From owner-genome-program@net.bio.net Fri Sep 02 23:00:00 1994 Newsgroups: bionet.molbio.genbank,bionet.molbio.embldatabank,bionet.molbio.genome-program,bionet.molbio.proteins Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!spool.mu.edu!darwin.sura.net!fconvx.ncifcrf.gov!fcsparc6!toms From: toms@fcsparc6.ncifcrf.gov (Tom Schneider) Subject: Re: BCM Sequence Annotation Web Server Message-ID: Sender: usenet@ncifcrf.gov (C News) Nntp-Posting-Host: fcsparc6.ncifcrf.gov Organization: Frederick Cancer Research and Development Center References: <1994Aug31.142529.4040@emba.uvm.edu> Date: Fri, 2 Sep 1994 23:59:29 GMT Lines: 46 Xref: biosci bionet.molbio.genbank:1737 bionet.molbio.embldatabank:362 bionet.molbio.genome-program:925 bionet.molbio.proteins:2587 In article rsmith@dot.bcm.tmc.edu (Randall Smith) writes: | : Announcing a new WWW Server: The BCM Sequence Annotation Server | : URL: http://dot.imgen.bcm.tmc.edu:9331/seq-annot/home.html This idea has both good and bad points and I think that they should be considered extremely carefully. First, the idea that individual researchers should be able to update a database directly is wonderful. If everybody were to do that to the data they are experts on, GenBank would quickly become a clean database. However, there are several problems: 1. Corruption of the data either intentionally or inadvertently. The authors already are aware of this possibility. 2. Inconsistency between researchers. The NCBI attempts to make entries uniform by certain standards, but individual researchers cannot know what these are in detail. The only solutions I see are to force the kinds of annotations to follow certain forms or to pass all the changes to experts for editing. The trouble with passing the data to experts is that the number of experts has to grow exponentially along with the growth of the database. Maybe we just have to accept that to avoid a worse mess! 2. Do the data flow into GenBank? There is no indication that it will. This means that if GenBank makes a correction it won't go into this database and vice versa. Since the data are not maintained in one place, it is duplicated and will eventually become inconsistent. Who should or will a researcher believe? A randomly annotated database or the "official" one? How will inconsistencies be resolved? I see this as an experiment. Once the experiment has been shown to work reasonably well, all the data should be passed to NCBI for careful processing along with all new data. That is, the server should be run by NCBI or closely in conjunction with them. For my reasoning behind this posting, see the philosophy paper available from: http://fconvx.ncifcrf.gov:2001/~toms/onlinepapers.html Tom Schneider National Cancer Institute Laboratory of Mathematical Biology Frederick, Maryland 21702-1201 toms@ncifcrf.gov From owner-genome-program@net.bio.net Tue Sep 06 23:00:00 1994 Path: biosci!agate!cat.cis.Brown.EDU!news2.near.net!news.delphi.com!usenet From: genethics Newsgroups: bionet.molbio.genome-program Subject: Re: GenEthics Date: Wed, 7 Sep 94 01:23:21 -0500 Organization: Delphi (info@delphi.com email, 800-695-4005 voice) Lines: 3 Message-ID: References: <9408300240.AA06670@hes.unity.ncsu.edu> NNTP-Posting-Host: bos1d.delphi.com X-To: I would appreciate any references you may have on the effect of elimination of deleterious genes. thank you and may your genes be good. Hans Goerl From owner-genome-program@net.bio.net Tue Sep 06 23:00:00 1994 Path: biosci!HOH.MBL.EDU!mriley From: mriley@HOH.MBL.EDU ("Monica Riley") Newsgroups: bionet.molbio.genome-program Subject: E. coli Genome Meeting Date: 7 Sep 1994 14:31:56 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 34 Sender: daemon@net.bio.net Distribution: world Message-ID: <20229.mriley@hoh.mbl.edu> NNTP-Posting-Host: net.bio.net >Second Announcement: Third International E. coli Genome Meeting > >The Third International E. coli Genome Meeting will be held November >4-8, 1994, at the Marine Biological Laboratory in Woods Hole, >Massachusetts. This Meeting will include invited talks, poster >sessions, and workshops analyzing the E. coli genome at the genetic, >sequence, and structural levels with the goal being to facilitate a >coordinated structure/function analysis of the genome. > >Specific topics will include: status reports on large-scale sequence >efforts; genome mapping technologies; applications of sequence >analysis; genome organization, rearrangements; interrelationships and >demonstrations of databases; global regulatory mechanisms; repeated >sequences; evolutionary origin of genes. > >Speakers will be: A. Bairoch, M. Berlyn, F. Blattner, M. Borodovsky, A. >Campbell, G.Church, A. Danchin, B. Demple, R. Doolittle, B. Hall, M. >Hofnung, K.Isono, P. Karp, E. Kofoid, C. Kurland, S. Letovsky, R. Milkman, >J.Miller, M. O'Neill, J. Ostell, G. Perriere, M. Riley, R. Robbins, S. >Rosenberg, J. Roth, K. Rudd, R. Schleif, T. Schneider, P. Sharp, R. >Van Bogelen, B. Wanner, G. Weinstock, T. Whittam. > >There will be two concurrent sessions of posters and database/software >demonstrations. Poster abstracts or short descriptions of the >database/software you wish to demonstrate should be submitted by >September 26, 1994. > >Advance registration is requested; deadline is September 26, 1994. >For registration materials please send your name and address to: >Conference Services, P.O. Box 477, Woods Hole, MA 02543-0477, phone >508-540-6055, fax 508-540-0155, e-mail confserv@mbl.edu > >Meeting Organizers: M. Riley (Woods Hole), J. Miller (UCLA), P. Sharp >(Nottingham), P. Karp (SRI), and M. Berlyn (Yale). From owner-genome-program@net.bio.net Wed Sep 07 23:00:00 1994 Path: biosci!DB.TORONTO.EDU!bonner From: bonner@DB.TORONTO.EDU (Anthony Bonner) Newsgroups: bionet.molbio.genome-program Subject: map assembly software Date: 8 Sep 1994 13:06:42 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 10 Sender: daemon@net.bio.net Distribution: world Message-ID: <94Sep8.160631edt.205300@twist.db.toronto.edu> NNTP-Posting-Host: net.bio.net I am looking software to assemble physical maps from partial digest data. The digest fragments are labeled, so we know the order of the restriction cut sites. Is software for assembling such maps available on the net? --Anthony Bonner Dept of Computer Science University of Toronto From owner-genome-program@net.bio.net Thu Sep 08 23:00:00 1994 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!torn!nott!nrcnet0.nrc.ca!biologym54.lan.nrc.ca!hogue From: hogue@biologym54.lan.nrc.ca (Hogue, Christopher) Newsgroups: bionet.molbio.genome-program Subject: Looking For C. elegans chrom III people... Date: 9 Sep 1994 20:41:55 GMT Organization: National Research Council of Canada Lines: 31 Message-ID: NNTP-Posting-Host: 132.246.164.78 I'm trying to locate Robert Waterston/J. Kirsten/R. Wilson regarding a specific C. elegans sequence they submitted to Genbank, ID 5000727 described as "similar to tryptophanyl- tRNA synthetase" Submitted June of 94. I'm also trying to locate K Robinson who deposited sequence 467165 to Genbank. If anyone can e-mail me information on how to contact one or all of these people I would be grateful. Christopher Hogue NRC-IBS Building M54 Montreal Rd. Ottawa Ont. Canada K1A 0R6 (613)-993-5304. hogue@biologym54.lan.nrc.ca || ai473@freenet.carelton.ca From owner-genome-program@net.bio.net Thu Sep 08 23:00:00 1994 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!vixen.cso.uiuc.edu!newsfeed.ksu.ksu.edu!moe.ksu.ksu.edu!crcnis1.unl.edu!unlinfo.unl.edu!gwright From: gwright@unlinfo.unl.edu (gregg wright) Newsgroups: bionet.molbio.genome-program Subject: School Genetic Policy Symposium Date: 9 Sep 1994 20:00:00 GMT Organization: University of Nebraska--Lincoln Lines: 103 Message-ID: <34qes0$eph@crcnis1.unl.edu> NNTP-Posting-Host: unlinfo.unl.edu Summary: Announcing Nov 18-9 Symposium on School Genetic Policy Keywords: ELSI Schools Policy Genetics X-Newsreader: TIN [version 1.2 PL2] / *** / *** PREPARING SCHOOLS FOR THE GENETIC REVOLUTION ************* ********++*** A Symposium Sponsored by ********++*** The University of Nebraska *********** Center on Children, Families, and the Law ********* and the Cooper Foundation of Lincoln ***^*** November 18-19, 1994 in Lincoln, Nebraska ***-A-*** **-G-C-** Advances in genetic knowledge and technology will ***-T-*** affect every institution of society. How will schools *** *** respond to increased genetic information? Will they ***** deal with the resulting ethical, legal, and social *** *** issues? Can we help them prepare? ***-A-*** **-G-C-** This symposium brings together nationally known ***-T-*** scholars from biology, medicine, law, education, ethics, *** *** sociology, & parent advocacy to address these important ***** questions. It is intended for anyone who is interested *** *** in the challenges of school policy or of the human genome. ***-T-*** **-T-A-** Speakers and topics include: ***-G-*** *** *** Lee Hood, M.D., Ph.D., University of Washington ***** HGI: Challenge to Science and Society *** *** ***-C-*** Sanford Dornbusch, Ph.D., Stanford University **-C-G-** Effort, Ability, Genetics, and Schools ***-T-*** *** *** Peter Cortese, Dr.PH, Centers for Disease Control ***** Policy Lessons from H.I.V. *** *** ***-A-*** Julie Beckett, M.A., Parent Advocate, Univ. of Iowa **-C-G-** Genetic Decision Making:A Parent's Perspective ***-T-*** *** *** Troy Duster, Ph.D., Univ. of California, Berkeley ***** From Reductionism to Emergence *** *** ***-G-*** Marque-Luisa Miringoff, Ph.D., Vassar College **-A-T-** Labels and Institutionalized Stigmatism ***-G-*** *** *** Jeff Murray, M.D., University of Iowa ***** High School HGI:Science/Social Policy Concerns / Ruth Purtilo, Ph.D., Creighton University *** / *** Lessons from Medical Ethics ************* ********++*** Laura Rothstein, J.D., University of Houston ********++*** How Genetics May Change School Law ************* *********** David Smith, Ph.D., University of South Carolina ********* Eugenics and Social Responsibility ***^*** ----8<-------------------------cut here-----------------------8<---- Name:________________________________________ To register, Address:_____________________________________ send