From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!OFFICE.MMC.ORG!varyc.mmcri From: varyc.mmcri@OFFICE.MMC.ORG (Varyc) Newsgroups: bionet.molbio.methds-reagnts Subject: Enhancer characterization Date: 2 Nov 1994 12:56:02 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 13 Sender: daemon@net.bio.net Distribution: world Message-ID: <4475B72E01B938D9@office.mmc.org> NNTP-Posting-Host: net.bio.net Hi Netters, I have a number of anonymous genomic DNAs cloned into pBluescript SK+ and would like to evaluate their capabilities as enhancers. I would appreciate any advice and esp. specific suggestions on the most efficient way to gear this up. Considerations include that we're a nonradioisotopic lab (colorimetric, westerns ok), and will need a fair amount of sample throughput, so we need an approach that's adaptable to screening. I'm particularly interested in specific vector systems. Thanks in advance for your help. Cal Vary From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!THORIN.UTHSCSA.EDU!HARDIES From: HARDIES@THORIN.UTHSCSA.EDU Newsgroups: bionet.molbio.methds-reagnts Subject: re: primer-dimers in pcr Date: 2 Nov 1994 12:56:51 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 26 Sender: daemon@net.bio.net Distribution: world Message-ID: <941102145816.40206cfa@thorin.uthscsa.edu> NNTP-Posting-Host: net.bio.net sl6dp@cc.usu.edu wrote: > Does anybody knows how to get rid of the nasty primner-dimers. My > oligos have a lot of G-C. Something to do with the MgCl concentrations??? You can try to increase the annealing temp. to the minimum tolerated by the primer pair. Reducing Mg has the same effect as increasing annealing temp. and is convenient because you can try several Mg conc.'s at once. However, I don't recommend doing Mg titrations because Mg alters several parameters of the experiment at once and makes you vulnerable to a variety of secondary problems. If you can get the correct target band in your positive control, you can probably ignore primer dimers. But be careful to simulate the same concentration/complexity in the positive control as in your target template or else an inefficient ampl. might limp by on the positive control but fail on the real thing. Otherwise, you're going to have to redesign the primers so they don't prime on themselves or each other. It helps to make the 3' end the least stable part of the primers. That is, don't put G+C clamps on 3' ends unless something about your experiment absolutely requires it. Hope this helps. Steve Hardies, Dept. of Biochem., Univ. of Texas HSC at San Antonio Hardies@thorin.uthscsa.edu From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!ns1.faseb.org!darwin.sura.net!news.sesqui.net!rice!scandium.rice.edu!user From: mmp@bioc.rice.edu () Newsgroups: bionet.molbio.methds-reagnts Subject: Refolding urea-solubilized protein Followup-To: bionet.molbio.methds-reagnts Date: 2 Nov 1994 17:44:54 GMT Organization: Rice University Lines: 17 Message-ID: NNTP-Posting-Host: scandium.rice.edu I have overproduced a recombinant plant protein in E. coli, and it is insoluble. I can solubilize it in urea and isolate it by its Histidine tag on a nickel column, but I need to get rid of the urea and hopefully refold it correctly to reconstitute its activity. When I try to dialyze to remove the urea, the protein precipitates. What are some techniques used to promote folding? Should I add anything that will help stabilize the protein while it folds? What concentration is best for the protein in the dialysis tubing? Are there other techniques that might be better than dialysis? (I tried gradual removal by dialysis into lesser concentrations of urea, and it looked OK at 4 M, but precipitated at 2 M). If anybody can recommend any articles or books that might also help, these would be greatly appreciated. Thanks! From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!HERA.MED.UTORONTO.CA!emma From: emma@HERA.MED.UTORONTO.CA (Emma Macfarlane) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Use of Amersham's Hybond N+ Date: 2 Nov 1994 09:03:12 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 23 Sender: daemon@net.bio.net Distribution: world Message-ID: References: <396csb$lh8@mark.ucdavis.edu> NNTP-Posting-Host: net.bio.net I have also used Hybond N+ on a regular basis for genomic and plasmid DNA (Southerns, colony blots, dot blots) and it has worked just fine. Emma On 1 Nov 1994, Michael Cooley wrote: > Grace Mendoza (mendoz@vaxd.gat.com) wrote: > > : Our laboratory just recently heard that DNA does not transfer real well to > : Amersham's Hybond N+ filters. Has anybody else heard this? It is > : supposedly better to use for transfer of RNA not DNA. Does anybody have > : comments, experiences with using Hybond? Thanks. > > : Grace Mendoza > : mendoz@vaxd.gat.com > : General Atomics > > We use it regulary here for genomic DNA and have not experienced any > difficulties. > > > From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Newsgroups: bionet.molbio.methds-reagnts Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!news.sprintlink.net!EU.net!Germany.EU.net!news.dfn.de!gs.dfn.de!zib-berlin.de!math.fu-berlin.de!fub46!soenke From: soenke@zedat.fu-berlin.de (Soenke Behrends) Subject: specific 'nested' priming for reverse transcription in RT-PCR Message-ID: <762TBQVI@math.fu-berlin.de> Keywords: RT-PCR Sender: news@math.fu-berlin.de (Math Department) Nntp-Posting-Host: fub46.zedat.fu-berlin.de Organization: Free University of Berlin, Germany Date: Wed, 2 Nov 1994 19:53:25 GMT Lines: 16 I want to do reverse transcription with a specific additional downstream oligo. From what I have heard thermostable enzymes like Tth or Retrotherm don't work as well as for example Stratascript that I use routinely. So I habe decided on a 17mer oligo with an annealing temperature of 40C. What about RNA concentrations (polyA or total)? Primer concentrations? thermal profile? Does anyone have any experience? Is it worth the effort? Can you go further up with the RNA amount when you have transcripts of low abundance? Thanks in advance From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!THORIN.UTHSCSA.EDU!HARDIES From: HARDIES@THORIN.UTHSCSA.EDU Newsgroups: bionet.molbio.methds-reagnts Subject: re: lambda DNA resists digestion Date: 2 Nov 1994 12:30:17 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 54 Sender: daemon@net.bio.net Distribution: world Message-ID: <941102143128.40206cfa@thorin.uthscsa.edu> NNTP-Posting-Host: net.bio.net Rob Mauk wrote: > I have isolated lambda gt10 DNA by PEG precipitation followed by organic > extraction and ethanol precipitation, and find that it is almost > completely resistant to digestion by EcoRI and all other enzymes that I > have tested. Proteinase K treatment did not help, nor did additional > extractions and precipitations. Plasmid DNA digests normally with these > enzymes, but if the plasmid is mixed with the lambda DNA, it is rendered > undigestable. Any comments or suggestions regarding the nature of this > contaminant, or solutions to the problem would be greatly appreciated. 1. Check and see if there's a lot of tRNA in the DNA prep. There shouldn't be in a lambda prep., but if you leak whole bacteria through the first spin, you can get it. If this is your problem, you'll see a huge tRNA band on an agarose gel, and RNAse added to your r. digest will clear up the problem. 2. If it's salt, then you're probably using too much EtOH in the EtOH prec., or making it too cold. If you've tampered with the conditions trying to make a big white pellet, you've optimized the recovery of salt. In this case, you can clear it out by reprecipitating with correct conditions. Or, dialysis will work too, especially on a large prep. If you dialyze, go against TE + 0.5 M NaCl first, then 2x against just TE. The high salt in the first step helps lots of kinds of low MW crud get through the bag. 3. Some procedures can leave a load of EDTA in the DNA, although usually not a phage isolation procedure. If you have a lot of EDTA, your OD 230 will be as high or higher than the OD 260. I clean this problem up by dialysis as above, although I suppose you could just titrate with Mg. 4. No matter what it is, you may get a quick fix by just increasing the volume of the r. rxn. and diluting the inhibitor. Try going up 10 x in vol., even if you have to EtOH prec. the product to get it on the gel afterwards. 5. Lots of commercial kits involving resins or glass beads will clear out almost anything. If you go this route, make sure you use one specifically known to work with lambda-sized DNA, since some resins bind DNA that size so tight that you'll never get it back off. 6. As to the original procedure: If you carry over much sup. from the PEG precipitation, it can cause this problem. If you're working in a microfuge tube, it may be worth respinning after taking off the sup. to knock more sup. off the walls so you can take that off too. Regarding phenol extraction: lore has it that 1x phenol extraction can let enough crud through to cause this problem. If you only do 1 x phenol extraction, it's better to sacrifice a significant part of the aqueous layer than to risk carrying over any of the interface material. With multiple phenol extractions, on the other hand, you don't have to worry about this. Hope this helps. Steve Hardies, Dept. of Biochem., Univ. of Texas HSC at San Antonio Hardies@thorin.uthscsa.edu From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!gatech!newsxfer.itd.umich.edu!gumby!newspump.wustl.edu!cerberus-138.wustl.edu!usenet From: HAVILAND@KIDS.WUSTL.EDU (David L. Haviland, Ph.D.) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Use of Amersham's Hybond N+ Date: 2 Nov 1994 19:02:59 GMT Organization: Washington University School of Med. Lines: 19 Distribution: world Message-ID: <398np3$stb@cerberus-138.wustl.edu> References: NNTP-Posting-Host: kids1.wustl.edu X-News-Reader: VMS NEWS v1.25 In-Reply-To: mendoz@vaxd.gat.com's message of Tue, 01 Nov 1994 10:47:25 -0800 In mendoz@vaxd.gat.com writes: > > Our laboratory just recently heard that DNA does not transfer real well to > Amersham's Hybond N+ filters. Has anybody else heard this? It is > supposedly better to use for transfer of RNA not DNA. Does anybody have > comments, experiences with using Hybond? Thanks. Grace: We have had minimal problems with Hybond N+ in genomic and regular southerns, Northerns, and even with Oligo ECL. For most, it is a workhorse in our lab. I say minimal because we've have had an occasional "bad batch" of Hybond N+ which with a simple phone call has gleefully been replaced. Probably two batches in the last 6 years. Hope this helps, David From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Newsgroups: bionet.molbio.methds-reagnts,bionet.molbio.proteins Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!gatech!newsxfer.itd.umich.edu!nntp.cs.ubc.ca!news.UVic.CA!spruce.pfc.forestry.ca!PFC.Forestry.CA!AEKRAMODDOUL From: aekramoddoul@PFC.Forestry.CA (Ekramoddoullah, Abul Kalam M.) Subject: Re: Quantitative protein determinations in plant extracts Message-ID: <1994Nov1.232711.25054@spruce.pfc.forestry.ca> Sender: news@spruce.pfc.forestry.ca Nntp-Posting-Host: pfc.pfc.forestry.ca Reply-To: aekramoddoul@PFC.Forestry.CA Organization: Forestry Canada (Pacific Forestry Centre) References: Date: Tue, 1 Nov 1994 23:27:11 GMT Lines: 25 Xref: biosci bionet.molbio.methds-reagnts:20405 bionet.molbio.proteins:3027 In article , bipin dalmia writes: > >what is an absolute method of protein determination in plant extracts >besides gravimetric analysis? in particular, does anyone have data on how >nitrogen combustion, Kjeldahl or any other method compare when >determining total protein content in any kind of crude preparations? we >are getting pretty large differences between lowry (folin), BCA and >bradford assays. these were done with BSA as a standard, and all buffer >inteferences were eliminated. > >bip Not knowing how you had prepared the crude extract and type of plant and tissue used for extraction, I have a feeling that your extracts contained phenolic copmpunds free or bound which give rise this difference. I had a similar problem a few years ago with conifer tissues. I had overcome these obstacles by developing a suitable method for protein extraction and subsequent method for the determination protein in plant extracts. The latter method will be published in Phytochemical Analysis shortly. If you would like to discuss this further, please feel free to give me a call me at following number. Thanks Abul EKRAMODDOULLAH, ABUL KALAM M. Title: Research Scientist Forestry Canada Phone: (604) 363-0600 Victoria, B.C. Internet: AEKRAMODDOUL@A1.PFC.Forestry.CA From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!rutgers!netnews.upenn.edu!brass2.med.upenn.edu!user From: obrien@pharm.med.upenn.edu (PJOB) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: HA epitope tag problems Followup-To: bionet.molbio.methds-reagnts Date: Wed, 02 Nov 1994 14:51:13 -0500 Organization: U of Penn Lines: 12 Message-ID: References: NNTP-Posting-Host: brass2.med.upenn.edu In article , spang@vms.biochem.mpg.de (Anne Spang) wrote: > Hi Peter! > Are you sure that your tagged protein is made? Is it possible, that your > protein is degraded? > > Anne Yes, we have confirmed the function of the receptor by Inositol Phosphate assay and Ca++ transients and it's expression on the surface by FACS. We just can't IP or western blot it. The DNA sequence checks out o.k. too. From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!bcm!cs.utexas.edu!convex!news.duke.edu!bongo.cellbio.duke.edu!user From: kamin_johnson@cellbio.duke.edu (kamin johnson) Newsgroups: bionet.molbio.methds-reagnts Subject: Where can I obtain EcoA? Date: Wed, 02 Nov 1994 14:30:49 -0800 Organization: Duke University Lines: 2 Message-ID: NNTP-Posting-Host: bongo.cellbio.duke.edu I would like to obtain the restriction enzyme EcoA. Does anyone know if it is commerically available? From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Newsgroups: bionet.molbio.methds-reagnts Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!news.sprintlink.net!EU.net!dkuug!news.uni-c.dk!news.daimi.aau.dk!biobase!ali From: ali@biobase.aau.dk (Ali Karami) Subject: Electron microscopy of Plasmid Message-ID: Summary: Electron Microscopy of Plasmid Keywords: DNA-Electron microscopy-Plasmid Organization: The Danish BioBase Date: Thu, 27 Oct 1994 16:51:40 GMT Lines: 13 Dear Neters I am trying to prepare an Electron Microscopy ( transmissin) Analysis of my Plasmd. I would like to have any information about techniques specially using Negative stain By Uranyl formate or any alternative for DNA staining. I will apreciate any comment. Ali Karami copenhagen University email: Ali@biobase.aau.dk From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Newsgroups: bionet.molbio.methds-reagnts Path: biosci!agate!howland.reston.ans.net!news.sprintlink.net!EU.net!sun4nl!news.nic.surfnet.nl!rlmix1.rulimburg.nl!Farmaco.RuLimburg.NL!G.Fazzi From: G.Fazzi@Farmaco.RuLimburg.NL (G.E.Fazzi) Subject: CYCLO OXYGENASE antibody commerially available? Message-ID: Keywords: cyclo oxygenase antibody prostaglandin endoperoxide synthase Lines: 12 Sender: news@rlmix1.rulimburg.nl (USENET