From owner-methds-reagnts@net.bio.net Wed Jul 01 23:00:00 1998 Path: biosci!news.Stanford.EDU!newsfeed.concentric.net!su-news-hub1.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!news-peer.gip.net!news-raspail.gip.net!news.gsl.net!gip.net!rain.fr!wanadoo.fr!not-for-mail From: "GPDF" Newsgroups: bionet.molbio.methds-reagnts Subject: blood cell conservation Date: Thu, 2 Jul 1998 17:15:13 +0200 Organization: Wanadoo - (Client of French Internet Provider) Lines: 7 Message-ID: <6ngv8u$89k$1@platane.wanadoo.fr> NNTP-Posting-Host: papitre1-146.abo.wanadoo.fr X-Newsreader: Microsoft Outlook Express 4.72.2106.4 X-MimeOLE: Produced By Microsoft MimeOLE V4.72.2106.4 I am looking for datas about the reagents to use for blood cell conservation. I have eard about the SAG-Mannitol but i can't find anything about the final concentration i have to respect. Can you help me please? From owner-methds-reagnts@net.bio.net Wed Jul 01 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!news-peer.gip.net!news.gsl.net!gip.net!portc01.blue.aol.com!newsstand.cit.cornell.edu!fastpath3a.tn.cornell.edu!user From: ajs40@cornell.edu (Aaron Schetter) Newsgroups: bionet.molbio.methds-reagnts Subject: Methylation insensitive restriction enzymes Date: Thu, 02 Jul 1998 17:05:55 -0500 Organization: Cornell University Lines: 7 Sender: ajs40@cornell.edu (Verified) Message-ID: NNTP-Posting-Host: fastpath3a.tn.cornell.edu Does anyone have any information on what restriction enzymes can be used to cut the unmethylated strand of hemimethylated DNA? Thanks Aaron ajs40@cornell.edu From owner-methds-reagnts@net.bio.net Wed Jul 01 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!news.maxwell.syr.edu!nntp.news.xara.net!xara.net!server5.netnews.ja.net!daresbury!not-for-mail From: Alastair Hamilton Newsgroups: bionet.molbio.methds-reagnts Subject: recipe for tris-maleate Date: 2 Jul 1998 21:10:31 +0100 Lines: 18 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <6ngpfn$7bd@mserv1.dl.ac.uk> MIME-Version: 1.0 Original-To: methods@dl.ac.uk Dear Netters Could some kind soul help me out with the recipe for tris-maleate buffer, it doesn't seem to be in any of the usual manuals. Thanks in advance, Alastair Alastair Hamilton Institute of Aquaculture University of Stirling Scotland FK9 4LA From owner-methds-reagnts@net.bio.net Wed Jul 01 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!europa.clark.net!164.67.42.145!awabi.library.ucla.edu!137.82.194.1!unixg.ubc.ca!not-for-mail From: Luke Bu Newsgroups: bionet.molbio.methds-reagnts Subject: Transfer Apparatus Date: Wed, 01 Jul 1998 23:58:15 -0700 Organization: University of British Columbia Lines: 8 Message-ID: <359B2F86.6949D90C@ecc.ubc.ca> NNTP-Posting-Host: slide.ecc.ubc.ca Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 4.0 [en] (Win95; I) X-Priority: 3 (Normal) We want to buy a transfer apparatus for Western blot. Anybody out there has any suggestions ? Besides the Bio-Rad products, any others provide similar things ? How are the trasfer efficiency and cost ? Thanks in advance for any reply. Luke From owner-methds-reagnts@net.bio.net Wed Jul 01 23:00:00 1998 Message-ID: <359B5D2E.161B7062@chclu.chemie.uni-konstanz.de> Date: Thu, 02 Jul 1998 12:12:59 +0200 From: "Frank O. Fackelmayer" Reply-To: fof1@chclu.chemie.uni-konstanz.de X-Mailer: Mozilla 4.04 (Macintosh; I; PPC) MIME-Version: 1.0 Newsgroups: bionet.molbio.methds-reagnts Subject: Re: southern blotting References: <359AB303.1A66@yorku.ca> Content-Type: text/plain; charset=iso-8859-1 Content-Transfer-Encoding: 8bit NNTP-Posting-Host: 134.34.126.40 X-Trace: 2 Jul 1998 12:12:03 +0100, 134.34.126.40 Organization: University of Constance, Germany Lines: 45 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!howland.erols.net!frankfurt.de.uu.net!news.uni-stuttgart.de!news.belwue.de!news.uni-konstanz.de!134.34.126.40 Moens' lab wrote: > > I've tried to do mammalian genomic southerns before but all I get > is a smear signal whose intensity correlates with the ethidium bromide > intensity in an agarose gel. Therefore, it is not due to repeat > sequences or anything of the sort. Sounds to me like an alu sequence (you´re working on human DNA, I assume), or any other highly repetitive sequence, is in your probe that gives you the strong smear. The fact that the smear correlates with the EtBr staining is actually the best argument FOR, not AGAINST repetitive elements in your probe. I´d recommend you characterize your probe by restriction digestion, blot the digested DNA to a nylon membrane, and hybridize with labelled (unfractionated) genomic DNA. Hybridizing with total genomic DNA will give a signal only if there is a repetitive element on the corresponding band. There are two possible results: Either all bands give a signal, or only a subset of bands give a signal. If all bands give a signal it is likely that your probe is very GC-rich, and you´ll have to compensate for that by higher temperature: Increase your hybridization temperature to 70C and try again. If you find only a subset of bands giving a signal, your conditions are ok, but some of the bands contain a highly repetitive element. The bands that give NO signal are then single-copy and well suited as hybridization probes. Isolate one such negative band, label, and use as a probe. Hope this helps, Frank I had PAC DNA on the same southerns > and these worked fine. Also, the lambda marker was clean. I followed > the protocol in Maniatis et al, 1989 "Molecular Cloning" to the letter > (for what I can tell) but I keep getting these smears. I've digested > with BamHI to apparent completion, also. What am I doing wrong? The > amount loaded was about 20 ug and I left hybridizing O/N. I used > Denhardt's solution without formamide. Does anyone have any idea how I > can solve this? > > Thank you, > Rob Botelho > > yu106715@yorku.ca > or > moens@yorku.ca From owner-methds-reagnts@net.bio.net Wed Jul 01 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!news-peer.gip.net!news.gsl.net!gip.net!dca1-hub1.news.digex.net!digex!newscore.univie.ac.at!newsfeed03.univie.ac.at!03-newsfeed.univie.ac.at!news.univie.ac.at!not-for-mail From: a8803349.nospam@unet.univie.ac.at (Martin Offterdinger) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Q: Autoclave Triton X-100 and NP-40 buffers? Date: Wed, 01 Jul 1998 12:04:23 GMT Organization: AKH Lines: 26 Message-ID: <359a255c.15378670@news.univie.ac.at> References: <6msnci$1uu@tali.UCHSC.edu> NNTP-Posting-Host: grunt.imed1.akh-wien.ac.at X-Newsreader: Forte Free Agent 1.1/16.230 On 25 Jun 1998 05:32:02 GMT, Guy.Oshiro@UCHSC.edu (Guy Oshiro) wrote: >Hi, > >A quick question: is there any harm in autoclaving Triton X-100 (1%) or >NP-40 (0.5%) buffers. Can the detergents break down during the >autoclaving procedure? > >TIA, > >Guy Oshiro >EMAIL: Guy.Oshiro@UCHSC.edu > > /\ /\ /\ > / \/ \/\/ \ Science in the Rockies. >/ \ \/ \ Do not do this! Triton and NP-40 are not stable under these conditions and will decompose; use nuclease free dtergents and filter sterilise if you like! Martin Martin Offterdinger Internal Med.I,Dept. Oncology University of Vienna Austria E-Mail:a8803349.nospam@unet.univie.ac.at (remove nospam before mailing) From owner-methds-reagnts@net.bio.net Wed Jul 01 23:00:00 1998 Path: biosci!news.Stanford.EDU!newsfeed.concentric.net!su-news-hub1.bbnplanet.com!news.bbnplanet.com!news1.best.com!newsxfer3.itd.umich.edu!newsxfer.itd.umich.edu!news.join.ad.jp!wnoc-tyo-news!news.nc.u-tokyo.ac.jp!news.t.u-tokyo.ac.jp!news From: Yasushi Okada Newsgroups: bionet.molbio.methds-reagnts Subject: Pierce B-PER kit Date: 2 Jul 1998 06:26:46 GMT Organization: Dept. Anatomy & Cell Biol. Facul. Med. Univ. Tokyo. Lines: 2 Sender: yokada@tubulin.cb.m.u-tokyo.ac.jp Message-ID: NNTP-Posting-Host: tubulin.cb.m.u-tokyo.ac.jp Mime-Version: 1.0 (generated by SEMI MIME-Edit 0.100 - "Otomaru") Content-Type: text/plain; charset=US-ASCII X-Emacs: Emacs 20.2, MULE 3.0 (MOMIJINOGA) X-Newsreader: Semi-gnus 6.0.5 (based on Quassia Gnus v0.29) What is the trick of the new kit B-PER (Pierce) for the extraction of the recombinant protein from E.coli? From owner-methds-reagnts@net.bio.net Wed Jul 01 23:00:00 1998 Path: biosci!student.eur.nl!144436lt From: 144436lt@student.eur.nl (144436lt) Newsgroups: bionet.molbio.methds-reagnts Subject: RNA isolation from liposarcomas Date: 2 Jul 1998 01:24:01 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 2 Sender: daemon@net.bio.net Distribution: world Message-ID: <359B4308.FDB3BFEC@student.eur.nl> NNTP-Posting-Host: net.bio.net Does any body knows how to isolate RNA from liposarmas? Or fat tissue? From owner-methds-reagnts@net.bio.net Wed Jul 01 23:00:00 1998 Date: Thu, 02 Jul 1998 09:44:07 +0100 From: roney.graf@uni-konstanz.de (Roney Graf) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: ethidium bromide: add to gel before pouring or stain afterwards Message-ID: References: <6n4csb$ssf$1@nnrp1.dejanews.com> <35996EFD.5A8D4DEB@emory.edu> Mime-Version: 1.0 Content-Type: text/plain; charset=ISO-8859-1 Content-transfer-encoding: 8bit X-Newsreader: Yet Another NewsWatcher 2.4.0 NNTP-Posting-Host: 134.34.126.34 X-Trace: 2 Jul 1998 09:41:01 +0100, 134.34.126.34 Organization: University of Constance, Germany Lines: 17 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!europa.clark.net!205.252.116.205!howland.erols.net!frankfurt.de.uu.net!news.uni-stuttgart.de!news.belwue.de!news.uni-konstanz.de!roney.graf In article <35996EFD.5A8D4DEB@emory.edu>, "Rick A. Bright" wrote: > We have much success in our lab by nuking the gel to melt, then cool > until bottle is touchable, add the EtBr and pour the gel. Great bands, > no mess, no staining time, no problems. Yup, that's the way I liked to do it ( but we don't do it this way in this lab :/ ). There's only one thing to consider: if you have very crude samples (like minipreps with tons of RNA running ahead of the DNA) or preparative gels with very fat bands, it can happen that a fast-moving fat band 'eats away' most of the EtBr in the lane, and bands following after will show a weird migration behavior. The workarounds are obvious, of course. rg From owner-methds-reagnts@net.bio.net Wed Jul 01 23:00:00 1998 Path: biosci!NMSU.EDU!hroychow From: hroychow@NMSU.EDU (Hiranya Roychowdhury) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: How to seq. a single-primer PCR product Date: 2 Jul 1998 13:13:16 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 41 Sender: daemon@net.bio.net Distribution: world Message-ID: <199807022010.OAA86920@nestor.NMSU.Edu> NNTP-Posting-Host: net.bio.net At 03:57 PM 7/2/98 GMT, Brian Sydnor Burnes wrote: >Hello fellow labrats! I have PCR products generated from inverse PCR >primed off the inverted repeats of a Tn5 insertion. Only one primer was >used, so the ends of the products are inverted repeats like the >transposon. How can I directly sequence these products without getting >overlapping forward and reverse reads? Sequence an asymetric digest? If you have an idea of the RE map of your amplicon(s), this is a good way to go. Reactions for automated sequencers can employ differentially labelled primers where the reactions carried out in the same tube would be readable from both ends. In such cases, RE digests are not necessary, and, for a reasonably sized template, you may actually read overlaping sequence through the middle of the template - thereby confirming that portion of the sequence. For a very large number of amplicons, direct sequencing with the same primers would be desirable, otherwise, >Ligate (blunt) into a sequencing vector? this may be the better way since you'll have a larger supply of template for future. T/A cloning, using a vector like pGEMT, works more efficiently than blunt-end cloning. I appreciate any input; thanks. > > >-- >Brian Sydnor Burnes >Georgia Institute of Technology, Atlanta Georgia, 30332 >uucp: ...!