this form City: _______________________________________ with check to State: ___________________ Zip: ____________ address below: Phone: ______________________________________ Fax:_________________________________________ Institution/Agency: ______________________________________________ Specialty/Position: ______________________________________________ REGISTRATION FEE IS $35.00 FOR BOTH DAYS, $20.00 FOR ONE DAY Registration includes a luncheon each day. Make check payable to: Center on Children, Families, and the Law Mail to: Symposium Registration Center on Children, Families, and the Law University of Nebraska 121 South 13th Street Suite 302 Lincoln, NE 68588-0227 Additional information will be sent with your confirmation. For more information, call (402) 472-3479 or send e-mail to gwright@unlinfo.unl.edu For Hotel Reservations: write: Ramada Hotel and Conference Center 141 No. 9th Street Lincoln, NE 68508 Attention: Reservation or call: (800) 432-0002 rate: $47.00 single/$52.00 double Let hotel know you will be attending "Preparing Schools for the Genetic Revolution" ------------------------------------------------------------------------ From owner-genome-program@net.bio.net Sat Sep 10 23:00:00 1994 Newsgroups: bionet.molbio.genome-program Path: biosci!lhc!borduas!francis From: francis@borduas.nlm.nih.gov (Francis Ouellette) Subject: Re: Looking For C. elegans chrom III people... Message-ID: <1994Sep11.192337.9983@nlm.nih.gov> Sender: news@nlm.nih.gov Organization: National Library of Medicine X-Newsreader: TIN [version 1.2 PL2] References: Date: Sun, 11 Sep 94 19:23:37 GMT Lines: 57 Hogue, Christopher (hogue@biologym54.lan.nrc.ca) wrote: > I'm trying to locate > Robert Waterston/J. Kirsten/R. Wilson > regarding a specific C. elegans sequence > they submitted to Genbank, ID 5000727 try: ------------------------------------------------------- alias: ROBERT-WATERSTON name: WATERSTON, ROBERT H email: RW@NEMATODE.wustl.edu phone: (314) 362-2657 address: Campus Box 8232 department: GENETICS-INSTRUCTION AND RESEARC title: JAMES S. MCDONNELL PROF. OF GENETICS type: University Employee ------------------------------------------------------- alias: JENNIFER-KIRSTEN name: KIRSTEN, JENNIFER MARY email: JENNY@ELEGANS.WUSTL.EDU phone: (314) 286-1819 address: Campus Box 8501 department: GENETICS-INSTRUCTION AND RESEARC title: MED RESEARCH TECHNOLOGIST ------------------------------------------------------- alias: RICHARD-WILSON name: WILSON, RICHARD K. email: RICK@GENEMAN.WUSTL.EDU phone: (314) 286-1804 address: Campus Box 8501 department: GENETICS-INSTRUCTION AND RESEARC title: RESRCH ASST PROF OF GENETICS type: University Employee > I'm also trying to locate K Robinson > who deposited sequence 467165 to > Genbank. Keith Robison Harvard University Department of Cellular and Developmental Biology Department of Genetics / HHMI krobison@mito.harvard.edu all the best, francis -- | B.F. Francis Ouellette | | francis@ncbi.nlm.nih.gov From owner-genome-program@net.bio.net Sun Sep 11 23:00:00 1994 Path: biosci!agate!cat.cis.Brown.EDU!news2.near.net!das-news.harvard.edu!husc-news.harvard.edu!golgi!robison Newsgroups: bionet.molbio.genome-program Subject: Re: Looking For C. elegans chrom III people... Message-ID: <1994Sep11.231009.34699@hulaw1.harvard.edu> From: robison@golgi.harvard.edu (Keith Robison) Date: 11 Sep 94 23:10:08 EDT References: Nntp-Posting-Host: golgi.harvard.edu X-Newsreader: TIN [version 1.2 PL2] Lines: 47 Hogue, Christopher (hogue@biologym54.lan.nrc.ca) wrote: : I'm trying to locate : Robert Waterston/J. Kirsten/R. Wilson : regarding a specific C. elegans sequence : they submitted to Genbank, ID 5000727 : described as : "similar to tryptophanyl- : tRNA synthetase" They are all part of the Washington University (St.Louis) C.elegans sequencing center. Two major publications describing their sequencing effort have appeared in Nature, one last spring (April or May). : I'm also trying to locate K Robinson : who deposited sequence 467165 to : Genbank. I'm a lot easier to find if the name is spelled correctly!!! (Sorry, pet peeve). Questions regarding this sequence (as well as all of the other Mycobacterium sequences with my name attached) should be directed to Doug Smith at Genome Therapeutics Inc. (formerly Collaborative Research Inc), who heads the sequencing unit which generated this data. He can be found at smith@cr.cric.com. Please feel free to CC informatics and similarity questions to me. : If anyone can e-mail me information on how to contact one or all of these : people I would be grateful. : Christopher Hogue : NRC-IBS Building M54 Montreal Rd. Ottawa Ont. Canada K1A 0R6 : (613)-993-5304. : hogue@biologym54.lan.nrc.ca || ai473@freenet.carelton.ca Keith Robison Harvard University Department of Cellular and Developmental Biology Department of Genetics / HHMI robison@mito.harvard.edu From owner-genome-program@net.bio.net Sun Sep 11 23:00:00 1994 Path: biosci!VTBIT.CC.VT.EDU!CCP3128%SAKAAU03.BITNET From: CCP3128%SAKAAU03.BITNET@VTBIT.CC.VT.EDU Newsgroups: bionet.molbio.genome-program Subject: help Date: 12 Sep 1994 07:26:10 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 1 Sender: daemon@net.bio.net Distribution: world Message-ID: <199409121426.HAA15015@net.bio.net> NNTP-Posting-Host: net.bio.net subscribe gnome+pr abed al-akkad From owner-genome-program@net.bio.net Sun Sep 11 23:00:00 1994 Path: biosci!daresbury!trane.uninett.no!eunet.no!nuug!EU.net!Germany.EU.net!news.dfn.de!urmel.informatik.rwth-aachen.de!news.rhrz.uni-bonn.de!usenet From: allera@mailer.meb.uni-bonn.de Newsgroups: bionet.molbio.genbank,bionet.molbio.embldatabank,bionet.molbio.genome-program,bionet.molbio.proteins Subject: Re: BCM Sequence Annotation Web Server Date: 12 Sep 1994 15:49:53 GMT Organization: Klin.Biochemie/MEB Lines: 47 Message-ID: <351tb1$3k2@news.rhrz.uni-bonn.de> NNTP-Posting-Host: allera.meb.uni-bonn.de X-Newsreader: Xref: biosci bionet.molbio.genbank:1742 bionet.molbio.embldatabank:363 bionet.molbio.genome-program:935 bionet.molbio.proteins:2653 In article toms@fcsparc6.ncifcrf.gov (Tom Schneider) writes: >In article rsmith@dot.bcm.tmc.edu >(Randall Smith) writes: > >| : Announcing a new WWW Server: The BCM Sequence Annotation Server >| : URL: http://dot.imgen.bcm.tmc.edu:9331/seq-annot/home.html > >This idea has both good and bad points and I think that they should be >considered extremely carefully. > >First, the idea that individual researchers should be able to update a database >directly is wonderful. If everybody were to do that to the data they are >experts on, GenBank would quickly become a clean database. > >However, there are several problems: > >1. Corruption of the data either intentionally or inadvertently. The authors >already are aware of this possibility. > >2. Inconsistency between researchers. The NCBI attempts to make entries >uniform by certain standards, but individual researchers cannot know what these >are in detail. The only solutions I see are to force the kinds of annotations >to follow certain forms or to pass all the changes to experts for editing. The >trouble with passing the data to experts is that the number of experts has to >grow exponentially along with the growth of the database. Maybe we just have >to accept that to avoid a worse mess! > >2. Do the data flow into GenBank? There is no indication that it will. This >means that if GenBank makes a correction it won't go into this database and >vice versa. Since the data are not maintained in one place, it is duplicated >and will eventually become inconsistent. Who should or will a researcher >believe? A randomly annotated database or the "official" one? How will >inconsistencies be resolved? > >I see this as an experiment. Once the experiment has been shown to work >reasonably well, all the data should be passed to NCBI for careful processing >along with all new data. That is, the server should be run by NCBI or closely >in conjunction with them. > >For my reasoning behind this posting, see the philosophy paper available from: >http://fconvx.ncifcrf.gov:2001/~toms/onlinepapers.html > > Tom Schneider > National Cancer Institute > Laboratory of Mathematical Biology > Frederick, Maryland 21702-1201 > toms@ncifcrf.gov From owner-genome-program@net.bio.net Sun Sep 11 23:00:00 1994 Path: biosci!bcm!cs.utexas.edu!uunet!newstf01.cr1.aol.com!search01.news.aol.com!not-for-mail From: bilazar@aol.com (BILazar) Newsgroups: bionet.molbio.genome-program Subject: Genetic Counseling Newsgroup? Date: 12 Sep 1994 19:00:04 -0400 Organization: America Online, Inc. (1-800-827-6364) Lines: 4 Sender: news@search01.news.aol.com Message-ID: <352mhk$838@search01.news.aol.com> NNTP-Posting-Host: search01.news.aol.com Is anyone aware of a newsgroup devoted to genetic counseling and related issues? Thank you. From owner-genome-program@net.bio.net Mon Sep 12 23:00:00 1994 Path: biosci!daresbury!trane.uninett.no!eunet.no!nuug!EU.net!uunet!news.delphi.com!usenet From: genethics Newsgroups: bionet.molbio.genome-program Subject: Re: Genetic Counseling Newsgroup? Date: Mon, 12 Sep 94 21:42:33 -0500 Organization: Delphi (info@delphi.com email, 800-695-4005 voice) Lines: 8 Message-ID: References: <352mhk$838@search01.news.aol.com> NNTP-Posting-Host: bos1d.delphi.com X-To: BILazar BILazar writes: >Is anyone aware of a newsgroup devoted to genetic counseling and related >issues? I don't think there is one but there certainly ought to be one. Suggest you contact Elizabeth Thompson of the ELSI program of the Human Genome Project. she is, among other things, a genetic couselor. From owner-genome-program@net.bio.net Mon Sep 12 23:00:00 1994 Path: biosci!bcm!gazette.bcm.tmc.edu!rsmith From: rsmith@dot.bcm.tmc.edu (Randall Smith) Newsgroups: bionet.molbio.genbank,bionet.molbio.genome-program Subject: New FAQ for the BCM Sequence Annotation Server Date: 13 Sep 1994 18:32:12 GMT Organization: Institute for Molecular Genetics, Baylor College of Medicine Lines: 210 Distribution: world Message-ID: NNTP-Posting-Host: dot.imgen.bcm.tmc.edu Xref: biosci bionet.molbio.genbank:1745 bionet.molbio.genome-program:938 In response to the feedback we've been getting on our Annotation Server, and also in response to issues raised by Tom