN.1 data used to create Release 131.0

  Uncompressed, the Release 131.0 flatfiles require roughly 74.82 GB
(sequence files only) or 83.65 GB (including the 'short directory' and
'index' files).  The ASN.1 version requires roughly 65.92 GB. From the
release notes:

   Release  Date       Base Pairs   Entries

   130      Jun 2002   20648748345  17471130
   131      Aug 2002   22616937182  18197119

  Close-of-data was 08/23/2002. Six working days were required to prepare
this release. In the nine-week period between close-of-data for GenBank
releases 130.0 and 131.0, GenBank grew by 1.968 billion basepairs and by
725,989 sequence records. During that same period, 221,216 records were
updated. Combined, this yields an average of about 14,800 new/updated
records per day.

  We would like to remind our users that GenBank mirrors are available
at ftp://genbank.sdsc.edu/pub and ftp://bio-mirror.net/biomirror/genbank .
Those who experience slow FTP transfers of large files (entire releases, the
GenBank Cumulative Update, etc) might realize an improvement in transfer
rates from these alternate sites when traffic at the NCBI is heavy.

  For additional release information, see the README files in either of the
directories mentioned above, and the release notes (gbrel.txt) in the
genbank directory. Sections 1.3 and 1.4 of the release notes (Changes in
Release 131.0 and Upcoming Changes) have been appended below.

  Release 131.0 data, and subsequent updates, are available now via NCBI's
Entrez and Blast services.

  New GenBank cumulative update files (gbcu.flat.Z and gbcu.aso.Z), containing
only those entries new/updated since the Release 131.0 close-of-data, should be
available by 10:00am EDT, August 31. Please note that the new CUs will be
smaller than previous versions you might have obtained after Release 130.0 was
posted.

  If you encounter problems while ftp'ing or uncompressing Release 131.0,
please send email outlining your difficulties to info@ncbi.nlm.nih.gov .

Mark Cavanaugh, Vladimir Alekseyev, Anton Butanaev
GenBank
NCBI/NLM/NIH


1.3 Important Changes in Release 131.0

1.3.1 Organizational changes

  Due to database growth, the EST division is now being split into 178 pieces.

  Due to database growth, the GSS division is now being split into 52 pieces.

  Due to database growth, the HTG division is now being split into 43 pieces.

  Due to database growth, the PRI division is now being split into 22 pieces.

  Due to database growth, the ROD division is now being split into 4 pieces.

1.3.2 GSS File Header Problem

  GSS sequences at GenBank are maintained in one of two different systems,
depending on their origin. One recent change to release processing involves
the parallelization of the dumps from those systems. Because the second dump
(for example) has no prior knowledge of exactly how many GSS files will be
dumped from the first, it doesn't know how to number it's own output files.
There is thus a discrepancy between the filenames and file headers of eight
GSS flatfiles in Release 131.0. Consider the gbgss45.seq file:

GBGSS1.SEQ           Genetic Sequence Data Bank
                           August 15 2002

                NCBI-GenBank Flat File Release 131.0

                           GSS Sequences (Part 1)

  Here, the filename and part number in the header is "1", though the file
has been renamed as "45" based on the files dumped from the other system.
We will work to resolve this discrepancy in future releases, but the priority
is admittedly much lower than many other tasks.

1.3.3 Selenocysteine representation

  At the May 1999 DDBJ/EMBL/GenBank collaborative meeting, it was learned
that IUPAC plans to adopt the letter 'U' for selenocysteine.

  With this August 2002 release, selenocysteine residues are now presented
via residue abbreviation 'U', in both /translation and /transl_except
qualifiers.

1.4 Upcoming Changes

1.4.1 Change to the SOURCE and ORGANISM format

The GenBank flatfile format utilizes two different formats for the SOURCE
linetype, depending on the existence of a designated common name in the
GenBank Taxonomy Database -

   --- Current GenBank format ---

SOURCE    [organism name] OR [common name]
ORGANISM  [organelle prefix] organism name

Starting with GenBank release 132.0 in October 2002, a new more flexible
SOURCE format will be adopted, allowing for the display of several types
of secondary names (common names, acronyms, synonyms, anamorphs for the fungi)
which can be derived either from the taxonomy database *or* from the source
feature annotation provided by the submitter.

In addition, the optional organelle prefix will move from the ORGANISM line 
(in the old format) to the SOURCE line in the new format. The ORGANISM line
will contain only the unadorned organism name, the name by which a sequence
entry is indexed in the taxonomy database.