News System) Organization: University of Limburg X-Newsreader: Trumpet for Windows [Version 1.0 Rev A] Date: Wed, 2 Nov 1994 14:22:43 GMT Does anyone know if there are antibodies commercially available against CYCLO OXYGENASE. Cyclo oxygenase (or prostaglandin endoperoxide synthase) tranfers arachidonic acid into prostaglandines. Thanks, Gregorio Fazzi E-mail: G.Fazzi@Farmaco.RuLimburg.NL Dept.Pharmacology, Univ.of Limburg, Maastricht, The Netherlands. From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Newsgroups: bionet.molbio.methds-reagnts Path: biosci!agate!howland.reston.ans.net!news.sprintlink.net!EU.net!sun4nl!news.nic.surfnet.nl!rlmix1.rulimburg.nl!Farmaco.RuLimburg.NL!G.Fazzi From: G.Fazzi@Farmaco.RuLimburg.NL (G.E.Fazzi) Subject: Re: Luciferase antibody Message-ID: Lines: 29 Sender: news@rlmix1.rulimburg.nl (USENET News System) Organization: University of Limburg X-Newsreader: Trumpet for Windows [Version 1.0 Rev A] References: <3969c4$di4@news.acns.nwu.edu> Date: Wed, 2 Nov 1994 14:05:40 GMT In article <3969c4$di4@news.acns.nwu.edu> Kalvares@merle.acns.nwu.edu (Keith Alvares) writes: >From: Kalvares@merle.acns.nwu.edu (Keith Alvares) >Subject: Luciferase antibody >Date: 1 Nov 1994 20:44:52 GMT >Hi ! Does anybody out there know if Luciferase antibodies are commercially >available? >If you do know of a source, could you please e-mail me the name of the company >and >the telephone number if possible. I need the antibodies to do a histochemical >analysis >on tissues from a transgenic mouse line we have established. Thanks in advance >Keith Alvares >Department of Pathology, >Northwestern University Medical School >Chicago, IL >Kalvares@merle.acns.nwu.edu Rabbit Polyclonal anti- (firefly) luciferase: Promega, catalog nr. E 4191 Greetings, Gregorio Fazzi E-mail: G.Fazzi@Farmaco.RuLimburg.NL Dept.Pharmacology, Univ.of Limburg, Maastricht, The Netherlands. From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!ERE.UMontreal.CA!daoustm From: daoustm@ERE.UMontreal.CA (Daoust Martin) Newsgroups: bionet.molbio.methds-reagnts Subject: DNASIS Date: 2 Nov 1994 06:01:53 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 11 Sender: daemon@net.bio.net Distribution: world Message-ID: <9411021359.AA18055@alize.ERE.UMontreal.CA> NNTP-Posting-Host: net.bio.net Hello everybody, Does anyone used DNASIS sequence analysis program for IBM? If so, I would appreciated your comments. Thanks Martin daoustm@ere.umontreal.ca From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Newsgroups: bionet.molbio.methds-reagnts Path: biosci!agate!howland.reston.ans.net!news.sprintlink.net!EU.net!uunet!nih-csl!jowens.nci.nih.gov!jow From: Jim Owens Subject: Re: Do you need supercoiled pDNA for ds-sequencing? Message-ID: <1994Nov2.132750.13260@alw.nih.gov> X-Xxmessage-Id: X-Xxdate: Wed, 2 Nov 1994 13: 27:47 GMT Sender: postman@alw.nih.gov (AMDS Postmaster) Organization: NIH, Lab of Genetics X-Newsreader: Nuntius Version 1.2 References: Date: Wed, 2 Nov 1994 13:27:50 GMT Lines: 35 In article Roger Wiegand, rcwieg@ccmail.monsanto.com writes: >In article , >MURIANAP@FOODSCI.PURDUE.EDU (Pete Muriana) wrote: > stuff deleted >> Now the question - the DNA sequencing facility representative indicated that >> we need to have **supercoiled** plasmid DNA to sequence from. Is this true? >> and why wouldn't a linear double-stranded fragment work? Am I missing >> something here? >> > >This is nonsense. Both cycle sequencing and Sequenase work fine from >linear DNA such as PCR products. We have a number of examples where >nicking or linearizing (either mechanically or using enzymes) plasmids >results in a 5-10X *increase* in signal strength for cycle sequencing. It seem to be a common phenomenon that some labs can get one technique to work while other labs cannot. Roger gets better results with nicked or linearized plasmid DNA, I do not. Assuming that your sequencing facility will be doing the sequencing reactions for you, Pete, I'd suggest you give them what they want since that works for them. If you will be doing the sequencing reactions, try out both methods and see which works better in your hands. By the way, Pete, your e-mail box is full, ten thousand messages, according to your daemon. I guess that mean you do not use the address above for mail? Good luck, Jim Owens From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Newsgroups: bionet.molbio.methds-reagnts Path: biosci!agate!howland.reston.ans.net!EU.net!uunet!newsflash.concordia.ca!CC.UMontreal.CA!news.uqam.ca!UQuebec.CA!Benoit_Hebert From: Benoit_Hebert@IAF.UQUEBEC.CA () Subject: Re: recombinant adenovirus? Sender: news@UQuebec.CA (news) Message-ID: Date: Wed, 2 Nov 1994 05:18:29 GMT References: Nntp-Posting-Host: panoramix.uqss.uquebec.ca Organization: Universite du Quebec X-Newsreader: TIN [version 1.2 PL2] Lines: 18 J.C. Irminger (irminger@cmu.unige.ch) wrote: > Wir are trying to construct recombinant adenoviruses for genexpression in > mammalian cells. Anybody who has some experince? > Please e-mail. Thanks JC You should try contacting Dr. Bernard Massie (at Montreal's Biotechnology Research Institute) who is an expert on Adenoviral expression vectors. You may know him by some constructs found in a few publications (pBM5). If finding his snail mail address via Current Contents or Index Medicus is impossible for you, I'll try finding his phone number for you. Unfortunately, I don't have his email address. Benoit Hebert ===== Benoit_Hebert@iaf.uquebec.ca From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!agate!howland.reston.ans.net!pipex!sunsite.doc.ic.ac.uk!news.sys.uea.ac.uk!cpca3.uea.ac.uk!news From: Richard James Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Shotgun sequencing assembly Date: 2 Nov 1994 12:49:42 GMT Organization: University of East Anglia, Norwich, Norfolk, NR47TJ, UK Lines: 16 Message-ID: <3981t6$6a1@cpca3.uea.ac.uk> References: <7552A52E01B938D9@office.mmc.org> NNTP-Posting-Host: biorij.bio.uea.ac.uk > Does anyonh know of a decent program for assembly of sequences in a > sequencing project, with alignment capability etc. We've been using the > PC-Gene Assemgel program and are [:( ] not happy with the alignment > capabilities with gappy sequences. > > Thanks in advance, > Cal Vary We use Lasergene software by DNASTAR. There are both Mac and PC versions available. It is not cheap but so far we have been very happy with it. Regards, Richard James From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!agate!howland.reston.ans.net!EU.net!uknet!lyra.csx.cam.ac.uk!sunsite.doc.ic.ac.uk!warwick!bham!bcs93.bham.ac.uk!user From: devitta@uk.ac.birmingham (Chutney) Newsgroups: bionet.molbio.methds-reagnts Subject: Cloning with LambdaGEM-12 Date: 2 Nov 1994 11:24:37 GMT Organization: The University of Birmingham Lines: 12 Message-ID: NNTP-Posting-Host: bcs93.bham.ac.uk LambdaGEM-12 Xho I half-site arms cloning system. In this system LambdaGEM-12 has been digested with Xho I, partially filled-in with dTTP and dCTP and dephosphorylated. This allows it to ligate specifically with Mbo I or Sau 3A I digested genomic DNA which has been partially filled-in with dATP and dGTP. Using this cloning system (from Promega) I have been obtaining unusually high levels of background when vector DNA is ligated and packaged in the absence of insert genomic DNA. Typically 20,000 pfu/microgram of vector DNA. Has anybody else had similar problems?? I would appreciate any advice available. From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Newsgroups: bionet.molbio.methds-reagnts Path: biosci!agate!spool.mu.edu!uwm.edu!lll-winken.llnl.gov!koriel!wnoc-sfc-news!wnoc-kyo-news!hakozaki.karrn!siebold!news From: yasunari takami Subject: Re: re: Odd problem with RAPD Message-ID: <1994Nov2.105839.8001@siebold.cc.nagasaki-u.ac.jp> Sender: news@siebold.cc.nagasaki-u.ac.jp (news) Organization: Nagasaki Univ., JAPAN References: <941101143135.40203949@thorin.uthscsa.edu> Date: Wed, 2 Nov 1994 10:58:39 GMT Lines: 19 > Robert Rumpf wrote: > > > I'm posting this for a friend...he's successfully amplified a RAPD band > > and cloned it, then sequenced it using vector primers. He went ahead and > > designed primers for the RAPD based on the sequences he obtained and now > > can't amplify using these specific primers! Anyone have a problem similar > > to this or perhaps have an explanation for it? > > I assume your friend used the clone as a positive control template and > recovered the expected size band. Suggest to him to dilute the clone into > something like salmon sperm DNA to simulate the amount and complexity of > unique DNA in the target genome and see if that works. This will distinguish > between a technical flaw in the amp. vs. the target seq. just not being there. > > Hope this helps. > Steve Hardies, Dept. of Biochemistry, Univ. of Texas HSC at San Antonio > Hardies@thorin.uthscsa.edu > From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!daresbury!bioftp.unibas.ch!citi2.fr!jussieu.fr!univ-lyon1.fr!ws41.cnusc.fr!ciril.fr!thot.u-strasbg.fr!usenet From: nussbaum@neurochem.u-strasbg.fr Newsgroups: bionet.molbio.methds-reagnts Subject: galactosyltransferase Date: 2 Nov 1994 09:15:32 GMT Organization: cnrs Lines: 6 Message-ID: <397lbk$9rh@thot.u-strasbg.fr> NNTP-Posting-Host: noiset.u-strasbg.fr X-Newsreader: We would like to test antibodies raised against UDP-galactose: N-acetylglucosamine galactosyltransferase (EC 2.4.1.38) with a galactosyltransferase preparation obtained from rat brain. If somebody could provide a sample, please inform me Many thanks Nuss From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!daresbury!bioftp.unibas.ch!citi2.fr!jussieu.fr!univ-lyon1.fr!ws41.cnusc.fr!ciril.fr!thot.u-strasbg.fr!usenet From: nussbaum@neurochem.u-strasbg.fr Newsgroups: bionet.molbio.methds-reagnts Subject: re:westerns using monoclonals Date: 2 Nov 1994 08:48:43 GMT Organization: cnrs Lines: 22 Message-ID: <397jpb$c63@thot.u-strasbg.fr> NNTP-Posting-Host: noiset.u-strasbg.fr X-Newsreader: In article <9410312005.AA14428@phinet.smithkline.com> pattonaj%phvax.dnet@sb.com writes: > >I have a question along similar lines to that of QiWang. >Is there anything you can do other than starting again if a monoclonal fails >to immunoprecipitate or western blot? I used to work on a monoclonal that >gave a beautiful response on cryostat sections yet we could never do anything >else with it. We eventually gave up but if there was anything I could try.... > >Many thanks > >Amanda Patton I have the same problem too working with a Mab directed against a surface antigen of oligodendrocytes. I suppose that your epitope is conformation dependent; so I suggest the following: extract your material with 1 or 2% CHAPS containing 0.5 M NaCl and try a dot blotting research .You will already see if there is some immunoreaction; If it is positive my assumption is probably correct. After that you may perhaps try an affinity column with this extract and it will probably work!!! Let me know your results From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!agate!howland.reston.ans.net!EU.net!uknet!daresbury!not-for-mail From: Clemens Suter-Crazzolara Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Luciferase Problems? Date: 2 Nov 1994 08:49:03 -0000 Lines: 23 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <397jpv$epd@mserv1.dl.ac.uk> MIME-Version: 1.0 Original-To: sfraser@acs.ucalgary.ca (Sherri Fraser) > > Hi, I was wondering if you could elaborate on this reply. I have > Hi, I was wondering if you could elaborate on this reply, I have never heard of this problem, ie: not being able to quantify it. > Thanks, > Sherri > > > Hello netters, > > do only thing that comes to my mind is that luciferase is almost impossible > > to quantify, even if you have a luminometer. Sorry, no exp. with beta- > > gal > > > > clemens, heidelberg unlike other enzymes, luciferase stays bound to D-luciferin (substrate). Thus, the amount of active luciferase is rapdily depleted from the reaction mixture. To reduce this binding, I beleive acetyl-coA is added to the reaction; this allows to some extend an uncoupling of enzyme and substrate/product. Generally, with luciferase, you get a peak flash in the first 0.1 secs or so, then the signal goes down rapidly. This is, as you may understamd, not ideal if you want to measure enzyme activity in the linear range... clemens, heidelberg From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!agate!msuinfo!harbinger.cc.monash.edu.au!bunyip.cc.uq.oz.au!munnari.oz.au!ariel.ucs.unimelb.EDU.AU!ucsvc.ucs.unimelb.edu.au!lugb!genome.latrobe.edu.au!user Newsgroups: bionet.molbio.methds-reagnts Subject: Anyone know about pDK101? Message-ID: From: genmjw@genome.latrobe.edu.au (Matthew Wakefield) Date: Wed, 2 Nov 1994 06:22:02 GMT Sender: news@lugb.latrobe.edu.au (News System) Followup-To: bionet.molbio.methds-reagnts Organization: La Trobe University Australia Lines: 11 Does anyone have a map of pDK101 or know who makes it or where I can get its sequence? Thanks, Matt -- M a t t h e w W a k e f i e l d School of Genetics and Human Variation La Trobe University, Bundoora (Melbourne), Australia Ph +613 4792770 Fx 4792480 genmjw@genome.latrobe.edu.au From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Newsgroups: bionet.molbio.methds-reagnts Path: biosci!agate!howland.reston.ans.net!news.sprintlink.net!EU.net!uunet!nih-csl!postman From: moos@helix.nih.gov (Malcolm Moos Jr., M.D., Ph.D.) Subject: Re: urea/SDS, guanidine/SDS PAGE Message-ID: <1994Nov2.163514.17651@alw.nih.gov> X-Posted-From: InterNews 1.0.1b7@newssrv.dcrt.nih.gov Lines: 11 Sender: postman@alw.nih.gov (AMDS Postmaster) Organization: FDA/CBER References: <51768.ashendel@aclcb.purdue.edu> Date: Wed, 2 Nov 1994 16:35:14 GMT SDS and guanidine form an extremely insoluble soap. In fact, one procedure for removing SDS from solution involves sequential precipitation with KCl and then guanidine (if you go with guanidine immediately, you coprecipitate variable, but often major, amounts of your protein). If you contemplate SDS-PAGE, you're far better off using urea or SDS-urea as denaturants. Just don't boil the solutions at high pH-you may carbamylate amino groups. Urea is directly compatible with SDS-PAGE; the only artifacts result from big osmotic differences between lanes if, for example, your standards do not contain urea. Malcolm Moos Jr., M.D., Ph.D. From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Newsgroups: bionet.molbio.methds-reagnts Path: biosci!agate!howland.reston.ans.net!ix.netcom.com!netcom.com!nntp!Sgmiller From: Sgmiller@netcom.com (Steve Miller) Subject: Re: HA epitope TAG: is 12CA5 the only Ab available? Message-ID: Sender: netnews@netcom.com (USENET Administration) Organization: NETCOM On-line Communication Services (408 261-4700 guest) X-Newsreader: VersaTerm Link v1.1.1 References: <01NOV94.25777015.0067@VM1.MCGILL.CA> Date: Wed, 2 Nov 1994 16:01:16 GMT Lines: 11 In Article <01NOV94.25777015.0067@VM1.MCGILL.CA>, "DE ANGELIS,DINO" wrote: >Dear netters >I am looking for a non-mouse anti HAtag Ab in order to do double immuno >staining in transfected cells using another mouse Ab. In fact, even a >biotinylated, digoxygenin or fluorochrome conjugated version of 12CA5 >would do the job for me. Any pointers would be greatly