Schneider, Brian Foley, and Dennis Benson in their recent posts to bionet.molbio.genbank, we've added a new Overview/FAQ to our Sequence Annotation server. The Overview/FAQ describes in more detail the scope and intended use of our server. The URL of the new FAQ is: http://dot.imgen.bcm.tmc.edu:9331/seq-annot/faq.html A text version of the Overview/FAQ is also appended below (links to other documents will be missing, so it would be best to view the URL directly with a WWW client). All comments, critiques, and suggestions are welcome. Randall F. Smith, Human Genome Center, Baylor College of Medicine rsmith@bcm.tmc.edu ------------------------------------------------------------------------------ BCM Sequence Annotation Server - Overview and FAQ Contents: 1. Notes concerning the purpose and use of this server A. Motivation and Purpose B. Annotations are embedded into sequence records for display purposes only C. There are no current plans for annotations to be forwarded to the databases D. What happens when an Entrez sequence is updated or corrected by the database? E. Originating authors should report updates and corrections directly to the appropriate database 2. General Information A. Why we chose Entrez as our base sequence database B. Only the annotations are stored on our server C. Annotations cannot be edited or deleted by any user 3. Overview of the steps involved in adding a new annotation to the server ------------------------------------------------------------------------------ 1. Notes concerning the purpose and use of this server: A. Motivation and Purpose Currently there is no easy way for investigators to communicate and share new information about nucleic acid and protein sequences. This server is an attempt to correct this situation by providing a forum by which the research community can easily attach notes to sequence records in the Entrez database. We especially hope that users will take advantage of this service to share new information about gene/protein function. In order to identify a new gene's function using sequence similarity information generated during a database search, it is critical that the latest functional information be available to the community. However, in a large number of cases, functional information is not known at the time the sequence is entered into the database. Often it is only from subsequent studies (often by third parties) that a gene/protein's function is determined. In such cases, it is extremely rare for this information to be entered back into a sequence's entry. We hope this server will provide a convenient method for attaching new functional information to previously entered sequence records. B. Annotations are embedded into sequence records for display purposes only Annotations submitted to this server should be viewed as free-text electronic "Post-it notes" attached to Entrez sequence reports. The annotations are tagged with a "Comment" feature key and embedded within sequence records (similar to actual sequence features) for display. The annotations should not be considered true features. Submitting authors. however, are encouraged to format the annotations to appear similar to standard sequence features to enhance readability. C. There are no current plans for annotations to be forwarded to the databases. This server is an attempt to foster the communication of new information about sequences. It is not intended to be a mechanism for officially updating or correcting the databases. D. What happens when an Entrez sequence is updated or corrected by the database? All sequences in the Entrez database are assigned a unique identifier, the NCBI Seq UID (also known as the "gi" number). When Entrez sequences are updated or corrected by the database, if even a single base change is made to the sequence, then the the original version of the entry is archived by the NCBI and a new Seq UID is assigned to the altered sequence. If the update does not involve an change in the sequence (e.g., if a feature is added or corrected) then the entry is updated without a change in its Seq UID. The NCBI Seq UIDs are used by our server to associate each of annotations to the sequence being annotated. When a request to view an annotated sequence is made, our server retrieves the most up-to-date Entrez sequence report for the Seq UID directly from the NCBI's Entrez WWW Server. The annotations, which are stored locally on our server, are then retrieved and embedded into the report and displayed. Thus 1) if a database update does not cause a change in its Seq UID, the annotations will be automatically attached to the most recent entry and 2) if a change in a Seq UID is made then the annotations will remain associated with the original sequence entry. In future work we would like to set up an system that will automatically add a notice of change of Seq UID as an annotation to any sequence that has been superseded by a new UID. D. Originating authors should report updates and corrections directly to the appropriate database. The databases will always accept updates and corrections from sequence authors. Originating authors should therefore report updates directly to the databases. To report updates and corrections to GenBank, either: 1. Email a GenBank Update Form (obtained from the NCBI/GenBank Web Page) to: update@ncbi.nlm.nih.gov or 2. Fill-out the GSDB Online Update Form (this requires a WWW client that supports forms). A GenBank update form can also be emailed to the GSDB at: update@gsdb.ncgr.org 2. General Information: A. Why we chose Entrez as our base sequence database The NCBI Entrez database has a number of features which make it extremely useful as our base sequence database: 1. The Entrez database is very comprehensive, including nucleic acid and protein sequences from most, if not all, of the current sequence databases (including GenBank/EMBL/DDBJ, NCBI Backbone, PIR, Swiss-Prot, PDB, and PRF) 2. The Entrez database employs a stable set of unique identifiers, the NCBI Seq UIDs (gi numbers), to reference each sequence in the database. 3. Sequence reports are available directly over the Internet using the NCBI's Entrez WWW Server. 4. Since all annotated sequences are linked directly to the the NCBI's Entrez WWW Server, the full power of the Entrez database's search and retrieval system is available for use within our server. This includes, for example, direct access to the Medline abstracts of all references included in sequence records. B. Only the annotations are stored on our server When a user asks to view an annotated sequence, an Entrez sequence report is obtained from the NCBI network server. Annotations are then retrieved from our local database and embedded in the sequence report. C. Annotations cannot be edited or deleted by any user If an author of an annotation wishes to edit or delete an annotation, please send email to: rsmith@bcm.tmc.edu 3. Overview of the steps involved in adding a new annotation to the server Note: To be able to enter an annotation, one must use a WWW client that supports forms (e.g., Mosaic 2.x, Chimera, lynx). The steps needed to add a new annotation are outlined here. You should not need to refer to this page, however, when adding an annotation, since the steps are described in detail on the individual input forms. 1. From the Home Page, select the "Add a new feature annotation to the database" line from the list of possible actions. 2. On the "Add an Annotation page, enter a user-id if you already have one, else leave the field blank and select "Submit" if this is the first time you have entered an annotation. 3. If you wish to be assigned a new user-id, enter a user-id, then fill-in your name, address, etc. on the Personal Information page (this step is skipped if you have been previously assigned a user-id). 4. Enter either the NCBI Seq UID (gi number) or the accession number of the sequence you wish to annotate. If you do not either of these id's, then you can search the Entrez database for a UID or accession number using the NCBI Entrez server. Once you have finished searching Entrez, select "Back" from your browser's control panel until you return to the Annotation Server. Then enter a Seq UID (preferred) or an accession number in the appropriate fields. 5. Enter a short annotation into the text field (When the sequence report is subsequently viewed from our browser, the annotation will appear as a "Comment" feature type embedded in the sequence report). To help in preparing the annotation, the Entrez report for the sequence being annotated is appended to the bottom of annotation entry page. 6. Enter an extended commentary that will provide additional information (e.g., literature references) for the annotation. (When viewing the sequence report from our browser, the extended commentary will be displayed by clicking on the annotation). 7. Enter one or more keywords that others can use to find your annotation by doing a keyword search of the annotation database. 