{decvax,hplabs,ncar,purdue,rutgers}!gatech!prism!gt2837a >Internet: gt2837a@prism.gatech.edu > > Dr. Hiranya Sankar Roychowdhury Plant Genetic Engineering Lab. New Mexico State University Las Cruces, NM 88003 Ph. (505) 646-5785 hroychow@nmsu.edu From owner-methds-reagnts@net.bio.net Wed Jul 01 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!news-feed.inet.tele.dk!bofh.vszbr.cz!online.no!not-for-mail From: "Bjorn P." Newsgroups: bionet.molbio.methds-reagnts Subject: Immunology Newsletter 2/98 Date: Thu, 2 Jul 1998 21:18:39 +0200 Organization: Telenor Online Public Access Lines: 27 Message-ID: <6ngm9b$hhu$1@o.online.no> NNTP-Posting-Host: ti01a24-0110.dialup.online.no X-Newsreader: Microsoft Outlook Express 4.71.1712.3 X-MimeOLE: Produced By Microsoft MimeOLE V4.71.1712.3 Immunology Newsletter 2/98. Diatec AS has during the last months distributed a large number of samplepacks to cytometry laboratories worldwide as part of our product quality survey. The feedback has been above expectations, especially our anti-human kappa, lambda, CD3, CD4, CD8 and CD37 have been rated better than the current market leaders. http://www.diatec.com/goods.htm We challenge you to try our monoclonal antibodies, and throughout July we will offer you a 50% discount on our regular prices when you purchase 3 or more vials. http://www.diatec.com/offer.htm You will always find interesting immunology-links on our NEWS page, which is updated daily http://www.diatec.com Sincerely Yours Knut J. Egelie Diatec AS PS. If you do not want to receive the Immunology Newsletter in the future, please return this mail with: No Mail in the Subject Field. From owner-methds-reagnts@net.bio.net Wed Jul 01 23:00:00 1998 Path: biosci!cdc.gov!jby6 From: jby6@cdc.gov (Jonny Yokosawa) Newsgroups: bionet.molbio.methds-reagnts Subject: Hansenula polymorpha problem Date: 2 Jul 1998 11:12:03 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 13 Sender: daemon@net.bio.net Distribution: world Message-ID: <359BCCCC.568D@cdc.gov> NNTP-Posting-Host: net.bio.net Dear netters, I received a strain of Pichia angusta (formerly Hansenula polymorpha)from ATCC and want to use it to express heterologous protein. The catalog says that genotype is leu1 and ura3, but the strain grows well in YNB-URA, YNB-LEU or even YNB without any aminoacids. I wonder if anybody knows what is happening and how I can solve this problem. Thank you. Jonny Yokosawa jby6@cdc.gov Centers for Disease Control and Prevention Atlanta, GA - USA From owner-methds-reagnts@net.bio.net Wed Jul 01 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!Supernews60!supernews.com!Supernews69!not-for-mail From: dalmiabk@phibred.com (bipin k. dalmia) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Pierce B-PER kit Date: Thu, 02 Jul 1998 17:42:09 GMT Organization: The World's Usenet -- http://www.Supernews.com Lines: 22 Message-ID: <359bc5fa.79744146@207.126.101.81> References: NNTP-Posting-Host: 204.233.143.2 X-Trace: 899401044 ZOKXWGLXK8F02CCE9C usenet57.supernews.com X-Complaints-To: newsabuse@supernews.com X-Newsreader: Forte Free Agent 1.1/32.230 we tried the B-PER reagent and to put it mildly, it fell well short of their claims (of extracting greater than 90% of soluble proteins in one round). we compared it against our current method that uses lysozyme and sonication treatments. bip On 2 Jul 1998 06:26:46 GMT, Yasushi Okada wrote: >What is the trick of the new kit B-PER (Pierce) for the extraction of >the recombinant protein from E.coli? Bipin K. Dalmia, Ph.D. Research Manager Protein Core Facility Pioneer Hi-Bred International, Inc. Johnston, Iowa 50131 mailto:dalmiabk@phibred.com From owner-methds-reagnts@net.bio.net Wed Jul 01 23:00:00 1998 Path: biosci!news.Stanford.EDU!newsfeed.concentric.net!netnews.com!feed2.news.erols.com!erols!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!wuff.mayn.de!informatik.tu-muenchen.de!lrz-muenchen.de!eos.gi.biologie.uni-muenchen.de!user From: J.Kaemper@lrz.uni-muenchen.de (Joerg Kaemper) Newsgroups: bionet.molbio.methds-reagnts Subject: Problems with Glyoxal/DMSO Northern Date: Thu, 02 Jul 1998 18:51:26 +0200 Organization: Institute of Genetics, Munich Lines: 18 Distribution: world Message-ID: NNTP-Posting-Host: eos.gi.biologie.uni-muenchen.de X-Newsreader: MT-NewsWatcher 2.2.2 For Northern analysis we are often using the Glyoxal/DMSO protocol to run RNA-gels, followed up by blotting to positively charged Nylon membranes using 20x SSC. Usually this protocol works fine, but in every 5th to 6th blot only the bottom half of the RNA is transferred to the membrane; the top half stays in the gel. We have never obtained this problem with Formaldehyde gels. Of course we could switch back to Formaldehyde gels, but the people in the lab favour, despite the set-backs, the DMSO/Glyoxal method, because it gives sharper bands and is less toxic. We have the wildest hypotheses why only the bottom-RNA is transferred to the membrane, but none is really satisfying. Has anybody observed something similar, or has somebody an explanation (or wild hypothesis, we do collect those) for the effect??? Thanks for replying, Joerg -- Joerg Kaemper Institute of Genetics University of Munich From owner-methds-reagnts@net.bio.net Wed Jul 01 23:00:00 1998 Message-ID: <359BB53D.1CF6@4dnet.com> Date: Thu, 02 Jul 1998 09:28:45 -0700 From: "D. Shane Beck" Reply-To: sb-labconsumer@4dnet.com Organization: The Scientist X-Mailer: Mozilla 3.0C-4DCOMM (Win95; I) MIME-Version: 1.0 Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Coenzyme Q References: Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit NNTP-Posting-Host: 209.189.20.85 X-Trace: 2 Jul 1998 09:19:01 +0700, 209.189.20.85 Lines: 22 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!news-peer.gip.net!news.gsl.net!gip.net!newsfeed.internetmci.com!206.229.87.25!news-peer.sprintlink.net!news-backup-west.sprintlink.net!news.sprintlink.net!207.67.253.7!atmnet.net!newsboy.4d.net!209.189.20.85 Lestrate Pascal wrote: > > Hello > > do somebody know a firm that commercializes CoEnzyme Q? > Thanks you > Lestrate, At least two companies... Try Sigma Aldrich NV/SA (Belgium) Phone: 0800-14747 Web: www.sigma.sial.com ICN Biomedicals NV/SA (Belgium) Phone: 02-466-0000 Web: www.icnpharm.com Shane From owner-methds-reagnts@net.bio.net Wed Jul 01 23:00:00 1998 Path: biosci!agate!howland.erols.net!europa.clark.net!164.67.42.145!awabi.library.ucla.edu!134.139.1.31!csulb.edu!gatech!130.207.171.33.MISMATCH!prism!acmey!gt2837a From: gt2837a@acmey.gatech.edu (Brian Sydnor Burnes) Newsgroups: bionet.molbio.methds-reagnts Subject: How to seq. a single-primer PCR product Date: 2 Jul 1998 15:57:43 GMT Organization: Georgia Institute of Technology Lines: 13 Message-ID: <6ngaln$sda@catapult.gatech.edu> NNTP-Posting-Host: gt2837a@acmey-prism.gatech.edu X-Newsreader: TIN [version 1.2 PL2] Hello fellow labrats! I have PCR products generated from inverse PCR primed off the inverted repeats of a Tn5 insertion. Only one primer was used, so the ends of the products are inverted repeats like the transposon. How can I directly sequence these products without getting overlapping forward and reverse reads? Sequence an asymetric digest? Ligate (blunt) into a sequencing vector? I appreciate any input; thanks. -- Brian Sydnor Burnes Georgia Institute of Technology, Atlanta Georgia, 30332 uucp: ...!{decvax,hplabs,ncar,purdue,rutgers}!gatech!prism!gt2837a Internet: gt2837a@prism.gatech.edu From owner-methds-reagnts@net.bio.net Wed Jul 01 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!woodstock.news.demon.net!demon!news.demon.co.uk!demon!genesys.demon.co.uk!demon.co.uk!duncan From: "Dr. Duncan Clark" Newsgroups: bionet.molbio.methds-reagnts Subject: Re: mutation detection protocol for oligos Date: Thu, 2 Jul 1998 10:05:25 +0100 Message-ID: References: <6negie$1v7$1@its.hooked.net> Reply-To: "Dr. Duncan Clark" NNTP-Posting-Host: genesys.demon.co.uk X-NNTP-Posting-Host: genesys.demon.co.uk:158.152.17.110 X-Trace: news.demon.co.uk 899391558 nnrp-11:16137 NO-IDENT genesys.demon.co.uk:158.152.17.110 X-Complaints-To: abuse@demon.net MIME-Version: 1.0 X-Newsreader: Turnpike (32) Version 4.00 beta 7 Lines: 17 In article <6negie$1v7$1@its.hooked.net>, Todd Martinsky writes >ArrayItTM However interesting or useful this maybe (or not) it is advertising, which is strictly forbidden on the bionet newsgroups. Duncan -- The problem with being on the cutting edge is that you occasionally get sliced from time to time.... Duncan Clark DNAmp Ltd. TEl/FAX 01252376288 http://www.dnamp.com http://www.genesys.demon.co.uk From owner-methds-reagnts@net.bio.net Wed Jul 01 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!europa.clark.net!194.162.162.196!newsfeed.nacamar.de!rill.news.pipex.net!pipex!sun4nl!uva.nl!nol.amc.uva.nl!not-for-mail From: "Rene Raggers" Newsgroups: bionet.molbio.methds-reagnts Subject: UDP-glucose measurement and depletion Date: Thu, 2 Jul 1998 16:01:56 +0200 Organization: Academisch Medisch Centrum Lines: 12 Message-ID: <6ng466$7e02@nol.amc.uva.nl> NNTP-Posting-Host: amcip0441.amc.uva.nl X-Newsreader: Microsoft Outlook Express 4.71.1712.3 X-MimeOLE: Produced By Microsoft MimeOLE V4.71.1712.3 Dear people, I am looking for a method to measure UDP-glucose form cells. Besides of that I would appreciate a method to change the levels of UDP-glucose in living cells. Are there possibilities to introduce exogenous UDP-glucose to cells !! Any help will be appreciated, Rene Raggers From owner-methds-reagnts@net.bio.net Wed Jul 01 23:00:00 1998 Path: biosci!news.Stanford.EDU!newsfeed.concentric.net!news-peer-west.sprintlink.net!news-peer.sprintlink.net!news-backup-east.sprintlink.net!news.sprintlink.net!208.134.241.18!newsfeed.internetmci.com!152.163.199.19!portc03.blue.aol.com!audrey01.news.aol.com!not-for-mail From: iladol@aol.com (Iladol) Newsgroups: bionet.molbio.methds-reagnts Subject: Looking for genotyping services Lines: 7 Message-ID: <1998070214124000.KAA20968@ladder01.news.aol.com> NNTP-Posting-Host: ladder01.news.aol.com X-Admin: news@aol.com Date: 2 Jul 1998 14:12:40 GMT Organization: AOL http://www.aol.com Hi, I am looking for companies that do genotyping on alarge scale, 200-500 samples at atime. I am looking for people who can do NAT2, GST, p-53, CYP1A1, MPO, ADH assays on a regular basis. Please e-mail!! Lala From owner-methds-reagnts@net.bio.net Wed Jul 01 23:00:00 1998 Path: biosci!agate!nntp-out.monmouth.com!newspeer.monmouth.com!naxos!news.belnet.be!news.fundp.ac.be!Pascal.Lestrate From: Pascal.Lestrate@fundp.ac.be (Lestrate Pascal) Newsgroups: bionet.molbio.methds-reagnts Subject: Coenzyme Q Date: Thu, 02 Jul 1998 15:42:49 +0000 Organization: FUNDP, URBM Lines: 18 Message-ID: NNTP-Posting-Host: immuno-polux.sciences.fundp.ac.be Mime-Version: 1.0 Content-Type: text/plain; charset=ISO-8859-1 Content-Transfer-Encoding: 8bit X-Newsreader: Yet Another NewsWatcher F2.4.0 Hello do somebody know a firm that commercializes CoEnzyme Q? Thanks you Rose-May Rose-may -- Rose-May Delrue Laboratory of Immunology and Microbiology URBM Facultés Universitaires Notre-Dame de la Paix 61 Rue de Bruxelles 5000 Namur Belgium Phone: (32) 81 724409 Fax: (32) 81 724420 From owner-methds-reagnts@net.bio.net Wed Jul 01 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!news-peer.gip.net!news.gsl.net!gip.net!news-peer.sprintlink.net!news-backup-east.sprintlink.net!news.sprintlink.net!138.5.100.92!servers!NewsWatcher!user From: eanderson@suny.hscbklyn.edu (Eric Anderson) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Which pipetter? (second inquiry) Date: 2 Jul 1998 13:11:47 GMT Organization: SUNY-HSC@Brooklyn Lines: 18 Distribution: world Message-ID: References: NNTP-Posting-Host: 138.5.70.87 In article , rosatoc@AVA.BCC.ORST.EDU (Caprice Rosato) wrote: > I'm planning to buy a pipetter for small volumes (0.5-2.0ul) for a daily > use of >= 400 strokes/day. The two that I am currently considering > are the Eppendorf Model 4850 