From owner-genbankb@hgmp.mrc.ac.uk Wed Jul 2 22:21:52 2003 Return-Path: X-Original-To: genbankb-outgoing Received: from localhost (localhost [127.0.0.1]) by mercury.hgmp.mrc.ac.uk (Postfix) with SMTP id 9A83F7D187 for ; Wed, 2 Jul 2003 22:21:52 +0100 (BST) X-Original-To: genbankb-list@hgmp.mrc.ac.uk Received: from localhost (localhost [127.0.0.1]) by mercury.hgmp.mrc.ac.uk (Postfix) with ESMTP id 2DEBD7D24D for ; Wed, 2 Jul 2003 22:21:52 +0100 (BST) Received: by mercury.hgmp.mrc.ac.uk (Postfix, from userid 60001) id 4D0407D187; Wed, 2 Jul 2003 22:21:51 +0100 (BST) To: genbank@net.bio.net Newsgroups: bionet.molbio.genbank Date: 2 Jul 2003 22:04:09 +0100 From: "Pruitt, Kim (NIH/NLM/NCBI)" Subject: Announcing RefSeq Release 1 Message-Id: <20030702212151.4D0407D187@mercury.hgmp.mrc.ac.uk> Sender: owner-genbankb@hgmp.mrc.ac.uk Precedence: bulk This announcement is being provided to the GenBank newsgroup because of the high likelihood that GenBank users will have interest in the RefSeq database product. **************************** ANNOUNCING: RefSeq Release 1 **************************** RefSeq Release 1, the first full release of all NCBI RefSeq records, is now available by anonymous FTP at: ftp://ftp.ncbi.nih.gov/RefSeq/release/ The NCBI RefSeq project is an ongoing effort to provide a curated, non-redundant collection of reference sequences, representative of the central dogma (genomes, transcripts, protein), for each major organism. This first release includes all of the sequence data that we have collected at this time. Although the RefSeq collection is not yet complete, its value as a non-redundant dataset has reached a level that justifies providing full releases. This full release, Release 1, incorporates genomic, transcript, and protein data available as of June 30, 2003 and includes over 785,000 proteins and sequences from 2005 different organisms. The release is provided in several directories as a complete dataset and also as divided by logical groupings. The number of species represented in each Release sub-directory, determined by counting distinct tax IDs, is as follows: complete 2005 fungi 27 invertebrate 80 microbial 334 mitochondrion 417 plant 30 plasmid 36 plastid 31 protozoa 39 vertebrate_mammalian 74 vertebrate_other 206 viral 1179 The total number of accessions and length (number of nucleotides or amino acids, per type of molecule, is as follows: Type Accessions Length ------------------------------------------ Genomic: 64729 4339114280 RNA: 211803 333757669 Protein: 785143 263588685 RefSeq Release 1 is available by anonymous FTP at: ftp://ftp.ncbi.nih.gov/RefSeq/release/ Release notes documenting the scope and contents of the release are provided at: ftp://ftp.ncbi.nih.gov/RefSeq/release/release-notes/ A catalog documenting the contents of the release is available at: ftp://ftp.ncbi.nih.gov/RefSeq/release/release-catalog/ Release statistics are available at: ftp://ftp.ncbi.nih.gov/RefSeq/release/release-statistics/ Additional information about the RefSeq project is available at: 1. The NCBI RefSeq Web Site: http://www.ncbi.nih.gov/RefSeq/ 2. The NCBI Handbook The Reference Sequence (RefSeq) Project. Available from: http://www.ncbi.nih.gov/entrez/query.fcgi?db=Books Please send questions, comments, and suggestions concerning the RefSeq release or the RefSeq project to: info@ncbi.nlm.nih.gov --- - gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc - - GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/ - GENBANKB e-mail: messages sent to genbankb@net.bio.net - subscribe: e-mail