8. Enter one or more URLs that will be attached to the extended commentary. This will allow other users to jump to other WWW pages that you would liked linked to the annotation (e.g., your own home page or publications that you have online). ------------------------------------------------------------------------------ Randall F. Smith, Human Genome Center, Baylor College of Medicine rsmith@bcm.tmc.edu From owner-genome-program@net.bio.net Mon Sep 12 23:00:00 1994 Path: biosci!bcm!news.msfc.nasa.gov!europa.eng.gtefsd.com!howland.reston.ans.net!swrinde!emory!cs.utk.edu!stc06.CTD.ORNL.GOV!lrd.ctd.ornl.gov!lrd From: lrd@ornl.gov (Deborah L. Reece) Newsgroups: bionet.molbio.genome-program Subject: Hurler's Syndrome Date: Tue, 13 Sep 1994 16:39:24 GMT Organization: c&ts Lines: 11 Message-ID: NNTP-Posting-Host: lrd.ctd.ornl.gov X-Newsreader: Trumpet for Windows [Version 1.0 Rev A] I have a neice with Hurlers' Syndrome. There isn't anything we can do for her now but my concern is for her brother, sister, and cousins. My questions are what research is being done on this syndrome and is their any way (testing) to determine if you are a carrier? Any help would be appreciated. Deborah L. Reece From owner-genome-program@net.bio.net Tue Sep 13 23:00:00 1994 Path: biosci!bcm!news.msfc.nasa.gov!cs.utk.edu!stc06.CTD.ORNL.GOV!lrd.ctd.ornl.gov!lrd From: lrd@ornl.gov (Deborah L. Reece) Newsgroups: bionet.molbio.genome-program Subject: Re: Hurler's Syndrome and Fucosidosis (sp) Date: Wed, 14 Sep 1994 16:10:02 GMT Organization: c&ts Lines: 60 Distribution: world Message-ID: References: NNTP-Posting-Host: lrd.ctd.ornl.gov X-Newsreader: Trumpet for Windows [Version 1.0 Rev A] In article lrd@ornl.gov (Deborah L. Reece) writes: >Path: stc06.CTD.ORNL.GOV!lrd.ctd.ornl.gov!lrd >From: lrd@ornl.gov (Deborah L. Reece) >Newsgroups: bionet.molbio.genome-program >Subject: Hurler's Syndrome and Fucosidosis (sp) >Date: Wed, 14 Sep 1994 15:18:09 GMT >Organization: c&ts >Lines: 12 >Message-ID: >NNTP-Posting-Host: lrd.ctd.ornl.gov >X-Newsreader: Trumpet for Windows [Version 1.0 Rev A] >I have posted before on Hurler's Syndrome. >Question 1) >My neice, Lacee, has Hurler's Syndrome and a cousins child has Fucosidosis (If >this is spelled wrong, please let me know because I may want to Search: >somewhere.) Are these disorders related? If so, how? I will explain their >relationship: Oops! Robert and Mary Everett had Dow and Nola (and 11 other children). Dow had Mary (and 16 others); Mary had Nathan (and 4 others); and Nathan had Coty (Fucosidosis). Nola had S.J. (and 13 others); S.J. had Dinah (and 2 others); and Dinah had Lacee (Hurler's; and 2 other children). The afflicted children are 3rd Cousins (?). Dinah (my sister) and her husband (my husband's brother, possibly half-brother???) are 4th cousins (on their mother's side) and are carriers of Hurler's. Question 2) Where (my mother, mother-in-law, Dad's family, etc.) in the family tree would we (the family) start testing for possible carriers? Who should definitely worry and who should not worry? Is there a way to determine.. Yes, you need testing and No, you don't necessarily need testing. Obviously my concern is for future generations. The carriers could decide whether or not to have children or more children and who they marry. There is prenatal testing available but I wouldn't have a problem with pre-children/marriage testing. Since my son is Lacee's double first-cousin and shares the same relation to Coty as Lacee, you can see why this is more than a just passing curiousity. Thanks in advance for advice, help, etc. Deborah L. Reece at LRD@ornl.gov From owner-genome-program@net.bio.net Tue Sep 13 23:00:00 1994 Path: biosci!rutgers!gatech!newsxfer.itd.umich.edu!europa.eng.gtefsd.com!emory!cs.utk.edu!stc06.CTD.ORNL.GOV!lrd.ctd.ornl.gov!lrd From: lrd@ornl.gov (Deborah L. Reece) Newsgroups: bionet.molbio.genome-program Subject: Hurler's Syndrome and Fucosidosis (sp) Date: Wed, 14 Sep 1994 15:18:09 GMT Organization: c&ts Lines: 12 Message-ID: NNTP-Posting-Host: lrd.ctd.ornl.gov X-Newsreader: Trumpet for Windows [Version 1.0 Rev A] I have posted before on Hurler's Syndrome. Question 1) My neice, Lacee, has Hurler's Syndrome and a cousins child has Fucosidosis (If this is spelled wrong, please let me know because I may want to Search: somewhere.) Are these disorders related? If so, how? I will explain their relationship: From owner-genome-program@net.bio.net Tue Sep 13 23:00:00 1994 Newsgroups: bionet.molbio.genbank,bionet.molbio.genome-program Path: biosci!bcm!cs.utexas.edu!convex!darwin.sura.net!fconvx.ncifcrf.gov!fcsparc6!toms From: toms@fcsparc6.ncifcrf.gov (Tom Schneider) Subject: Re: New FAQ for the BCM Sequence Annotation Server Message-ID: Sender: usenet@ncifcrf.gov (C News) Nntp-Posting-Host: fcsparc6.ncifcrf.gov Organization: Frederick Cancer Research and Development Center References: Date: Wed, 14 Sep 1994 03:08:01 GMT Lines: 124 Xref: biosci bionet.molbio.genbank:1746 bionet.molbio.genome-program:940 In article rsmith@dot.bcm.tmc.edu (Randall Smith) writes: | In response to the feedback we've been getting on our Annotation | Server, and also in response to issues raised by Tom Schneider, Brian | Foley, and Dennis Benson in their recent posts to | bionet.molbio.genbank, we've added a new Overview/FAQ to our Sequence | Annotation server. The Overview/FAQ describes in more detail the | scope and intended use of our server. The URL of the new FAQ is: | | http://dot.imgen.bcm.tmc.edu:9331/seq-annot/faq.html | All comments, critiques, and suggestions are welcome. Thanks for saying this! :-) | Currently there is no easy way for investigators to communicate and | share new information about nucleic acid and protein sequences. This | server is an attempt to correct this situation by providing a forum by | which the research community can easily attach notes to sequence | records in the Entrez database. This is not strictly true, people communicate via GenBank at NCBI. The only question is how easy it is, and I'll grant you it's not as easy as your WWW server! | We especially hope that users will take advantage of this service to | share new information about gene/protein function. In order to | identify a new gene's function using sequence similarity information | generated during a database search, it is critical that the latest | functional information be available to the community. However, in a | large number of cases, functional information is not known at the time | the sequence is entered into the database. Often it is only from | subsequent studies (often by third parties) that a gene/protein's | function is determined. In such cases, it is extremely rare for this | information to be entered back into a sequence's entry. If I'm working on P53, unless I'm made aware of it I won't know about the latest stuff put on your server. I'll go look in GenBank and not see it. With zillions of specialized services poping up all over the planet, it's going to be impossible to track all this stuff, as Brian pointed out. (If you've taken any time to do some net surfing, you'll realize the magnitude of the problem - the number of home pages is astounding and growing fast.) | We hope this server will provide a convenient method for attaching | new functional information to previously entered sequence records. | | B. Annotations are embedded into sequence records for display | purposes only | | Annotations submitted to this server should be viewed as free-text | electronic "Post-it notes" attached to Entrez sequence reports. The | annotations are tagged with a "Comment" feature key and embedded | within sequence records (similar to actual sequence features) for | display. The annotations should not be considered true features. | Submitting authors. however, are encouraged to format the | annotations to appear similar to standard sequence features to enhance | readability. This is awful. Since you are going to use "comments" there is no way that I can write a program to read it and get anything useful out of it. Generally the use of comments and misc features should be STRONGLY DISCOURAGED! | C. There are no current plans for annotations to be forwarded to the | databases. | | This server is an attempt to foster the communication of new | information about sequences. It is not intended to be a mechanism for | officially updating or correcting the databases. Why not? Have you discussed this with them? Why not? It would be a fantastic service if you could provide the front end and then they would meld the appropriate comments into TRUE features with real data types that can be manipulated by software. | D. Originating authors should report updates and corrections | directly to the appropriate database. | | The databases will always accept updates and corrections from | sequence authors. Originating authors should therefore report updates | directly to the databases. Ok, fine. So people ALSO have to submit to the other 5232234 databases? How about the idea of one-stop-shopping (Cuticchia et al, Science 262:46 1993)? WHY should they have to report this to you and then go all over again to the trouble to report to the official cite? Why not report directly to the official site? It might be a bit slow in responding but they WILL put your data up for world wide distribution, guaranteed. And they'll check it's quality very carefully too! They won't let you blunder in public if they can help it! There's another problem here: duplication! So I send you some stuff and send them some stuff and then NCBI comes back and points out some inconsistency and I say "OOPS!" fix it and we put that into the GenBank database. Well ... a month later my actual data appears and there is my little postit note hovering over it in your database saying something else (the wrong thing) and by golly, everybody believes postit notes because, of course, they were stuck on later, right? So who's going to figure out the mess later? | C. Annotations cannot be edited or deleted by any user | | If an author of an annotation wishes to edit or delete an annotation, | please send email to: rsmith@bcm.tmc.edu So mistakes will be just as "hard" and "slow" to change as in GenBank, and if this project flies, you will have to have a big staff to handle all of it. Sorry to be so harsh about all this, but NOW is the time to make your data flow into the central repository. I suggest that you set up your service so that periodically all of the notes are swept up and given to GenBank for processing. Then you redisplay the new GenBank database with all the processed notes. This formalizes the data and at least gives us a shot at having the data be more than comments that machines can't handle. It also eliminates the duplication, and makes postits really indicate new information. Tom Schneider National Cancer Institute Laboratory of Mathematical Biology Frederick, Maryland 21702-1201 toms@ncifcrf.gov http://fconvx.ncifcrf.gov:2001/~toms/info.html From owner-genome-program@net.bio.net Fri Sep 16 23:00:00 1994 Path: biosci!agate!overload.lbl.gov!dancer.ca.sandia.gov!cronkite.nersc.gov!fastrac.llnl.gov!lll-winken.llnl.gov!koriel!cs.utexas.edu!howland.reston.ans.net!vixen.cso.uiuc.edu!news.uoregon.edu!gaia.ucs.orst.edu!news.cs.indiana.edu!nstn.ns.ca!coranto.ucs.mun.ca!ahab!roger From: roger@kean.ucs.mun.ca (ROGER GREEN,MEDICINE,ST.JOHN'S,NF,CAN) Newsgroups: bionet.molbio.genome-program Subject: Breast cancer gene identified?? Date: 