   --- NEW GenBank format ---

SOURCE    [organelle prefix] organism name ([optional second name])
ORGANISM  organism name

The optional second name can be one of the following (ordered by precedence) -

  'synonym' from the source feature organism modifiers (submitter-supplied)
  'acronym' from the source feature organism modifiers (submitter-supplied)
  'anamorph' from the source feature organism modifiers (submitter-supplied)
  'common' from the source feature organism modifiers (submitter-supplied)

  'genbank synonym' from the taxonomy database
  'genbank acronmym' from the taxonomy database
  'genbank anamorph' from the taxonomy database
  'genbank common name' from the taxonomy database

The first set allows us to customize the flatfiles of particular entries,
the last allow us to add useful & informative information from the
taxonomy database (with a more reasonable presentation than in the
current flatfiles).

The 'anamorph' names will appear within parentheses prefixed with
(anamorph: ---). The 'common name', 'acronym' and 'synonym' fields will be 
parenthesized without a prefix (see examples below).

The SOURCE line organelle prefix will correspond to the most detailed portion
of the string value for the /organelle qualifier of the source feature. This
allows us to annotate everything with the correct general terms, yet prominently
display the familiar 'Chloroplast' & 'Kinetoplast' :

  organelle qualifer            SOURCE organelle prefix
  -----------------             -----------------------
  "plastid"                     plastid
  "mitochondrion"               mitochondrion
  "nucleomorph"                 nucleomorph
  "mitochondrion: kinetoplast"  kinetoplast
  "plastid: chloroplast"        chloroplast
  "plastid: apicoplast"         apicoplast
  "plastid: chromoplast"        chromoplast
  "plastid: cyanelle"           cyanelle
  "plastid: leucoplast"         leucoplast
  "plastid: protoplast"         protoplast

=======================================================
======          Examples of the new format       ======
=======================================================

In all of the examples below, the source feature qualifiers given
in the first part of the example will automatically generate the
SOURCE & ORGANISM lines shown:

------------------------

  /organism="Sus scrofa"

SOURCE      Sus scrofa (pig)
ORGANISM    Sus scrofa

'pig' is the genbank common name from the GenBank taxonomy database.

------------------------

  /organism="Sus scrofa"
  /note="common: Japanese wild boar"

SOURCE      Sus scrofa (Japanese wild boar)
ORGANISM    Sus scrofa

The common name from the source feature (submittor-suppllied) for
the entry overrides the common name from the GenBank taxonomy database
with the new SOURCE format.

------------------------

  /organism="Takifugu rubripes"

SOURCE       Takifugu rubripes (Fugu rubripes)
ORGANISM     Takifugu rubripes

'genbank synonym' from the taxonomy database is displayed on the SOURCE
line.

------------------------

  /organism="Takifugu rubripes"
  /note="common: Sydney's pufferfish"

SOURCE       Takifugu rubripes (Sydney's pufferfish)
ORGANISM     Takifugu rubripes

Any of the customizing fields from the entry itself take precedence
over the default values from the taxonomy database.

------------------------

  /organism="Cauliflower mosaic virus"

SOURCE       Cauliflower mosaic virus (CaMV)
ORGANISM     Cauliflower mosaic virus

If there is a single acronym listed in the taxonomy database,
it will appear on the SOURCE line.

------------------------

'genbank anamorph' (from the taxonomy database) 

  /organism="Emericella nidulans"

SOURCE       Emericella nidulans (anamorph: Aspergillus nidulans)
ORGANISM     Emericella nidulans

The 'anamorph' nametype is prefixed with "anamorph:" on the SOURCE line
to distinguish it from a taxonomic synonym.

------------------------

  /organism="Mytilus californicus"
  /organelle="mitochondrion"

SOURCE       mitochondrion Mytilus californicus (California mussel)
ORGANISM     Mytilus californicus

Organelle prefix moved to SOURCE, with common name from the
GenBank taxonomy database.

Additional information about this change will be presented via the
GenBank release notes, and via the GenBank newsgroup.


---


- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/       
- GENBANKB e-mail: messages sent to genbankb@net.bio.net
- subscribe: e-mail biosci-server@net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server@net.bio.net with: unsubscribe genbankb      
- GenBank on the WWW, see:  http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis@cmmt.ubc.ca                  



