From owner-maize@net.bio.net Wed Dec 01 20:09:41 1999 Path: hgmp.mrc.ac.uk!warwick!fu-berlin.de!headwall.stanford.edu!newsfeed.stanford.edu!biosci!biosci!not-for-mail From: Karen Schumaker Newsgroups: bionet.maize Subject: Correction - Faculty Position Date: 1 Dec 1999 12:03:45 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 24 Sender: daemon@net.bio.net Approved: msachs@uiuc.edu Distribution: world Message-ID: <38457C49.5404B2B5@ag.arizona.edu> Reply-To: schumake@ag.arizona.edu NNTP-Posting-Host: net.bio.net Xref: hgmp.mrc.ac.uk bionet.maize:131 Assistant Professor, Plant Development Department of Plant Sciences University of Arizona This tenure-track position (80% research and 20% teaching) is available at the Assistant Professor level on July 1, 2000. The successful candidate is expected to conduct an independent research program that integrates structural and molecular genetic approaches to understand fundamental processes underlying plant development. The candidate will teach an undergraduate course in plant developmental anatomy and participate in the teaching of a graduate course in plant development. The position requires a Ph.D. degree in an appropriate field with a research emphasis in developmental biology. Applicants must have outstanding research and communication skills, and have the ability to attract extramural grant funding. The salary will depend upon qualifications and experience. Review of applications will begin January 10, 2000 and continue until the position is filled. Applicants should send a curriculum vitae, statements of research and teaching interests, and arrange to have three letters of recommendation sent to: Dr. Karen Schumaker, Chair, Plant Development Search Committee, Department of Plant Sciences, The University of Arizona, Tucson, AZ 85721 (e-mail: schumake@ag.arizona.edu; phone: (520) 621-9635). THE UNIVERSITY OF ARIZONA IS AN EEO/AA/ADA EMPLOYER From owner-maize@net.bio.net Thu Dec 02 03:18:12 1999 Path: hgmp.mrc.ac.uk!warwick!server5.netnews.ja.net!server3.netnews.ja.net!baron.netcom.net.uk!netcom.net.uk!dispose.news.demon.net!demon!nntp.primenet.com!nntp.gctr.net!newsfeed.berkeley.edu!newsfeed.stanford.edu!biosci!biosci!not-for-mail From: Karen Schumaker Newsgroups: bionet.maize Subject: Faculty Position, Plant Development Date: 1 Dec 1999 09:42:53 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Sender: daemon@net.bio.net Approved: msachs@uiuc.edu Distribution: world Message-ID: <38455A3E.FBA2C1AD@ag.arizona.edu> Reply-To: schumake@ag.arizona.edu NNTP-Posting-Host: net.bio.net Lines: 24 Xref: hgmp.mrc.ac.uk bionet.maize:132 Assistant Professor, Plant Development Department of Plant Sciences University of Arizona This tenure track position (80% research and 20% teaching) is available at the Assistant Professor level on July 1, 2000. The successful candidate is expected to conduct an independent research program that integrates structural and molecular genetic approaches to understand fundamental processes underlying plant development. The candidate will teach an undergraduate course in plant developmental anatomy and participate in the teaching of a graduate course in plant development. The position requires a Ph.D. degree in an appropriate field with a research emphasis in developmental biology. Applicants must have outstanding research and communication skills, and have the ability to attract extra mural grant funding. The salary will depend upon qualifications and experience. Review of applications will begin January 10, 2000 and continue until the position is filled. Applicants should send a curriculum vitae, statements of research and teaching interests, and arrange to have three letters of recommendation sent to: Dr. Karen Stomacher, Chair, Plant Development Search Committee, Department of Plant Sciences, The University of Arizona, Tucson, AZ 85721 (e-mail: schumake@ag.arizona.edu; phone: (520) 621-9635). THE UNIVERSITY OF ARIZONA IS AN EEO/AA/ADA EMPLOYER From owner-maize@net.bio.net Thu Dec 02 14:39:45 1999 Path: hgmp.mrc.ac.uk!pegasus.csx.cam.ac.uk!warwick!fu-berlin.de!newsfeed.direct.ca!logbridge.uoregon.edu!newsfeed.stanford.edu!biosci!biosci!not-for-mail From: Steve Haines Newsgroups: bionet.maize Subject: Maize Root RNA Extraction Date: 2 Dec 1999 06:39:03 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 16 Sender: daemon@net.bio.net Approved: msachs@uiuc.edu Distribution: world Message-ID: <3846307D.11B7B0D6@bbsrc.ac.uk> Reply-To: maize@net.bio.net, Steve Haines NNTP-Posting-Host: net.bio.net Xref: hgmp.mrc.ac.uk bionet.maize:133 Dear All, I am looking for a reliable protocol for extracting total RNA from maize root tissue. I want as high a yield as possible. I currently use an SDS based buffer with several phenol/chloroform treatments but I seem to get a very low yield (in some cases no yield at all!!). I hope you can help... Many Thanks Steve Haines Crop Genetics Group IACR-Long Ashton Research Station Bristol BS41 9AF E-mail : stephen.haines@bbsrc.ac.uk From