apperciated. >Thanks in advance > Check with Babco (Berkeley Antibody). They are marketing 12CA5 and were recently working on a rabbit polyclonal. It might be available by now. From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Newsgroups: bionet.molbio.methds-reagnts Path: biosci!agate!howland.reston.ans.net!ix.netcom.com!netcom.com!nntp!Sgmiller From: Sgmiller@netcom.com (Steve Miller) Subject: Re: Neuronal cell line with glutamate receptors?? Message-ID: Sender: netnews@netcom.com (USENET Administration) Organization: NETCOM On-line Communication Services (408 261-4700 guest) X-Newsreader: VersaTerm Link v1.1.1 References: Date: Wed, 2 Nov 1994 15:59:27 GMT Lines: 12 In Article , wheat@mbcrr.harvard.edu (Charles E. Weaver) wrote: >I would like to find a neuronal cell line that contains glutamate >receptors. I saw something in a journal a while back and can't find it >now.... anyone remember what the company was????? > >Thanks in advance > >-Chuck I thought that I saw this line being offered by Stratagene in a recent full page ad in Science. I would give them a call. From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!agate!howland.reston.ans.net!gatech!udel!news.sprintlink.net!EU.net!uknet!comlab.ox.ac.uk!oxuniv!rmewing From: rmewing@vax.oxford.ac.uk Newsgroups: bionet.molbio.methds-reagnts Subject: Direct sequencing of lambda phage dna Message-ID: <1994Nov2.144926.27119@oxvaxd> Date: 2 Nov 94 14:49:26 GMT Organization: Oxford University VAX 6620 Lines: 10 Anyone have experience with direct sequencing of lambda phage DNA? How easy is it...which isotope should I use, and do I need to end-label my primer, which enzyme etc. Is it difficult to get clear results and if so would I be better either subcloning into plasmids or PCR-amplifying and direct sequencing of the product? Thanks, Rob Ewing. From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!agate!howland.reston.ans.net!news.sprintlink.net!EU.net!uknet!bcc.ac.uk!arco2.afrc.ac.uk!pc0519.ri.afrc.ac.uk!user From: lawa@bbsrc.ac.uk (Andy Law (Big Nose)) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: minipreps for sequencing Date: 2 Nov 1994 15:25:44 GMT Organization: Roslin Institute Lines: 15 Distribution: world Message-ID: References: <2AC3B02E01B938D9@office.mmc.org> NNTP-Posting-Host: pc0519.ri.afrc.ac.uk In article <2AC3B02E01B938D9@office.mmc.org>, varyc.mmcri@OFFICE.MMC.ORG (Varyc) wrote: > Opinionated netters, > Are there any netters who are strongly opinionated as to the best protocol for large throughput reliable minipreps for cycle > sequencing/ on ABI systems?, Or rating of prep systems for this use? QIAWells from QIAGEN. A touch expensive, bnut good quality DNA and no centrifugation/precipitation step. A big timesaver when doing large numbers of samples. Andy Law ( Lawa @ bbsrc.ac.uk Big Nose in Edinburgh ) From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!agate!howland.reston.ans.net!EU.net!uknet!daresbury!not-for-mail From: LOGAND Newsgroups: bionet.molbio.methds-reagnts Subject: Rf: EDTA in cell fractionatio Date: 2 Nov 1994 15:42:04 -0000 Lines: 23 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <398c0c$3ku@mserv1.dl.ac.uk> Original-To: methods@dl.ac.uk >2nd Year requires background of using disodium EDTA in cell >fractionation. Is it just to buffer Ca2+ ions? >Just a quick note of why the EDTA is used and typical concs. would be >gratefully appreciated. Send clues by email, thanks. >Neil Benson It could be for at least two reasons: 1. to buffer magnesium and calcium cons. so conc. too low for activation of proteases or other detrimental enzymes.(EDTA has higher affinity for Mg, EGTA for Ca) 2. in order that the ER produced is all ribosome free - Mg required for ribosome attachment to ER. Conc. used depends on required effect normally in the range of a couple of mM. DCL Montpellier From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!agate!howland.reston.ans.net!europa.eng.gtefsd.com!news.umbc.edu!haven.umd.edu!purdue!news.bu.edu!med-pharm7.bu.edu!user From: wheat@mbcrr.harvard.edu (Charles E. Weaver) Newsgroups: bionet.molbio.methds-reagnts Subject: Neuronal cell line with glutamate receptors?? Date: 2 Nov 1994 15:08:14 GMT Organization: Boston University Dept. of Pharmacology Lines: 20 Message-ID: NNTP-Posting-Host: med-pharm7.bu.edu I would like to find a neuronal cell line that contains glutamate receptors. I saw something in a journal a while back and can't find it now.... anyone remember what the company was????? Thanks in advance -Chuck || || || || || || ___ _______ \\^// \ / | | | /\ | \\^// \ /\ / |__| |___ /__\ | \\^// \ / \ / | | | / \ | \\^// \/ \/ | | |___ / \ | \\^// Charles E.Weaver \\^// Boston University School of Medicine Phone (617)638-5323 | Department of Pharmacology L-603 Fax (617)638-4329 | 80 East Concord Street Boston MA 02118 cweaver@acs.bu.edu \__________________________________________________________________~o&o From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!THORIN.UTHSCSA.EDU!HARDIES From: HARDIES@THORIN.UTHSCSA.EDU Newsgroups: bionet.molbio.methds-reagnts Subject: re: Do you need supercoiled pDNA for ds-seq.? Date: 2 Nov 1994 13:41:43 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 51 Sender: daemon@net.bio.net Distribution: world Message-ID: <941102154309.40206cfa@thorin.uthscsa.edu> NNTP-Posting-Host: net.bio.net MURIANAP@FOODSCI.PURDUE.EDU (Pete Muriana) wrote: > > ... the DNA sequencing facility representative indicated that > we need to have **supercoiled** plasmid DNA to sequence from. Is this true? > and why wouldn't a linear double-stranded fragment work? Am I missing > something here? > And Roger Weigand responded : This is nonsense. Both cycle sequencing and Sequenase work fine from : linear DNA such as PCR products. We have a number of examples where : nicking or linearizing (either mechanically or using enzymes) plasmids : results in a 5-10X *increase* in signal strength for cycle sequencing. First there was a long background of linear ds sequencing giving really ugly results. Then 'supercoil' seq. came along and it was really pretty. The lore developed that the supercoil energy helped the primer compete to get into the duplex, and that by precipitating out of alkali, you froze the DNA in some kind of ccc denatured form that kept the other strand out of the way. I have always found this hard to swallow, and I wonder if what really happens is this: What hurts ds seq. is interference by reannealing of the other strand. I think that in supercoil seq. you only extend the stuff that got nicked and strand separated while the rest snaps back and never primes. This would artificially reduce your template conc. and inhibit template/template reannealing while increasing your primer/template ratio. Notice that the same time this all happened, the labelling procedure got switched from uniform incorporation to a preextension. I think the preextension may be an essential part of this story because it naturally rescues the signal strength by extending further when you prime fewer templates. [because you extend until you run out of 'labelling mix'. The lore that 'you can extend too long' has nothing to do with polymerization. It's because you're letting the other strand bump the labelled oligo off its template thus terminating it before it gets to see any ddNTPs. This makes bands in all 4 lanes at the bottom of the ladder.] My evidence for all this is only the following. If you measure the length of the blanked out region at the bottom of the ladder, you can estimate the average length of preextension. If you compare this to the template and 'labelling mix' concentrations, you can conclude that most of your template never primes. However, there is a competing explanation for this based on the processivity of the enzyme. Steve Hardies, Dept. of Biochemistry, Univ. of Texas HSC at San Antonio Hardies@thorin.uthscsa.edu From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!bcm!cs.utexas.edu!convex!news.duke.edu!bongo.cellbio.duke.edu!user From: kamin_johnson@cellbio.duke.edu (kamin johnson) Newsgroups: bionet.molbio.methds-reagnts Subject: Where can I get EcoA? Date: Wed, 02 Nov 1994 16:54:58 -0800 Organization: Duke University Lines: 3 Message-ID: NNTP-Posting-Host: bongo.cellbio.duke.edu I would like to know of any sources of the restriction enzyme EcoA. thanks, kam From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Newsgroups: bionet.molbio.methds-reagnts Path: biosci!rutgers!umdnj!bawagan From: bawagan@umdnj.edu (Hinayana Bawagan) Subject: hydroxylamine mutagenesis Message-ID: Organization: Univ. of Medicine and Dentistry of NJ Date: Thu, 3 Nov 1994 01:31:46 GMT Lines: 9 One of two methods I will use for mutagenizing my plasmid DNA is by hydroxylamine. I have no experience with this method but it has been successful for isolating temperature sensitive mutants of yeast. The protocol that I have states that the mutagenizing solution should be prepared FRESH. I would like to ask if this is a strict caveat and what is the reason for it. The protocol that I have appears straightforward and easy. To those who have experience with the method, did you have problems, tricks, precautions that you would like to share with me? From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!rutgers!gatech!newsfeed.pitt.edu!uunet!ftpbox!news3.acns.nwu.edu!mac125.physio.nwu.edu!user From: mic@nwu.edu (Mic Chaudoir) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Loading Long Ranger gels... Date: Wed, 02 Nov 1994 15:07:45 -0600 Organization: Chisholm Lab Rat Pack Lines: 23 Message-ID: References: <395651$jag@eldborg.rhi.hi.is> NNTP-Posting-Host: mac125.physio.nwu.edu In article <395651$jag@eldborg.rhi.hi.is>, php@rhi.hi.is (Petur Henry Petersen) wrote: > I was wondering... When running Long Ranger Sequencing gel (6%) > I usually wait until the gel is around 45 degr and run it at about 45-50 degr > (Celcius of course :) ). In the Long Ranger leaflet they say one has only > to prerun the gels for 10 min. After 10 min prerun my gels are about 35 degr. > Should I load at 35 or wait as I usually do? I am trying to get sharper > bands and one of the factors I am concerned about is the heat of the gels.. > > Could anyone tell me what they do? I should mention that I am running > sequenced PCR products and they show litle secondary structure and that I > use biotinlabeled primers to get ssDNA for sequencing... > > Petur Henry Petersen DeptmBiology U.Iceland I always just run the gel 20 minutes before loading. -- mic mic@nwu.edu "DOS is proof that PC users can take a joke" From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!rutgers!gatech!newsfeed.pitt.edu!uunet!ftpbox!news3.acns.nwu.edu!mac125.physio.nwu.edu!user From: mic@nwu.edu (Mic Chaudoir) Newsgroups: bionet.molbio.methds-reagnts Subject: LA PCR info ?!? Date: Wed, 02 Nov 1994 15:07:10 -0600 Organization: Chisholm Lab Rat Pack Lines: 23 Message-ID: NNTP-Posting-Host: mac125.physio.nwu.edu Hi there, I am anticipating screening a cell line for transformants. I would like to be able to screen using PCR, requiring less sample prep and fewer cells. However, I will probably need to PCR across at least 3kb, probably 5-6kb. I have heard that LA (Long and Accurate) PCR kits/enhancers make this possible. Can anyone please e-mail or post with the following information: 1) How does the reliability of LA PCR compare to standard PCR, i.e. will a miss a lot of positives with this technique ? 2) What kit are you using ? What kit is the best ? Thanks in advance for the info! :-) -- mic mic@nwu.edu "DOS is proof that PC users can take a joke" From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!agate!spool.mu.edu!howland.reston.ans.net!news.sprintlink.net!EU.net!Germany.EU.net!news.dfn.de!scsing.switch.ch!sun.rediris.es!obelix.cica.es!news From: bb1dopeg@lucano.uco.es (Gabriel Dorado) Newsgroups: bionet.molbio.methds-reagnts Subject: AUSTRALIA, Sidney, St. Vincent's Hospital, Dr. J.A. Eisman et al?? Date: 2 Nov 1994 20:47:05 GMT Organization: Centro Informatico Cientifico de Andalucia Lines: 18 Sender: -Not-Authenticated-[3387] Message-ID: <398ts9$5jn@obelix.cica.es> NNTP-Posting-Host: macta.uco.es X-Posted-From: InterNews 1.0.1@macta.uco.es Xdisclaimer: No attempt was made to authenticate the sender's name. I am trying to find the Email or Fax number of any of the following researchers at St. Vincent's Hospital, Sydney, Australia (I could not reach them by post!): Place: Bone and Mineral Research Division, Garvan Institute of Medical Research, St. Vincent's Hospital, Sydney, New South Wales 2010, Australia. People: Dr. John A. Eisman Or any of his collaborators, including: Dr. Nigel A. Morrison; Dr. Jian Cheng Qi; Dr. Akifumi Tokita; Dr. Paul J. Kelly, Dr. Linda Crofts; Dr. tuan V. Nguyen, Dr. Philip N. Sambrook. Thanks. G. Dorado Internet Email: bb1dopeg@lucano.uco.es From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Newsgroups: bionet.molbio.methds-reagnts Path: biosci!news.Stanford.EDU!rutgers!gatech!howland.reston.ans.net!news.moneng.mei.com!uwm.edu!psuvax1!news.cc.swarthmore.edu!netnews.upenn.edu!newshost!jtudor From: jtudor@sju.edu (J. Tudor) Subject: Imaging Systems Message-ID: Organization: Saint Joseph's University X-Newsreader: TIN [version 1.2 PL2] Date: Wed, 2 Nov 1994 14:57:21 GMT Lines: 4 There have been recent posts about the Eagle Eye II from Stratagene. I am interested in purchasing an imaging system. I would like to know about other systems that are available. Which ones should I look at? What are some of the important features I should look for? Thanks. jtudor@sju.edu From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!rutgers!gatech!howland.reston.ans.net!cs.utexas.edu!uunet!newsflash.concordia.ca!news.mcgill.ca!a-01.das.mcgill.ca!user From: kwan@medcor.mcgill.ca (Tony Kwan) Newsgroups: bionet.molbio.methds-reagnts Subject: Drug to kill actively growing yeast cells Date: Wed, 02 Nov 1994 22:46:46 -0500 Organization: Dept. of Biochemistry, McGill University Lines: 11 Message-ID: NNTP-Posting-Host: a-01.das.mcgill.ca Hello netters, I'm looking for a drug that would be able to kill yeast cells which are actively dividing and would leave those which aren't alone. Something analogous to penicillin in e.coli, for example. Any help would be appreciated. -- Tony Kwan Department of Biochemistry, McGill University kwan@medcor.mcgill.ca From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!rutgers!uwm.edu!spool.mu.edu!caen!msuinfo!harbinger.cc.monash.edu.au!bunyip.cc.uq.oz.au!brolga.cc.uq.oz.au!not-for-mail From: btbirch@brolga.cc.uq.oz.au (nicola fidler) Newsgroups: bionet.molbio.methds-reagnts Subject: PCR primer design with RE sites Date: 3 Nov 1994 12:50:21 +1000 Organization: Prentice Centre, University of Queensland Lines: 14 Message-ID: <399j5d$lgn@brolga.cc.uq.oz.au> NNTP-Posting-Host: brolga.cc.uq.oz.au Keywords: PCR primer, restriction enzymes, self homology Hi, thought some experienced netters might be able to help me with my PCR primerdesign problem. I am trying to introduce a unique restriction enzyme site using my PCR primer by either base mutations or with the introduction of a single codon. I realise by using palindromic restriction enzymes there will always be some self homology. My problem is this: when I put my chosen primer designs through Primer Detective, I'm given two type of primer self homology The first is where there is the end homology with long flanking regions (the primers will be about 30bp) GCCGTCGGATGCGCCGGAATTCGCG CTTAAGGCCGCGTAGGCTGCCG The second is where there are intermittent alignments along the length of the primer GGCGTCGGATGCGCCGGAATTCGCG GCCCACCGAACGGATTCCTCGCAGG Can someone please explain which is the better design if you have to live with self homolgy. I'm getting terribly confused and frustrated Thanks, in anticipation, Melisa Wall University of Queensland St Lucia, Australia From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!rutgers!gatech!howland.reston.ans.net!cs.utexas.edu!uunet!ftpbox!news3.acns.nwu.edu!casbah.acns.nwu.edu!cookie From: cookie@casbah.acns.nwu.edu (David Wong) Newsgroups: bionet.molbio.methds-reagnts Subject: Purifying a trancripxn factor using biotinylated DNA Date: 2 Nov 1994 23:16:37 GMT Organization: Northwestern University, Evanston IL Lines: 25 Distribution: na Message-ID: <3996kl$rsd@news.acns.nwu.edu> NNTP-Posting-Host: unseen1.acns.nwu.edu Recently we've found a cell line to provide a source for isolating and purifying a transcription factor (identified through gel shift). To purify the protein, we're using a biotinylated oligo consisting of the binding region. We hope then to complex the factor-DNA with streptavadin and precipitate it with biotinylated resin. We're using the protocol right out of Current Protocols. However, we're having difficulty getting even the DNA to come down with the resin (the DNA is radiolabelled for tracking purposes). I was wondering if anyone has had any previous experience using this or a similar protocol and could offer tips or advice as to what might be going wrong. Any additional suggestions in using this method as a whole would also be appreciated. Please e-mail me directly. Thanks. David Wong e-mail: davidwong@nwu.edu From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Newsgroups: bionet.molbio.methds-reagnts Path: biosci!rutgers!umdnj!bawagan From: bawagan@umdnj.edu (Hinayana Bawagan) Subject: temperature sensitive mutants Message-ID: Organization: Univ. of Medicine and Dentistry of NJ Date: Thu, 3 Nov 1994 01:33:57 GMT Lines: 3 Request for general literature reference on the significance of and studies that can be done on ts mutants. From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!galaxy.ucr.edu!ihnp4.ucsd.edu!news.service.uci.edu!slylab.mmg.uci.edu!user From: dcguttri@uci.edu (denis guttridge) Newsgroups: bionet.molbio.methds-reagnts Subject: quest for lipofectin protocol Date: Wed, 02 Nov 1994 15:23:56 -0800 Organization: UCI Lines: 13 Message-ID: NNTP-Posting-Host: slylab.mmg.uci.edu I'm looking for an alternative to using Life Technologies' (Gibco-BRL) lipofectin. At $130/ml, I feel like I'm getting royally ripped-off, especially when I consider the rate at which I use it. I hear it's not difficult to make and the cost of the materials turns out to be about $1/ml. If anybody has a protocol on how to make a lipofectin-like reagent could you please send it to me. Thanks!!! Denis Guttridge E-mail: dcguttri@uci.edu address: UCI department of microbiology Med Sci I B268 Irvine, CA 92717 (714)856-5267 From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!rutgers!netnews.upenn.edu!news.amherst.edu!news.mtholyoke.edu!news.umass.edu!nic.umass.edu!usenet From: AMRUT@UCSVAX.UCS.UMASS.EDU (AMRUT S BHOGLE) Newsgroups: bionet.molbio.methds-reagnts Subject: ICN translabel trouble Date: 2 Nov 1994 22:21:49 GMT Organization: University of Massachusetts at Amherst Lines: 21 Distribution: world Message-ID: <3993dt$90s@nic.umass.edu> NNTP-Posting-Host: deimos.ucs.umass.edu X-News-Reader: VMS NEWS v1.25 Dear Readers, I have been using ICN Tran35S-label (35S L-methionine) tolabel my actively growing cells. This batch I bought is Lot No. 183:358. Reference date August 11, 1994. I am horrified to see that the proteins labeled have energy in the excitation range of tritium instead of the 35S (Using a scintillation counter -- I have used two seperate ones --each individually calibrated to check for effeciency). ICN swears that they just couldn't have made any mistake. I was wondering if the disintegration pathway leads to a tritiated by-product -- which doesn't seem to be the case. (quenching effects have been taken into account and the shift in the excitation range cannot be accounted for.) I would be very grateful if somebody could try and help me figure out What has been happening. I wonder if somebody else who has used the same batch (Lot number) has had a similar problem and/or if this has happened to somebody somewhere before me. Thanks!!!!!!!!! Amrut From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!gatech!newsxfer.itd.umich.edu!news.itd.umich.edu!jddecker From: jddecker@umich.edu (Jim Decker) Newsgroups: bionet.molbio.methds-reagnts Subject: Soliciting Comments on Sequence Analysis Software Date: 2 Nov 1994 22:45:50 GMT Organization: univ. mich. Lines: 6 Sender: jddecker@gamera.rs.itd.umich.edu. Message-ID: <3994qu$ao9@lastactionhero.rs.itd.umich.edu> NNTP-Posting-Host: dent-226-97.dentistry.umich.edu X-Posted-From: InterNews 1.0@lastactionhero.rs.itd.umich.edu. I am soliciting comments on sequence analysis software that is personal computer based. We are currently using GCG on the vax and find it quite cumbersome and overall difficult to use. I have sent away for a thirty day trial of the Intelligenetics PC/Gene. I can use either a MAC or Dos-Windows format. Thanks for your help. From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!rutgers!gatech!news-feed-1.peachnet.edu!news.duke.edu!godot.cc.duq.edu!hudson.lm.com!news.pop.psu.edu!news.cac.psu.edu!news.tc.cornell.edu!loghost.sdsc.edu!mac02019.sd.gat.com!user From: lippay@vaxd.gat.com (Eric Lippay) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Cloning with LambdaGEM-12 Followup-To: bionet.molbio.methds-reagnts Date: Wed, 02 Nov 1994 16:41:04 -0800 Organization: GA Lines: 24 Message-ID: References: NNTP-Posting-Host: mac02019.sd.gat.com In article , devitta@uk.ac.birmingham (Chutney) wrote: > LambdaGEM-12 Xho I half-site arms cloning system. > > In this system LambdaGEM-12 has been digested with Xho I, partially > filled-in with dTTP and dCTP and dephosphorylated. This allows it to > ligate specifically with Mbo I or Sau 3A I digested genomic DNA which has > been partially filled-in with dATP and dGTP. > Using this cloning system (from Promega) I have been obtaining > unusually high levels of background when vector DNA is ligated and > packaged in the absence of insert genomic DNA. Typically 20,000 > pfu/microgram of vector DNA. > Has anybody else had similar problems?? I would appreciate any advice > available. I have used the lambda Gem 11 vector from Promega which has the same cloning strategy as Gem 12. When ligating the arms without insert the background was zero. I did this twice to make sure I did not make a mistake the first time. With insert the ligation was very effecient. I would think maybe you have a bad batch of vector. Eric Lippay General Atomic Biosciences Div. From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Newsgroups: bionet.molbio.methds-reagnts Path: biosci!rutgers!gatech!howland.reston.ans.net!news.sprintlink.net!EU.net!Germany.EU.net!news.dfn.de!gs.dfn.de!zib-berlin.de!math.fu-berlin.de!news From: uks13mh@fub46.zedat.fu-berlin.de (uks13mh) Subject: Re: DNA from formalin preserved tissue Message-ID: Sender: news@math.fu-berlin.de (Math Department) Nntp-Posting-Host: uks13mh.dialup.fu-berlin.de Organization: Freie Universitaet Berlin X-Newsreader: WinVN 0.92.6 References: Date: Wed, 2 Nov 1994 21:57:29 GMT Lines: 39 In article , duda@uhunix2.uhcc.Hawaii.Edu (Thomas F Duda) says: > > > >I am currently trying to extract (and amplify) DNA from tissue >originally fixed in formalin (actual length of time in formalin is >unknown) and then kept in ethanol (age of samples ranges from 25-35 >years). SO far I have not tried anything beyond a proteinase K/phenol/ >chloroform extraction that typically yields spooled DNA from fresh >or recent, ethanol-only-preserved tissue. DTT has been suggested as >a means of breaking up the DNA-protein cross-links, so this may be the >next line of attack. ANy suggestions or advice would be appreciated. >Has anyone had luck with formalin-preserved tissues or am I wasting >my time? > >Thanks... >-- > +========================================+ > + Thomas F. Duda, Jr. + > + duda@uhunix.uhcc.hawaii.edu + > +========================================+ Hi Thomas I am working with formalin-fixed paraffin-embedded samples since more than 6 years. In principle it works. But there are some limitations. First of all the time of formalin-fixation is crucial. Tissue sample fixed for more than one week are often not suitable to release DNA for PCR. In addition, the length of the amplificates is very important. Amplificates of more 400 bp could often not be generated in routinely fixed material. Another issue is the type of fixation. Fixation in un-buffered formalin prevents the subsequent PCR very efficiently!! Best wishes Michael Hummel UKS13MH@fub46.zedat.fu-berlin.de Inst. of Pathology Free University Berlin From owner-methds-reagnts@net.bio.net Tue Nov 01 22:00:00 1994 Path: biosci!rutgers!gatech!howland.reston.ans.net!spool.mu.edu!news.cs.indiana.edu!purdue!mozo.cc.purdue.edu!news From: "Curt Ashendel" Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Rf: EDTA in cell fractionatio Date: Wed, 2 Nov 94 16:01:12 EST Organization: Purdue University Lines: 53 Message-ID: <69172.ashendel@aclcb.purdue.edu> Reply-To: NNTP-Posting-Host: ashendel.medchem.purdue.edu X-Minuet-Version: Minuet1.0_Beta_17A X-POPMail-Charset: English To: logand@msdos.montpellier.inra.fr On 2 Nov 1994 15:42:04 -0000, LOGAND wrote: >>2nd Year requires background of using disodium EDTA in cell >>fractionation. Is it just to buffer Ca2+ ions? > >>Just a quick note of why the EDTA is used and typical concs. would be >>gratefully appreciated. Send clues by email, thanks. > >>Neil Benson > >It could be for at least two reasons: > >1. to buffer magnesium and calcium cons. so conc. too low for activation of >proteases or other detrimental enzymes.(EDTA has higher affinity for Mg, EGTA >for Ca) > This reason stated above for its use is essentially correct. I include EDTA to reduce the level of free Ca ions (primarily released by lysis from sequestration in the mitochondia), so that [Ca++] < 10^-10, and hence too low to activate calcium-dependent proteases, such as the aptly named calpain. I think that Mg has virtually no effect on proteases, although it is needed for most phosphatases and most DNases. However, the last statement above, that "EDTA has a higher affinity for Mg and EGTA has a higher affinity for Ca," is not completely correct and is a myth that perpetuates. If you look at the original EGTA paper (Schmid and Reilley, Analytical Chem. 29: 264, 1957), the log Kd values for each ligand and chleator at pH 8.0 are approximately: EDTA EGTA Ca++ -10.5 -10.5 Mg++ -8.7 -5.2 The correct statement is that EGTA has an affinity for Magnesium ions that is lower than the affinity of EDTA for Mg++. EGTA should be used when it is desired to have less impact on [Mg++] than on [Ca++]. (This often is the case when isolating membranous subcellular fractions or when it is important to keep the nuclei intact.) EGTA and EDTA have equal affinities for calcium over their effective pH ranges. Thus, one rarely really needs to add both EDTA and EGTA as one or the other should suffice. Also, neither agent allows for creating a condition of complexed magnesium in the presence of excess free calcium. Curt Ashendel Purdue University West Lafayette, IN ashendel@aclcb.purdue.edu From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!rutgers!gatech!howland.reston.ans.net!spool.mu.edu!caen!saimiri.primate.wisc.edu!news.doit.wisc.edu!sweetprotein.ahabs.wisc.edu!user From: ming@ahabs.wisc.edu (Ding Ming) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: a problem in protein purification Date: Thu, 03 Nov 1994 12:40:54 -0600 Organization: University of Wisconsin-Madison Lines: 23 Message-ID: References: <9411031605.AA25047@pobox.upenn.edu> <9411031154.AA36057@bono.oci.utoronto.ca> NNTP-Posting-Host: sweetprotein.ahabs.wisc.edu In article <9411031154.AA36057@bono.oci.utoronto.ca>, jwoodget@oci.utoronto.ca (Jim Woodgett) wrote: > it?). There are three possibilities you could try. Jim, there is at least one more possibility he/she could try:) Dr. Richard Burgess's group had developed a "soft elution" procedure when they were working on RNA polymerase a few years ago. The basic discovery was that IgG bound protein can be eluted from the affinity column by a solution of ammonia sulfate. This procedure was used to solve one of the problems I encountered at a similar situation. I am sorry that I cannot give you the reference at this movement, but you can find it by doing a little bit search. +++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ Ding Ming University of Wisconsin-Madison Telephone: (608)265-3544 Fax: (608)262-7420 ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!CGL.UCSF.EDU!elder From: elder@CGL.UCSF.EDU (Bruce Elder) Newsgroups: bionet.molbio.methds-reagnts Subject: DNAStar Program(s) Date: 3 Nov 1994 11:11:51 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 9 Sender: daemon@net.bio.net Distribution: world Message-ID: <199411031911.LAA07624@socrates.ucsf.EDU> NNTP-Posting-Host: net.bio.net Hi, I was just wondering if anyone out there has experience with programs put out by a company called DNAStar? Th one I am interested in is called Lasergene (I think). Any comments appreciated! Bruce Elder elder@cgl.ucsf.edu From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!rutgers!gatech!howland.reston.ans.net!news2.near.net!emerald.tufts.edu!pearl.tufts.edu!ajayaram From: ajayaram@pearl.tufts.edu Newsgroups: bionet.molbio.methds-reagnts Subject: info wanted on Dynal magnetic beads (efficiency of extraction) Date: 3 Nov 94 14:15:47 EST Organization: Tufts University Lines: 19 Message-ID: <1994Nov3.141547@pearl.tufts.edu> NNTP-Posting-Host: pearl.tufts.edu Hi there I am posting this querry on behalf of a friend who does not have access to the usenet groups. I/We would be grateful for any assistance provided. Thanx a lot. Please mail back to arul@judy.eng.uci.edu so that i can make a hard copy and send it to my friend. ---------------------------------------------------------------------- I want some info on Dynal Magnetic beads: particularly about the efficiency of extraction in comparison with Promega's OligoTex. We want to use it for constructing normalized cDNA libraries, in a one-step substractive procedure. ---------------------------------------------------------------------- Thanx again arul dept of biochemical engineering univ of california, irvine From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!SIUMED.EDU!clawyer From: clawyer@SIUMED.EDU (Carl Lawyer) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: DNAStar Program(s) Date: 3 Nov 1994 18:07:02 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 17 Sender: daemon@net.bio.net