and the Rainin EDP2. Any comments from > users on the benefits/detriments to these instruments or other choices > on the market would be greatly appreciated. Thanking you in advance. I used the Rainin EDP2 for a couple of years and never had any problems with it in terms of going out of adjusment. I've used both models of the Eppendorf 10 ul pipettor (but not the 2ul) and liked both of them although I feel that the Rainin's are a little more ergonomic and comfortable and in my experience hold their adjustments better. Hope this helps Eric From owner-methds-reagnts@net.bio.net Wed Jul 01 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!dallas-news-feed2.bbnplanet.com!news.bbnplanet.com!worldfeed.gte.net!news.maxwell.syr.edu!nntp2.dejanews.com!nnrp1.dejanews.com!not-for-mail From: c_burns@my-dejanews.com Newsgroups: bionet.molbio.methds-reagnts Subject: coli cell paste source? Date: Thu, 02 Jul 1998 10:26:20 GMT Organization: Deja News - The Leader in Internet Discussion Lines: 12 Message-ID: <6nfn8b$5fh$1@nnrp1.dejanews.com> NNTP-Posting-Host: 143.65.26.26 X-Article-Creation-Date: Thu Jul 02 08:57:12 1998 GMT X-Http-User-Agent: Mozilla/3.0 (compatible; MSIE 4.0p1; Mac_PowerPC) I am looking to buy coli cell paste and cannot find any suppliers. Grain Processing Corp (Muscatine, Iowa) used to sell this, but doesn't anymore. Does anyone know of a supplier? Thanks Chris C.Burns@icrf.icnet.uk -----== Posted via Deja News, The Leader in Internet Discussion ==----- http://www.dejanews.com/rg_mkgrp.xp Create Your Own Free Member Forum From owner-methds-reagnts@net.bio.net Wed Jul 01 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!dallas-news-feed2.bbnplanet.com!news.bbnplanet.com!worldfeed.gte.net!news.maxwell.syr.edu!nntp2.dejanews.com!nnrp1.dejanews.com!not-for-mail From: c_burns@my-dejanews.com Newsgroups: bionet.molbio.methds-reagnts Subject: coli cell paste Date: Thu, 02 Jul 1998 10:26:19 GMT Organization: Deja News - The Leader in Internet Discussion Lines: 12 Message-ID: <6nfn8a$5fg$1@nnrp1.dejanews.com> NNTP-Posting-Host: 143.65.26.26 X-Article-Creation-Date: Thu Jul 02 10:17:51 1998 GMT X-Http-User-Agent: Mozilla/3.0 (compatible; MSIE 4.0p1; Mac_PowerPC) I am looking to buy some E. coli cell paste. Grain processing corp of Muscatine Iowa used to sell this, but doesn't anymore. Does anyone know of a supplier? Thanks Chris C.Burns@icrf.icnet.uk -----== Posted via Deja News, The Leader in Internet Discussion ==----- http://www.dejanews.com/rg_mkgrp.xp Create Your Own Free Member Forum From owner-methds-reagnts@net.bio.net Wed Jul 01 23:00:00 1998 Path: biosci!chugaibio.com!dspinella From: dspinella@chugaibio.com (Dom Spinella) Newsgroups: bionet.molbio.methds-reagnts Subject: Filling in without chewing back Date: 2 Jul 1998 17:14:11 -0700 Organization: Chugai Biopharmaceuticals, Incorporated Lines: 25 Sender: daemon@net.bio.net Distribution: world Message-ID: <359C23C4.67AD@chugaibio.com> Reply-To: dspinella@chugaibio.com, @chugaibio.com NNTP-Posting-Host: net.bio.net Hi All. I have been forced to develop an esoteric cloning strategy which, at one step, requires that a a small DNA fragment with a 3' and 5' overhang be treated such that the 5' overhang is filled in, but the 3' overhang is left unaffected. That is, I need to convert this: 5'-NNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNN-5' into this: 5'-NNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNN-5' (I sure hope this gets posted like I drew it) Anybody have any ideas on how best to accomplish this? It seems to me that I need a polymerase with no 3'->5' exo activity, but reasonable polymerase activity. Is there such an enzyme? Modified T7 polymerase (Sequenase) is the closest thing I can think of, but I don't think its 3'->5' exo activity is completely absent -- just markedly reduced. BTW, just to make things more difficult, the fragment is rather small and will melt apart at high temperature which would probably rule out thermostable polymerases. Any thoughts on the subject will be appreciated. Thanks. -Dom Spinella From owner-methds-reagnts@net.bio.net Wed Jul 01 23:00:00 1998 Message-ID: <359C7EEA.5AE701FD@chclu.chemie.uni-konstanz.de> Date: Fri, 03 Jul 1998 08:49:14 +0200 From: "Frank O. Fackelmayer" Reply-To: fof1@chclu.chemie.uni-konstanz.de X-Mailer: Mozilla 4.04 (Macintosh; I; PPC) MIME-Version: 1.0 Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Filling in without chewing back References: <359C23C4.67AD@chugaibio.com> Content-Type: text/plain; charset=iso-8859-1 Content-Transfer-Encoding: 8bit NNTP-Posting-Host: 134.34.126.40 X-Trace: 3 Jul 1998 08:48:13 +0100, 134.34.126.40 Organization: University of Constance, Germany Lines: 41 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!howland.erols.net!frankfurt.de.uu.net!news.uni-stuttgart.de!news.belwue.de!news.uni-konstanz.de!134.34.126.40 Hi Dom, If the fragment is small enough that it will "melt apart at high temperature which would probably rule out thermostable polymerases", as you write, I would not use an enzymatic approach. Rather, it will be easier to let synthesize two complementary oligos that anneal to the ds sequence you want (I assume you know the sequence you want to clone). If not, e.g. when cloning anonymous fragments for later characterization, you could block the 3´ overhang by ligation to a ds linker with a complementary overhang (and a convenient restriction site), then fill in the other end, and clone into a vector for sequencing. Hope this helps, Frank Dom Spinella wrote: > > Hi All. I have been forced to develop an esoteric cloning strategy > which, at one step, requires that a a small DNA fragment with a 3' and > 5' overhang be treated such that the 5' overhang is filled in, but the > 3' overhang is left unaffected. That is, I need to convert this: > > 5'-NNNNNNNNNNNNNNNNNNNNNN > NNNNNNNNNNNN-5' > > into this: > > 5'-NNNNNNNNNNNNNNNNNNNNN > NNNNNNNNNNNNNNNN-5' > > (I sure hope this gets posted like I drew it) > > Anybody have any ideas on how best to accomplish this? It seems to me > that I need a polymerase with no 3'->5' exo activity, but reasonable > polymerase activity. Is there such an enzyme? Modified T7 polymerase > (Sequenase) is the closest thing I can think of, but I don't think its > 3'->5' exo activity is completely absent -- just markedly reduced. BTW, > just to make things more difficult, the fragment is rather small and > will melt apart at high temperature which would probably rule out > thermostable polymerases. Any thoughts on the subject will be > appreciated. Thanks. > -Dom Spinella From owner-methds-reagnts@net.bio.net Wed Jul 01 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!news.maxwell.syr.edu!news.mel.connect.com.au!munnari.OZ.AU!news.usyd.edu.au!news.nsw.CSIRO.AU!csiro!news From: David Tucker Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Adipocyte transfection Date: Fri, 03 Jul 1998 15:14:35 +1100 Organization: CSIRO Molecular Science Lines: 23 Message-ID: <359C68BB.20C9@WOWSERS.molsci.csiro.au> References: NNTP-Posting-Host: sao1-9.mel.dbe.csiro.au Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 3.0 (Win95; I) Hi Philippe: I have seen adenovirus used successfully with primary adipocytes, although the species and the authors allude me. A medline search should pick this up. Happy transfecting! David *****Remove "WOWSERS." to reply***** Phil wrote: > > Hi all ! > > Is there somebody that knows a good way of transfecting human > primary adipocytes ? We transfect rat primary adipocytes by > electroporation with little success... > Thanks, > > Philippe From owner-methds-reagnts@net.bio.net Wed Jul 01 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!howland.erols.net!newspeer.monmouth.com!uni-erlangen.de!news.uni-erlangen.de!not-for-mail From: "Christian Reiser, PhD" Newsgroups: bionet.molbio.methds-reagnts Subject: Searching for a company "Rent A Scientist" Date: Fri, 03 Jul 1998 07:49:28 +0200 Organization: Regionales Rechenzentrum Erlangen, Germany Lines: 16 Message-ID: <359C70E8.A4DE068B@rzmail.uni-erlangen> NNTP-Posting-Host: 131.188.231.11 Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 4.04 [en] (WinNT; I) Hi, does anybody know a company (not only in Germany) renting scientists or facilities for solving problems in life science, biochemistry, microbiology (theme "Rent A Scientist") eg. for overexpression and purification of a protein ? Thanks for your help. Chris Christian Reiser, PhD Med. IV, Nephrology Loschgestr. 8 D-91054 Erlangen Germany From owner-methds-reagnts@net.bio.net Wed Jul 01 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!cam-news-feed1.bbnplanet.com!news.bbnplanet.com!news.delphi.com!news From: aklib@delphi.com Newsgroups: bionet.molbio.methds-reagnts Subject: Looking for glyoxyl agarose. Date: Thu, 2 Jul 98 23:18:05 -0500 Organization: Delphi (info@delphi.com email, 800-695-4005 voice) Lines: 6 Message-ID: NNTP-Posting-Host: 199.93.4.4 I am looking for a source to obtain glyoxyl agarose. Sigma used to sell it. Not anymore; they discontinued it; apparently it was not a popular product :-(. My web search gave me a couple of leads. False. They did not even call me back :-(. If you could email me at aklib@delphi.com if you know about a source for glyoxyl agarose, I will be very grateful. Thanks! From owner-methds-reagnts@net.bio.net Wed Jul 01 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!cam-news-feed1.bbnplanet.com!news.bbnplanet.com!news.delphi.com!news From: aklib@delphi.com Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Pittsburgh: Great Science. Great Quality of Life Date: Thu, 2 Jul 98 23:08:56 -0500 Organization: Delphi (info@delphi.com email, 800-695-4005 voice) Lines: 21 Message-ID: References: <3593B678.502B@chugaibio.com> NNTP-Posting-Host: 199.93.4.4 X-To: Dom Spinella Dom Spinella writes: >> Cheapo tickets to the theatre, concerts (Bach or Beck), foreign >> films. Easy to get to. No traffic. No hot subways. Airport is >> easy to get to, and most big cities (D.C., NYC, Toronto) are >> couple hours away by car. >> >> No crime. No smog. > >What terrific criteria on which to base a decision to do a post-doc that Just curious, is there still the smell of sulfides available in Squirrell Hilll on occasional nights due to the steel mill that is still under the hill? And yes, there WAS a subway in Pittsburgh just a few years ago (nice German-made newer cars on the southern route :-). As far as "not traffic" statement, some tunnell/bridge combinations could create that once in a while There should be truth in advertizing. I suspect that for a postdoc candidate the Lab is the main attraction; if that person is eating sushi all the time instead of making something interesting happen in the lab, it is all a pretty useless undertaking. Then again, there are good labs in Pittsburgh, do not get me wrong. From owner-methds-reagnts@net.bio.net Thu Jul 02 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!news.bbnplanet.com!newsfeed.concentric.net!newsfeed1.earthlink.net!feed2.news.erols.com!erols!howland.erols.net!newspeer.monmouth.com!rill.news.pipex.net!pipex!server1.netnews.ja.net!cpca3.uea.ac.uk!news From: Greg Newsgroups: bionet.molbio.methds-reagnts Subject: Footprinting Date: Fri, 03 Jul 1998 18:08:22 +0100 Organization: University of East Anglia, Norwich, Norfolk, NR47TJ, UK Lines: 29 Message-ID: <359D1005.302F8BAA@uea.ac.uk> NNTP-Posting-Host: bioclark2.bio.uea.ac.uk Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 4.05 [en] (Win95; I) Hi All, I'm trying to footprint several regions of my favorite promoter, and am using the Pharmacia kit. I am attempting to bypass the shift step and go straight to the footprint. I have one problem I can find little in the literature to give me a rough idea of how much protein I should be using in an individual reaction; I am going to opt for approx. 