biosci-server@net.bio.net with: subscribe genbankb - unsub: e-mail biosci-server@net.bio.net with: unsubscribe genbankb - GenBank on the WWW, see: http://www.ncbi.nlm.nih.gov/Genbank/ - problems with GENBANKB? E-mail moderator: francis@cmmt.ubc.ca From owner-genbankb@hgmp.mrc.ac.uk Thu Jul 3 03:18:06 2003 Return-Path: X-Original-To: genbankb-outgoing Received: from localhost (localhost [127.0.0.1]) by mercury.hgmp.mrc.ac.uk (Postfix) with SMTP id 0EBB97D1C5 for ; Thu, 3 Jul 2003 03:18:06 +0100 (BST) X-Original-To: genbankb-list@hgmp.mrc.ac.uk Received: from localhost (localhost [127.0.0.1]) by mercury.hgmp.mrc.ac.uk (Postfix) with ESMTP id A50007D1E2 for ; Thu, 3 Jul 2003 03:18:05 +0100 (BST) Received: by mercury.hgmp.mrc.ac.uk (Postfix, from userid 60001) id 837E47D1C5; Thu, 3 Jul 2003 03:18:04 +0100 (BST) To: genbank@net.bio.net Newsgroups: bionet.molbio.genbank Date: 3 Jul 2003 01:25:39 +0100 From: "Pruitt, Kim (NIH/NLM/NCBI)" Subject: FW: Announcing RefSeq Release 1 Message-Id: <20030703021804.837E47D1C5@mercury.hgmp.mrc.ac.uk> Sender: owner-genbankb@hgmp.mrc.ac.uk Precedence: bulk Correction: There is a typo in the FTP site links, the correct URL is: ftp://ftp.ncbi.nih.gov/refseq/release/ ^^^^^^ all lower case Sorry for any inconvenience this may have caused. -----Original Message----- To: 'genbankb@net.bio.net' Sent: 7/2/2003 5:03 PM Subject: Announcing RefSeq Release 1 This announcement is being provided to the GenBank newsgroup because of the high likelihood that GenBank users will have interest in the RefSeq database product. **************************** ANNOUNCING: RefSeq Release 1 **************************** RefSeq Release 1, the first full release of all NCBI RefSeq records, is now available by anonymous FTP at: ftp://ftp.ncbi.nih.gov/RefSeq/release/ The NCBI RefSeq project is an ongoing effort to provide a curated, non-redundant collection of reference sequences, representative of the central dogma (genomes, transcripts, protein), for each major organism. This first release includes all of the sequence data that we have collected at this time. Although the RefSeq collection is not yet complete, its value as a non-redundant dataset has reached a level that justifies providing full releases. This full release, Release 1, incorporates genomic, transcript, and protein data available as of June 30, 2003 and includes over 785,000 proteins and sequences from 2005 different organisms. The release is provided in several directories as a complete dataset and also as divided by logical groupings. The number of species represented in each Release sub-directory, determined by counting distinct tax IDs, is as follows: complete 2005 fungi 27 invertebrate 80 microbial 334 mitochondrion 417 plant 30 plasmid 36 plastid 31 protozoa 39 vertebrate_mammalian 74 vertebrate_other 206 viral 1179 The total number of accessions and length (number of nucleotides or amino acids, per type of molecule, is as follows: Type Accessions Length ------------------------------------------ Genomic: 64729 4339114280 RNA: 211803 333757669 Protein: 785143 263588685 RefSeq Release 1 is available by anonymous FTP at: ftp://ftp.ncbi.nih.gov/RefSeq/release/ Release notes documenting the scope and contents of the release are provided at: ftp://ftp.ncbi.nih.gov/RefSeq/release/release-notes/ A catalog documenting the contents of the release is available at: ftp://ftp.ncbi.nih.gov/RefSeq/release/release-catalog/ Release statistics are available at: ftp://ftp.ncbi.nih.gov/RefSeq/release/release-statistics/ Additional information about the RefSeq