14 Sep 94 09:53:33 -0330 NST Organization: Memorial University. St.John's Nfld, Canada Lines: 8 Message-ID: <1994Sep14.095333.1@ahab> NNTP-Posting-Host: ahab.ucs.mun.ca I heard a rumour that (finally!) the gene for "inherited breast cancer" has been isolated. I assume this is the BRCA1 gene on 17q. Anyone have any more information on this?? Anything published or about to be published?? Roger C. Green, Faculty of Medicine Phone: (709)737-6884 Memorial University , St. John's, Newfoundland FAX : (709)737-7010 From owner-genome-program@net.bio.net Fri Sep 16 23:00:00 1994 Path: biosci!NETCOM.COM!wick From: wick@NETCOM.COM (Potter Wickware) Newsgroups: bionet.molbio.genome-program Subject: Re: Breast cancer gene identified?? Date: 17 Sep 1994 11:15:47 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 15 Sender: daemon@net.bio.net Distribution: world Message-ID: References: <1994Sep14.095333.1@ahab> NNTP-Posting-Host: net.bio.net BRCA1. It's a 100kb region on 17q21. Skolnick et al in Science, Oct 7. P Wickware, Oakland, CA. On 14 Sep 1994 roger@leif.ucs.mun.ca wrote: > I heard a rumour that (finally!) the gene for > "inherited breast cancer" has been isolated. I assume this is the > BRCA1 gene on 17q. Anyone have any more information on this?? > Anything published or about to be published?? > > > Roger C. Green, Faculty of Medicine Phone: (709)737-6884 > Memorial University , St. John's, Newfoundland FAX : (709)737-7010 > > From owner-genome-program@net.bio.net Sun Sep 18 23:00:00 1994 Path: biosci!rutgers!gatech!swrinde!howland.reston.ans.net!news.sprintlink.net!sundog.tiac.net!usenet.elf.com!news2.near.net!das-news.harvard.edu!husc-news.harvard.edu!nucleus!robison Newsgroups: bionet.molbio.genome-program Subject: Re: Hurler's Syndrome and Fucosidosis (sp) Message-ID: <1994Sep19.130321.34837@hulaw1.harvard.edu> From: robison@nucleus.harvard.edu (Keith Robison) Date: 19 Sep 94 13:03:20 EDT References: Distribution: world Nntp-Posting-Host: nucleus.harvard.edu X-Newsreader: TIN [version 1.2 PL2] Lines: 56 On-Line Mendelian Inheritance in Man is available on-line and is a complete textbook on human genetic diseases. It is freely available via: E-mail mailserv@gdb.orf FTP ftp.gdb.org Gopher gopher.gdb.org WWW http://gdbwww.gdb.org/ : Robert and Mary Everett had Dow and Nola (and 11 other children). Dow had : Mary (and 16 others); Mary had Nathan (and 4 others); and Nathan had Coty : (Fucosidosis). Nola had S.J. (and 13 others); S.J. had Dinah (and 2 others); : and Dinah had Lacee (Hurler's; and 2 other children). The afflicted children : are 3rd Cousins (?). : Dinah (my sister) and her husband (my husband's brother, possibly : half-brother???) are 4th cousins (on their mother's side) and are carriers of : Hurler's. : Question 2) : Where (my mother, mother-in-law, Dad's family, etc.) in the family tree would : we (the family) start testing for possible carriers? Who should definitely : worry and who should not worry? : necessarily need testing. : Obviously my concern is for future generations. The carriers could decide : whether or not to have children or more children and who they marry. There is : prenatal testing available but I wouldn't have a problem with : pre-children/marriage testing. Since my son is Lacee's double first-cousin : and shares the same relation to Coty as Lacee, you can see why this is more : than a just passing curiousity. The concerned individuals should contact a professional genetic counselor for such advice. In particular, your son should contact a counselor because he has about a 20% chance** of being a carrier (if your husband is a full brother of your sister's husband). Again, see a professional who can give you the latest information & can fully analyze your pedigree. ** quick, back-of-envelope calculation Keith Robison Harvard University Department of Cellular and Developmental Biology Department of Genetics / HHMI robison@mito.harvard.edu From owner-genome-program@net.bio.net Sun Sep 18 23:00:00 1994 Path: biosci!rutgers!gatech!howland.reston.ans.net!usenet.ins.cwru.edu!po.CWRU.Edu!sxl29 From: sxl29@po.CWRU.Edu (Shuang Liang) Newsgroups: bionet.molbio.genome-program Subject: mapping mutations of human genes Date: 19 Sep 1994 18:47:25 GMT Organization: Case Western Reserve University, Cleveland, Ohio (USA) Lines: 9 Message-ID: <35kmbt$ngf@usenet.INS.CWRU.Edu> NNTP-Posting-Host: owl.ins.cwru.edu I come up with an idea (although it is not finalized) which may help and speed up mapping of mutations related to human diseases. I am yeast molecular geneticist and I am interested in doing research in human genetics especially in genome mapping. I am looking for sponsor who understand the importance of finding mutation(s) and cloning of the corresponding human gene(s). If you are interested in this seriously, please contact me at: SXL@PO.CWRU.EDU A US company or major research center is preferred. From owner-genome-program@net.bio.net Mon Sep 19 23:00:00 1994 Path: biosci!bcm!cs.utexas.edu!convex!news.duke.edu!godot.cc.duq.edu!newsfeed.pitt.edu!dsinc!netnews.upenn.edu!netaxs.com!kost From: kost@netaxs.com (Michael Kost) Newsgroups: bionet.molbio.genome-program Subject: I need help finding Info for AD Bio HS class. Date: 20 Sep 1994 00:37:47 GMT Organization: Netaxs Internet BBS and Shell Accounts Lines: 17 Message-ID: <35lasr$gge@netaxs.com> NNTP-Posting-Host: unix1 X-Newsreader: TIN [version 1.2 PL2] Greetings My 11th and 12th grade students have been assigned a paper concerning human geno. Each has been given a human chromosome to research. Is there a simple easy to read summary that would be appropriate for them ?? We have access to internet as well as the usual library sources. Thank you Deb -- ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ kost@netaxs.com From owner-genome-program@net.bio.net Mon Sep 19 23:00:00 1994 Path: biosci!CSE.PSU.EDU!pevzner From: pevzner@CSE.PSU.EDU (Pavel Pevzner) Newsgroups: bionet.molbio.genome-program Subject: Combinatorial Pattern Matching 1995 Date: 20 Sep 1994 14:20:19 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 60 Sender: daemon@net.bio.net Distribution: world Message-ID: <94Sep20.171948edt.46109@colossus.cse.psu.edu> NNTP-Posting-Host: net.bio.net Call for Papers ------------------------------ COMBINATORIAL PATTERN MATCHING ------------------------------ Helsinki, Finland, July 4-7, 1995 The sixth symposium on Combinatorial Pattern Matching will be held in Helsinki, Finland, on July 4-7, 1995. The first meeting was in Paris in 1990, followed by meetings in London, Tucson, Padova, and Pacific Grove. Papers in all areas related to combinatorial pattern matching and its applications will be considered, including, but not limited to, string algorithms, pattern recognition, applications in molecular biology, text searching, information retrieval, symbolic computing, and data com- pression. Papers reporting on original research unpublished elsewhere are primarily sought. Surveys of important results, especially recent ones, are also invited. Proceedings will be published in the Springer-Verlag series Lecture Notes in Computer Science. The goal is to keep the attendance to under 100 participants to allow ample time for informal interaction. Thus, the participation will require advance registration. On July 2-4, 1995, just before the symposium, a short international summer school is planned to be organized in the same location. To submit a paper, please send 10 copies of an extended abstract (5-10 pages - standard, single-spacing single-column 11 pt or 12 pt format) to the address below by January 10, 1995. This is a strict deadline. Papers arriving after that date or submitted electronically will not be con- sidered. Please include your e-mail address if possible. Authors will be notified by March 3, 1995. Camera-ready manuscripts will be due April 7, 1995. Esko Ukkonen Department of Computer Science P. O. Box 26 FIN-00014 University of Helsinki, Finland e-mail address: cpm95@cs.helsinki.fi Program Committee: A. Ehrenfeucht, Z. Galil (co-chair), D. Gusfield, U. Manber, M. Paterson, P. Pevzner, I. Simon, J. Storer, E. Ukkonen (co- chair), M. Wegman. Invited Speaker(s): To be announced. Local Organizers: P. Kilpelainen, J. Karkkainen, E. Sutinen, and J. Tarhio. Helsinki, the capital of Finland, is a combination of old and new, city and country. Because of the northern location, the area is abundant of light in summer. The symposium venue will be Hanasaari Cultural Centre, a high-quality conference hotel charmingly overlooking the Baltic Sea just a few kilometers from downtown. From owner-genome-program@net.bio.net Mon Sep 19 23:00:00 1994 Path: biosci!OCCSHOST.NLM.NIH.GOV!Jeffery_Schloss From: Jeffery_Schloss@OCCSHOST.NLM.NIH.GOV Newsgroups: bionet.molbio.genome-program Subject: chromosome 13 coordinator Date: 20 Sep 1994 06:08:08 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 15 Sender: daemon@net.bio.net Distribution: world Message-ID: <9409200910.23673.AA@occshost.nlm.nih.gov> NNTP-Posting-Host: net.bio.net The GDB chromosome editors for chromosome 13 are Dorothy Warburton Columbia-Presb. Med. Ctr., NY fax: 212-305-7436 cuh@cuccfa.ccc.columbia.edu and Aravinda Chakravarti Case Western Reserve Univ. Cleveland aravinda@chimera.gene.cwru.edu fax: 216-368-5857 NIH supports a program project grant for physical mapping of chromosome 13 at Columbia University. The P.I. is Argiris Efstratiadis fax: 212-923-2090 From owner-genome-program@net.bio.net Mon Sep 19 23:00:00 1994 Path: biosci!daresbury!not-for-mail From: hkeil@hgmp.mrc.ac.uk (Dr. H. Keil) Newsgroups: bionet.molbio.genome-program Subject: chromosome 13 coordinator Date: 20 Sep 1994 13:08:20 +0100 Lines: 9 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <35mjbk$h1m@mserv1.dl.ac.uk> Original-To: gnome-pr@dl.ac.uk Does anyone know who the coordinator of the human chromosome 13 mapping project is? I would be grateful for name and postal and/or email address. Henry Keil Dept. of Biology and Biochemistry BRUNEL University Uxbridge, Middx UB8 3PH United Kingdom From owner-genome-program@net.bio.net Wed Sep 21 23:00:00 1994 Newsgroups: bionet.molbio.genome-program Path: biosci!agate!deep.rsoft.bc.ca!cow!pig From: duhh Subject: mortality genes? Sender: news@cow.shoreline.ca Organization: Shoreline BBS, Vancouver Date: Thu, 22 Sep 1994 05:57:40 GMT X-Newsreader: SL2 Usenet UA Message-ID: <454148@shoreline.ca> Lines: 44 An article posted elsewhere mentioned the immortality gene and I thought you might like to know that the work in that regard is further along, apparently than one might assume. I was wondering if anyone else knew much about this. Just over a year ago I ran into a two-hour documentary co-produced by the CBC and BBC new services, I believe on Panorama or a similar program. I'm sure it can be tracked down and obtained from them. The program focued on a privately run research team working on turning off and on the immortality gene in Houston Texas. They stated in the program that they had sucessfully turned off the gene in rats and in effect had produced immortal rats. One effect was that turning off the mortality gene turns off the reproductive gene and immortal rats cannot reproduce, but they had also suceeded in turning them back on, letting the rats breed and then turning them off again. As an aside they compared this to turning off the gay gene which similarily turns off creativity and higher intelligence. The program was built around discussion with the lead researcher and the private funder of the research, an old fraile Texas billionaire who had no intention of parting with his money. The research funding ran at somewhere in the low tens of millions a cheap bet as far as the billionaire was concerned. The researcher predicted that turning off the mortality genes in humans would mean you would be genetically about 25 permanently with a potential life span ranging anywhere from 20,000 to 200,000 years saying sumthing will get you eventually but it wouldnt be old age. As far as ramifications were concerned the program interviewed 20 something year olds at a disco who said they didnt want a lot good looking old farts around who should be making way for the young and should just die. More proof I guess twenty year olds think they're immortal. Other than this program I have not seen anything else about this in the media, surprising if this gen(e)i is out of the bottle. Anyone? as always 'dances forever' Dar Westlake infantus horriblis duhh@shoreline.ca Vancouver BC Canada ~~~ * eventually the improbable becomes unavoidable * From owner-genome-program@net.bio.net Wed Sep 21 23:00:00 1994 Newsgroups: bionet.molbio.genome-program Path: biosci!agate!howland.reston.ans.net!news.cac.psu.edu!news.tc.cornell.edu!news.graphics.cornell.edu!ghost.dsi.unimi.it!genes!NewsWatcher!user From: consaleg@dibit.hsr.it (Giacomo Consalez) Subject: database garbage Message-ID: Followup-To: bionet.molbio.genome-program Sender: news@genes.icgeb.trieste.it Organization: DIBIT - Istituto Scientifico San Raffaele, Milano Date: Wed, 21 Sep 1994 20:34:34 GMT Lines: 80 (Probably a FAQ) Today, I ran a BLASTN search using the pBluescript SK polylinker as a Query sequence. This was the format of my search: PROGRAM blastn DATALIB nr EXPECT 2 BEGIN >bluescript polylinker CAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCA GTGAATTGTAATACGACTCACTATAGGGCGAATTGGAGCTCCACCGCGGTGGCGGCCGCTCTA GAACTAGTGGATCCCCCGGGCTGCAGGAATTCGATATCAAGCTTATCGATACCGTCGACCTCG AGGGGGGGCCCGGTACCCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTCCGAGCTTGGCGTAA TCATGGTCATAGCTGTTTC This is what I found, among a bunch of vector sequences: gb|M80234|BOVDOPATR Cow dopamine transporter mRNA, putat... 546 6.5e-38 1 gb|M60510|MUSBETAA Mouse beta-D-galactosidase fusion pr... 542 6.8e-38 1 emb|Z32836|MASYNAP1 M.auratus synaptonemal complex DNA, ... 511 3.0e-37 1 .... gb|T18597|T18597 hbc2233 Homo sapiens cDNA clone hbc2... 481 1.3e-33 1 emb|Z28355|HSDHED52A H. sapiens partial cDNA sequence; cl... 495 2.5e-33 1 gb|M37144|MUSREBC Mouse dihydrofolate reductase promot... 475 3.8e-33 1 .... emb|Z32822|HHEA30P H. sapiens partial cDNA sequence; cl... 486 1.9e-32 1 emb|X79425|ATAG4 A.thaliana microsatellite [repeated ... 365 3.3e-32 2 gb|T10941|T10941 hbc162 Homo sapiens cDNA clone hbc16... 460 1.1e-31 1 gb|L31886|DROSTAR Drosophila melanogaster Star gene, c... 280 3.0e-31 2 gb|L29484|LEIPGLYA Leishmania tarentolae P-glycoprotein... 374 3.5e-31 2 gb|T11028|T11028 hbc465 Homo sapiens cDNA clone hbc46... 450 1.0e-30 1 gb|L04207|HUMSTSK26A Human STS, K23-4p-p or DXS1026. 465 5.3e-30 1 emb|Z30131|HHEA53E H. sapiens partial cDNA sequence; cl... 450 5.3e-30 1 gb|T03269|T03269 FB7H1 Homo sapiens cDNA clone FB7H1. 438 1.7e-29 1 .... gb|T03189|T03189 FB30F10 Homo sapiens cDNA clone FB30... 455 2.9e-29 1 gb|L04210|HUMSTSK22A Human STS, K23-6p or DXS1022. 457 2.9e-29 1 gb|L04208|HUMSTSK26B Human STS, K23-4p or DXS1026. 455 4.4e-29 1 emb|A18053|A18053 DNA for transforming monocotyledonou... 364 1.1e-28 2 .... gb|T11426|T11426 hbc162B Homo sapiens cDNA clone hbc1... 425 1.6e-28 1 All the above alignments are statistically significant. Would it be possible to clean up nucleotide databases from this material? ''' (o o) /-------------------oOOo--(v)--oOOo----------------/ / G. Giacomo Consalez, M.D. / / Genome Unit / / DIBIT - HSR / /--------------------------------------------------/ /Address: / E_mail: / / Via Olgettina 58 / consaleg@dibit.hsr.it / / 20132 - Milano / Phone: + 39 2 2643 4838 / / Italia / Fax.: + 39 2 2643 4767 / /--------------------/-----------------------------/ From owner-genome-program@net.bio.net Wed Sep 21 23:00:00 1994 Path: biosci!bcm!news.msfc.nasa.gov!europa.eng.gtefsd.com!howland.reston.ans.net!cs.utexas.edu!uunet!news.delphi.com!usenet From: genethics Newsgroups: bionet.molbio.genome-program Subject: Re: chromosome 13 coordinator Date: Thu, 22 Sep 94 14:24:41 -0500 Organization: Delphi (info@delphi.com email, 800-695-4005 voice) Lines: 3 Message-ID: <5ExVo2B.genethics@delphi.com> References: <35mjbk$h1m@mserv1.dl.ac.uk> NNTP-Posting-Host: bos1f.delphi.com X-To: Dr. H. Keil THE coordinatorfor chomosme 13 is Dorothy Warburton at Columbia-presbyterian med Center. E-mail is cuh@cuccfa.ccc.columbia.edu. she is identified as the "editor" in the last issue of the Human Geneome News. From owner-genome-program@net.bio.net Thu Sep 22 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!usc!nic-nac.CSU.net!charnel.ecst.csuchico.edu!olivea!uunet!zib-berlin.de!informatik.tu-muenchen.de!lrz-muenchen.de!ipp-garching.mpg.de!alf.biochem.mpg.de!krasel From: krasel@alf.biochem.mpg.de (Cornelius Krasel) Newsgroups: bionet.molbio.genome-program Subject: Re: database garbage Date: 23 Sep 1994 09:26:42 GMT Organization: Rechenzentrum der Max-Planck-Gesellschaft in Garching Lines: 17 Message-ID: <35u70iINN10qa@sat.ipp-garching.mpg.de> References: NNTP-Posting-Host: alf.biochem.mpg.de X-Newsreader: TIN [version 1.1 PL8] Giacomo Consalez (consaleg@dibit.hsr.it) wrote: : (Probably a FAQ) : Today, I ran a BLASTN search using the pBluescript SK polylinker as a Query : sequence. [Found lots of statistically significant hits in human and other sequences.] Two years ago you could have published this as a letter in Nature or Science :-) --Cornelius. -- /* Cornelius Krasel, Abt. Lohse, Genzentrum, D-82152 Martinsried, Germany */ /* email: krasel@alf.biochem.mpg.de fax: +49 89 8578 3795 */ /* "People are DNA's way of making more DNA." (Edward O. Wilson, 1975) */ From owner-genome-program@net.bio.net Thu Sep 22 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!cs.utexas.edu!convex!news.duke.edu!godot.cc.duq.edu!nntp.club.cc.cmu.edu!casaba.srv.cs.cmu.edu!das-news.harvard.edu!husc-news.harvard.edu!lipid!robison Newsgroups: bionet.molbio.genome-program Subject: Re: I need help finding Info for AD Bio HS class. Message-ID: <1994Sep23.091515.34896@hulaw1.harvard.edu> From: robison@lipid.harvard.edu (Keith Robison) Date: 23 Sep 94 09:15:13 EDT References: <35lasr$gge@netaxs.com> Nntp-Posting-Host: lipid.harvard.edu X-Newsreader: TIN [version 1.2 PL2] Lines: 37 Michael Kost (kost@netaxs.com) wrote: : Greetings : My 11th and 12th grade students have been assigned a paper concerning : human geno. Each has been given a human chromosome to research. Is there : a simple easy to read summary that would be appropriate for them ?? : We have access to internet as well as the usual library sources. The Human Genome Data Base (GDB) is on-line and freely accessible E-mail mailserv@gdb.org Gopher gopher.gdb.org WWW http://gdbwww.gdb.org/ I can't remember if they have text summaries, but there are nice GIFs of chromosome maps and chromosomal regions, as well as descriptions of various human genetic traits and diseases (in the affiliated On-Line Mendelian Inheritance in Man). If you have a choice, use the Web interface -- it is very nice. You might also look in http://golgi.harvard.edu/biopages/genetics.html for other human genetics sites (though I must confess I don't have all the chromosome-specific links in there). Many of the Human Genome Centers focus on a chromosome or two, and they might have good summaries, GIFs, etc. Good luck! Keith Robison Harvard University Department of Cellular and Developmental Biology Department of Genetics / HHMI robison@mito.harvard.edu From owner-genome-program@net.bio.net Thu Sep 22 23:00:00 1994 Newsgroups: bionet.molbio.genome-program,bionet.molbio.genbank Path: biosci!agate!overload.lbl.gov!dog.ee.lbl.gov!news.cs.utah.edu!emba-news.uvm.edu!brianf From: brianf@med.uvm.edu (Brian Foley) Subject: Re: database garbage Message-ID: <1994Sep23.153337.24496@emba.uvm.edu> Sender: news@emba.uvm.edu Organization: EMBA Computer Facility, University of Vermont X-Newsreader: TIN [version 1.2 PL1] References: Date: Fri, 23 Sep 1994 15:33:37 GMT Lines: 118 Xref: biosci bionet.molbio.genome-program:956 bionet.molbio.genbank:1754 Giacomo Consalez (consaleg@dibit.hsr.it) wrote: : (Probably a FAQ) Yes, this has been discussed many times before. If you scan the archives of bionet.molbio.genbank and bionet.molbio.embl, you can come up with about 20 articles discussing vector contamination in the databases. : Today, I ran a BLASTN search using the pBluescript SK polylinker as a Query : sequence. This was the format of my search: : PROGRAM blastn : DATALIB nr : EXPECT 2 : BEGIN : >bluescript polylinker : CAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCA : GTGAATTGTAATACGACTCACTATAGGGCGAATTGGAGCTCCACCGCGGTGGCGGCCGCTCTA : GAACTAGTGGATCCCCCGGGCTGCAGGAATTCGATATCAAGCTTATCGATACCGTCGACCTCG : AGGGGGGGCCCGGTACCCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTCCGAGCTTGGCGTAA : TCATGGTCATAGCTGTTTC : This is what I found, among a bunch of vector sequences: : gb|M80234|BOVDOPATR Cow dopamine transporter mRNA, putat... 