25ug per rxn of a crude nuclear extract, as this fits with previous shift work done in my lab, with the felling that an a smallish excess is far more preferable than being low on protein. I have to titrate my DNase I yet, my job for Monday morning. So any suggestions about this or any little help about footprinting in general would be greatly received as I have no one with experience of this technique around me. Thanks in advance Greg. ---------------------------- Dr. Greg Dean Dept. of Biological Sciences University of East Anglia Norwich Norfolk NR4 7TJ England Tel.: 01603 593796 Fax.: 01603 592250 ---------------------------- From owner-methds-reagnts@net.bio.net Thu Jul 02 23:00:00 1998 Path: biosci!NMSU.EDU!hroychow From: hroychow@NMSU.EDU (Hiranya Roychowdhury) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: How to seq. ...a mistake in my response. Date: 3 Jul 1998 08:05:47 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 21 Sender: daemon@net.bio.net Distribution: world Message-ID: <199807031503.JAA54730@nestor.NMSU.Edu> NNTP-Posting-Host: net.bio.net At 05:17 PM 7/2/98 -0400, Brian Sydnor Burnes wrote: >Thank you so much for your help. I was unaware of the possibility of >differentially labelled primers for sequencing. > Brian, You are welcome. BUT I MADE A MISTAKE. ... I was too hasty to suggest this approach. You would still need dissimilar primers for this one, since the single primer would pose the same problem on the template as they would in a conventinal sequencing reaction. 'Seems to me that the RE digest and/or the cloning should be the only approach available. Hiranya. Dr. Hiranya Sankar Roychowdhury Plant Genetic Engineering Lab. New Mexico State University Las Cruces, NM 88003 Ph. (505) 646-5785 hroychow@nmsu.edu From owner-methds-reagnts@net.bio.net Thu Jul 02 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!news.bbnplanet.com!logbridge.uoregon.edu!news.maxwell.syr.edu!bignews.mediaways.net!news-fra1.dfn.de!news-koe1.dfn.de!uni-muenster.de!news From: "Andreas Vogel" Newsgroups: bionet.molbio.methds-reagnts Subject: Bac-to-Bac system Date: Fri, 03 Jul 1998 10:49:12 +0200 Organization: Westfaelische Wilhelms-Universitaet Muenster, Germany Lines: 19 Sender: "Andreas Vogel" Message-ID: <359C9B08.98BF295C@uni-muenster.de> NNTP-Posting-Host: bc401.uni-muenster.de Mime-Version: 1.0 Content-Type: text/plain; charset=iso-8859-1 Content-Transfer-Encoding: 8bit X-Mailer: Mozilla 4.05 [de] (Win95; I) Hi all, I am going to start with baculovirus expression and decided to use the Bac-to-Bac system from life technologies. They say you dont have to waste your time with plaque purification because you can generate 100 percent recombinant virus DNA. But, are there really no difficulties with this system? Does anyone have experience with it? Thanks in advance for your help, Andreas ************************************************************************ Andreas Vogel Department of Biochemistry University of Münster Tel: +49-251-8332128 Wilhelm-Klemm-Str. 2 Fax: +49-251-8333206 D-48149 Münster/Germany E-mail: vogela@uni-muenster.de ************************************************************************ From owner-methds-reagnts@net.bio.net Thu Jul 02 23:00:00 1998 Path: biosci!SMH.TORONTO.ON.CA!VASCULAR From: VASCULAR@SMH.TORONTO.ON.CA (Lab Vascular) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Fermantas - TransformAid Kit Date: 3 Jul 1998 10:13:56 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 22 Sender: daemon@net.bio.net Distribution: world Message-ID: <98Jul3.122903edt.27939@firewall.smh.toronto.on.ca> NNTP-Posting-Host: net.bio.net Re: Question from Dr. W.A.Rosche The kit is fine. I use JM109, and it's been OK. I even use it for TOPO-TA Cloning -- from PCR to MiniPreps in 24 hours! However, I tried TOP10 cells (from Invitrogen), and it sucked. Dunno why..... :-( Go ahead with it and have FUN ! Patrick F.H. Lai Grad Student, U of Toronto 98July02 PS MBI Fermentas did not pay me anything for this endorsement. I am genuinely happy with the kit. It would be even better if it comes with some security features so that my lab mates would stop 'borrowing' it from me !!! :-) From owner-methds-reagnts@net.bio.net Thu Jul 02 23:00:00 1998 Path: biosci!agate!howland.erols.net!newsfeed.internetmci.com!164.67.42.145!awabi.library.ucla.edu!164.67.43.25!news.ucla.edu!not-for-mail From: Ng Newsgroups: bionet.molbio.methds-reagnts,bionet.molbio.proteins Subject: Chemical phosphorylation of proteins Date: 4 Jul 1998 00:24:18 GMT Organization: Molecular Biology Institute, UCLA Lines: 8 Message-ID: <6njsni$b33$1@carroll.library.ucla.edu> NNTP-Posting-Host: mendel.mbi.ucla.edu X-Newsreader: TIN [UNIX 1.3 unoff BETA 970731; alpha OSF1 V4.0] Xref: biosci bionet.molbio.methds-reagnts:68736 bionet.molbio.proteins:12965 Could someone point me to some resource that discusses different reagents for phosphorylating proteins with chemicals (such as acetyl phosphate)? Or suggest reagents? Thanks. -- Ho Leung Ng holeung@ucla.edu From owner-methds-reagnts@net.bio.net Thu Jul 02 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!newsfeed.direct.ca!news.bctel.net!not-for-mail From: Paul Kowalski Newsgroups: bionet.molbio.methds-reagnts Subject: Cheaper alternative to Centrisep Spincolumns? Date: Fri, 03 Jul 1998 16:07:36 -0700 Organization: Terry Fox Laboratory, BC Cancer Agency Lines: 17 Message-ID: <359D63EF.2475@bccancer.bc.ca> Reply-To: pkowalsk@bccancer.bc.ca NNTP-Posting-Host: cust-mails.bctel.net Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 3.04 (WinNT; I) Hi- we've found a very significant cost involved in fluorescent sequencing is the Princeton Seperations CentriSep spincolumns for purifying the PerkinElmer BigDye reactions prior to loading on the ABI. Currently they cost us a bit over $350CDN/100 tubes. We've tried using Biorad G50 spincols (much cheaper) but they don't work well. Does anyone have suggestions for a cheaper alternative? BTW, if anyone out there is doing Perkinelmer BigDye sequencing chemistry and hasn't seen Bruce Roe's page on ways to do it better/cheaper, you should check it out: http://www.genome.ou.edu/proto.html -- Paul Kowalski Terry Fox Laboratory, BC Cancer Agency Medical Genetics, UBC From owner-methds-reagnts@net.bio.net Thu Jul 02 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!news.bbnplanet.com!newsfeed.direct.ca!news.maxwell.syr.edu!nntp2.dejanews.com!nnrp1.dejanews.com!not-for-mail From: sarah_petersen@yahoo.com Newsgroups: bionet.molbio.methds-reagnts Subject: Southern problems Date: Fri, 03 Jul 1998 21:56:08 GMT Organization: Deja News - The Leader in Internet Discussion Lines: 32 Message-ID: <6njk1o$eok$1@nnrp1.dejanews.com> NNTP-Posting-Host: 152.1.176.19 X-Article-Creation-Date: Fri Jul 03 21:56:08 1998 GMT X-Http-User-Agent: Mozilla/4.05 [en] (X11; U; SunOS 5.4 sun4m) I'd like some advice: I'm trying to detect a low-copy number sequence in a genomic DNA Southern. The genome size is ~100Mb, and I've loaded 7-10 micrograms of RE-digested DNA per lane on nylon. The probe is a cloned fragment ~300bp long which I have prepared by PCR-ing the fragment out of its vector (using fragment-specific, not vector-specific, primers), ppting with EtOH, resuspending in HOH, and random primed labeling with 32P (using B-M High Prime) - used about 50-100ng for labeling. I filtered the probe through a G-50 gravity column, and hybed O/N in a 7% SDS phosphate buffer. The probe (eluted from the G-50 column) was in about 1/2 ml of TE, and was added to 3 mls of the hyb. solution (hyb in roller bottle). The membrane was about 5X10 CM (5 lanes). Hybed O/N at 60C, washed 2X5 min at RT, 2XSSPE, 0.1%SDS, 3X5 min at 60C, 1XSSPE, 0.1%SDS. On film at -80 with intensifying screen O/N. Before putting the blot to film, I had to cut off the two marker lanes (BRL 1Kb+) because the signal was too hot there. I left one of the cut-out lanes on the film (away from the genomic blot). Results? The genomic part of the film was blank. Little noise, no signal. The cut-off marker lane showed *every* band. I guess I overloaded it but didn't think I'd have enough vector stuff labeled to show it up that brightly (it is vector bits that light that up, isn't it?) Anyway, I'm thinking that 300bp must be marginal for random-primed labeling and that I'd be better off end-labeling, or treating the random-primed probe as an oligo and lowering the hyb. temp to 50 or so. But perhaps I'm missing something fundamental here? Thanks for any suggestions, especially the *good* ones :-) -----== Posted via Deja News, The Leader in Internet Discussion ==----- http://www.dejanews.com/rg_mkgrp.xp Create Your Own Free Member Forum From owner-methds-reagnts@net.bio.net Thu Jul 02 23:00:00 1998 Path: biosci!news.Stanford.EDU!newsfeed.concentric.net!newsfeed1.earthlink.net!uwm.edu!vixen.cso.uiuc.edu!thor.cmp.ilstu.edu!news From: Marc Domanus Newsgroups: bionet.molbio.methds-reagnts Subject: Cross-Linked Molecular Weight Markers Date: Fri, 03 Jul 1998 13:40:37 -0500 Organization: Illinois State University Lines: 20 Message-ID: <359D25A5.FC12ED06@rs6000.cmp.ilstu.edu> NNTP-Posting-Host: 138.87.99.75 Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 4.04 [en] (WinNT; I) Does anyone know of a high molecular weight protein marker for use with SDS-PAGE that has a range around 100,000-500,00 Da? I have tried Sigma's phosphorylase b cross-linked rabbit marker (P8906) and followed the recommended protocol. I am only able to see the 97,400 monomer; however, the dimer which should contain 28% overall intensity, for lot#105H9400, is not visible. Has anyone had luck with Sigma's phosphorylase b marker? If so, which lot number was used and were any changes made to Sigma's recommended protocol? For example, I have been unable to get the majority of the protein into solution. Any suggestions? Thanks for the help. Marc Domanus mhdoman@rs6000.cmp.ilstu.edu From owner-methds-reagnts@net.bio.net Thu Jul 02 23:00:00 1998 Path: biosci!SMH.TORONTO.ON.CA!VASCULAR From: VASCULAR@SMH.TORONTO.ON.CA (Lab Vascular) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Fermantas - TransformAid Kit Date: 3 Jul 1998 11:14:38 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 22 Sender: daemon@net.bio.net Distribution: world Message-ID: <98Jul3.132935edt.28421@firewall.smh.toronto.on.ca> NNTP-Posting-Host: net.bio.net Re: Question from Dr. W.A.Rosche The kit is fine. I use JM109, and it's been OK. I even use it for TOPO-TA Cloning -- from PCR to MiniPreps in 24 hours! However, I tried TOP10 cells (from Invitrogen), and it sucked. Dunno why..... :-( Go ahead with it and have FUN ! Patrick F.H. Lai Grad Student, U of Toronto 98July02 PS MBI Fermentas did not pay me anything for this endorsement. I am genuinely happy with the kit. It would be even better if it comes with some security features so that my lab mates would stop 'borrowing' it from me !!! :-) From owner-methds-reagnts@net.bio.net Fri Jul 03 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!news.bbnplanet.com!logbridge.uoregon.edu!nntp2.dejanews.com!nnrp1.dejanews.com!not-for-mail From: chris.moore@hri.ac.uk Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Bac-to-Bac system Date: Sat, 04 Jul 1998 16:49:13 GMT Organization: Deja News - The Leader in Internet Discussion Lines: 36 Message-ID: <6nlme9$9ob$1@nnrp1.dejanews.com> References: <359C9B08.98BF295C@uni-muenster.de> NNTP-Posting-Host: 149.155.238.205 X-Article-Creation-Date: Sat Jul 04 16:49:13 1998 GMT X-Http-User-Agent: Mozilla/3.01Gold (Win16; I) Hi Andreas, in my very brief aquaintance with the bac to bac system, as I understood it it was still a very good idea to plaque purify, as 100% recombinants are not always generated. Anyway i would have thought that plaque purifcation is a good idea, just as streaking out a new plasmid clone is. It ensures that the clone is pure. If you want to titre your virus, then a plaque assy is the best way to do it regards chris "Andreas Vogel" wrote: > > Hi all, > > I