project is available at: 1. The NCBI RefSeq Web Site: http://www.ncbi.nih.gov/RefSeq/ 2. The NCBI Handbook The Reference Sequence (RefSeq) Project. Available from: http://www.ncbi.nih.gov/entrez/query.fcgi?db=Books Please send questions, comments, and suggestions concerning the RefSeq release or the RefSeq project to: info@ncbi.nlm.nih.gov --- - gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc - - GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/ - GENBANKB e-mail: messages sent to genbankb@net.bio.net - subscribe: e-mail biosci-server@net.bio.net with: subscribe genbankb - unsub: e-mail biosci-server@net.bio.net with: unsubscribe genbankb - GenBank on the WWW, see: http://www.ncbi.nlm.nih.gov/Genbank/ - problems with GENBANKB? E-mail moderator: francis@cmmt.ubc.ca From owner-genbankb@hgmp.mrc.ac.uk Fri Jul 4 05:07:19 2003 Return-Path: X-Original-To: genbankb-outgoing Received: from localhost (localhost [127.0.0.1]) by mercury.hgmp.mrc.ac.uk (Postfix) with SMTP id B65E57D0C9 for ; Fri, 4 Jul 2003 05:07:18 +0100 (BST) X-Original-To: genbankb-list@hgmp.mrc.ac.uk Received: from localhost (localhost [127.0.0.1]) by mercury.hgmp.mrc.ac.uk (Postfix) with ESMTP id 51C5F7D10A for ; Fri, 4 Jul 2003 05:07:18 +0100 (BST) Received: by mercury.hgmp.mrc.ac.uk (Postfix, from userid 60001) id A06C97D0C9; Fri, 4 Jul 2003 05:07:17 +0100 (BST) To: genbank@net.bio.net Newsgroups: bionet.molbio.genbank Date: 3 Jul 2003 22:44:42 +0100 From: Mark Cavanaugh Subject: Missing Sequence Versions in nc0630 GenBank Update files Message-Id: <20030704040717.A06C97D0C9@mercury.hgmp.mrc.ac.uk> Sender: owner-genbankb@hgmp.mrc.ac.uk Precedence: bulk Greetings GenBank Users, The ASN.1 and GenBank flatfile versions of the 0630 GenBank Incremental Update (GIU) : ftp://ftp.ncbi.nih.gov/ncbi-asn1/nc0630.aso.gz ftp://ftp.ncbi.nih.gov/genbank/nc0630.flat.gz contain 128 sequence records which lack sequence version numbers. For example, from the 0630 flatfile : LOCUS AY208508 1140 bp DNA linear VRT 26-JUN-2003 DEFINITION Amphiprion akallopisos isolate stri-x-1578 cytochrome b gene, complete cds; mitochondrial gene for mitochondrial product. ACCESSION AY208508 VERSION AY208508 GI:32263642 ^^^ Normally, a sequence version number is appended after the accession number on the VERSION line. This problem was addressed on 6/30. The nc0701 GIU's made available on the following day contain repaired versions of the 128 records. For example: LOCUS AY208508 1140 bp DNA linear VRT 30-JUN-2003 DEFINITION Amphiprion akallopisos isolate stri-x-1578 cytochrome b gene, complete cds; mitochondrial gene for mitochondrial product. ACCESSION AY208508 VERSION AY208508.1 GI:32263642 The cause of this error is related to recent changes in how NCBI stores hold-until-publish sequence records. When the HUP-dates for these 128 sequences expired, they were incompletely processed (no sequence version assigned), and yet they were included in our 0630 products. This problem has also been addressed. We regret any inconvenience that the missing sequence version numbers may have caused for our users. Mark Cavanaugh GenBank NCBI/NLM/NIH --- - gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc - - GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/ - GENBANKB e-mail: messages sent to genbankb@net.bio.net - subscribe: e-mail biosci-server@net.bio.net with: subscribe genbankb - unsub: e-mail biosci-server@net.bio.net with: unsubscribe genbankb - GenBank on the WWW, see: http://www.ncbi.nlm.nih.gov/Genbank/ - problems with GENBANKB? E-mail moderator: francis@cmmt.ubc.ca