owner-maize@net.bio.net Fri Dec 03 00:39:38 1999 Path: hgmp.mrc.ac.uk!warwick!fu-berlin.de!newsfeed.berkeley.edu!newsfeed.stanford.edu!biosci!biosci!not-for-mail From: Mary Polacco Newsgroups: bionet.maize Subject: Missouri Maize Project announces 47 Newly Mapped SSR's Date: 2 Dec 1999 16:30:56 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 105 Sender: daemon@net.bio.net Approved: msachs@uiuc.edu Distribution: world Message-ID: <199912030013.SAA00252@teosinte.agron.missouri.edu> NNTP-Posting-Host: net.bio.net Xref: hgmp.mrc.ac.uk bionet.maize:134 The Missouri Maize Project announces some 47 newly mapped SSR primer pairs which may also be accessed at MaizeDB, http://www.agron.missouri.edu/ssr.html The below file lists the SSR primer pair name, the bins map location, GenBank accessions from which the SSR were detected, and the primers. Cheers, mary polacco umc1305 1.00- 1.02 AI947344 CAATTTGATGCTGGGATTCAGATA TGCTGTGTGTTTGATGCTTTAGTTT umc1269 1.01- 1.02 AI941989 TATATTAGAGGCACCTCCCTCCGT AGCTGCTTCAGCGACTTTGG umc1321 1.03- 1.06 AI901504 GATTTAAATTAGTAGCCGCCGTCC CCACCTGCAGATGTACAGAACAGT umc1297 1.05- 1.06 AI947917 TGGTCACTGACTGTTTCGACTAGC ATCGCCTCAACACACCTTCATATT umc1323 1.06- 1.05 AI901470 TTGCACCCCGTTATTATCCTACAG CCAGACTAGAGTGCCATGATCCTT umc1335 1.06- 1.07 AI861498 ATGGCATGCATGTGTTTGTTTTAC ACAGACGTCGCTAATTCCTGAAAG umc1298 1.09- 1.10 AI947839 AGCTGAACAAAATAAACGGAACGA AGGACAAGAAAAAGAAGAAGCACG umc1306 1.09- 1.11 AI944111 CGAAACAAAACACCCAGCAGTAGT CCAGGATGAATAAATCGTATTGCC umc1326 2.04 AI881970 GACCAAAGAATTCCCTCCCCTA TACCTAGTACTCGGCCAGTTCCTC umc1300 3.04- 3.06 AI947741 TCTGAACGCACTGGGAACATAGTA AGAATAATGGACGGTTCCTCTGG umc1311 3.05- 3.06 AI939856 CTCGACAACTTTTGGCTTCGTACT AAAGCGATGCCATCAGAATCTAAG umc1320 3.08 AI902115 TGCGAAATCTGTATACCATAGGCA CTCTTTTAGCAGTGTGCCGAATTT umc1273 3.08- 3.09 AI948095 GTTCGCTGCTGCTTCTTATATGCT AATTGGCGCAGGCTATAGACATTT umc1294 4.00- 4.04 AI948003 GCCGTCAACGGGCTTAAACT GCCTCCAGCTCTCTCGTCTCTT umc1288 4.02- 4.03 AI948003 ATCCGGACAAATTGAACTTTCATC ATAGATTCAGTGTTGGACCGAGGA umc1303 4.04- 4.05 AI947696 CTTGGTAGCTTCGTATTCGACGAG ATCCTAGGAAAGCAGGGAGGG umc1317 4.04- 4.07 AI920379 GCTAATGTTGCCTGTTGGCATAG CCGACTCCGAGTAGCTTTCGT umc1346 4.05 AI881378 TCTGATCTCTTCGGTGCTAGAGAAA AAGAGATCTCCCAACCCTAACTGC umc1299 4.06- 4.07 AI947817 CTTGGGTTCTTCTCTCCTATGGGT CGCTACAAACAAGTGGCGTTTAAT umc1329 4.06- 4.07 AI881613 CCTCTCACATCTCCTCTCCCCT GTGTCGGTGTAGGTCTCCGTCTT umc1313 4.08- 4.10 AI920754 GCTGTCTGTGACCAAGTTTCCTCT TGAAGAACAGGGACGTGATGATAA umc1328 4.08- 4.10 AI881634 TACAAGGAGGAGGCCGCTGT ATCCAGTCTCCGGACTTCCAAC umc1308 5.00- 5.01 AI943731 GCAGATGGACACAAACAAATGAAG GCTACTGATGCTGGCAATCTTACA umc1315 5.03 AI920576 CTTCAGTCCCCTACCTACCCTGAG GAGTTGGGATGAGCAGCAAGATAG umc1341 6.05- 6.07 AF073330 GTCTACCAGGACGTTTACCTGTGG CCTCAATCCTTTGTGGACAAACAC umc1296 6.06- 6.08 AI947918 CTCTCCCGGCTCTGACCTAGC GCTGGAGATAGGCATCCAGACAC umc1324 7.03- 7.04 AI901427 ATCCATCATCATCATCATTGCTTG ATGTCATCATGTACCAGGTGTTGG umc1295 7.03- 7.10 AI947923 GTCGATCTTCCTCCCCATCA CGTTTCTATCTATGGAGGAGTGCG umc1342 7.04- 7.05 AI944014 TCTAATCCAATCGACATCGACAGA TCGCCCTCTTTTCTTTTCTTTTCT umc1327 8.01- 8.02 AI881644 AGGGTTTTGCTCTTGGAATCTCTC GAGGAAGGAGGAGGTCGTATCGT umc1302 8.03- 8.04 AI947718 ATTTATTCAAACCGACGAAGCAAC TACAAGCGCTACTGCGATGTCTT umc1343 8.04- 8.06 AJ238507 CTTCCTGGCACGTAACATTACCAT ATCGGTCTTCCAACCAGATCATTA umc1309 8.05 AJ238507 CTCTCATTAGTTCGTGCCAGTCAA CCAGAAATCAGAGGAAGCTCTCAG umc1316 8.05 AI920488 CAGGGCACATAGTTTCAGATGTTG GGGATAAGTCTCTCCCTCGTTTGT umc1340 8.05 AI947716 GATGTCTCTATGGAACCCAGCAAC GAGACGCCTACGAGTACCACAACT umc1287 8.05- 8.06 AI979450 ATGGGATGATCAGTCGTTTCAGTC AGAAGGAGGCCCACTACGAGAG umc1271 9.02- 9.05 AI948396 CTCTCCTCGTCCGGTAATTAAGC GCTTCTTCTTCTTGCGCTTCTCT umc1231 9.03- 9.05 CTGTAGGGCTGAGAAAAGAGAGGG CGACAACTTAGGAGAACCATGGAG umc1310 9.06- 9.08 AI939884 AACTCCGAGATCTACGACAACAGC GAGGAAGAGTTGGCCAGGATG umc1293 10.00-10.02 AI977907 GATCTCGATCTGCTTCATCATCTG GTATCCGTTTCTCATGCAACACAC umc1318 10.01-10.02 AI902041 ACTTCGTCTAGTGTCCCTCCGTT TGCCAGATTAAAAGCAACACAAGA umc1319 10.01-10.03 AI902130 TGAGAGCCACCTTCTTGAGCTACT TTCCTTGAAGGCGAAGGTAGGTAT umc1345 10.03 AI881397 ACCGCAGCAGCAGAGAAGAG GAACATCTGGGTCACCTCTGTCAT umc1312 10.03-10.04 AI932183 AAAGTTACTGCTGCCAAAGCTGTC AGATCGAGCGGTGGATATGGT umc1336 10.03-10.04 AI861156 GTACAAATGATAAGCAAGGGGCAG CTCTGTTTTGGAAGAAGCTTTTGG umc1272 10.03-10.05 AI948375 CTCTGACAGACCTGCAGATAGGGT ATCGAGGGGCTAATCAGCAAG umc1344 10.07 AB024291 GCGCTCTGACTTAATTAGAGGAGTTG GGCAGCAGATCTATGTCCAAGAAG From owner-maize@net.bio.net Mon Dec 06 22:39:36 1999 Path: hgmp.mrc.ac.uk!server1.netnews.ja.net!fu-berlin.de!newsfeed.berkeley.edu!newsfeed.stanford.edu!biosci!biosci!not-for-mail From: tony pryor Newsgroups: bionet.maize Subject: 42nd Annual Maize Genetics Conference Date: 6 Dec 1999 14:25:24 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 55 Sender: daemon@net.bio.net Approved: msachs@uiuc.edu Distribution: world Message-ID: <3.0.32.19991207091528.0069ac2c@pican> NNTP-Posting-Host: net.bio.net Xref: hgmp.mrc.ac.uk bionet.maize:135 42nd Annual Maize Genetics Conference March 16-19, 2000 Coeur