am going to start with baculovirus expression and decided to use the > Bac-to-Bac system from life technologies. They say you dont have to > waste your time with plaque purification because you can generate 100 > percent recombinant virus DNA. > But, are there really no difficulties with this system? Does anyone have > experience with it? > > Thanks in advance for your help, > Andreas > > ************************************************************************ > Andreas Vogel > Department of Biochemistry > University of Münster Tel: +49-251-8332128 > Wilhelm-Klemm-Str. 2 Fax: +49-251-8333206 > D-48149 Münster/Germany E-mail: vogela@uni-muenster.de > ************************************************************************ > -----== Posted via Deja News, The Leader in Internet Discussion ==----- http://www.dejanews.com/rg_mkgrp.xp Create Your Own Free Member Forum From owner-methds-reagnts@net.bio.net Fri Jul 03 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!news.bbnplanet.com!news1.best.com!newsxfer3.itd.umich.edu!newsxfer.itd.umich.edu!news.join.ad.jp!wnoc-tyo-news!wnoc-sfc-news!wnoc-kyo-news!news.csi.ad.jp!east-news.csi.ad.jp!hiroshima-u!not-for-mail From: "Paul Timotiwu" Newsgroups: bionet.molbio.methds-reagnts Subject: subscribe methods Date: Sat, 4 Jul 1998 16:22:57 +0900 Organization: Hiroshima University, Hiroshima JAPAN Lines: 2 Message-ID: <6nkkrs$r7v$1@news.hiroshima-u.ac.jp> References: NNTP-Posting-Host: ppp-saijo-169.ipc.hiroshima-u.ac.jp Mime-Version: 1.0 Content-Type: text/plain; charset="iso-2022-jp" Content-Transfer-Encoding: 7bit X-Newsreader: Microsoft Outlook Express 4.72.2106.4 X-MimeOLE: Produced By Microsoft MimeOLE V4.72.2106.4 subscribe methods From owner-methds-reagnts@net.bio.net Fri Jul 03 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!feed2.news.erols.com!erols!news.ultranet.com!bigboote.WPI.EDU!bert.WPI.EDU!jbagshaw From: "Joseph C. Bagshaw" Newsgroups: bionet.molbio.methds-reagnts Subject: Re: southern blotting Date: Sat, 4 Jul 1998 08:30:05 -0400 Organization: Worcester Polytechnic Institute Lines: 38 Message-ID: References: <359AB303.1A66@yorku.ca> NNTP-Posting-Host: bert.wpi.edu Mime-Version: 1.0 Content-Type: TEXT/PLAIN; charset=US-ASCII In-Reply-To: <359AB303.1A66@yorku.ca> Rob, You didn't mention what your probe is, but if it contains a highly repeated sequence, like a microsatellite, it is entirely possible to see what appear to be smears on a genomic Southern. Some sequences are so highly repeated and so widely distributed that they appear to be ubiquitous. The distribution of signals is not significantly different from the distribution of DNA fragments. I've seen this happen many times. If this is your problem, you will have to get a different probe. ******************** HAVE GENES, WILL TRAVEL ******************** Joe Bagshaw, Worcester Polytechnic Institute jbagshaw@wpi.edu Roadkill on the information superhighway. On 1 Jul 1998, Moens' lab wrote: > I've tried to do mammalian genomic southerns before but all I get > is a smear signal whose intensity correlates with the ethidium bromide > intensity in an agarose gel. Therefore, it is not due to repeat > sequences or anything of the sort. I had PAC DNA on the same southerns > and these worked fine. Also, the lambda marker was clean. I followed > the protocol in Maniatis et al, 1989 "Molecular Cloning" to the letter > (for what I can tell) but I keep getting these smears. I've digested > with BamHI to apparent completion, also. What am I doing wrong? The > amount loaded was about 20 ug and I left hybridizing O/N. I used > Denhardt's solution without formamide. Does anyone have any idea how I > can solve this? > > Thank you, > Rob Botelho > > yu106715@yorku.ca > or > moens@yorku.ca > > From owner-methds-reagnts@net.bio.net Fri Jul 03 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!news.bbnplanet.com!newsfeed.wli.net!nntp2.dejanews.com!nnrp1.dejanews.com!not-for-mail From: sarah_petersen@yahoo.com Newsgroups: bionet.molbio.methds-reagnts Subject: "flash-freezing" denatured probes Date: Sat, 04 Jul 1998 18:01:31 GMT Organization: Deja News - The Leader in Internet Discussion Lines: 9 Message-ID: <6nlqlq$cul$1@nnrp1.dejanews.com> NNTP-Posting-Host: 152.1.176.19 X-Article-Creation-Date: Sat Jul 04 18:01:31 1998 GMT X-Http-User-Agent: Mozilla/4.05 [en] (X11; U; SunOS 5.4 sun4m) Hi, I often see the instruction to 'quickly cool' a denatured probe before adding it to the hybridization buffer. If you're going -straight- from boiling to the hyb bottle, is this neccessary? Is it bad for the probe to slowly cool to the hyb temp? Any thoughts on this? -----== Posted via Deja News, The Leader in Internet Discussion ==----- http://www.dejanews.com/rg_mkgrp.xp Create Your Own Free Member Forum From owner-methds-reagnts@net.bio.net Fri Jul 03 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!news.uoregon.edu!newsfeed.orst.edu!news.uidaho.edu!not-for-mail From: Kajetan Groicher Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Filling in without chewing back Date: Sat, 04 Jul 1998 14:53:42 -0700 Organization: University of Idaho Department of Microbiology, Molecular Biology, and Biochemistry Lines: 10 Message-ID: <359EA466.3850@uidaho.edu> References: <359C23C4.67AD@chugaibio.com> NNTP-Posting-Host: staph-gods2.campus.uidaho.edu Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 3.01 (WinNT; I) Hi- Would Klenow Fragement (3'--5' exo-) work for this rxn? It can be used at RT, and a claim is made that the 3'--5'exo activity is abolished. Try New England Biolabs (no affiliation) www.neb.com. Hope this helps- Kajetan From owner-methds-reagnts@net.bio.net Fri Jul 03 23:00:00 1998 Path: biosci!agate!howland.erols.net!newsfeed.internetmci.com!152.163.199.19!portc03.blue.aol.com!audrey03.news.aol.com!not-for-mail From: loupass@aol.com (LouPass) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Chloramphenicol resistance marker Lines: 6 Message-ID: <1998070502052100.WAA11944@ladder03.news.aol.com> NNTP-Posting-Host: ladder03.news.aol.com X-Admin: news@aol.com Date: 5 Jul 1998 02:05:20 GMT Organization: AOL http://www.aol.com References: You're correct. I stand corrected. I did not have any references for 177 in front of me and obviously misspoke. Hope it didnt confuse anyone. Lou Passador Dept. of Microbiology and Immunology Univ. of Rochester Rochester NY. From owner-methds-reagnts@net.bio.net Fri Jul 03 23:00:00 1998 Path: biosci!agate!howland.erols.net!portc02.blue.aol.com!audrey01.news.aol.com!not-for-mail From: loupass@aol.com (LouPass) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: ethidium bromide: add to gel before pouring or stain afterwards Lines: 9 Message-ID: <1998070502091000.WAA11577@ladder01.news.aol.com> NNTP-Posting-Host: ladder01.news.aol.com X-Admin: news@aol.com Date: 5 Jul 1998 02:09:10 GMT Organization: AOL http://www.aol.com References: <6n4csb$ssf$1@nnrp1.dejanews.com> melt-cool-addEtBr-pour. Doing this for years, and it works like a charm. Lou Lou Passador Dept. of Microbiology and Immunology Univ. of Rochester Rochester NY. From owner-methds-reagnts@net.bio.net Sat Jul 04 23:00:00 1998 Path: biosci!USA.NET!srsres From: srsres@USA.NET Newsgroups: bionet.molbio.methds-reagnts Subject: 800 Money Making Books: UNDER $50.00 TAKES ALL! Date: 5 Jul 1998 23:30:38 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 37 Sender: daemon@net.bio.net Distribution: world Message-ID: <199807060630.XAA04596@net.bio.net> NNTP-Posting-Host: net.bio.net We have over 800 high quality How-To Books & Reports that you can own, read, or even re-sell yourself. PRICE: Under $50.00 TAKES ALL! Popular Titles: Government Auctions, How to Get a Patent, Web Marketing, Business Start-ups, Legal Documents, Classic Novels, many other "Making Money" titles and more! For many FREE PREVIEWS and other FREEBIES go here: http://www.srsinfo.com/allen/books2.htm VERY WELL WRITTEN, QUALITY INFORMATION! RESALE RIGHTS INCLUDED. *************************************************************************** To be removed: GO TO WEB PAGE and click E-MAIL. Use REMOVE in BODY or SUBJECT fields. At the time of this mailing, the reply-to address was working. We cannot be held responsible if by the time you reply, it works or not, therefore use the above removal instructions to guarantee removal. This advertisement is copyright. Any reproduction (electronically or physically] is strictly forbidden. *************************************************************************** From owner-methds-reagnts@net.bio.net Sat Jul 04 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!newsfeed.internetmci.com!152.163.199.19!portc03.blue.aol.com!audrey01.news.aol.com!not-for-mail From: greggsilk@aol.com (Gregg Silk) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Bac-to-Bac system Lines: 7 Message-ID: <1998070604351900.AAA05396@ladder01.news.aol.com> NNTP-Posting-Host: ladder01.news.aol.com X-Admin: news@aol.com Date: 6 Jul 1998 04:35:19 GMT Organization: AOL http://www.aol.com References: <359C9B08.98BF295C@uni-muenster.de> We had a long thread about this last month. It works pretty well, you generate the recombinants in a special E. coli host (not insect cells), do selection, minipreps, and characterization THEN transfect insect cells. A round of screening might be needed to purify isolates. But it is much much faster AND much cheaper than many alternatives. Gregg W. Silk From owner-methds-reagnts@net.bio.net Sat Jul 04 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!howland.erols.net!portc02.blue.aol.com!audrey01.news.aol.com!not-for-mail From: greggsilk@aol.com (Gregg Silk) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Pittsburgh: Great Science. Quality of Life? Lines: 8 Message-ID: <1998070604444300.AAA06462@ladder01.news.aol.com> NNTP-Posting-Host: ladder01.news.aol.com X-Admin: news@aol.com Date: 6 Jul 1998 04:44:43 GMT Organization: AOL http://www.aol.com References: >This is not really the venue to comment on cities, >other than to say that Pittsburgh is a very viable >place to do science and it offers many amenities >other cities dont. Good point! For a young person trying to establish a career and family, quality of life will have a lot more to do with career choice (science or not) than where they live..... From owner-methds-reagnts@net.bio.net Sat Jul 04 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!nntp2.dejanews.com!nnrp1.dejanews.com!not-for-mail From: ruckeri@my-dejanews.com Newsgroups: bionet.molbio.methds-reagnts Subject: Background when using AP immunodetection system Date: Mon, 06 Jul 1998 04:37:18 GMT Organization: Deja News - The Leader in Internet Discussion Lines: 9 Message-ID: <6npk9u$6ua$1@nnrp1.dejanews.com> NNTP-Posting-Host: 202.7.15.11 X-Article-Creation-Date: Mon Jul 06 04:37:18 1998 GMT X-Http-User-Agent: Mozilla/3.01 (WinNT; I) X-Http-Proxy: 1.0 proxy2.nt.tas.gov.au:8080 (Squid/1.1.20) for client 147.109.136.210 I am doing Western blotting using a PVDF membrane and an amplified alkaline phosphatase detection system. I am getting high levels of background staining and am wondering if it is because of the biotin/avidin system being used. The AP substrate may also be a little old - would this cause background staining or just less colour production? Thankyou for your help. -----== Posted via Deja News, The Leader in Internet Discussion ==----- http://www.dejanews.com/rg_mkgrp.xp Create Your Own Free Member Forum From owner-methds-reagnts@net.bio.net Sat Jul 04 23:00:00 1998 Date: Sun, 05 Jul 1998 09:40:28 +0200 From: bickle@ubaclu.unibas.ch (Tom Bickle) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Filling in without chewing back Message-ID: References: <359C23C4.67AD@chugaibio.com> <359EA466.3850@uidaho.edu> Organization: Biozentrum, Basel University NNTP-Posting-Host: 131.152.13.1 X-Trace: 5 Jul 1998 09:40:27 +0100, 131.152.13.1 Lines: 16 