Distribution: world Message-ID: <9411040202.AA01443@siumed.edu> NNTP-Posting-Host: net.bio.net At 11:11 AM 11/3/94 -0800, Bruce Elder wrote: >Hi, > >I was just wondering if anyone out there has experience with >programs put out by a company called DNAStar? Th one I am interested >in is called Lasergene (I think). Any comments appreciated! > >Bruce Elder >elder@cgl.ucsf.edu > I have a lot of experience with the DNAStar programs on CD Lasergene for >macintosh & they are excellent. Very user friendly. Let me know if you have ? >about specific applications. Carl Lawyer MD SIU School of Medicine From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!bloom-beacon.mit.edu!grapevine.lcs.mit.edu!uhog.mit.edu!europa.eng.gtefsd.com!howland.reston.ans.net!usc!sol.ctr.columbia.edu!s-cwis.unomaha.edu!crcnis1.unl.edu!news.mid.net!netserv.unmc.edu!netserv.unmc.edu!bghallor From: bghallor@unmc.edu (Brian Halloran) Newsgroups: bionet.molbio.methds-reagnts Subject: Need Help with Northern Blot Date: 3 Nov 1994 18:29:06 GMT Organization: University of Nebraska Medical Center, Omaha, NE, USA Lines: 20 Message-ID: <39ba5i$783@netserv.unmc.edu> NNTP-Posting-Host: netserv.unmc.edu X-Newsreader: TIN [version 1.2 PL2] Our lab is trying to become proficient with Northerns, but we can't seem to get it right. After many months, we are tired of trying to "re-invent the wheel" (about as futile as re-inventing the government) and desparately nned some expert advice. We can get good RNA on extraction, and run good gels, but must be having probs with transfer and/or hybridization. If anyone can help I'd appreciate it. Ideally this grapevine will find someone at the Univ of Nebraska Med Center where we are at so that we may get some real hands-on advice. I feel that just one week of someone's expertise will bring us up to speed, so the posibility exists of someone from my lab travelling to a good center to be trained. Thanks in advance for your consideration Brian Halloran e-mail replies to: bghallor@unmcvm.unmc.edu From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!agate!cat.cis.Brown.EDU!poncho-slip6.cis.brown.edu!user From: Stephen_Lasky@brown.edu alt.fan.hello-kitty alt.fan.hofstadter alt.fan.holmes alt.fan.howard-stern alt.fan.howard-stern.fartman alt.fan.hurricane.yip alt.fan.itchy-n-scratchy alt.fan.james-bond alt.fan.jello-biafra alt.fan.jen- (Stephen R. Lasky, Ph.D. alt.binaries.pictures.erotica.blondes alt.binaries.pictures.erotica.d alt.binaries.pictures.erotica.female alt.binaries.pictures.erotica.male alt.binaries.pictures.erotica.orientals alt.binaries.pictures.fine-art.d alt) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: chilis Date: 4 Nov 1994 00:35:34 GMT Organization: Roger Williams Hospital/Brown U alt.binaries.pictures.fine-art.graphics alt.binaries.pictures.fractals alt.binaries.pictures.misc alt.binaries.pictures.supermodels alt.binaries.pictures.tasteless alt.binaries.pictures.utilities alt.binaries.sounds.d Lines: 55 Distribution: world Message-ID: References: <199411031746.AA23794@wugate.wustl.edu> NNTP-Posting-Host: poncho-slip6.cis.brown.edu In article <199411031746.AA23794@wugate.wustl.edu>, saboteur@BORCIM.WUSTL.EDU (bdl) wrote: > As I recall, the units are called Skovills, and range from about 1 for very > mild fruit to millions of units for the very hottest. The units are defined > empirically by limiting dilution as assayed for "heat" on one's tongue. In > other words, you could dilute a habanero a million (or more? I forget its > skovill rating), I believe that this is an older measurment that was used before the capsicum could be quantitated. It seems to me that the Smithsonian Mag wrote an article on chili's about 2 years ago that described a new, less subjective unit based on the amount of capsicum produced in a specific chile. Could be called a C unit or Capsicum Unit or something like that. That article also compared the rating (I don't remember whether it was in C units or Skovills) of the jalepeno (about 5000 units) and a habenero (>500,000 units I think). >times, and still feel the heat on your tongue. Now, how > subjective this readout is, I don't know, but the results are supposedly > reproducible. My information does not come from any particular expertise in this > area other than love of good spicy food, but I do recall this from an NPR broad- > cast about a year ago. Also, I beleive habaneros have the highest skovill > rating, but my own experience finds scotch bonnets to be far superior in kick. > What do you think? > brett@borcim.wustl.edu > Brett Lindenbach (I realize that this should be on the rec.food.hot (or something) thread so I apologize to those of you not interested.) I haven't tried scotch bonnets fresh or in cooking, but I do know (and have raised) habenero's and they are beautifully hot. So hot that your eyes seem to jump around in their sockets for a few seconds after consuming one. But, I think that the heat in a habenero goes away much faster than the heat in a little thai chile. Where can scotch bonnets be had? (I've had a hot sauce made with them and it is about on the same level as the habenero hot sauces I have had.) SRLasky -- *********************************************************************Stephen R. Lasky, Ph.D. Roger Williams Medical Center/Brown University Phone: 401-456-6572 Fax: 401-456-6569 e-mail: Stephen_Lasky@brown.edu ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ "To me at least, 'Yuck' doesn't capture the full essence of death by neurotoxin." -Dick Dunn ********************************************************************* From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!agate!cat.cis.Brown.EDU!poncho-slip6.cis.brown.edu!user From: Stephen_Lasky@brown.edu alt.fan.hello-kitty alt.fan.hofstadter alt.fan.holmes alt.fan.howard-stern alt.fan.howard-stern.fartman alt.fan.hurricane.yip alt.fan.itchy-n-scratchy alt.fan.james-bond alt.fan.jello-biafra alt.fan.jen- (Stephen R. Lasky, Ph.D. alt.binaries.pictures.erotica.blondes alt.binaries.pictures.erotica.d alt.binaries.pictures.erotica.female alt.binaries.pictures.erotica.male alt.binaries.pictures.erotica.orientals alt.binaries.pictures.fine-art.d alt) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Rf: EDTA in cell fractionatio Date: 4 Nov 1994 00:22:13 GMT Organization: Roger Williams Hospital/Brown U alt.binaries.pictures.fine-art.graphics alt.binaries.pictures.fractals alt.binaries.pictures.misc alt.binaries.pictures.supermodels alt.binaries.pictures.tasteless alt.binaries.pictures.utilities alt.binaries.sounds.d Lines: 33 Message-ID: References: <69172.ashendel@aclcb.purdue.edu> NNTP-Posting-Host: poncho-slip6.cis.brown.edu In article <69172.ashendel@aclcb.purdue.edu>, wrote: Curt, thanks for these #'s, I had forgotten where to find them. > (Schmid and Reilley, Analytical Chem. 29: 264, 1957), the log Kd values > for each ligand and chleator at pH 8.0 are approximately: > > EDTA EGTA > Ca++ -10.5 -10.5 > > Mg++ -8.7 -5.2 > > The correct statement is that EGTA has an affinity for Magnesium ions that > is lower than the affinity of EDTA for Mg++. EGTA should be used when > it is desired to have less impact on [Mg++] than on [Ca++]. (This often is > the case when isolating membranous subcellular fractions or when it is > important to keep the nuclei intact.) > It is also useful when following Pelham and Jacksons protocol for making mRNA dependant retic translation systems. This uses micrococcal nuclease which has a strict requirement for Ca++. SRLasky -- *********************************************************************Stephen R. Lasky, Ph.D. Roger Williams Medical Center/Brown University Phone: 401-456-6572 Fax: 401-456-6569 e-mail: Stephen_Lasky@brown.edu ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ "To me at least, 'Yuck' doesn't capture the full essence of death by neurotoxin." -Dick Dunn ********************************************************************* From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!rutgers!csn!harpo.uccs.edu!sprint!aplummer From: aplummer@sprint.uccs.edu (AL R. PLUMMER) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Drug to kill actively growing yeast cells Date: 3 Nov 1994 18:09:12 GMT Organization: University of Colorado at Colorado Springs Lines: 20 Message-ID: <39b908$7la@harpo.uccs.edu> References: NNTP-Posting-Host: sprint.uccs.edu X-Newsreader: TIN [version 1.2 PL2] Tony Kwan (kwan@medcor.mcgill.ca) wrote: : Hello netters, : I'm looking for a drug that would be able to kill yeast cells which are : actively dividing and would leave those which aren't alone. Something : analogous to penicillin in e.coli, for example. Any help would be : appreciated. : -- : Tony Kwan : Department of Biochemistry, McGill University : kwan@medcor.mcgill.ca How about Nystatin? I have found it very useful for selecting many types of auxotrophic strains. You can find the original paper concerning its use under the authors name, Snow. I forget the reference now, but can get it to you later today. Hope this helps, -Al From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!rutgers!gatech!europa.eng.gtefsd.com!library.ucla.edu!news.mic.ucla.edu!modem0-d.lifesci.ucla.edu!user From: meyerdj@biovx1.biology.ucla.edu (David J. Meyer) Newsgroups: bionet.molbio.methds-reagnts Subject: Unusual 3' RACE artifact? Date: Thu, 03 Nov 1994 09:44:05 -0800 Organization: University of California­Los Angeles Lines: 64 Message-ID: NNTP-Posting-Host: modem0-d.lifesci.ucla.edu Hello, Netters! This is a query about the prevalence of deletion artifacts in PCR and a solicitation of discussion of such artifacts. Nucleotide changes in PCR are an often-discussed problem, but I am unaware of how common deletion artifacts are in PCR. I would like also to learn how such artifacts could arise. Here's the story- I have a cDNA from a library which has a very long 3' UTR; a shorter mRNA (which hybridizations suggest lacks the 3' UTR, although changes elsewhere are possible) is also identified on northerns. Using gene-specific primers based on the sequence of the long cDNA, I performed 3' RACE and identified products arising from the long cDNA (~2 kb), and shorter species which have been cloned and are being sequenced. One of the shorter RACE products (~0.7 kb) corresponds exactly to the sequence of the long cDNA but is truncated at the 3' end (so this is the hypothesized product). However, some still shorter products were identified: these are truncated at the 3' end relative to the long cDNA *at the same point as the 0.7 kb product* but contain deletions within the ORF. One of the deletions is 237 nt and so maintains the ORF. Another deletion is ~187 nt and does not retain the ORF. Note that the shorter deletion appears to begin at the same postion in the sequence as does the other deletion. Of course, the big question is whether these deletions are 1) actually present in some mRNAs or 2) result from an artifact during reverse transcription or 3' RACE (the explanation I am inclined to favor). *Does anyone have similar observations of such artifacts from 3' RACE or other RNA-PCR reactions? I would be very interested in hearing about your experiences!* I have run RNA folding programs to see if there are secondary structures in the RNA which lie in the region which was deleted; of course there are some such structures in the region, but they don't jump out and hit you over the head. (I would need to be hit over the head with an extremely stable secondary structure with endpoints near the deletion endpoints to belive that it is responsible for the deletions 8-) I plan S1 nuclease mapping in the region to address the possible existence of different classes of messenger RNAs‹ this way I avoid more PCR, the technique which may give rise to the potential artifact. Another possibility I have considered is to probe northern blots with sequences corresponding to the region possibly absent in the shorter mRNA. I am also considering PCR (with two gene-specific primers) from cDNA and genomic DNA around this region to see if I get multiple products or indications of introns in the region, respectively. I would appreciate other ideas to address the veracity of these PCR products, and your thoughts on how these apparent deletion products could arise by an artifact in the 3' RACE or how they could arise in the mRNAs (other that alternate exon splicing?) if they are, in fact, real. Thank you for your input! -- ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ David J. Meyer Department of Biological Chemistry University of California-Los Angeles meyerdj@biovx1.biology.ucla.edu From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!agate!trib.apple.com!olivea!uunet!dziuxsolim.rutgers.edu!gandalf.rutgers.edu!not-for-mail From: dak@gandalf.rutgers.edu (Dorothy Klein) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Question on chillies Date: 3 Nov 1994 12:22:28 -0500 Organization: Rutgers University Lines: 29 Distribution: bionet Message-ID: <39b68k$ha@gandalf.rutgers.edu> References: <395p56$k80@mserv1.dl.ac.uk> NNTP-Posting-Host: gandalf.rutgers.edu ROGERSH writes: >What is the name of the scientific unit for the degree of hotness of a chilli >and, more importantly, how is it measured? Does an international standard >exist? The hotness of chiles is measured in Scoville units, an open-ended scale based on the dilution factor at which the hotness is still perceived by taste-testers, in aqueous solution. Habaneros rate at something like 10,000 (or was it 40,000?) Scoville units. For exact testing protocols, try asking on rec.gardens, where you may be referred to a chiliheads FAQ or mailing list. A decent popular explanation of the method appeared in _Organic Gardening_ within the past two years. It's probably treated in some articles on the hot pepper craze, too. Later, Dorothy Klein grad student, microbiology and molecular genetics Rutgers University From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!BORCIM.WUSTL.EDU!saboteur From: saboteur@BORCIM.WUSTL.EDU (bdl) Newsgroups: bionet.molbio.methds-reagnts Subject: chilis Date: 3 Nov 1994 09:46:35 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 25 Sender: daemon@net.bio.net Distribution: world Message-ID: <199411031746.AA23794@wugate.wustl.edu> NNTP-Posting-Host: net.bio.net As I recall, the units are called Skovills, and range from about 1 for very mild fruit to millions of units for the very hottest. The units are defined empirically by limiting dilution as assayed for "heat" on one's tongue. In other words, you could dilute a habanero a million (or more? I forget its skovill rating), times, and still feel the heat on your tongue. Now, how subjective this readout is, I don't know, but the results are supposedly reproducible. My information does not come from any particular expertise in this area other than love of good spicy food, but I do recall this from an NPR broad- cast about a year ago. Also, I beleive habaneros have the highest skovill rating, but my own experience finds scotch bonnets to be far superior in kick. What do you think? brett@borcim.wustl.edu Brett Lindenbach Lucille P. Markey Student in Human Pathobiology Immunology Program Dept. of Molecular Microbiology Washington University School of Medicine, Box 8230 660 S. Euclid Ave. St. Louis, MO 63110-1093 Phone: (314) 362-2767 Fax: (314) 362-1232 E-mail: brett@borcim.wustl.edu From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Newsgroups: bionet.molbio.methds-reagnts Path: biosci!agate!spool.mu.edu!caen!newsxfer.itd.umich.edu!gatech!news-feed-1.peachnet.edu!news.duke.edu!solaris.cc.vt.edu!uunet!utcsri!utnut!oci!bono.oci.utoronto.ca From: jwoodget@oci.utoronto.ca (Jim Woodgett) Subject: Re: a problem in protein purification Content-Type: text/plain; charset=US-ASCII Message-ID: <9411031154.AA36057@bono.oci.utoronto.ca> Sender: news@oci.utoronto.ca Reply-To: jwoodget@oci.utoronto.ca (Jim Woodgett) Organization: Ontario Cancer Institute X-Newsreader: InterCon TCP/Connect II 2.0.1 References: <9411031605.AA25047@pobox.upenn.edu> Mime-Version: 1.0 Date: Thu, 3 Nov 1994 16:54:36 GMT Lines: 44 In article <9411031605.AA25047@pobox.upenn.edu>, yluo@POBOX.UPENN.EDU (yuling luo) writes: > I am trying to purify a myc-tagged recombinant protein (pI=7.6, 100 > kd) from the supernatant of baculovirus-infected insect cells. I > first enriched the protein on a cation exchange column, which worked > out fine. > I then loaded the eluate into an anti-myc monoclonal affinity column > and eluted the column with 0.1 M glycine pH 2.5. I found that most of > the myc-tagged protein bound to the affinity column. But the > eluted protein is in precipitated form. It become obvious when I > netralize the elute to netral pH with Tris buffer. Then I would just see > a big white precipitate forming. I also tried high pH elution buffer. > The eluted protein is still precipitated. My questions are 1) could > this be the problem of the affinity column itself? (if it is, I could > try different ways to purify it) 2) Could this be the protein's > problem? (ie, the protein will aggregate in the absence of other > proteins, if this is the case, I am hopeless. 