d'Alene Resort Coeur d'Alene, ID USA Additional information on the meeting is available at the Maize Genome Database Website at http://www.agron.missouri.edu/ FEATURED SPEAKERS: The keynote speaker topics are: Dr. John Doebley University of Wisconsin Genetics Dept. Genetic evidence and the evolution of maize; Dr. Jane Langdale University of Oxford Dept. of Plant Sciences, Cellular differentiation in maize leaves; Dr. Elliot Meyerowitz California Institute of Technology Division of Biology, Cell-cell communication in the Arabidopsis shoot apical meristem; Dr. Graham Moore John Innes Centre Cereals Dept.; Wheat, a model or commodity - chromosome pairing and polyploidy TOPICS: Molecular Genetics Development Cytogenetics Biochemical genetics Transposable elements Mutation and transmission genetics. WORKSHOPS: Comparative Genomics Maize Genomic and Internet Resources CONTENT: Attended by approximately 400 scientists, the annual Maize Genetics Conference convenes for three days to discuss recent research results and technical advances. Featured speakers will give overviews of rapidly moving fields. There will be approximately 40 short talks and 100 posters. Information on participation in the oral and poster presentations will be sent with the registration materials or can be obtained by contacting the meeting co-chairs, Rebecca Boston, Dept. of Botany, Box 7612, NC State Univ., Raleigh, NC 27695, boston@unity.ncsu.edu or Sue Wessler, Dept. of Genetics, Life Sciences Bldg., University of Georgia, Athens, GA 30602, sue@dogwood.botany.uga.edu Tony Pryor CSIRO Plant Industry GPO Box 1600 Canberra ACT 2601 Australia Tel Int. 61 (0)2 6246 5494 Fax 6246 5000 Email tony.pryor@pi.csiro.au From owner-maize@net.bio.net Tue Dec 07 03:25:14 1999 Path: hgmp.mrc.ac.uk!pegasus.csx.cam.ac.uk!daresbury!uninett.no!news.algonet.se!algonet!newsfeed.berkeley.edu!newsfeed.stanford.edu!biosci!biosci!not-for-mail From: Jeanne Romero-Severson Newsgroups: bionet.maize Subject: Genomics Lab Manager position Date: 6 Dec 1999 19:15:49 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 22 Sender: daemon@net.bio.net Approved: msachs@uiuc.edu Distribution: world Message-ID: <384C4E0E.5D378B7F@fnr.purdue.edu> NNTP-Posting-Host: net.bio.net Xref: hgmp.mrc.ac.uk bionet.maize:136 To any interested person: I have a permanent full-time hard money position with full benefits. The position is open now and will remain open until a suitable applicant is found. http://www.fnr.purdue.edu/Dept/pos-opening/position.htm This site has the position description. Regards J. Romero-Severson Purdue University Department of Forestry and Natural Resources Room 206C WSLR 1159 Forestry Bldg. West Lafayette, IN 47907-1159 phone: 765 496-6801 fax: 765 496-2422 E-mail: romeros@fnr.purdue.edu From owner-maize@net.bio.net Tue Dec 07 16:40:20 1999 Path: hgmp.mrc.ac.uk!guardian!warwick!server1.netnews.ja.net!fu-berlin.de!enews.sgi.com!newsfeed.berkeley.edu!newsfeed.stanford.edu!biosci!biosci!not-for-mail From: Christopher Newsgroups: bionet.maize Subject: cDNA library from diploperennis? Date: 7 Dec 1999 06:43:28 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 10 Sender: daemon@net.bio.net Approved: msachs@uiuc.edu Distribution: world Message-ID: <19991207085316.45202.qmail@hotmail.com> NNTP-Posting-Host: net.bio.net Xref: hgmp.mrc.ac.uk bionet.maize:137 We are working on the phylogeny of ccr1 and ccr2 genes isolated from Zea mays we are looking for a cDNA library from Zea diploperennis for the isolation of similar homologs. If any one is willing, please respond. Christopher CNRS Tolouse France From owner-maize@net.bio.net Tue Dec 07 19:09:44 1999 Path: hgmp.mrc.ac.uk!server1.netnews.ja.net!fu-berlin.de!newsfeed.direct.ca!newsfeed.berkeley.edu!newsfeed.stanford.edu!biosci!biosci!not-for-mail From: Lisa Harper Newsgroups: bionet.maize Subject: Winter GH Date: 7 Dec 1999 10:50:50 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 27 Sender: daemon@net.bio.net Approved: msachs@uiuc.edu Distribution: world Message-ID: Reply-To: maize@net.bio.net, Lisa Harper NNTP-Posting-Host: net.bio.net Xref: hgmp.mrc.ac.uk bionet.maize:138 Dear Fellow Maize Folks, We are trying to fix up a very small old greenhouse room so that we can grow plants and harvest good male meiocytes through the winter (Nov-Feb are hard for us). We have played with a lot of conditions, but we are still getting tip rot and many of the plants have sterile shrivelled anthers. Some that make good looking anthers actually have meiocytes arrested at pachytene with a thickened wall. The current conditions are: Specs: 250 square feet. 4 metal halid lamps with new bulbs lights on from 6 am to 10 pm plants potted in sterile soil (not peet) 82-85 degrees day and night there is a fan on day (high speed) and night (Low speed) Anyone have any ideas how we can improve our situation? If you have perfectly shedding plants in your green house right now, in Dec, can you let me know how you do it? I would be happy to contact your greenhouse manager if that