546 6.5e-38 : 1 : gb|M60510|MUSBETAA Mouse beta-D-galactosidase fusion pr... 542 6.8e-38 : 1 : emb|Z32836|MASYNAP1 M.auratus synaptonemal complex DNA, ... 511 3.0e-37 : 1 : .... : gb|T18597|T18597 hbc2233 Homo sapiens cDNA clone hbc2... 481 1.3e-33 : 1 : emb|Z28355|HSDHED52A H. sapiens partial cDNA sequence; cl... 495 2.5e-33 : 1 : gb|M37144|MUSREBC Mouse dihydrofolate reductase promot... 475 3.8e-33 : 1 : .... : emb|Z32822|HHEA30P H. sapiens partial cDNA sequence; cl... 486 1.9e-32 : 1 : emb|X79425|ATAG4 A.thaliana microsatellite [repeated ... 365 3.3e-32 : 2 : gb|T10941|T10941 hbc162 Homo sapiens cDNA clone hbc16... 460 1.1e-31 : 1 : gb|L31886|DROSTAR Drosophila melanogaster Star gene, c... 280 3.0e-31 : 2 : gb|L29484|LEIPGLYA Leishmania tarentolae P-glycoprotein... 374 3.5e-31 : 2 : gb|T11028|T11028 hbc465 Homo sapiens cDNA clone hbc46... 450 1.0e-30 : 1 : gb|L04207|HUMSTSK26A Human STS, K23-4p-p or DXS1026. 465 5.3e-30 : 1 : emb|Z30131|HHEA53E H. sapiens partial cDNA sequence; cl... 450 5.3e-30 : 1 : gb|T03269|T03269 FB7H1 Homo sapiens cDNA clone FB7H1. 438 1.7e-29 : 1 : .... : gb|T03189|T03189 FB30F10 Homo sapiens cDNA clone FB30... 455 2.9e-29 : 1 : gb|L04210|HUMSTSK22A Human STS, K23-6p or DXS1022. 457 2.9e-29 : 1 : gb|L04208|HUMSTSK26B Human STS, K23-4p or DXS1026. 455 4.4e-29 : 1 : emb|A18053|A18053 DNA for transforming monocotyledonou... 364 1.1e-28 : 2 : .... : gb|T11426|T11426 hbc162B Homo sapiens cDNA clone hbc1... 425 1.6e-28 : 1 : All the above alignments are statistically significant. : Would it be possible to clean up nucleotide databases from this material? The official word from GenBank is: From: dab@ray.nlm.nih.gov (Dennis Benson) Subject: Re: Mislabelled Vector Sequences Message-ID: <1993Jun9.143801.23889@nlm.nih.gov> Sender: news@nlm.nih.gov Organization: National Library of Medicine X-Newsreader: Tin 1.1 PL4 References: <93159.134000IO00865@MAINE.MAINE.EDU> Date: Wed, 9 Jun 93 14:38:01 GMT Lines: 29 GenBank, as well as EMBL and DDBJ, try to annotate and identify regions of sequences where there is possible vector contamination. We would appreciate getting reports of suspect sequences by e-mail to: update@ncbi.nlm.nih.gov Thank you, Dennis Benson GenBank/NCBI The policy is to add annotation marking the sequence as vector, but not to remove the vector sequence unless the authors of the sequence make a request to do so. This causes some new problems, and doesn't entirely solve the existing problem, but the limitation is that authors "own" their database entries and should be responsible for keeping them clean. Often times, only the sequence author can go back to the actual raw data and decide what is vector and what is real sequence. Only the author will know whether a BamHI linker was added to blunt DNA or if the BamHI site actually exists in both the vector and the real sequence. The real world is not the ideal world = lesson one in the facts of life. -- ******************************************************************** * Brian Foley * If we knew what we were doing * * Molecular Genetics Dept. * it wouldn't be called research * * University of Vermont * * ******************************************************************** From owner-genome-program@net.bio.net Sun Sep 25 23:00:00 1994 Path: biosci!agate!ames!lll-winken.llnl.gov!noc.near.net!bigboote.WPI.EDU!wpi.WPI.EDU!bean From: bean@wpi.WPI.EDU (chrisTOPH BEAN) Newsgroups: bionet.molbio.genome-program Subject: Looking for software (UPGMA) Date: 26 Sep 1994 13:34:13 GMT Organization: Worcester Polytechnic Institute Lines: 23 Distribution: na Message-ID: <366ikl$3k2@bigboote.WPI.EDU> NNTP-Posting-Host: wpi.wpi.edu We are two biotechnology students currently studying under Dr. Joseph Bagshaw at Worcester Polytechnic Institute. Our project, which is a graduation requirement for WPI, involves genetic variation among and between Limulus polyphemus (Horseshoe crab) populations along the Atlantic coast. Consequently, we are looking for a suitable program to meaningfully analyize our data, which will be band sharing on autoradiograms. We are looking for restriction fragment length polymorphism (RFLP), and we want to do pairwise comparisons. If you know of any software that might be useful to us or where we might be able to find it, we would really appreciate a post to this group or e-mail at bean@wpi.wpi.edu. Thank-you, Christopher Bean Kristin Sullivan bean@wpi.wpi.edu From owner-genome-program@net.bio.net Sun Sep 25 23:00:00 1994 Path: biosci!SILVER.NLM.NIH.GOV!sofia From: sofia@SILVER.NLM.NIH.GOV (Heidi Sofia) Newsgroups: bionet.molbio.genome-program Subject: Vector contamination of Genbank Date: 26 Sep 1994 10:20:05 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 54 Sender: daemon@net.bio.net Distribution: world Message-ID: <9409261719.AA07314@silver.ncbi.nlm.nih.gov> NNTP-Posting-Host: net.bio.net VECTOR CONTAMINATION OF THE DATABASES As recently noted in the genome-program newsgroup, GenBank sequences sometimes contain vector that was unrecognized at the time of submission and has thus become an unintentional and misleading component of natural sequences. Since December, 1993, all direct submissions to NCBI have been screened for vector contamination and accession numbers beginning with "U" reflect this quality assurance procedure. We are currently in the process of analyzing earlier entries to eliminate vector contamination from older data. Analysis of the 33381 entries in the Primate division, for example, revealed 249 entries with vector contamination. Of these, most contained vector sequence extending to the ends of the entry, but 69 sequences contained internal matches, as defined by exact matches beginning 10 bp or more from the ends. Most of the contaminated entries were submitted individually by different researchers; however, 9 groups submitted more than two sequences each for a total of 80 contaminated entries. Out of 249 matches, 22 were already annotated as containing vector sequence. At least 70% of the contaminating vector sequence matches either the pUC19 multiple cloning site, pBluescript, lambda, or pBR322. This analysis will be extended to all other GenBank divisions with exception of the Bacterial, Synthetic, and Patent sequences. This work is already being carried out for sequences in the EST division where vector and other types of contamination are even more pronounced due to the volume and "single-pass" nature of the data. We appreciate being notified about vector contamination or any other problems with GenBank entries. Updates, corrections and comments should be sent to update@ncbi.nlm.nih.gov Heidi Sofia Mark Boguski GenBank National Center for Biotechnology Information National Library of Medicine National Institutes of Health 8600 Rockville Pike Bethesda, Maryland 20894 USA 301-496-2475 301-480-9241 FAX From owner-genome-program@net.bio.net Tue Sep 27 23:00:00 1994 Path: biosci!CGL.UCSF.EDU!vulpe From: vulpe@CGL.UCSF.EDU (Chris Vulpe) Newsgroups: bionet.molbio.genome-program Subject: Genetic diagnosis of Rare Genetic diseases Date: 27 Sep 1994 18:20:23 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 22 Sender: daemon@net.bio.net Distribution: world Message-ID: <199409280120.SAA11667@socrates.ucsf.EDU> NNTP-Posting-Host: net.bio.net To all with an interest in Human genetic disease diagnosis, I would like to begin a discussion on genetic testing for rare genetic diseases in the United States. For some more common genetic diseases, the identification of the gene has led to the commercial availability of mutational analysis and prenatal, pre symptomatic or carrier testing. The laboratory in which I work was involved in the identification of the gene defective in Menkes disease, a rare genetic disorder, and since have received numerous requests for prenatal and carrier testing. Unfortunately, we have neither the resources or the personnel to continue this effort for the long term. However, I believe that there is a moral obligation to provide these services for individuals affected by the disorder. Numerous disease loci have been identified for rare genetic diseases and I presume that other researchers are faced with a similar dilemma. I would be interested in hearing what solutions or choices were made in these cases and comments about this question. Please respond directly at the email address below or in the discussion group general posting. Sincerely Chris Vulpe email: vulpe@cgl.ucsf.edu From owner-genome-program@net.bio.net Tue Sep 27 23:00:00 1994 Newsgroups: bionet.molbio.genome-program Path: biosci!lhc!silver!sofia From: sofia@silver.nlm.nih.gov (Heidi Sofia) Subject: Vector Contamination in GenBank Message-ID: <1994Sep28.153106.17199@nlm.nih.gov> Sender: news@nlm.nih.gov Organization: National Library of Medicine X-Newsreader: TIN [version 1.2 PL2] Date: Wed, 28 Sep 94 15:31:06 GMT Lines: 55 VECTOR CONTAMINATION OF DATABASES As recently noted in the genome-program newsgroup, GenBank sequences sometimes contain vector that was unrecognized at the time of submission and has thus become an unintentional and misleading component of natural sequences. Since December, 1993, all direct submissions to NCBI have been screened for vector contamination and accession numbers beginning with "U" reflect this quality assurance procedure. We are currently in the process of analyzing earlier entries to eliminate vector contamination from older data. Analysis of the 33381 entries in the Primate division, for example, revealed 249 entries with vector contamination. Of these, most contained vector sequence extending to the ends of the entry, but 69 sequences contained internal matches, as defined by exact matches beginning 10 bp or more from the ends. Most of the contaminated entries were submitted individually by different researchers; however, 9 groups submitted more than two sequences each for a