3) anyone out there > has similar experience? Clearly your 100 kDa protein doesn't like being at pH 2.5 (who could blame it?). There are three possibilities you could try. Try eluting with diethylamine (50 mM, freshly pHed to 11.5). It's possible your protein doesn't object so much to alkali, but it's a long shot. Try eluting with 4M MgCl2. This is chaotropic and has the same potential problems as extreme pH. In all cases dilute or neutrilize as quickly as possible (have a buffer in the collection tubes). Finally, synthesize the epitope peptide and use it to compete the protein. This is highly likely to work but is expensive. It also screws up your antibody column as its very difficult to elute all of the peptide in a regeneration step. You can recover the excess peptide that elutes with your protein and recycle it. Why do you need to tag purify in the first place if you are using baculovirus expression? Usually proteins require only 100-500 fold purification from such systems. It might be worth trying conventional purification and following the protein by Myc tag immunoblotting. Jim Woodgett From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!daresbury!not-for-mail From: Newsgroups: bionet.molbio.methds-reagnts Subject: Luciferase sensitive to dilution Date: 3 Nov 1994 16:57:06 -0000 Lines: 22 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <39b4p2$hv1@mserv1.dl.ac.uk> X-Mts: smtp Original-To: methods@dl.ac.uk Dear netters, In my transfections I obtained unproportionally poor luciferase readings in samples where I had only few cells left (e.g. 5- 10% confluency, 60 ul reporter lysis buffer in one well of a 24 well plate). Promega answered that luciferase is indeed sensitive to dilution in the reporter lysis buffer (RLB). The cell culture lysis reagent however has a higher detergent concentration and luciferase is more stable. So, for cells that are washed away easily during transfection you might want to think about reducing the amount of RLB, or increase the cell density to begin with, or include some BSA in your buffer. Just wanted to share that information Yours sincerely Dr. Roger Aeschbacher c/o CIBA Pharma Research Mauerstr. K 681-304 4002 Basel E-mail: aeschba@fmi.ch From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!daresbury!not-for-mail From: Newsgroups: bionet.molbio.methds-reagnts Subject: When do you starve cells after transfection? Date: 3 Nov 1994 16:45:24 -0000 Lines: 27 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <39b434$h6a@mserv1.dl.ac.uk> X-Mts: smtp Original-To: methods@dl.ac.uk Dear netters, My question: How quickly after transfection can you start to starve the cells. Will cells that are starved the same day that they were transfected still take the DNA correctly up and express it once you induce the cells? I transfect cell lines with plasmids expressing the luciferase reporter gene under the control of various promoters. I starve the cells 24 to 48 hours after transfection with 0.5% FCS overnight (more than 16hours), then in the morning 0% FCS for 3 to 4 hours. At this point, I induce with different compounds. Analysis of luciferase is in intervals up to 24hours later. I'd like to shorten now the time between starvation and induction, since quite often I take time points which are up to 96 hours after transfection. Also how do you correct for simple induction of metabolism and growth, which leads to more gene expression. I use SV40 promoter as a reference point, but I wonder if it really is a good "baseline". Thanks for your answers. Dr. Roger Aeschbacher c/o CIBA Pharma Research Mauerstr. K 681-304 4002 Basel E-mail: aeschba@fmi.ch From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!THORIN.UTHSCSA.EDU!HARDIES From: HARDIES@THORIN.UTHSCSA.EDU Newsgroups: bionet.molbio.methds-reagnts Subject: re: PCR primer design (keep eye on 3' end) Date: 3 Nov 1994 08:40:56 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 49 Sender: daemon@net.bio.net Distribution: world Message-ID: <941103104224.60200923@thorin.uthscsa.edu> NNTP-Posting-Host: net.bio.net Melisa Wall asked which of the following PCR primer self complementarity problem was worse: 1 5' GCCGTCGGATGCGCCGGAATTCGCG 3' ****** * 3' CTTAAGGCCGCGTAGGCTGCCG 5' 2 5' GGCGTCGGATGCGCCGGAATTCGCG 3' * ** * **** * * * 3' GCCCACCGAACGGATTCCTCGCAGG 5' Hi Melisa, I've added 5' and 3' and complementarity the way I assume that your program is reporting its results. This is very important to get right, because the critical thing is to see what is happening with the 3' ends. Match #1 above is potentially disasterous, because the bottom primer will prime on the upper primer and extend, potentially removing it completely from your rxn. This is called "primer dimer". It may be possible to squeeze by if you make your annealing temp. very stringent, but most people would try to avoid perfect complementarity of more than about 3 bp involving the 3' end. Even if the match computes to a Tm below your annealing temp., the polymerase may stabilize it and prime anyway. Match #2 is inconsequential. It doesn't result in polymerization. It would only be a problem if it were so strong that the hybrid would hold together at your annealing temp., thus holding both primers back from priming. A good primer design program should give you some quantitative indication of the stability. This one isn't close to being a problem, and you could hardly design two primers without this much matching between them. If the primer is self complementary such that it hairpins into a stem loop, then it gains some stabilization from the intramolecular nature of the structure. A good design program will tell you if a primer has a stable enough hairpin to remove itself from your priming rxn at the annealing temp. This would require a pretty impressive self-complementary stem, however, so you could usually screen these cases out by eye. I hope this helps. Steve Hardies, Dept. of Biochemistry, Univ. of Texas HSC at San Antonio Hardies@thorin.uthscsa.edu From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!agate!howland.reston.ans.net!wupost!newspump.wustl.edu!cerberus-138.wustl.edu!NewsWatcher!user From: anderson@pharmdec.wustl.edu (Eric C. Anderson) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: temperature sensitive mutants Followup-To: bionet.molbio.methds-reagnts Date: Thu, 03 Nov 1994 14:51:38 -0600 Organization: Dept. of Molecular Biol. & Pharmacology Lines: 20 Distribution: world Message-ID: References: NNTP-Posting-Host: 128.252.181.14 In article , bawagan@umdnj.edu (Hinayana Bawagan) wrote: > > Request for general literature reference on the significance of and > studies that can be done on ts mutants. ts mutants of what? this might make a difference. -- ************************************* *Of course it's not true... * *But let's make the bastard deny it!* * LBJ (1948) * ************************************* eric c. anderson anderson@pharmdec.wustl.edu dept. of molecular bio. and pharm. (314)362-3963 (lab) washington univ. school of medicine (314)862-2435 (home) 660 s. euclid box 8103 (314)362-7058 (FAX) st. louis, mo 63110 From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!rutgers!gatech!howland.reston.ans.net!pipex!oleane!jussieu.fr!univ-lyon1.fr!swidir.switch.ch!scsing.switch.ch!sun.rediris.es!obelix.cica.es!news From: bb1dopeg@lucano.uco.es (Gabriel Dorado) Newsgroups: bionet.molbio.methds-reagnts Subject: Genomic DNA from E.coli without phenol or chloroform?? Date: 3 Nov 1994 16:43:23 GMT Organization: Centro Informatico Cientifico de Andalucia Lines: 9 Sender: -Not-Authenticated-[3387] Message-ID: <39b3vb$rnj@obelix.cica.es> NNTP-Posting-Host: macta.uco.es X-Posted-From: InterNews 1.0.1@macta.uco.es Xdisclaimer: No attempt was made to authenticate the sender's name. Anybody knows a reliable method to obtain genomic DNA from E coli without the need of hazardous substances like phenol or chloroform? The DNA should be suitable for PCR amplification. Any kit available? I have read the new Puregene Isolation Kits from Flowgene can do it. Anybody has tried them? Thanks G. Dorado Internet Email: bb1dopeg@lucano.uco.es From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!rutgers!gatech!howland.reston.ans.net!pipex!oleane!jussieu.fr!univ-lyon1.fr!swidir.switch.ch!scsing.switch.ch!sun.rediris.es!obelix.cica.es!news From: bb1dopeg@lucano.uco.es (Gabriel Dorado) Newsgroups: bionet.molbio.methds-reagnts Subject: AUSTRALIA, Sidney, St. Vincent's Hospital, Dr. J.A. Eisman et al?? Date: 3 Nov 1994 16:43:11 GMT Organization: Centro Informatico Cientifico de Andalucia Lines: 18 Sender: -Not-Authenticated-[3387] Message-ID: <39b3uv$rnj@obelix.cica.es> NNTP-Posting-Host: macta.uco.es X-Posted-From: InterNews 1.0.1@macta.uco.es Xdisclaimer: No attempt was made to authenticate the sender's name. I am trying to find the Email or Fax number of any of the following researchers at St. Vincent's Hospital, Sydney, Australia (I could not reach them by post!): Place: Bone and Mineral Research Division, Garvan Institute of Medical Research, St. Vincent's Hospital, Sydney, New South Wales 2010, Australia. People: Dr. John A. Eisman Or any of his collaborators, including: Dr. Nigel A. Morrison; Dr. Jian Cheng Qi; Dr. Akifumi Tokita; Dr. Paul J. Kelly, Dr. Linda Crofts; Dr. tuan V. Nguyen, Dr. Philip N. Sambrook. Thanks. G. Dorado Internet Email: bb1dopeg@lucano.uco.es From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!rutgers!gatech!howland.reston.ans.net!pipex!oleane!jussieu.fr!centre.univ-orleans.fr!univ-lyon1.fr!swidir.switch.ch!scsing.switch.ch!sun.rediris.es!obelix.cica.es!news From: bb1dopeg@lucano.uco.es (Gabriel Dorado) Newsgroups: bionet.molbio.methds-reagnts Subject: Genomic DNA from E.coli without phenol or chloroform?? Date: 3 Nov 1994 09:10:14 GMT Organization: Centro Informatico Cientifico de Andalucia Lines: 9 Sender: -Not-Authenticated-[3387] Message-ID: <39a9dm$q22@obelix.cica.es> NNTP-Posting-Host: macta.uco.es X-Posted-From: InterNews 1.0.1@macta.uco.es Xdisclaimer: No attempt was made to authenticate the sender's name. Anybody knows a reliable method to obtain genomic DNA from E coli without the need of hazardous substances like phenol or chloroform? The DNA should be suitable for PCR amplification. Any kit available? I have read the new Puregene Isolation Kits from Flowgene can do it. Anybody has tried them? Thanks G. Dorado Internet Email: bb1dopeg@lucano.uco.es From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!rutgers!gatech!howland.reston.ans.net!pipex!oleane!jussieu.fr!centre.univ-orleans.fr!univ-lyon1.fr!swidir.switch.ch!scsing.switch.ch!sun.rediris.es!obelix.cica.es!news From: bb1dopeg@lucano.uco.es (Gabriel Dorado) Newsgroups: bionet.molbio.methds-reagnts Subject: AUSTRALIA, Sidney, St. Vincent's Hospital, Dr. J.A. Eisman et al?? Date: 3 Nov 1994 09:10:01 GMT Organization: Centro Informatico Cientifico de Andalucia Lines: 18 Sender: -Not-Authenticated-[3387] Message-ID: <39a9d9$q22@obelix.cica.es> NNTP-Posting-Host: macta.uco.es X-Posted-From: InterNews 1.0.1@macta.uco.es Xdisclaimer: No attempt was made to authenticate the sender's name. I am trying to find the Email or Fax number of any of the following researchers at St. Vincent's Hospital, Sydney, Australia (I could not reach them by post!): Place: Bone and Mineral Research Division, Garvan Institute of Medical Research, St. Vincent's Hospital, Sydney, New South Wales 2010, Australia. People: Dr. John A. Eisman Or any of his collaborators, including: Dr. Nigel A. Morrison; Dr. Jian Cheng Qi; Dr. Akifumi Tokita; Dr. Paul J. Kelly, Dr. Linda Crofts; Dr. tuan V. Nguyen, Dr. Philip N. Sambrook. Thanks. G. Dorado Internet Email: bb1dopeg@lucano.uco.es From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!rutgers!gatech!howland.reston.ans.net!wupost!newspump.wustl.edu!cerberus-138.wustl.edu!NewsWatcher!user From: anderson@pharmdec.wustl.edu (Eric C. Anderson) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Soliciting Comments on Sequence Analysis Software Followup-To: bionet.molbio.methds-reagnts Date: Thu, 03 Nov 1994 14:05:59 -0600 Organization: Dept. of Molecular Biol. & Pharmacology Lines: 40 Distribution: world Message-ID: References: <3994qu$ao9@lastactionhero.rs.itd.umich.edu> NNTP-Posting-Host: 128.252.181.14 In article <3994qu$ao9@lastactionhero.rs.itd.umich.edu>, jddecker@umich.edu (Jim Decker) wrote: > I am soliciting comments on sequence analysis software that is personal > computer based. We are currently using GCG on the vax and find it > quite cumbersome and overall difficult to use. I have sent away for a > thirty day trial of the Intelligenetics PC/Gene. I can use either a > MAC or Dos-Windows format. > Thanks for your help. our lab uses a number of different analysis programs including DNA Star, DNA Strider, Geneworks (the Mac version of PC Gene) and Sequence Navigator (the sequence analysis software for the ABI 373 autosequencer. Geneworks has become the standard and everyone uses it for most analysis situations. although there are people in this lab who think that Geneworks is the worst thing since Hitler, i actually kind of like the way that it works. it's newest version (2.3.1 i think) is very easy to use and powerful. this is the one that i use in conjunction with Navigator which i use to clean up data from the autosequencer before putting it into Geneworks, unfortunately, Navigator isn't a very useful analysis program and is very clumsy. Geneworks has an excellent interface and most things can be done using common sense (i used it for a few months b4 i read the manual). hope this is helpful, eric -- ************************************* *Of course it's not true... * *But let's make the bastard deny it!