is easiest. Thank you very much! Lisa Harper Cande Lab Department of Molecular and Cell Biology 345 LSA University of California Berkeley, CA 94720-3200 (510)-643-8277 From owner-maize@net.bio.net Tue Dec 07 20:09:38 1999 Path: hgmp.mrc.ac.uk!server1.netnews.ja.net!fu-berlin.de!newsfeed.berkeley.edu!newsfeed.stanford.edu!biosci!biosci!not-for-mail From: Erin Irish Newsgroups: bionet.maize Subject: Re: Winter GH Date: 7 Dec 1999 12:14:24 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 34 Sender: daemon@net.bio.net Approved: msachs@uiuc.edu Distribution: world Message-ID: Reply-To: maize@net.bio.net, Lisa Harper NNTP-Posting-Host: net.bio.net Xref: hgmp.mrc.ac.uk bionet.maize:139 Dear Lisa, I stopped tip rot in the winter when I switched to a bark-based potting mix and begged the GH staff not to overwater! I have not been going for meiocytes, so don't know if this will do it, but it can't hurt. These short days are tough on some waterers who are still thinking August when they douse the plants, it seems. So if you can get good drainage around the roots, the plants will be a lot happier. Erin >Dear Fellow Maize Folks, > > We are trying to fix up a very small old greenhouse room so that we >can grow plants and harvest good male meiocytes through the winter (Nov-Feb >are hard for us). We have played with a lot of conditions, but we are >still getting tip rot and many of the plants have sterile shrivelled >anthers. Some that make good looking anthers actually have meiocytes >arrested at pachytene with a thickened wall. The current conditions are: >Specs: 250 square feet. > 4 metal halid lamps with new bulbs > lights on from 6 am to 10 pm > plants potted in sterile soil (not peet) > 82-85 degrees day and night > there is a fan on day (high speed) and night (Low speed) > > Anyone have any ideas how we can improve our situation? If you >have perfectly shedding plants in your green house right now, in Dec, can >you let me know how you do it? I would be happy to contact your greenhouse >manager if that is easiest. Thank you very much! > >Lisa Harper From owner-maize@net.bio.net Tue Dec 07 21:09:10 1999 Path: hgmp.mrc.ac.uk!server1.netnews.ja.net!fu-berlin.de!news.maxwell.syr.edu!news.msfc.nasa.gov!bcm.tmc.edu!biosci!biosci!not-for-mail From: Martin Spalding Newsgroups: bionet.maize Subject: Graduate Opportunities in Plant Physiology/Molecular Biology Date: 7 Dec 1999 13:09:50 -0800 Organization: Iowa State University, Ames, Iowa, USA Lines: 31 Sender: daemon@net.bio.net Approved: msachs@uiuc.edu Distribution: world Message-ID: <384D71D5.79DB38BF@iastate.edu> NNTP-Posting-Host: net.bio.net Xref: hgmp.mrc.ac.uk bionet.maize:140 Graduate Assistantships and Fellowships Iowa State University, Ames, IA The Plant Physiology Interdepartmental Graduate Program at Iowa State University is pleased to announce the availability of graduate fellowships and assistantships for study in plant physiology and plant molecular biology. The Plant Physiology Program includes 28 research-active faculty from seven different departments and provides research opportunities stressing the development of a strong background in fundamental biology, biochemistry, and molecular biology. The available Assistantships and Fellowships provide outstanding candidates with funding for the first year of study, during which time students perform laboratory research rotations with any of the Plant Physiology Faculty. Continuing funding will be provided by the major professor, who will be chosen by the end of the first year. To obtain application forms and more information about the Plant Physiology Program, please contact us by email (ippm@iastate.edu), visit our Homepage (http://www.public.iastate.edu/~ippm) or send inquiries to: Plant Physiology Graduate Admissions, 353 Bessey Hall, Iowa State University, Ames, IA 50011 -- **************************************************************************** Martin H. Spalding, Chair Ph: (515) 294-1749 Interdept Plant Physiology Major FAX: (515) 294-1337 Iowa State University e-mail: ippm@iastate.edu Ames, Iowa 50011 http://www.public.iastate.edu/~ippm http://www.plantsciences.iastate.edu/ ***************************************************************************** From owner-maize@net.bio.net Tue Dec 07 22:09:40 1999 Path: hgmp.mrc.ac.uk!server1.netnews.ja.net!fu-berlin.de!headwall.stanford.edu!newsfeed.stanford.edu!biosci!biosci!not-for-mail From: Virginia Walbot Newsgroups: bionet.maize Subject: Re: Winter GH Date: 7 Dec 1999 14:15:07 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 45 Sender: daemon@net.bio.net Approved: msachs@uiuc.edu Distribution: world Message-ID: <4.1.19991207135348.0094bd40@walbot.pobox.stanford.edu> Reply-To: maize@net.bio.net, Lisa Harper NNTP-Posting-Host: net.bio.net Xref: hgmp.mrc.ac.uk bionet.maize:141 night 65-70 day >85 1/2 metal halide and 1/2 sodium vapor lights plus a few fluorescent "black light" or near UV-blue lights (highly reflected radiation so can be placed almost anywhere in the greenhouse) At 