total of 80 contaminated entries. Out of 249 matches, 22 were already annotated as containing vector sequence. At least 70% of the contaminating vector sequence matches either the pUC19 multiple cloning site, pBluescript, lambda, or pBR322. This analysis will be extended to all other GenBank divisions with exception of the Bacterial, Synthetic, and Patent sequences. This work is already being carried out for sequences in the EST division where vector and other types of contamination are even more pronounced due to the volume and "single-pass" nature of the data. We appreciate being notified about vector contamination or any other problems with GenBank entries. Updates, corrections and comments should be sent to update@ncbi.nlm.nih.gov Heidi Sofia Mark Boguski GenBank National Center for Biotechnology Information National Library of Medicine National Institutes of Health 8600 Rockville Pike Bethesda, Maryland 20894 USA 301-496-2475 301-480-9241 FAX From owner-genome-program@net.bio.net Tue Sep 27 23:00:00 1994 Path: biosci!CASTALIA.NLM.NIH.GOV!boguski From: boguski@CASTALIA.NLM.NIH.GOV (Mark Boguski) Newsgroups: bionet.molbio.genome-program Subject: dbEST passes 50,000 sequence mark Date: 28 Sep 1994 11:37:11 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 108 Sender: daemon@net.bio.net Distribution: world Message-ID: <9409281836.AA02527@castalia.nlm.nih.gov> NNTP-Posting-Host: net.bio.net dbEST AS A RESOURCE FOR GENE DISCOVERY The number of public cDNA sequences ("Expressed Sequence Tags" or ESTs) recently exceeded the 50,000 mark* and it was of interest to assess the usefulness of this resource for gene discovery. We therefore compiled a list of 32 human disease genes that had been cloned as of August 1994 by either the positional cloning or positional candidate methods (1) and performed sequence homology searching (2) , against dbEST, the database of expressed sequence tags (3). Thirty eight percent of these human genes had exact and often multiple matches in dbEST and an additional 47% were represented by homologs in other organisms.** Only five human disease genes had no convincing matches with ESTs. Thus for 85% of the human disease genes positionally-cloned to date, there is a homologous partial cDNA sequence in the public domain. These results underscore the utility of "single pass," tag/survey cDNA sequencing (4) and demonstrate that much valuable information is already present in the public databases if one knows how to find it (2) . These results also underscore the value of "model organisms" for accelerating progress in the identification of human genes by homology - an explicit goal of the U.S. Genome Program (5). If one is searching for exons in human genomic DNA, a statistically significant match to a cDNA, whether it be from humans, nematodes, rice, maize or yeast, is the best proof (apart from an experiment) that an exon has been found. dbEST may be searched using the BLAST (2) e-mail or network services and full reports on individual ESTs may be obtained via NCBI's retrieve e-mail server (6). The capability of retrieving ESTs based on their chromosome assignment and map location has recently been implemented. Instructions on submitting new sequence and mapping data are available (6). World Wide Web access is also provided at http://www.ncbi.nlm.nih.gov/. An NCSA Mosaic interface (7) allows complex (Boolean) queries of dbEST to be performed. Mark S. Boguski, Carolyn M. Tolstoshev National Center for Biotechnology Information National Library of Medicine National Institutes of Health Bldg. 38A, 8600 Rockville Pike, Bethesda, MD 20894, USA Douglas E. Bassett, Jr. Johns Hopkins University School of Medicine, 725 North Wolfe Street, Baltimore, MD 21205, USA ---------------------------------------------------------------------------- *dbEST release 2.27 contained 50,214 DNA sequences from 22 different organisms. Information on the current release is available via the World Wide Web at http://www.ncbi.nlm.nih.gov/dbEST/index.html. **A detailed summary of these homologies with dbEST sequences in is available in Postscript, GIF and HTML formats on the dbEST Home Page at the URL specified above. We thank Dan Jacobson for instructing us on how to provide the HTML links to OMIM entries (McKusick, V. Online Mendelian Inheritance in Man. The Johns Hopkins University, Baltimore, MD). ----------------------------------------------------------------------------- References and Notes 1. A. Ballabio, Nature Genet. 3, 277-279 (1993). 2. S. F. Altschul, M. S. Boguski, W. Gish, J. C. Wootton, Nature Genet. 6, 119-129 (1994). The TBLASTN program is essential for EST homology searching. TBLASTN takes a protein query sequence and compares it against conceptual translations of DNA sequences in all six reading frames. This is much more sensitive than nucleotide vs. nucleotide comparisons for detecting more distant, cross-phylum relationships (D.J. States, S.F. Altschul, Methods 3, 66-70 (1991)). Indeed most of the homologs representing inexact matches would not have been detected by searching GenBank for nucleotide sequence similarities alone. 3. M. S. Boguski, T. M. J. Lowe, C. M. Tolstoshev, Nature Genetics 4, 332-333 (1993). Although all dbEST sequences are also present in the EST Division of GenBank (D. Benson, D.J. Lipman, J. Ostell, Nucl. Acids Res. 13, 2963-2965 (1993)), dbEST contains additional value-added annotation such as the latest homologies, mapping data and contact information for obtaining physical DNA clones. Note that in addition to cDNA data, dbEST contains some genomic sequences that have been isolated by exon "trapping" or "amplification" (e.g. A.J. Buckler, et al. Proc. Natl. Acad. Sci. USA 88, 4005-4009 (1991)). 4. M. D. Adams, et al., Science 252, 1651-6 (1991); A. S. Kahn, et al., Nature Genet. 2, 180-185 (1992); K. Okubo, et al., Nature Genet. 2, 173-179 (1992); R. Waterston, et al., Nature Genet. 1, 114-123 (1992). 5. F. Collins, D. Galas, Science 262, 43-46 (1993). 6. The e-mail address for BLAST is blast@ncbi.nlm.nih.gov and the address for database records is retrieve@ncbi.nlm.nih.gov. To receive documentation, send a message containing the work 'help' (unquoted) in the body of the message. For specific information on dbEST, place the instruction 'datalib dbest' (unquoted) on a line preceding 'help.' For information on the BLAST network service, send e-mail to blast- help@ncbi.nlm.nih.gov. For information on submitting data send e-mail to info@ncbi.nlm.nih.gov. For other questions, telephone 301-496-2475 and ask for the service desk. 7. B.R. Schatz, J.B. Hardin, Science 265, 895-901 (1994). From owner-genome-program@net.bio.net Wed Sep 28 23:00:00 1994 Path: biosci!ucl.ac.uk!R.Sargesson From: R.Sargesson@ucl.ac.uk (Roy Sargesson) Newsgroups: bionet.molbio.genome-program Subject: Joining request - instryctions needed!? Date: 29 Sep 1994 01:39:32 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 14 Sender: daemon@net.bio.net Distribution: world Message-ID: <199409290839.BAA04264@net.bio.net> NNTP-Posting-Host: net.bio.net Join R.Sargesson@ucl.ac.uk Roy Sargesson ==== Draft Signature ==== Rayne Institute UCL Med School Telephone 0171 387 9300 ex 5313 email R.Sargesson ***** From owner-genome-program@net.bio.net Wed Sep 28 23:00:00 1994 Path: biosci!AI.SRI.COM!pkarp From: pkarp@AI.SRI.COM (Peter Karp) Newsgroups: bionet.molbio.genome-program Subject: Meeting on the Interconnection of Molecular Biology Databases Date: 29 Sep 1994 15:16:24 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 52 Sender: daemon@net.bio.net Distribution: world Message-ID: NNTP-Posting-Host: net.bio.net There is tremendous synergy between the roughly 100 existing molecular-biology databases. Once these databases are interconnected, biologists will be able to integrate diverse sources of information to answer questions that are laborious or impossible to tackle today. A workshop entitled ``Interconnection of Molecular Biology Databases'' was held at Stanford University on August 9-12, 1994. The workshop was sponsored by the National Science Foundation and by the Biomatrix Society, and was organized by Dr. Peter D. Karp of the SRI International Artificial Intelligence Center, with program committee assistance. The meeting brought together 55 bioinformatics researchers, computer scientists, and biologists from nine countries. The participants included members of genome centers at Baylor College of Medicine, the University of Pennsylvania, the Whitehead Institute, Lawrence Berkeley Laboratory, Lawrence Livermore National Laboratory, Genethon, and the Sanger Centre. The workshop surveyed existing molecular-biology databases and the requirements for interoperation among them. Computer scientists presented an overview of the database-operation problem, and of techniques for solving it. Participants described a wide range of approaches to interoperation of molecular-biology databases, that are generating practical results. Existing systems allow multidatabase queries to databases such as Genbank, GDB, and PDB. There now exists no single, final resolution to the interoperation problem. Current approaches differ along a variety of dimensions including ability to handle complex queries, difficulty of implementation, required user expertise, and scalability. An understanding of these dimensions is important when deciding what techniques to employ for a given collection of databases and a given scientific community. The workshop identified a number of barriers to interoperation, such as resistance to standards, inaccessibility of existing databases to structured query via Internet, and poor documentation of many databases. But interoperation is proceeding at a rapid pace that promises to fuel scientific discovery. Scientists can use the Internet to access the following hypertext documents from the SRI International Web servers starting at URL http://www.ai.sri.com/people/pkarp/mimbd.html: o The final report of the workshop o Abstracts from the workshop participants o The meeting agenda o The call for participation and summary of workshop goals o Contact information for workshop participants o A summary of biological databases, including Web pointers to many of them