* * LBJ (1948) * ************************************* eric c. anderson anderson@pharmdec.wustl.edu dept. of molecular bio. and pharm. (314)362-3963 (lab) washington univ. school of medicine (314)862-2435 (home) 660 s. euclid box 8103 (314)362-7058 (FAX) st. louis, mo 63110 From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!rutgers!gatech!europa.eng.gtefsd.com!news.umbc.edu!haven.umd.edu!purdue!mozo.cc.purdue.edu!bc214a.biochem.purdue.edu!user From: wolle@biochem.purdue.edu (Dana Wolle) Newsgroups: bionet.molbio.methds-reagnts Subject: help:how tomake 250ug 130bp fragment? Followup-To: bionet.molbio.methds-reagnts Date: Thu, 03 Nov 1994 21:55:04 +0200 Organization: Biochemistry -- Purdue U. Lines: 4 Message-ID: NNTP-Posting-Host: bc214a.biochem.purdue.edu I need 250ug of a 130bp DNA fragment for affinity column. I don't know what is the goog method to make it. Anybody can help? lu@aclcb.purdue.edu From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!rutgers!gatech!howland.reston.ans.net!wupost!waikato!comp.vuw.ac.nz!news.massey.ac.nz!nikau.palm.cri.nz!gra79.grasslands.cri.nz!user From: agpfxm@pnv.palm.cri.nz (Ferenc Marincs) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Smallest Cloning Vector and Selectable Marker ... Date: 3 Nov 1994 18:18:50 GMT Organization: AgResearch Lines: 27 Message-ID: References: <394epv$mr2@usenet.INS.CWRU.Edu> NNTP-Posting-Host: gra79.grasslands.cri.nz In article , vam2@midway.uchicago.edu (Viraj Master) wrote: > pMOB is a 1.8 kb stripped-down BluescriptII. It contains the full MCS, > T3/T7 RNA pol. binding sites, B-lactamase gene for ampicillin resistance > and an origin of replication. I hope this helps. > > Good luck > Viraj > > -- > Viraj Master > Dept. of Organismal Biology and Anatomy > University of Chicago Hi, Viraj Do you know any source for the plasmid pMOB. Please let me know, I would need it. Thanks, Frank Ferenc Marincs AgResearch, Private Bag 11008, Palmerston North, New Zealand Phone: +64-6-356 8019, Fax: +64-6-351 8032 E-mail: agpfxm@pnv.palm.cri.nz From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!agate!howland.reston.ans.net!news.sprintlink.net!EU.net!uknet!daresbury!not-for-mail From: Newsgroups: bionet.molbio.methds-reagnts Subject: Izinta Date: 3 Nov 1994 10:49:51 -0000 Lines: 20 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <39af8f$86@mserv1.dl.ac.uk> MIME-Version: 1.0 Original-To: methods@dl.ac.uk Does someone know the "IZITAN TRADING CO" address ? I know that it is in Budapest but no more. thanks by advance. Georges -------------------------------------------------------------------------------- Georges GAUDRIAULT Institut de pharmacologie moleculaire et cellulaire 660, route des lucioles 06560 valbonne FRANCE Tel:19 (33)-93-95-77-61 Tel:19 (33)-93-95-77-08 e-mail :mazella@naxos.unice.fr ---------------------------------------------------------------------------- ---- From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!daresbury!not-for-mail From: nce@rri.sari.ac.uk (Nigel Eastmond) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Question on chillies Date: 3 Nov 1994 09:20:11 -0000 Organization: Rowett Research Institute Lines: 35 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <39aa0b$o7n@mserv1.dl.ac.uk> References: <9411205927.~INN-HRCa00163.bionet-news@dl.ac.uk> Apparently-To: DE ANGELIS,DINO (BG2Z000@CA.MCGILL.MUSICB) wrote: : In article <395p56$k80@mserv1.dl.ac.uk> ROGERSH writes: : >Netters - I have often found that deep scientific questions to the net often : >go unanswered, while those of a more whimsical nature generate many replies. : >Anyway, to help prove this to myself I would be grateful for any answers to : >the following question (which has troubled myself and others over many beers): : >What is the name of the scientific unit for the degree of hotness of a chilli : >and, more importantly, how is it measured? Does an international standard exist?Sorry, thats three questions. : >. : >. : the fiery sensation which chili peppers cause is due to capsaicin, a : potent chemical which survives both cooking and freezing processes. : The amount of capsaicin present in a chili determines its fieriness. : In addition to causing a burning sensation, this substance triggers : brain to produce endorphins-natural painkillers that promote a sense : of well being and stimulation. Chilis are classified on a scale of 0 : (bell peppers) to 10 (habanero-handle this baby with gloves, people: it : is 30 to 50 times hotter that the jalapeno!!!) : Dino De Angelis : McGill University : Biochemistry Dept. : 3655 Drummond St. : Montreal QC H3G 1Y6 : CANADA But what about units? How about Sombreros? -- News Administrator, | JANET: Rowett Research Institute, | other: Greenburn Road, Bucksburn, | phone: +44 (0)224 712751 Aberdeen, AB2 9SB. UK. | fax: +44 (0)224 715349 From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!CS.Arizona.EDU!news.Arizona.EDU!hamblin.math.byu.edu!sol.ctr.columbia.edu!howland.reston.ans.net!torn!nermal.cs.uoguelph.ca!herman.cs.uoguelph.ca!nxu From: nxu@uoguelph.ca (Nanfel Xu) Newsgroups: bionet.molbio.methds-reagnts Subject: Need advice on soybean protoplast Date: 3 Nov 1994 01:34:33 GMT Organization: University of Guelph Lines: 14 Message-ID: <399en9$fis@nermal.cs.uoguelph.ca> NNTP-Posting-Host: herman.cs.uoguelph.ca X-Newsreader: TIN [version 1.2 PL2] I am trying to isolate protoplast from cotyledons of germinated soybean seeds. Some of the protoplast can be liberated by 0.1% pectolyase and 3% cellulase (both from Sigma). But I have two problems. First, the liberated protoplasts become brown (and presumably died) after an hour or so, while waiting for more protoplasts to be released. Also, the work of cellulase seems to be quit slow. By 12 h, almost all the cotyledon pieces are broken into single cells, but the proportion of protoplast is small. Has anybody encountered this kind of problems before? What can I do to improve the yield and quality of these protos? Thank you. Nanfei Xu From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!rutgers!gatech!howland.reston.ans.net!spool.mu.edu!caen!usenet.coe.montana.edu!Msu.oscs.montana.edu!uvsbgsm From: uvsbgsm@Msu.oscs.montana.edu Newsgroups: bionet.molbio.methds-reagnts Subject: cell surface biotinylation Date: Thu, 03 Nov 1994 14:38:58 Organization: Montana State University Lines: 7 Message-ID: <00986EB1.19F25B80@Msu.oscs.montana.edu> Reply-To: uvsbgsm@Msu.oscs.montana.edu NNTP-Posting-Host: trex.oscs.montana.edu I have been trying to cell surface biotinylate membrane proteins with very little efficiency. Radiolabeled monoclonals bound to surface proteins give a higher signal, so I really think I have an efficiency problem. The protein is a highly glycosylated type I protein expressed in CHO cells. Any methods/advice would be welcome. Thanks! From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!rutgers!gatech!newsxfer.itd.umich.edu!caen!usenet.coe.montana.edu!Msu.oscs.montana.edu!uvsbgsm From: uvsbgsm@Msu.oscs.montana.edu Newsgroups: bionet.molbio.methds-reagnts Subject: Texas Red labeling of antibodies Date: Thu, 03 Nov 1994 14:34:47 Organization: Montana State University Lines: 4 Message-ID: <00986EB0.84216420@Msu.oscs.montana.edu> Reply-To: uvsbgsm@Msu.oscs.montana.edu NNTP-Posting-Host: trex.oscs.montana.edu I have been trying to texas red label purified monoclonal antibody with no luck using the Current Protocols in Immunology method. Efficiency is very low. Does anyone out there have a good method/advice? Thanks! From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!rutgers!gatech!newsxfer.itd.umich.edu!zip.eecs.umich.edu!caen!saimiri.primate.wisc.edu!news.doit.wisc.edu!sweetprotein.ahabs.wisc.edu!user From: ming@ahabs.wisc.edu (Ding Ming) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: a problem in protein purification Date: Thu, 03 Nov 1994 16:54:13 -0600 Organization: University of Wisconsin-Madison Lines: 18 Message-ID: References: <9411031605.AA25047@pobox.upenn.edu> <9411031154.AA36057@bono.oci.utoronto.ca> <39blhk$nrf@netnews.upenn.edu> NNTP-Posting-Host: sweetprotein.ahabs.wisc.edu In article <39blhk$nrf@netnews.upenn.edu>, yluo@pobox.upenn.edu (yuling luo) wrote: > Thanks for the reply, I did exactly what Jim suggested. ie, tried high > pH DEA elution and 5M LiCl elution. It didn't work out. In fact I am trying > conventional methods now. I wonder if ming could dig out the reference > and send it to me. I did the search on Richard Burgess and didn't find > the reference ming refered. thanks a lot for the suggestion. yl JBC 265:7069-77 Vox. Sang. 58, 21-29 +++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ Ding Ming University of Wisconsin-Madison Telephone: (608)265-3544 Fax: (608)262-7420 ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Newsgroups: bionet.molbio.methds-reagnts Path: biosci!rutgers!gatech!howland.reston.ans.net!newsserver.jvnc.net!cyanamid!igate.cyanamid.com!sandy From: sandy@icr.pt.cyanamid.COM (Sandy Silverman) Subject: Re: Question on chillies In-Reply-To: "DE ANGELIS,DINO"'s message of 01 NOV 94 23:42:45 EST Message-ID: Sender: news@cyanamid.uucp Organization: American Cyanamid Company References: <395p56$k80@mserv1.dl.ac.uk> <01NOV94.25609710.0067@VM1.MCGILL.CA> Date: Thu, 3 Nov 1994 21:58:08 GMT Lines: 9 I believe there is a standard (international?) unit called the scoville, after a person. It ranges up into the 300,000s for the hottest (habanero, thai, etc.) Peppers are rated by dilution and tasting for the highest dilution still detectable as "hot". -------Sandy -- Sanford Silverman >Opinions expressed here are my own< American Cyanamid silvermans@pt.cyanamid.com "Yeast is Best" From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!bloom-beacon.mit.edu!grapevine.lcs.mit.edu!uhog.mit.edu!europa.eng.gtefsd.com!howland.reston.ans.net!gatech!rutgers!netnews.upenn.edu!pobox.upenn.edu!yluo From: yluo@pobox.upenn.edu (yuling luo) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: a problem in protein purification Date: 3 Nov 1994 21:43:16 GMT Organization: University of Pennsylvania Lines: 29 Message-ID: <39blhk$nrf@netnews.upenn.edu> References: <9411031605.AA25047@pobox.upenn.edu> <9411031154.AA36057@bono.oci.utoronto.ca> NNTP-Posting-Host: pobox.upenn.edu X-Newsreader: TIN [version 1.2 PL2-upenn1.1] Ding Ming (ming@ahabs.wisc.edu) wrote: : In article <9411031154.AA36057@bono.oci.utoronto.ca>, : jwoodget@oci.utoronto.ca (Jim Woodgett) wrote: : > it?). There are three possibilities you could try. : Jim, : there is at least one more possibility he/she could try:) : Dr. Richard Burgess's group had developed a "soft elution" procedure when : they were working on RNA polymerase a few years ago. The basic discovery : was that IgG bound protein can be eluted from the affinity column by a : solution of ammonia sulfate. This procedure was used to solve one of the : problems I encountered at a similar situation. I am sorry that I cannot : give you the reference at this movement, but you can find it by doing a : little bit search. : +++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ : Ding Ming : University of Wisconsin-Madison : Telephone: (608)265-3544 Fax: (608)262-7420 : ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ Thanks for the reply, I did exactly what Jim suggested. ie, tried high pH DEA elution and 5M LiCl elution. It didn't work out. In fact I am trying conventional methods now. I wonder if ming could dig out the reference and send it to me. I did the search on Richard Burgess and didn't find the reference ming refered. thanks a lot for the suggestion. yl From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!rutgers!netnews.upenn.edu!dsinc!spool.mu.edu!howland.reston.ans.net!pipex!sunsite.doc.ic.ac.uk!hgmp.mrc.ac.uk!daresbury!not-for-mail From: Clemens Suter-Crazzolara Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Refolding urea-solubilized protein Date: 3 Nov 1994 21:40:30 -0000 Lines: 27 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <39blce$2tv@mserv1.dl.ac.uk> MIME-Version: 1.0 Original-To: mmp@bioc.rice.edu > > I have overproduced a recombinant plant protein in E. coli, and it is > insoluble. I can solubilize it in urea and isolate it by its Histidine tag > on a nickel column, but I need to get rid of the urea and hopefully refold > it correctly to reconstitute its activity. > > When I try to dialyze to remove the urea, the protein precipitates. What > are some techniques used to promote folding? Should I add anything that > will help stabilize the protein while it folds? What concentration is best > for the protein in the dialysis tubing? Are there other techniques that > might be better than dialysis? (I tried gradual removal by dialysis into > lesser concentrations of urea, and it looked OK at 4 M, but precipitated at > 2 M). > > If anybody can recommend any articles or books that might also help, these > would be greatly appreciated. I have the same problem. Currently, I dialyze first against NaPo4 (5 mM) , 0.01% Triton X-100 and 6 M urea. Then I remove the Urea by very slow dialysis against the same without Urea, this takes appr. 3 days. The protein precipitates, so I centrifuhe and use the supernatant. The concentration is about 20 micrograms / ml... and is biologically active. Since I am working with a member of the TGF-beta family, I am thinking of trying a very low pH (currently it is at 6.8), which may help. hope this helps a little. clemens, heidelberg From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!rutgers!netnews.upenn.edu!dsinc!spool.mu.edu!howland.reston.ans.net!news.sprintlink.net!EU.net!sunic!ugle.unit.no!trane.uninett.no!daresbury!not-for-mail From: Clemens Suter-Crazzolara Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Use of Amersham's Hybond N+ Date: 3 Nov 1994 21:38:47 -0000 Lines: 10 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <39bl97$2pk@mserv1.dl.ac.uk> MIME-Version: 1.0 Original-To: HAVILAND@KIDS.WUSTL.EDU do any of you have experience with Zetaprobe from Biorad and how does that compare to Hybond N+ ??? I am now# working with hybond, but my impression is that zetaprobe is better. No relationship with any of these companies. clemens, heidelberg From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!rutgers!gatech!howland.reston.ans.net!europa.eng.gtefsd.com!news.umbc.edu!haven.umd.edu!purdue!news.bu.edu!olivea!uunet!zib-berlin.de!informatik.tu-muenchen.de!lrz-muenchen.de!news.informatik.uni-muenchen.de!wap18.zi.biologie.uni-muenchen.de!salger From: salger@wap18.zi.biologie.uni-muenchen.de (Klaus Salger) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Where can I get EcoA? Date: 3 Nov 1994 21:05:40 GMT Organization: Institut fuer Informatik der Universitaet Muenchen Lines: 17 Distribution: world Message-ID: <39bjb4$lff@arcadia.informatik.uni-muenchen.de> References: NNTP-Posting-Host: wap18.zi.biologie.uni-muenchen.de X-Newsreader: TIN [version 1.2 PL2] kamin johnson (kamin_johnson@cellbio.duke.edu) wrote: : I would like to know of any sources of the restriction enzyme EcoA. : thanks, kam Do you mean EcoA4I, target sequence: GGTCTC? If so, there is an isoschizomer, BsaAI, which is available from NEB. Hope this helps Klaus -- Klaus Salger phone : ++49 (0)89 5902 -502 Zoologisches Institut FAX : -450 AG MacWilliams e-mail: salger@zi.biologie.uni-muenchen.de Luisenstr. 