10:30 AM 12/7/99 -0800, you wrote: >Dear Fellow Maize Folks, > > We are trying to fix up a very small old greenhouse room so that we >can grow plants and harvest good male meiocytes through the winter (Nov-Feb >are hard for us). We have played with a lot of conditions, but we are >still getting tip rot and many of the plants have sterile shrivelled >anthers. Some that make good looking anthers actually have meiocytes >arrested at pachytene with a thickened wall. The current conditions are: >Specs: 250 square feet. > 4 metal halid lamps with new bulbs > lights on from 6 am to 10 pm > plants potted in sterile soil (not peet) > 82-85 degrees day and night > there is a fan on day (high speed) and night (Low speed) > > Anyone have any ideas how we can improve our situation? If you >have perfectly shedding plants in your green house right now, in Dec, can >you let me know how you do it? I would be happy to contact your greenhouse >manager if that is easiest. Thank you very much! > >Lisa Harper >Cande Lab >Department of Molecular and Cell Biology >345 LSA >University of California >Berkeley, CA 94720-3200 >(510)-643-8277 Virginia Walbot Department of Biological Sciences MC5020 385 Serra Mall Stanford University Stanford CA 94305-5020 Phone 650-723-2227 FAX 650-725-8221 http://www.stanford.edu/~walbot Stanford Laboratory http://www.zmdb.iastate.edu/ Maize Gene Discovery Project From owner-maize@net.bio.net Tue Dec 14 10:21:03 1999 Path: hgmp.mrc.ac.uk!not-for-mail From: cgriffin@wco.com (Chandi Griffin) Newsgroups: bionet.maize Subject: ABRF MICROARRAY USER SURVEY Date: 14 Dec 1999 10:21:02 -0000 Organization: Verio Lines: 57 Approved: msachs@uiuc.edu Message-ID: <8355me$f44$1@mercury.hgmp.mrc.ac.uk> NNTP-Posting-Host: mercury.hgmp.mrc.ac.uk X-Trace: niobium.hgmp.mrc.ac.uk 945166863 6019 193.62.192.80 (14 Dec 1999 10:21:03 GMT) X-Complaints-To: news@hgmp.mrc.ac.uk NNTP-Posting-Date: 14 Dec 1999 10:21:03 GMT Xref: hgmp.mrc.ac.uk bionet.maize:142 To all investigators involved in microarray technologies: The 1999/2000 ABRF MICROARRAY RESEARCH GROUP STUDY is open for submissions as of December 10, 1999. The goal of this study is to build a current picture of the microarray analysis world. Microarray analysis is a fast developing field. New methods and instrumentation are being constantly introduced and the number of investigators using the technology is rapidly expanding. We are focusing on both Affymetrix and cDNA related technologies. Laboratories using these technologies can participate in our study by filling out a web based survey form. The form is used to collect information such as instrumentation, protocols, staffing, funding, and throughput. This data will be analyzed to build a current profile of microarray analysis laboratories. The survey from is posted at http://brcweb.bio.cornell.edu/surveys/microsurvey.html. The survey is geared to gathering information from academic, pharmaceutical, and commercial laboratories that offer microarray technologies as a shared resource. Individual laboratories that have these technologies are also welcome to participate in the survey. In addition, microarray instrument and related manufacturers are welcome to submit data. However, data from manufacturers must be clearly identified and will be analyzed separately from the pool of data submitted anonymously by all other laboratories. An analysis of data submitted to this survey will be presented at the ABRF2000 meeting in February 2000 (http://www.faseb.org/meetings/abrf2000) and will then be posted on the web. We appreciate your participation in this study. The ABRF Microarray Research Group: George Grills, Albert Einstein College of Medicine, Bronx, NY (chair) Chandi Griffin, Gen. Clin. Res. Ctr., University of California, San Francisco,CA Kathryn Lilley, University of Leicester, UK Aldo Massimi, Albert Einstein College of Medicine, Bronx, NY Yongde Bao, University of Virginia School of Medicine, Charlottesville, VA (ad hoc) Suzanne Sandmeyer, University of California, Irvine, CA (ad hoc) James VanEe, Cornell University, Ithaca, NY (ad hoc) ------------------------------------------------------------------ Please direct questions about participation in this study to George Grills at grills@aecom.yu.edu Chandi Griffin GCRC: Molecular Biology Core Laboratory & GCRC GeneChip Contact Univ. of California, San Francisco/San Francisco General Hospital E-mail: aniya@itsa.ucsf.edu --- From owner-maize@net.bio.net Tue Dec 14 14:33:46 1999 Path: hgmp.mrc.ac.uk!not-for-mail From: dab@cnsvax.albany.edu (Dmitry Belostotsky) Newsgroups: bionet.maize Subject: Faculty position Date: 14 Dec 1999 14:33:46 -0000 Organization: MRC Human Genome Mapping Project Resource Centre Lines: 41 Approved: msachs@uiuc.edu Message-ID: <3854DEF9.5A2A@cnsvax.albany.edu> NNTP-Posting-Host: mercury.hgmp.mrc.ac.uk X-Trace: niobium.hgmp.mrc.ac.uk 945182026 9581 193.62.192.80 (14 Dec 1999 14:33:46 GMT) X-Complaints-To: news@hgmp.mrc.ac.uk NNTP-Posting-Date: 14 Dec 1999 14:33:46 GMT Xref: hgmp.mrc.ac.uk bionet.maize:143 FACULTY POSITION: STATE UNIVERSITY OF NEW YORK, ALBANY, NY (The full ad appears in Dec. 3 Science v.286, #5446, p.2011). Department of Biological Sciences seeks a tenure track Assistant Professor, or tenured Associate Professor studying Developmental Genetics of model eukaryotes. The successful candidate is expected to establish or (for Associate Professor level appointment) already have an externally funded research program and to participate in undergraduate and graduate teaching. Department of Biological Sciences has a large and diverse group of active researchers working with a number of model organisms including Arabidopsis and maize. The Department has launched a university wide initiative in Comparative Functional Genomics. A $2.5M grant is being used to establish and staff new core facilities in molecular biology and transgenesis. Construction of a new 160 000 sq. ft. Life Sciences building will begin in summer 2000. Departmental homepage can be found at http://www.albany.edu/biology To apply, send a CV, research statement and at least 3 reference letters to the Chair of the search Committee, Department of Biological Sciences, State University of New York at Albany, 1400 Washington Ave., Albany NY 12222. Review of applications will begin on January 3, 2000 and continue until the position is filled. -- -------------------------------------------------------------- Dmitry A. Belostotsky Assistant Professor Department of Biological Sciences State University of New York at Albany 1400 Washington Ave. Albany NY 12222 Tel. (518) 442 4368 FAX (518) 442 4767 E-mail dab@cnsvax.albany.edu http://www.albany.edu/faculty/dab/index.html -------------------------------------------------------------- --- From owner-maize@net.bio.net Tue Dec 14 14:41:58 1999 Path: hgmp.mrc.ac.uk!not-for-mail From: rnielsen@purdue.edu ("Robert Nielsen") Newsgroups: bionet.maize Subject: RE: Question about hybrids Date: 14 Dec 1999 14:41:57 -0000 Organization: MRC Human Genome Mapping Project Resource Centre Lines: 44 Approved: msachs@uiuc.edu Message-ID: <000401bf4634$db08e460$7238d280@CORN.AGRONOMY> References: <19991129165702.21349.qmail@hotmail.com> Reply-To: maize@net.bio.net, "Christian Leihner" NNTP-Posting-Host: mercury.hgmp.mrc.ac.uk X-Trace: niobium.hgmp.mrc.ac.uk 945182518 9737 193.62.192.80 (14 Dec 1999 14:41:58 GMT) X-Complaints-To: news@hgmp.mrc.ac.uk NNTP-Posting-Date: 14 Dec 1999 14:41:58 GMT Xref: hgmp.mrc.ac.uk bionet.maize:144 Dear Chris, Amazingly, there is little general information on the Web about the production of maize hybrids. One of our pubs offers a cursory description at: http://www.agcom.purdue.edu/AgCom/Pubs/NCH/NCH-29.html :>)bob From: ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Dr. R.L. (Bob) Nielsen Professor of Agronomy Agronomy Department/Purdue University West Lafayette, Indiana 47907-1150 Office ph. 765 494 4802 Dept. FAX 765 496 2926 Campus Email: rnielsen@purdue.edu Home Email: nielsen@gte.net Check out the Corn Growers Guidebook at... http://www.kingcorn.org ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ > -----Original Message----- > From: Christian Leihner [mailto:rockaz9@hotmail.com] > Sent: Monday, November 29, 1999 11:57 AM > To: nobody@net.bio.net > Subject: Question about hybrids > > > Hello, I am a student from the vocational school for agricultural > sciences in Nürtingen, Germany. I need some general informations or > links about how to make maize hybrids ( only in general, not too > specific ) and their advances in areas with bad conditions. > > Thank you for your help ! > > Chris Leihner > --- From owner-maize@net.bio.net Wed Dec 15 17:27:08 1999 Path: hgmp.mrc.ac.uk!not-for-mail From: HancockDC@missouri.edu ("Hancock Jr, Denis C.") Newsgroups: bionet.maize Subject: New web statistics for MaizeDB Date: 15 Dec 1999 17:27:07 -0000 Organization: MRC Human Genome Mapping Project Resource Centre Lines: 29 Approved: msachs@uiuc.edu Message-ID: <52246021B94FD311B4B900609451548D012288D6@umc-mail02.missouri.edu> NNTP-Posting-Host: mercury.hgmp.mrc.ac.uk X-Trace: niobium.hgmp.mrc.ac.uk 945278828 8274 193.62.192.80 (15 Dec 1999 17:27:08 GMT) X-Complaints-To: news@hgmp.mrc.ac.uk NNTP-Posting-Date: 15 Dec 1999 17:27:08 GMT Xref: hgmp.mrc.ac.uk bionet.maize:145 A few months ago we began experimenting with a new, more comprehensive web log analyzer. After making it available locally, we have decided to replace the earlier analysis program (while keeping the older data for historical purposes). The new reports may be found at the following URL: http://www.agron.missouri.edu/webalizer/ This program is free, and links to its maintainer can be found at the bottom of the page. Looking at the tables and graphs, it is quite obvious that the major web search engines are a major mode of access to MaizeDB. It is also obvious that Netscape and MS Explorer are equally significant players in the browser market, and this constrains us to design pages in such a way as to be readable by both browsers. It