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!enews.sgi.com!news-ge.switch.ch!news-zh.switch.ch!maser.urz.unibas.ch!bickle.bioz.unibas.ch!user In article <359EA466.3850@uidaho.edu>, Kajetan Groicher wrote: > Hi- > > Would Klenow Fragement (3'--5' exo-) work for this rxn? It can be used > at RT, and a claim is made that the 3'--5'exo activity is abolished. > > Try New England Biolabs (no affiliation) www.neb.com. > > Hope this helps- > > Kajetan Right, but not room temperature, use 6 degrees C (this turned out to be the temp of our cold room at the time). From owner-methds-reagnts@net.bio.net Sun Jul 05 23:00:00 1998 Path: biosci!agate!nntp-out.monmouth.com!newspeer.monmouth.com!feeder.qis.net!news.umbc.edu!umbc7.umbc.edu!albano From: albano renee Newsgroups: bionet.molbio.methds-reagnts Subject: antibodies Date: Mon, 6 Jul 1998 12:26:32 -0400 Organization: University of Maryland, Baltimore County Lines: 11 Message-ID: NNTP-Posting-Host: umbc7.umbc.edu Mime-Version: 1.0 Content-Type: TEXT/PLAIN; charset=US-ASCII I am looking for the following antibodies: sodA acnA zwf dnaK dps katE recA If anyone can give me a source I would appreciate it From owner-methds-reagnts@net.bio.net Sun Jul 05 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!woodstock.news.demon.net!demon!dispose.news.demon.net!demon!newsfeed.nacamar.de!uni-erlangen.de!lrz-muenchen.de!eos.gi.biologie.uni-muenchen.de!user From: J.Kaemper@lrz.uni-muenchen.de (Joerg Kaemper) Newsgroups: bionet.molbio.methds-reagnts Subject: Glyoxal/DMSO Northern Date: Mon, 06 Jul 1998 18:45:26 +0200 Organization: Institute of Genetics, Munich Distribution: world Message-ID: NNTP-Posting-Host: eos.gi.biologie.uni-muenchen.de X-Newsreader: MT-NewsWatcher 2.2.2 Lines: 18 For Northern analysis we are often using the Glyoxal/DMSO protocol to run RNA-gels, followed up by blotting to positively charged Nylon membranes using 20x SSC. Usually this protocol works fine, but in every 5th to 6th blot only the bottom half of the RNA is transferred to the membrane; the top half stays in the gel. We have never obtained this problem with Formaldehyde gels. Of course we could switch back to Formaldehyde gels, but the people in the lab favour, despite the set-backs, the DMSO/Glyoxal method, because it gives sharper bands and is less toxic. We have the wildest hypotheses why only the bottom-RNA is transferred to the membrane, but none is really satisfying. Has anybody observed something similar, or has somebody an explanation (or wild hypothesis, we do collect those) for the effect??? Thanks for replying, Joerg -- Joerg Kaemper Institute of Genetics University of Munich From owner-methds-reagnts@net.bio.net Sun Jul 05 23:00:00 1998 Path: biosci!JHMI.EDU!gsemenza From: gsemenza@JHMI.EDU ("Gregg Semenza") Newsgroups: bionet.molbio.methds-reagnts Subject: (none) Date: 6 Jul 1998 05:50:25 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 1 Sender: daemon@net.bio.net Distribution: world Message-ID: NNTP-Posting-Host: net.bio.net unsubscribe methods From owner-methds-reagnts@net.bio.net Sun Jul 05 23:00:00 1998 Path: biosci!agate!howland.erols.net!news-peer.gip.net!news-raspail.gip.net!news.gsl.net!gip.net!oleane!jussieu.fr!univ-angers.fr!melon.univ-brest.fr!fraise.univ-brest.fr!glepenne From: glepenne@fraise.univ-brest.fr (Gael Le Pennec) Newsgroups: bionet.molbio.methds-reagnts Subject: problem with NA45 DEAE Cellulose membrane Date: 6 Jul 1998 12:29:09 GMT Organization: Universite de Bretagne Occidentale - Brest - France Lines: 2 Message-ID: <6nqful$a3r$1@melon.univ-brest.fr> NNTP-Posting-Host: fraise.univ-brest.fr Mime-Version: 1.0 Content-Type: text/plain; charset=iso-8859-1 Content-Transfer-Encoding: 8bit I get some problems to eluate DNA insert from NA 45 DEAE cellulaose membrane. Does anybody get such trouble. From owner-methds-reagnts@net.bio.net Sun Jul 05 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!europa.clark.net!194.162.162.196!newsfeed.nacamar.de!nntp.news.xara.net!xara.net!server5.netnews.ja.net!daresbury!not-for-mail From: Nico Dantuma Newsgroups: bionet.molbio.methds-reagnts Subject: freeze chloroquine stock Date: 6 Jul 1998 17:16:07 +0100 Lines: 25 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <6nqt87$dse@mserv1.dl.ac.uk> X-Sender: nicdan@mbox.ki.se Original-To: "methods@dl.ac.uk" Hi, For DEAE-dextran transfection of COS cells, I routinely make a fresh 40 mM chloroquine solution in PBS which is eventually diluted in the medium. This is according to the standard protocol of Cullen in Meth. Enzym. Yet, I noticed that in the commercial DEAE-dextran transfection kits the chloroquine solution is stored at -20oC. Can I also freeze the stock solution or is it really necessary to prepare each time a fresh solution? What is the logic behind using fresh choloroquine solutions? Thanks in advance. Nico ______________________ Nico Dantuma Microbiology and Tumorbiology Center Karolinska Institute Box 280 S-171 77 Stockholm SWEDEN Phone: +46 8 7286280; fax: +46 8 331399 From owner-methds-reagnts@net.bio.net Sun Jul 05 23:00:00 1998 Path: biosci!NMSU.EDU!hroychow From: hroychow@NMSU.EDU (Hiranya Roychowdhury) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: PAGE Alternatives Date: 6 Jul 1998 08:45:54 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 41 Sender: daemon@net.bio.net Distribution: world Message-ID: <199807061543.JAA29148@nestor.NMSU.Edu> NNTP-Posting-Host: net.bio.net At 10:07 AM 7/6/98 -0400, Martha Ogilvie wrote: >Hi all! >I have a Highschool teacher in my lab this summer who is learning to run >SDS-PAGE and Western Blotting. She wants to take this back to the >classroom but because of the potential toxicity of acrylamide, they can't >use that in the school. So I wondered if anyone knew of an alternative >that could work for running a protein on a gel and at least getting to the >point of staining and destaining with it. > >Thanks for your help. > >-- >Martha Ogilvie, Ph.D. >Laboratory of Chemical Biology >Martha Ogilvie, Ph.D. >National Institutes of Health >Phone: 301/496-3510 >Fax: 301/480-6202 Starch matrix is used for non-denaturing applications but this wouldn't be showing the resolution that is obtained in SDS-PAGE. Alternatively, electrochromatography on paper (eg. 3M) may be tried with denatured samples, using the same buffer system. High percentage, thin agarose gels are also sometimes used for applications like detecting antigenicity of proteins (precipitin rxns) and enzyme activities, but I've never come across denaturing set-ups with agarose. However, if the teacher is careful in handling the acrylamide (weighing in a fume-hood, polymerizing unused portion completely etc.) and not let the students touch it with bare hands, the system may be deemed safe when used once or twice during the entire school year. Hiranya. Dr. Hiranya Sankar Roychowdhury Plant Genetic Engineering Lab. New Mexico State University Las Cruces, NM 88003 Ph. (505) 646-5785 hroychow@nmsu.edu From owner-methds-reagnts@net.bio.net Sun Jul 05 23:00:00 1998 Path: biosci!NMSU.EDU!hroychow From: hroychow@NMSU.EDU (Hiranya Roychowdhury) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: problem with NA45 DEAE Cellulose membrane Date: 6 Jul 1998 08:33:30 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 17 Sender: daemon@net.bio.net Distribution: world Message-ID: <199807061530.JAA47408@nestor.NMSU.Edu> NNTP-Posting-Host: net.bio.net At 12:29 PM 7/6/98 GMT, Gael Le Pennec wrote: >I get some problems to eluate DNA insert from NA 45 DEAE cellulaose >membrane. Does anybody get such trouble. > > What sort of problem? More detailed question is required before any help/pointer is offered! Dr. Hiranya Sankar Roychowdhury Plant Genetic Engineering Lab. New Mexico State University Las Cruces, NM 88003 Ph. (505) 646-5785 hroychow@nmsu.edu From owner-methds-reagnts@net.bio.net Sun Jul 05 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!newsfeed.ecrc.net!newsfeed.nacamar.de!dispose.news.demon.net!demon!baron.netcom.net.uk!netcom.net.uk!server3.netnews.ja.net!is.bbsrc.ac.uk!news From: "Andy Bettany" Newsgroups: bionet.molbio.methds-reagnts Subject: Double digest Sma1/Sac1 Date: Mon, 6 Jul 1998 15:32:08 +0100 Organization: BBSRC Biotechnology and Biological Sciences Research Council Message-ID: <6nqn62$pb3@is.bbsrc.ac.uk> NNTP-Posting-Host: pc0714.wpbs.bbsrc.ac.uk X-Newsreader: Microsoft Outlook Express 4.72.2106.4 X-MimeOLE: Produced By Microsoft MimeOLE V4.72.2106.4 Lines: 16 Dear All, I need to double digest a plasmid with Sac1 and Sma1. Both enzymes cut in the same buffer (according to Boehringer). Can I add both enzymes and incubate at 30C? Or do I need to do the Sma1 first at 30C then add the Sac1 and put at 37C? Thanks for your help, -- Dr. Andy Bettany Research Scientist Institute of Grassland and Environmental Research Plas Gogerddan Wales, UK From owner-methds-reagnts@net.bio.net Sun Jul 05 23:00:00 1998 Path: biosci!agate!howland.erols.net!newsfeed.internetmci.com!152.163.199.19!portc03.blue.aol.com!audrey01.news.aol.com!not-for-mail From: rmodali@aol.com (RModali) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Looking for genotyping services Lines: 14 Message-ID: <1998070614165500.KAA06563@ladder01.news.aol.com> NNTP-Posting-Host: ladder01.news.aol.com X-Admin: news@aol.com Date: 6 Jul 1998 14:16:55 GMT Organization: AOL http://www.aol.com References: <1998070214124000.KAA20968@ladder01.news.aol.com> Dear Lala, BioServe Biotechnologies provides genotyping services for all the assays you have identified. We also have developed and provide several other assays that are not identified in your request. For information regarding other assays please visit our WEB site at http://www.Bioserve.com or can contact us at (301) 470-3362 and talk to Dr. Terri Lehman. Sincerely, Rama Modali President BioServe Biotechnologies From owner-methds-reagnts@net.bio.net Sun Jul 05 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!hammer.uoregon.edu!news.niehs.nih.gov!icet.net.nih.gov!mogilvie From: mogilvie@helix.nih.gov (Martha Ogilvie) Newsgroups: bionet.molbio.methds-reagnts Subject: PAGE Alternatives Date: Mon, 06 Jul 1998 10:07:12 -0400 Organization: National Institutes of Health Lines: 18 Message-ID: NNTP-Posting-Host: 128.231.113.176 X-Newsreader: MT-NewsWatcher 2.3.5 Hi all! I have a Highschool teacher in my lab this summer who is learning to run SDS-PAGE and Western Blotting. She wants to take this back to the classroom but because of the potential toxicity of acrylamide, they can't use that in the school. So I wondered if anyone knew of an alternative that could work for running a protein on a gel and at least getting to the point of staining and destaining with it. Thanks for your help. -- Martha Ogilvie, Ph.D. Laboratory of Chemical Biology Martha Ogilvie, Ph.D. National Institutes of Health Phone: 301/496-3510 Fax: 301/480-6202 From owner-methds-reagnts@net.bio.net Sun Jul 05 23:00:00 1998 Path: biosci!LEONARDO.LS.HUJI.AC.IL!yoramg2 From: yoramg2@LEONARDO.LS.HUJI.AC.IL (Yoram Gerchman) Newsgroups: bionet.molbio.methds-reagnts Subject: Trypsin inhibitor as Factor X inhibitor. Date: 6 Jul 1998 06:36:14 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 18 Sender: daemon@net.bio.net Distribution: world Message-ID: Reply-To: Yoram Gerchman NNTP-Posting-Host: net.bio.net Greeting netters Dose any one have conditions for using Trypsin inhibitor to inhibit Factor Xa? ......................................................................... "Support bacteria - they're the only culture some people have" (anonymous) Yoram Gerchman Division of Microbial & Molecular Ecology The Institute of Life Sciences Hebrew University of Jerusalem Givat Ram, Jerusalem 91904, Israel From owner-methds-reagnts@net.bio.net Sun Jul 05 23:00:00 1998 Path: biosci!Uni-Hohenheim.DE!hanyihua From: hanyihua@Uni-Hohenheim.DE (Yihua Han) Newsgroups: bionet.molbio.methds-reagnts Subject: pCMV-Luc Date: 6 Jul 1998 09:46:53 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 