14 80333 Muenchen Germany From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!daresbury!bioftp.unibas.ch!citi2.fr!jussieu.fr!cea.fr!usenet From: cisitm@albert.cad.cea.fr (Pierre Didierjean) Newsgroups: bionet.molbio.methds-reagnts Subject: *** Q: WHAT KIND OF PEOPLE ON THE NET ? Date: 3 Nov 1994 16:17:12 GMT Organization: SSII Lines: 28 Sender: cisitm@albert.cad.cea.fr Message-ID: <39b2e8$9pl@anemone.saclay.cea.fr> NNTP-Posting-Host: nyassa.cad.cea.fr I'd like to know what kind of people i find on the net. Students, Commercials, Adminitrations, Scientifics or what ?? Is anybody knows that or have statistical results ? What are YOU doing in life ? I am a system administrator. Thanks for the answers and sorry for my english ..... Bye +-----------------------------------------------------------------------------+ | Pierre DIDIERJEAN | | | | Administrateur Systeme UNIX | | Cisi, Aix-en-Provence | | France | +-----------------------------------------------------------------------------+ | email : cisitm@albert.cad.cea.fr | +-----------------------------------------------------------------------------+ From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!PUCCINI.CRL.UMN.EDU!debbys From: debbys@PUCCINI.CRL.UMN.EDU ("Deborah A. Samac") Newsgroups: bionet.molbio.methds-reagnts Subject: Chemiluminescent assay for GUS Date: 3 Nov 1994 08:26:33 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 9 Sender: daemon@net.bio.net Distribution: world Message-ID: <199411031627.KAA21539@puccini.crl.umn.edu> NNTP-Posting-Host: net.bio.net Dear Netters, I would like some information on chemiluminescent detection of beta-glucuronidase (GUS). Who sells the reagents? Which luminometer do you recommend for microtiter plate assays? Is the chemiluminescent assay easier or more sensitive than the fluorometric assay? Protocols for use with plant samples would be much appreciated. Thanks in advance. The net is great! From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Newsgroups: bionet.molbio.methds-reagnts Path: biosci!agate!howland.reston.ans.net!pipex!sunsite.doc.ic.ac.uk!warwick!bsmail!mail!pamkb From: pamkb@mail.bris.ac.uk (M K Bennett) Subject: Re: Question on chillies Message-ID: Sender: usenet@info.bris.ac.uk (Usenet news owner) Nntp-Posting-Host: mail.bris.ac.uk Organization: University of Bristol, England X-Newsreader: TIN [version 1.2 PL1] References: <9411205927.~INN-HRCa00163.bionet-news@dl.ac.uk> <39aa0b$o7n@mserv1.dl.ac.uk> Distribution: bionet Date: Thu, 3 Nov 1994 15:58:07 GMT Lines: 21 Nigel Eastmond (nce@rri.sari.ac.uk) wrote: : DE ANGELIS,DINO (BG2Z000@CA.MCGILL.MUSICB) wrote: : : In article <395p56$k80@mserv1.dl.ac.uk> : ROGERSH writes: : But what about units? How about Sombreros? I was watching one of these pseudo science programs and their is an actual unit of "hottness" of chillies, but I've tried all day and I cant remember what it is. mike ----------------------------------------------------------------------------- Mike Bennett D.Phil |Scientists have odious manners, except when Dept Pathology and Microbiology,|you prop up their theory; then you can borrow University of Bristol, UK |money from them--Mark Twain 1917 m.k.bennett@bristol.ac.uk | ----------------------------------------------------------------------------- From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!POBOX.UPENN.EDU!yluo From: yluo@POBOX.UPENN.EDU (yuling luo) Newsgroups: bionet.molbio.methds-reagnts Subject: a problem in protein purification Date: 3 Nov 1994 08:05:45 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 19 Sender: daemon@net.bio.net Distribution: world Message-ID: <9411031605.AA25047@pobox.upenn.edu> NNTP-Posting-Host: net.bio.net Hi there, I am trying to purify a myc-tagged recombinant protein (pI=7.6, 100 kd) from the supernatant of baculovirus-infected insect cells. I first enriched the protein on a cation exchange column, which worked out fine. I then loaded the eluate into an anti-myc monoclonal affinity column and eluted the column with 0.1 M glycine pH 2.5. I found that most of the myc-tagged protein bound to the affinity column. But the eluted protein is in precipitated form. It become obvious when I netralize the elute to netral pH with Tris buffer. Then I would just see a big white precipitate forming. I also tried high pH elution buffer. The eluted protein is still precipitated. My questions are 1) could this be the problem of the affinity column itself? (if it is, I could try different ways to purify it) 2) Could this be the protein's problem? (ie, the protein will aggregate in the absence of other proteins, if this is the case, I am hopeless. 3) anyone out there has similar experience? Your advice is much appreciated. yl From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!agate!howland.reston.ans.net!spool.mu.edu!caen!msuinfo!NewsWatcher!user From: 22313tcn@ibm.cl.msu.edu (Thomas Newman) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Lambda DNA resists digestion Followup-To: bionet.molbio.methds-reagnts Date: Thu, 03 Nov 1994 10:56:35 -0500 Organization: MSU-DOE Plant Research Lab Lines: 21 Message-ID: <22313tcn-031194105635@35.8.197.53> References: <396aas$ki1@news.service.uci.edu> NNTP-Posting-Host: 35.8.197.53 In article <396aas$ki1@news.service.uci.edu>, rmauk@crick.bio.uci.edu (Rob Mauk) wrote: > > I have isolated lambda gt10 DNA by PEG precipitation followed by organic > extraction and ethanol precipitation, and find that it is almost > completely resistant to digestion by EcoRI and all other enzymes that I > have tested. Proteinase K treatment did not help, nor did additional > extractions and precipitations. Plasmid DNA digests normally with these > enzymes, but if the plasmid is mixed with the lambda DNA, it is rendered > undigestable. Any comments or suggestions regarding the nature of this > contaminant, or solutions to the problem would be greatly appreciated. > Thank you. I have found in many cases that the addition of spermidine to a final concentration of 4 mM in the restriction buffer will allow the enzymes to work. It is an easy test!! Tom Newman Assistant Prof. MSU-DOE Plant Research Laboratory From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!agate!howland.reston.ans.net!gatech!news-feed-1.peachnet.edu!news.cc.emory.edu!jrubi02 From: jrubi02@unix.cc.emory.edu (Janet E. Rubin) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: help for oligo hybridization Date: 3 Nov 1994 15:14:40 GMT Organization: Emory University Lines: 6 Message-ID: <39aup0$2n6@emoryu1.cc.emory.edu> References: <38nigg$2u3@nntp.Stanford.EDU> NNTP-Posting-Host: larry-le0.cc.emory.edu X-Newsreader: TIN [version 1.2 PL2] Perhaps I missed the beginning of this thread, but do you wish to hybridize Northerns or Southerns with your oligos? We've had success with Northerns when the oligos are longer - 48mer or more. But with Southerns, even 20mers work great. We've p32 and dig labelled for Southerns with these short oligos. Is this what you're after? From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!agate!howland.reston.ans.net!news.sprintlink.net!EU.net!uknet!daresbury!not-for-mail From: dudy bar-zvi Newsgroups: bionet.molbio.methds-reagnts Subject: TECHNE thermal cyclers Date: 3 Nov 1994 13:47:01 -0000 Lines: 13 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <39apkm$8st@mserv1.dl.ac.uk> Original-To: methods@dl.ac.uk, rapd@dl.ac.uk Dear netters, We have got a nice offer from thermocyclers form Techne. I would like to get some information and experience with thermocyclers made by Techne. Are Techne cyclers users happy with it? Do they recommend to get it? Thanks, Dudy Bar-Zvi Ben-Gurion University Beer-Sheva, Israel From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!agate!howland.reston.ans.net!pipex!sunic!isgate!news.rhi.hi.is!php From: php@rhi.hi.is (Petur Henry Petersen) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Loading Long Ranger gels... Date: 3 Nov 1994 13:07:06 GMT Organization: University of Iceland Lines: 29 Distribution: world Message-ID: <39an9q$i6m@eldborg.rhi.hi.is> References: <395651$jag@eldborg.rhi.hi.is> NNTP-Posting-Host: hengill.rhi.hi.is In mic@nwu.edu (Mic Chaudoir) writes: >In article <395651$jag@eldborg.rhi.hi.is>, php@rhi.hi.is (Petur Henry >Petersen) wrote: >> I was wondering... When running Long Ranger Sequencing gel (6%) >> I usually wait until the gel is around 45 degr and run it at about 45-50 degr >> (Celcius of course :) ). In the Long Ranger leaflet they say one has only >> to prerun the gels for 10 min. After 10 min prerun my gels are about 35 degr. >> Should I load at 35 or wait as I usually do? I am trying to get sharper >> bands and one of the factors I am concerned about is the heat of the gels.. >> >> Could anyone tell me what they do? I should mention that I am running >> sequenced PCR products and they show litle secondary structure and that I >> use biotinlabeled primers to get ssDNA for sequencing... >> >> Petur Henry Petersen DeptmBiology U.Iceland >I always just run the gel 20 minutes before loading. Yeasterday (wrong spelling?) I did run 2 gels. One of those i preran for 20 min and loaded it at 35 degr. The other one i ran longer and loaded at 43 degr. When I develop those I will post the results (if any). In the meantime I will continue loaidng them at 44-45 degr. happy days! php U.Iceland From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!rutgers!gatech!howland.reston.ans.net!cs.utexas.edu!uunet!ftpbox!news3.acns.nwu.edu!mac129.hogan.nwu.edu!user From: doerther@nwu.edu (Dan Oerther) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: PCR primer design with RE sites Date: 3 Nov 1994 19:28:29 GMT Organization: Northwestern University Lines: 63 Message-ID: References: <399j5d$lgn@brolga.cc.uq.oz.au> NNTP-Posting-Host: mac129.hogan.nwu.edu In article <399j5d$lgn@brolga.cc.uq.oz.au>, btbirch@brolga.cc.uq.oz.au (nicola fidler) wrote: > Hi, thought some experienced netters might be able to help me with my PCR primerdesign problem. I am trying to introduce a unique restriction enzyme site using my PCR primer by either base mutations or with the introduction of a single > codon. I realise by using palindromic restriction enzymes there will always be some self homology. My problem is this: when I put my chosen primer designs through Primer Detective, I'm given two type of primer self homology > The first is where there is the end homology with long flanking regions (the primers will be about 30bp) > GCCGTCGGATGCGCCGGAATTCGCG > CTTAAGGCCGCGTAGGCTGCCG > The second is where there are intermittent alignments along the length of the primer > GGCGTCGGATGCGCCGGAATTCGCG > GCCCACCGAACGGATTCCTCGCAGG > Can someone please explain which is the better design if you have to live with self homolgy. I'm getting terribly confused and frustrated > Thanks, in anticipation, > Melisa Wall > University of Queensland > St Lucia, Australia Melisa- Tm for nucleic acid hybridization (and therefore for oligo hybridization) is based upon the longest continuous stretch of aligned nucleotides. For example, if you have a 13mer that has 5nt alignment, 3nt misalignment, and then 5nt alignment, the effective Tm is calculated from a 5nt stretch not a 10nt stretch! Of course, many people, including myself, have experienced primer dimer, and spurious PCR product production when it appeared that the chosen annealing temperature would be sufficiently high enough to overcome any small regions of alignment. So, to make a confusing problem simple, my recipe is: Design a primer with high GC content that has the smallest continuous stretches of homology with any other potentially spurious non-specific sites ( including self and cross-annealing). Calculate an approximate Tm based of 4dC for G/C and 2dC for A/T summed for the entire oligo. Try (Tm-10), (Tm-5), (Tm), (Tm+5), and (Tm-5) to determine the optimum temperature. Very important, if possible use a hot start (i.e preheat everything except Polymerase to 100dC for 5 min, then add Polymerase at 94dC) or heat denature all of the reactions minus Polymerase for 5 min 100dC then immediately put on ice for 10 min. Then add Polymerase while the reactions are on ice and place the reactions into a 94dC preheated Thermal Cycler Block (the machine) Hope this helps to answer your question. Best, Dan -- Dan Oerther Departments of Civil Engineering and Biochemsitry Northwestern University Evanston, Illinois doerther@nwu.edu From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Newsgroups: bionet.molbio.methds-reagnts Path: biosci!ns1.faseb.org!darwin.sura.net!news.Vanderbilt.Edu!NewsWatcher!user From: sticknbd@miranda.cc.vanderbilt.edu (B Stickney) Subject: Re: Stability of Heparin Message-ID: Followup-To: bionet.molbio.methds-reagnts Sender: news@news.vanderbilt.edu Nntp-Posting-Host: 160.129.125.10 Organization: Department of Pathology References: <393iuv$fhk@owl.csrv.uidaho.edu> Date: Thu, 3 Nov 1994 19:55:56 GMT Lines: 22 In article <393iuv$fhk@owl.csrv.uidaho.edu>, raman913@uidaho.edu (Ramanujam Raman) wrote: > Dear Netters, > I have been using Heparin as non-specific competitor in my gel-retardation > assays at the concentration of 10 ug per 15 ul reaction. I had made up > a 20 ug/ul stock about 6 months ago and had it stored at 4^C. I have had > very good specifc shifts so far. Unfortunately, it isn't working now. In > the process of trouble shooting the problem, I was wondering about the > stability of heparin at 4^C. Is this storage temperature ideal for heparin > in solution? Or does it need to be at freezer temperatures? Also, if anyone > out there has been using it for gel-retardation assays, is there preference > for any particular salt of the compound? I have been using the sodium salt > of heparin. Ramanujam Raman: We aliquot our heparin and freeze it. Although we use it in cell culture experiments, not in gel retardation, my lab would not consider using it if it were not a fresh vial. This may or may not make a difference in your case, and I'm not even sure it's critical for us; it's just how we've always done it. B Stickney From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!rutgers!gatech!europa.eng.gtefsd.com!news.umbc.edu!haven.umd.edu!purdue!mozo.cc.purdue.edu!inet.d48.lilly.com!mcvax4.d48.lilly.com!books Newsgroups: bionet.molbio.methds-reagnts Subject: How to Calculate Oligo MW? Message-ID: <1994Nov3.140526.1@mcvax4.d48.lilly.com> From: books@mcvax4.d48.lilly.com Date: 3 Nov 94 14:05:26 EST Distribution: world Nntp-Posting-Host: mcvax4.d48.lilly.com Lines: 4 We are looking for a formula to calculate the exact MW for oligonucleotides. The oligo will have a 5'-hydroxy group. We can estimate oligonucleotide MW if we use 330 as the average MW for each base but we need a exact number. Thanks DPSMITH smith_dennis_p@lilly.com From owner-methds-reagnts@net.bio.net Wed Nov 02 22:00:00 1994 Path: biosci!ANU.EDU.AU!Klaus.Matthaei From: Klaus.Matthaei@ANU.EDU.AU