has been a wild ride this Fall, with a record month for hits in November. The daily graph shows a number of days with unusually high numbers of accesses. ----------------------------------------- Denis C. Hancock , Jr. Sr. Scientific Programmer/Analyst 213 Curtis Hall 573-882-1722 (voice) UMC-Agronomy 573-884-7850 (fax) Columbia MO 65211 HancockDC@missouri.edu --- From owner-maize@net.bio.net Wed Dec 15 19:12:04 1999 Path: hgmp.mrc.ac.uk!not-for-mail From: "john r. schermerhorn" Newsgroups: bionet.maize Subject: black diamond popcorn id# 139927 Date: 15 Dec 1999 19:12:03 -0000 Organization: MRC Human Genome Mapping Project Resource Centre Lines: 11 Approved: msachs@uiuc.edu Message-ID: <838p63$gl1$1@mercury.hgmp.mrc.ac.uk> Reply-To: "john r. schermerhorn" , maize@net.bio.net NNTP-Posting-Host: mercury.hgmp.mrc.ac.uk X-Trace: niobium.hgmp.mrc.ac.uk 945285124 9616 193.62.192.80 (15 Dec 1999 19:12:04 GMT) X-Complaints-To: news@hgmp.mrc.ac.uk NNTP-Posting-Date: 15 Dec 1999 19:12:04 GMT Xref: hgmp.mrc.ac.uk bionet.maize:146 [Forwarded from MaizeDB to bionet.maize] I would like to know where I can purchase a small quantity of this type of popcorn. 5 to 10 lbs for my own use. If this is not possible please let me know. john r. schermerhorn 900 E 12th st. so. newton, iowa 50208 telephone 515 792-0785 From owner-maize@net.bio.net Wed Dec 15 23:27:11 1999 Path: hgmp.mrc.ac.uk!not-for-mail From: "Jara T Wind (S) " Newsgroups: bionet.maize Subject: Question about corn Date: 15 Dec 1999 23:27:10 -0000 Organization: Colorado College Lines: 24 Approved: msachs@uiuc.edu Message-ID: <38581C3E.EB002A81@teosinte.agron.missouri.edu> Reply-To: maize@net.bio.net, "Jara T Wind (S) " NNTP-Posting-Host: mercury.hgmp.mrc.ac.uk X-Trace: niobium.hgmp.mrc.ac.uk 945300430 21022 193.62.192.80 (15 Dec 1999 23:27:10 GMT) X-Complaints-To: news@hgmp.mrc.ac.uk NNTP-Posting-Date: 15 Dec 1999 23:27:10 GMT Xref: hgmp.mrc.ac.uk bionet.maize:147 Forwarding to the maize net. Ed Coe ------ Dear Mr. Coe, My name is Jara Wind and I am a biology student at Colorado College. I received your name from Ralph Bertrand and I have a question about corn production. I'm doing research on fertilizer substitutes and I'm wonderng which is more important data for predicting overall productivity, the number of root branches or the radical root growth. If you could get back to me at your earliest convenience I would really appreciate it. Thank you for your time. Sincerely, Jara Colorado College Worner Box 1098 902 N. Cascade Ave. Colorado Springs, CO 80946 j_wind@ColoradoCollege.edu --- From owner-maize@hgmp.mrc.ac.uk Thu Dec 16 16:13:31 1999 Return-Path: Received: by mercury.hgmp.mrc.ac.uk (Postfix, from userid 110) id 6691517A71; Thu, 16 Dec 1999 16:13:29 +0000 (GMT) Received: by mercury.hgmp.mrc.ac.uk (Postfix, from userid 1) id 0166E17A56; Thu, 16 Dec 1999 16:13:26 +0000 (GMT) To: nobody@net.bio.net X-Really-To: maize@net.bio.net Newsgroups: bionet.maize From: stephen.haines@bbsrc.ac.uk (Steve Haines) Reply-To: maize@net.bio.net, stephen.haines@bbsrc.ac.uk (Steve Haines) Subject: Non-Isotopic Methods for Nitrocellulose Date: 16 Dec 1999 15:55:07 -0000 Organization: IACR-Long Ashton Research Station Message-ID: <38590AE3.B991EEE6@bbsrc.ac.uk> Sender: owner-maize@hgmp.mrc.ac.uk Precedence: bulk Dear All A colleague is looking for non-isotopic methods that can be used with nitrocellulose membranes. Most kits / methods only seem to work with nylon membranes and do not work with nitrocellulose membranes. Any advice would be gratefully received. Many Thanks Steve Haines Crop Genetics Group IACR-Long Ashton Research Station Bristol BS41 9AF UK E-mail : stephen.haines@bbsrc.ac.uk Tel : +44 1275 549412 --- From owner-maize@hgmp.mrc.ac.uk Thu Dec 16 21:09:33 1999 Return-Path: Received: by mercury.hgmp.mrc.ac.uk (Postfix, from userid 110) id 2352617ADC; Thu, 16 Dec 1999 21:09:32 +0000 (GMT) Received: by mercury.hgmp.mrc.ac.uk (Postfix, from userid 1) id 4B14817A9D; Thu, 16 Dec 1999 21:07:25 +0000 (GMT) To: nobody@net.bio.net X-Really-To: maize@net.bio.net Newsgroups: bionet.maize Message-ID: <013601bf4800$ff1c0710$1700000a@epicyte.com> From: "Debby DeMello" References: <011f01bf47f3$7292c6b0$1700000a@epicyte.com> Subject: Job Opportunities in Plant Transformation Date: Thu, 16 Dec 1999 12:06:10 -0800 Sender: owner-maize@hgmp.mrc.ac.uk Precedence: bulk Epicyte Pharmaceutical, Inc., located in San Diego, CA, is producing antibodies for the treatment or prevention of infectious diseases. We are currently seeking qualified applicants who have a demonstrated record of independent, creative research and pharmaceutical product development experience with strong interpersonal and communication skills. We have openings for the following positions: Research Scientist, Plant Transformation - A Ph.D. in plant sciences, cell biology or related field plus at least 5 years relevant experience is required. The successful candidate will be responsible for expressing antibodies in plants. Demonstrated ability in