6 Sender: daemon@net.bio.net Distribution: world Message-ID: NNTP-Posting-Host: net.bio.net Hi,does anyone have this plasmid pCMV-Luc?or who know from where can I get it? thanks for help! hyh From owner-methds-reagnts@net.bio.net Sun Jul 05 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!cyclone.mbnet.mb.ca!canopus.cc.umanitoba.ca!gietz.hgen.umanitoba.ca!user From: kirkpat@?cc.umanitoba.ca? (Rob Kirkpatrick) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Double digest Sma1/Sac1 Date: Mon, 06 Jul 1998 12:03:18 -0600 Organization: U of Manitoba Lines: 22 Message-ID: References: <6nqn62$pb3@is.bbsrc.ac.uk> NNTP-Posting-Host: gietz.hgen.umanitoba.ca In article <6nqn62$pb3@is.bbsrc.ac.uk>, "Andy Bettany" wrote: > Dear All, > > I need to double digest a plasmid with Sac1 and Sma1. Both enzymes cut in > the same buffer (according to Boehringer). Can I add both enzymes and > incubate at 30C? Or do I need to do the > Sma1 first at 30C then add the Sac1 and put at 37C? > Thanks for your help, > > -- In situations like this, we'll start the digest off with Sma1 at room temp for an hour then add the second enzyme and put it at 37C. Sma1 still works at 37C, but we like to give it that optimal head-start then it can finish off it's life at 37C. Works like a charm!!! Rob -- remove the ??'s to reply From owner-methds-reagnts@net.bio.net Sun Jul 05 23:00:00 1998 Path: biosci!NMSU.EDU!hroychow From: hroychow@NMSU.EDU (Hiranya Roychowdhury) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Double digest Sma1/Sac1 Date: 6 Jul 1998 12:55:35 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 47 Sender: daemon@net.bio.net Distribution: world Message-ID: <199807061952.NAA97068@nestor.NMSU.Edu> NNTP-Posting-Host: net.bio.net At 11:28 AM 7/6/98 -0700, Bernard Murray wrote: >In article , >kirkpat@?cc.umanitoba.ca? (Rob Kirkpatrick) wrote: > >> In article <6nqn62$pb3@is.bbsrc.ac.uk>, "Andy Bettany" >> wrote: >> >> > Dear All, >> > >> > I need to double digest a plasmid with Sac1 and Sma1.... >Okay, just to confuse matters I'll venture another opinion. >I'd suggest digesting first with SacI alone at 37degC and >then dropping the temperature and adding the SmaI. >My reason is that SmaI can nibble back at warmer temperatures >and you may not finish up with the exact ends that you >intended. If you look back through the archives you'll >find a few posts on digests with SmaI (I believe some people >even suggest dropping the temperature to ambient or below). > I hope one of the methods gives you what you want, > Bernard Now, I have occassionally come across postings re: SmaI digests and all the "horror" stories about it. I use SmaI-digested vector and inserts almost routinely for sequencing of subclones. I have carried out SmaI digestion in all kinds of buffers that come with all kinds of SmaI preps (you know, BRL, NEB, Pharmacia etc.) at 37C (routinely) and have never observed any "chew back" by SmaI! I have been monitoring the sequences at the junctions closely for a couple of years now since I first came across such comment(s) about the enzyme. I can emphatically say that SmaI has never done that in my hands. As far as double digestion goes, I am quite comfortable digesting with two enzymes simultaneously in a compatible buffer after making sure that the sites are well separated (at least 6bases). The "One-Phor-All plus" buffer (pharmacia's) is a very good one that works with almost all common enzymes with slight variations for those enzymes that require lower or higher salts (eg. using 0.5x to 2x). Hiranya. Dr. Hiranya Sankar Roychowdhury Plant Genetic Engineering Lab. New Mexico State University Las Cruces, NM 88003 Ph. (505) 646-5785 hroychow@nmsu.edu From owner-methds-reagnts@net.bio.net Sun Jul 05 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!news-peer.gip.net!news.gsl.net!gip.net!howland.erols.net!portc02.blue.aol.com!pitt.edu!not-for-mail From: pxpst2@spam.suxs.unixs.cis.pitt.edu (Peter) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: PAGE Alternatives Date: Mon, 06 Jul 1998 15:43:07 -0500 Organization: University of Pittsburgh Lines: 22 Message-ID: References: NNTP-Posting-Host: pelli.pathology.pitt.edu Mail-Copies-To: pxpst2@spam.suxs.unixs.cis.pitt.edu X-Newsreader: MT-NewsWatcher 2.4.4 In article , mogilvie@helix.nih.gov (Martha Ogilvie) wrote: > Hi all! > I have a Highschool teacher in my lab this summer who is learning to run > SDS-PAGE and Western Blotting. She wants to take this back to the > classroom but because of the potential toxicity of acrylamide, they can't > use that in the school. So I wondered if anyone knew of an alternative > that could work for running a protein on a gel and at least getting to the > point of staining and destaining with it. Use the Page but make sure that the teaacher is the person responsible for polymerizing the gel. Acrylamide is only dangerous in its monomer form. Peter -- "Don't you eat that yellow snow watch out where the Huskies go" FZ --------------------------------------------------------------------- From owner-methds-reagnts@net.bio.net Sun Jul 05 23:00:00 1998 Path: biosci!agate!news.ucdavis.edu!curt.ucdavis.edu!user From: mwcrepeau@ucdavis.edu (Marc Crepeau) Newsgroups: bionet.molbio.methds-reagnts Subject: hybridization to HindIII lambda Date: Mon, 06 Jul 1998 17:18:46 -0700 Organization: University of California, Davis Lines: 22 Message-ID: NNTP-Posting-Host: curt.ucdavis.edu In the lab next door an attempt to probe a Southern blot resulted in very dark bands corresponding to the HindIII lambda fragments used for molecular weight markers, but only very faint bands in the lanes containing Drosophila genomic DNA. Such hybidization to lambda DNA markers on Southern blots seems to be pretty common. I've seen it in my own work with probes made from lambda clones, and wasn't surprised. But this probe was made by random priming of a plasmid clone (the whole plasmid, not just the insert). Is there some highly homologous sequence between lambda phage DNA and E. coli plasmids? The bands were dark enough to suggest that it was fairly specific hybridization, especially considering that almost no signal was visible in the lanes with genemic DNA even though the student loaded a microgram of DNA in each lane. On the other hand, all seven lambda fragments lit up, whereas I would think a homologous vector sequence would only hybidize selectively to one or two of the lambda fragments. Any ideas? Marc Crepeau From owner-methds-reagnts@net.bio.net Sun Jul 05 23:00:00 1998 Path: biosci!news.Stanford.EDU!agate!howland.erols.net!portc02.blue.aol.com!pitt.edu!not-for-mail From: akhst7+@pitt.edu (AKi Hoji) Newsgroups: bionet.molbio.methds-reagnts Subject: BL21(DE3)pLys and chloramphenicol Date: 7 Jul 1998 04:25:44 GMT Organization: U. Pitt Lines: 10 Message-ID: NNTP-Posting-Host: ehdup-h-9.rmt.net.pitt.edu X-Newsreader: MT-NewsWatcher 2.3.1 Dear, Is the presence of chloramphenicol absolutely essential druing growth of BL21(DE3)pLys for induction of a target protein ? I have two kinds of mixed opinions. -- Aki Hoji (akhst7+@pitt.edu) Dept. Infectious Diseases & Microbiology University of Pittsburgh From owner-methds-reagnts@net.bio.net Sun Jul 05 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!newsfeed.internetmci.com!152.163.199.19!portc03.blue.aol.com!audrey03.news.aol.com!not-for-mail From: greggsilk@aol.com (Gregg Silk) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Cheaper alternative to Centrisep Spincolumns? Lines: 11 Message-ID: <1998070703231100.XAA18582@ladder03.news.aol.com> NNTP-Posting-Host: ladder03.news.aol.com X-Admin: news@aol.com Date: 7 Jul 1998 03:23:11 GMT Organization: AOL http://www.aol.com References: <359D63EF.2475@bccancer.bc.ca> If you want to experiment with homebrew cleanups, call Polyfiltronics (USA 617 878-1133) who makes a 96 well filter plate with 800 ul wells and a MBPP 25-30 um membrane. I used Sephadex G-50 *medium* for diRhodamine cleanups and they were perfect and forgiving. You might need Sephadex with a larger exclusion size for BigDye-I didn't optimize that. The Polyfiltronics plate is deep enough to make a real column in each well. I like the extended drip plate on the bottom (looks like golf cleats) which meshes well with the collection plate (Polyfiltronics) during the spin. Put a flexible 96 well plate into the stack to catch the samples. You'll need a centrifuge that can spin plates up to 2000 rpm and holders that can handle tall plates as tall as the 2 mlx96 style. Gregg From owner-methds-reagnts@net.bio.net Sun Jul 05 23:00:00 1998 From: Sam Michaelson Newsgroups: bionet.molbio.methds-reagnts Subject: Re: ethidium bromide: add to gel before pouring or stain afterwards Date: Tue, 07 Jul 1998 09:44:11 +1000 Organization: Defence Science & Technology Organisation Lines: 22 Message-ID: <35A1614A.E3FAE877@dsto.defence.gov.au.ANTISPAM> References: NNTP-Posting-Host: mbr-44-pc173.dsto.defence.gov.au Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 4.01 [en] (Win95; I) X-Priority: 3 (Normal) Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!news.bbnplanet.com!newsfeed.direct.ca!news.maxwell.syr.edu!news.mel.connect.com.au!munnari.OZ.AU!news.uwa.edu.au!o2robox02.optus.net.au!yorrell.saard.net!fang.dsto.defence.gov.au!foxhound.dsto.defence.gov.au!usenet Aniko Varga wrote: > destaining is a hassle... especially with large gels, moving them from > > bath to bath... any easy ways to do this, especially with large gels? Nalgene supplies gel/blot washing boxes, in two sizes, that have a port and stopper on the side on the outside of the box. To remove a solution from the box, you just have to remove the stopper and let it drain out - remove the solution from the gel, rather than try to remove the gel from the solution. I have found that staining flat bed agarose gels (up to 2%) with 10 ug/ml EtBr after a gel is run is possible while leaving the gel sitting in its tray - staining for 30 minutes, then destaining for 45 - 60 minutes, gives a good result, with a satisfactory background. The presence of the tray around the gel doesn't seem to have any adverse affect on the removal of unbound EtBr. Leaving the gel in the tray certainly makes them easier to handle, especially the larger ones. Sam Michaelson From owner-methds-reagnts@net.bio.net Sun Jul 05 23:00:00 1998 Path: biosci!MOLECULE.BIO.UTS.EDU.AU!michelle From: michelle@MOLECULE.BIO.UTS.EDU.AU (Michelle Gleeson) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: PAGE Alternatives Date: 6 Jul 1998 15:50:45 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 43 Sender: daemon@net.bio.net Distribution: world Message-ID: References: NNTP-Posting-Host: net.bio.net Hi, Another possible solution would be to get some BioRad or Novex pre-cast gels for the students to use. The teacher could show the actual gel construction and polymerisation as a demonstration. And how about liquid stock solutions - would at least save the hazard of weighing out powder. AATAGGCAATGGGCCCCATATAGGAACACAGAGCTGCATGCGTATTGCATGCCAGGCTATTCATTCCAGGGAAA Michelle Gleeson Molecular Parasitology Unit Ph: (02) 9514 4043 University of Technology Fax:(02) 9514 4003 Westbourne St Gore Hill, NSW 2065 michelle.gleeson@uts.edu.au AUSTRALIA TTATCCGTTACCCGGGGTATATCCTTGTGTCTCGACGTACGCATAACGTACGGTCCGATAAGTAAGGTCCCTTT On Mon, 6 Jul 1998, Peter wrote: > In article , > mogilvie@helix.nih.gov (Martha Ogilvie) wrote: > > > Hi all! > > I have a Highschool teacher in my lab this summer who is learning to run > > SDS-PAGE and Western Blotting. She wants to take this back to the > > classroom but because of the potential toxicity of acrylamide, they can't > > use that in the school. So I wondered if anyone knew of an alternative > > that could work for running a protein on a gel and at least getting to the > > point of staining and destaining with it. > > Use the Page but make sure that the teaacher is the person