monocot transformation is required. Experience in managing greenhouse operations and familiarity with plant breeding operations are desired. Position Number: RD99-9 Research Associate, Plant Transformation - A Masters in plant sciences, molecular or cell biology is desired but not essential. The position involves technical support for the antibody expression program. Experience with plant transformation is required. Familiarity with monocot cell culture and transformation is desired. Position Number: RD99-10 Please send your resume or CV and cover letter to: Epicyte Pharmaceutical, Inc. Attn: Human Resources Position # _____________ 5810 Nancy Ridge Dr., Suite 150 San Diego, CA 92121 VIA FACSIMILE to 619-554-0288 VIA E-MAIL to ddemello@epicyte.com Please reference the position number in your cover letter. Epicyte offers competitive compensation in addition to a generous benefits package. Epicyte is an equal opportunity employer and promotes diversity throughout its workforce. Applications are considered for all positions without regard to race, color, religion, sex, national origin, age, marital or veteran status, sexual orientation, or the presence of medical condition or disability. From owner-maize@hgmp.mrc.ac.uk Sat Dec 18 19:21:16 1999 Return-Path: Received: by mercury.hgmp.mrc.ac.uk (Postfix, from userid 110) id A53EF17AE7; Sat, 18 Dec 1999 19:21:15 +0000 (GMT) Received: by mercury.hgmp.mrc.ac.uk (Postfix, from userid 1) id 74C1217A58; Sat, 18 Dec 1999 19:21:14 +0000 (GMT) To: nobody@net.bio.net X-Really-To: maize@net.bio.net Newsgroups: bionet.maize From: pap@iastate.edu (Peter A Peterson) Reply-To: maize@net.bio.net Subject: Re: Winter GH Date: 18 Dec 1999 18:56:39 -0000 Organization: Iowa State University Message-ID: <4.1.19991218125516.00927540@pop-2.iastate.edu> References: Sender: owner-maize@hgmp.mrc.ac.uk Precedence: bulk Not sure about tip rot in your greenhouse, but when the people in Cologne Germany were in the Green house they got the same conditions. My suggestion to them was that the lights were too "rich" and sugars were building up in the tips and thus the rotting and shriveling of anthers. They cut down on the lights and this was corrected. Not sure about your case but check the intensity of the lights. PAP At 10:30 AM 12/7/99 -0800, you wrote: >Dear Fellow Maize Folks, > > We are trying to fix up a very small old greenhouse room so that we >can grow plants and harvest good male meiocytes through the winter (Nov-Feb >are hard for us). We have played with a lot of conditions, but we are >still getting tip rot and many of the plants have sterile shrivelled >anthers. Some that make good looking anthers actually have meiocytes >arrested at pachytene with a thickened wall. The current conditions are: >Specs: 250 square feet. > 4 metal halid lamps with new bulbs > lights on from 6 am to 10 pm > plants potted in sterile soil (not peet) > 82-85 degrees day and night > there is a fan on day (high speed) and night (Low speed) > > Anyone have any ideas how we can improve our situation? If you >have perfectly shedding plants in your green house right now, in Dec, can >you let me know how you do it? I would be happy to contact your greenhouse >manager if that is easiest. Thank you very much! > >Lisa Harper >Cande Lab >Department of Molecular and Cell Biology >345 LSA >University of California >Berkeley, CA 94720-3200 >(510)-643-8277 --------- Peter A. Peterson Agronomy Department Iowa State University Ames, Iowa 50011 OFFICE: [515] 294-9652 FAX: [515] 294-2299 pap@iastate.edu http://www.public.iastate.edu/~pap/homepage.html From owner-maize@hgmp.mrc.ac.uk Sun Dec 19 17:29:35 1999 Return-Path: Received: by mercury.hgmp.mrc.ac.uk (Postfix, from userid 110) id DA8B917A59; Sun, 19 Dec 1999 17:29:34 +0000 (GMT) Received: by mercury.hgmp.mrc.ac.uk (Postfix, from userid 1) id A30EB17A4E; Sun, 19 Dec 1999 17:29:33 +0000 (GMT) To: nobody@net.bio.net X-Really-To: maize@net.bio.net Newsgroups: bionet.maize From: venugopal mikkilineni Reply-To: maize@net.bio.net, venu@uiuc.edu Subject: Olc1 mutant Date: Sat, 18 Dec 1999 14:11:04 -0600 Organization: University of Illinois at Urbana-Champaign Message-ID: References: Sender: owner-maize@hgmp.mrc.ac.uk Precedence: bulk Hello: I am trying to get seeds of the "Olc1" mutant of maize. This mutant has been recovered from mutagenized B73 and has been shown to increase oleic acid content in the seed oil. This mutant was originally developed by Dr. A. Wright at Iowa State. But, I have not had much luck in tracking him or the mutant. So, if anyone out there has any information about the mutant and can send me seed of "Olc1" I would greatly appreciate it. Thanks Venu ******************************************************************************* Venugopal Mikkilineni (venu) HOME OFFICE 805 W. Illinois St. #1 1102, S. Goodwin Ave., Urbana, IL 61801 W-221, Urbana, IL 61801 (217) 328-5751 (217) 244-3388 MC-046 E-Mail: venu@uiuc.edu *******************************************************************************