responsible for > polymerizing the gel. Acrylamide is only dangerous in its monomer form. > > Peter > > -- > "Don't you eat that yellow snow > watch out where the Huskies go" FZ > > --------------------------------------------------------------------- > > > From owner-methds-reagnts@net.bio.net Sun Jul 05 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!europa.clark.net!164.67.42.145!awabi.library.ucla.edu!137.82.194.1!unixg.ubc.ca!not-for-mail From: William Jia Newsgroups: bionet.molbio.methds-reagnts Subject: human glioma cell lines Date: Mon, 06 Jul 1998 13:41:27 -0700 Organization: The University of British Columbia Lines: 11 Message-ID: <35A13673.3A2B@unixg.ubc.ca> Reply-To: wjia@unixg.ubc.ca NNTP-Posting-Host: jia.ecc.ubc.ca Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 3.0 (Macintosh; I; PPC) If anybody in North American has the following human glioma cell lines, please let me know. LN18, LN215, LN229, LN319, LN405, LN-308. Those cell lines originally generated from Dr.N. de Tribolet's lab in Switzerland. But it will be much convenient if I can get them from somebody in North America. Please reply to this email account. Thank you very much in advance. William Jia From owner-methds-reagnts@net.bio.net Sun Jul 05 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!europa.clark.net!141.211.144.13!newsxfer3.itd.umich.edu!news.eecs.umich.edu!news.bu.edu!not-for-mail From: Robert Negm Newsgroups: bionet.molbio.methds-reagnts Subject: StrainMan Date: Mon, 06 Jul 1998 16:01:20 -0400 Organization: Caesar Software, LLC Lines: 18 Message-ID: <35A12D0F.E511FC61@caesarsoftware.com> Reply-To: negm@caesarsoftware.com NNTP-Posting-Host: mac031.hematol.bmc.org Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii; x-mac-type="54455854"; x-mac-creator="4D4F5353" Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 4.04 (Macintosh; I; PPC) Have you spent too much time in your freezer looking for a strain to perform an upcoming experiment? Would you like to find strains that you have frozen down in your laboratory minus 80 freezer quickly? If yes, then download StrainMan 1.0 for Windows or Macintosh and feel the power of advanced computer database technology for molecular biologists. http://www.caesarsoftware.com Sincerely, Robert Negm negm@caesarsoftware.com From owner-methds-reagnts@net.bio.net Sun Jul 05 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!news-peer.gip.net!news-lond.gip.net!news.gsl.net!gip.net!nntp.news.xara.net!xara.net!server5.netnews.ja.net!HEAnet!rowan.ucg.ie!not-for-mail From: kathy gately Newsgroups: bionet.molbio.methds-reagnts Subject: Smeared footprints Date: Mon, 06 Jul 1998 20:42:45 +0100 Organization: ucg Lines: 9 Message-ID: <35A128B5.735@ucg.ie> Reply-To: kathy.gatelynospamm@ucg.ie NNTP-Posting-Host: bio6.ucg.ie Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 3.04 (WinNT; I) I'm using a footprinting method, adapted from that of Galas and Schmitz and I'm getting alot of background smearing in the lanes containing the footprints. Any ideas? I was also wondering if anyone could recommend a good method/column for probe purification? I'm digesting my probe with restrictions enzymes that give a 3' end and a 5' end, then I 5' end-label with P32, I would like a method of purification that would result in the probe being eluted in a small final volume. Thanks for any advice, kathy. From owner-methds-reagnts@net.bio.net Sun Jul 05 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!news.bbnplanet.com!logbridge.uoregon.edu!europa.clark.net!208.134.241.18!newsfeed.internetmci.com!138.95.18.2!wilbur.sequent.com!newsfeed.orst.edu!news.nero.net!not-for-mail From: "Bryan L. Ford" Newsgroups: bionet.molbio.methds-reagnts Subject: Re: mRNA from parafin tissues Date: Mon, 06 Jul 1998 11:47:39 -0700 Organization: Marine/Freshwater Biomedical Sciences Center, Oregon State University, Corvallis OR 97331-6603 Lines: 21 Message-ID: <35A11BCB.7682@bcc.orst.edu> References: <1998Jul1.160650@balin.uthscsa.edu> Reply-To: fordb@bcc.orst.edu NNTP-Posting-Host: loveland-228-f.fst.orst.edu Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 3.04Gold (WinNT; I) To: simmons@uthscsa.edu knightcb@balin.uthscsa.edu wrote: > I need a good protocol for extracting mRNA from parafin embedded tissues to be > used for RT-PCR. Can anybody please help? Darrin: Try these: Koopmans, M. et al (1993) "Optimization of extraction and PCR amplification of RNA extracts from paraffin-embedded tissue in different fixatives" Journal of Virological Methods, 43:189-204. Finke, J. et al (1993) "An improved strategy and a useful housekeeping gene for RNA analysis from formalin-fixed paraffin-embedded tissues by PCR" Bioteqniques, 14(3):448-453. Hope these help. -Bryan From owner-methds-reagnts@net.bio.net Sun Jul 05 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!london-news-feed1.bbnplanet.com!news.bbnplanet.com!diablo.theplanet.net!dispose.news.demon.net!demon!news-lond.gip.net!news.gsl.net!gip.net!nntp.news.xara.net!xara.net!server5.netnews.ja.net!HEAnet!rowan.ucg.ie!not-for-mail From: kathy gately Newsgroups: bionet.molbio.methds-reagnts Subject: Transfection of HepG2 cells Date: Mon, 06 Jul 1998 20:53:41 +0100 Organization: ucg Message-ID: <35A12B45.C52@ucg.ie> Reply-To: kathy.gatelynospamm@ucg.ie NNTP-Posting-Host: bio6.ucg.ie Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 3.04 (WinNT; I) Lines: 6 Hi, Has anybody transfected HepG2 cells with SV40-CAT or CMV enhanced tk-CAT? I have done several transfections and I've used the CAT ELISA kit by Boehringer-Mannheim to detect CAT activity, my readings are very low for CAT, but are good for beta-gal, any ideas? thanks for any advice, kathy From owner-methds-reagnts@net.bio.net Sun Jul 05 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!news-peer.gip.net!news.gsl.net!gip.net!news-peer.sprintlink.net!news-backup-east.sprintlink.net!news.sprintlink.net!128.218.95.22!itssrv1.ucsf.edu!macmac-2.ucsf.edu!user From: bpmurray*STUFFER*@socrates.ucsf.edu (Bernard Murray) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Double digest Sma1/Sac1 Date: Mon, 06 Jul 1998 11:28:15 -0700 Organization: University of California, San Francisco Lines: 33 Message-ID: References: <6nqn62$pb3@is.bbsrc.ac.uk> NNTP-Posting-Host: macmac-2.ucsf.edu In article , kirkpat@?cc.umanitoba.ca? (Rob Kirkpatrick) wrote: > In article <6nqn62$pb3@is.bbsrc.ac.uk>, "Andy Bettany" > wrote: > > > Dear All, > > > > I need to double digest a plasmid with Sac1 and Sma1. Both enzymes cut in > > the same buffer (according to Boehringer). Can I add both enzymes and > > incubate at 30C? Or do I need to do the > > Sma1 first at 30C then add the Sac1 and put at 37C? > > Thanks for your help, > In situations like this, we'll start the digest off with Sma1 at room temp > for an hour then add the second enzyme and put it at 37C. Sma1 still > works at 37C, but we like to give it that optimal head-start then it can > finish off it's life at 37C. Works like a charm!!! > Rob Okay, just to confuse matters I'll venture another opinion. I'd suggest digesting first with SacI alone at 37degC and then dropping the temperature and adding the SmaI. My reason is that SmaI can nibble back at warmer temperatures and you may not finish up with the exact ends that you intended. If you look back through the archives you'll find a few posts on digests with SmaI (I believe some people even suggest dropping the temperature to ambient or below). I hope one of the methods gives you what you want, Bernard -- Bernard Murray, PhD Dept. Cell. Mol. Pharmacol., UCSF, San Francisco, USA From owner-methds-reagnts@net.bio.net Sun Jul 05 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!newshub.northeast.verio.net!news.pn.com!nntp.pn.com!mozo.cc.purdue.edu!expert.cc.purdue.edu!mhari From: mhari@expert.cc.purdue.edu (Malathi Hari) Newsgroups: bionet.molbio.methds-reagnts Subject: RT_PCR positive control Date: 6 Jul 1998 17:21:20 GMT Organization: Purdue University Computing Center Lines: 11 Message-ID: <6nr12g$5lp@mozo.cc.purdue.edu> NNTP-Posting-Host: expert.cc.purdue.edu X-Newsreader: TIN [version 1.2 PL2] I am trying to work out RT-PCR conditions to detect the expression of a small GTPase gene in various tissues and was wondering what positve control to use. I think I need to use Glyceraldehyde 3 phosphate dehydrogenase as a positve. I was wondering if someone could point me in the right direction and tell me where I can obtain primers or primer sequences for a postive control. Thanks in advance. Malathi From owner-methds-reagnts@net.bio.net Sun Jul 05 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!hammer.uoregon.edu!csulb.edu!gatech!nntp-xfer.ncsu.edu!not-for-mail From: John Fellers Newsgroups: bionet.molbio.methds-reagnts Subject: 96 well plates for PCR Date: Mon, 06 Jul 1998 12:43:37 +0000 Organization: North Carolina State University Lines: 2 Message-ID: <35A0C679.15BA@unity.ncsu.edu> NNTP-Posting-Host: conkling-lab2.gnets.ncsu.edu Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 2.0 (Macintosh; I; 68K) Just a general question, is there much cross contamination between wells using 96 well plates for PCR? From owner-methds-reagnts@net.bio.net Sun Jul 05 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!dallas-news-feed2.bbnplanet.com!news.bbnplanet.com!worldfeed.gte.net!howland.erols.net!newsfeed.internetmci.com!138.95.18.2!wilbur.sequent.com!newsfeed.orst.edu!news.nero.net!not-for-mail From: "Bryan L. Ford" Newsgroups: bionet.molbio.methds-reagnts Subject: Re: How to seq. a single-primer PCR product Date: Mon, 06 Jul 1998 11:12:35 -0700 Organization: Marine/Freshwater Biomedical Sciences Center, Oregon State University, Corvallis OR 97331-6603 Lines: 26 Message-ID: <35A11393.5191@bcc.orst.edu> References: <6ngaln$sda@catapult.gatech.edu> Reply-To: fordb@bcc.orst.edu NNTP-Posting-Host: loveland-228-f.fst.orst.edu Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 3.04Gold (WinNT; I) To: Brian Sydnor Burnes Brian Sydnor Burnes wrote: > I have PCR products generated from inverse PCR > primed off the inverted repeats of a Tn5 insertion. Only one primer was > used, so the ends of the products are inverted repeats like the > transposon. How can I directly sequence these products without getting > overlapping forward and reverse reads? Sequence an asymetric digest? > Ligate (blunt) into a sequencing vector? Brian: You are on the right track. I would either T-A clone and sequence with vector-specific primers. Or you could digest by trial-and-error until you found an RE that cuts once in a fairly medial location and then proceed to sequence the gel-isolated fragments with your single primer. Check your inverted repeats to make certain they can/do not act as sequencing primers themselves-- if they do then cycle sequence without a primer (high cycle numbers) after the digest and isolation. (You probably know that one suggestion you received will not work: You will not be able to resolve the two ends with fluorescently differentiated but otherwise identical primers-- since there is nothing to discriminate one side from the other, both labels will prime from both ends.) -Bryan From owner-methds-reagnts@net.bio.net Mon Jul 06 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!netnews.com!feed2.news.erols.com!erols!news.ultranet.com!bigboote.WPI.EDU!bert.WPI.EDU!jbagshaw From: "Joseph C. Bagshaw" Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Southern problems Date: Tue, 7 Jul 1998 17:27:17 -0400 Organization: Worcester Polytechnic Institute Lines: 52 Message-ID: References: <6njk1o$eok$1@nnrp1.dejanews.com> NNTP-Posting-Host: bert.wpi.edu Mime-Version: 1.0 Content-Type: TEXT/PLAIN; charset=US-ASCII In-Reply-To: <6njk1o$eok$1@nnrp1.dejanews.com> You might try substituting the primers used to PCR the fragment for the random primers. However, it sounds like your fighting the never-ending battle for truth, justice, and low-copy-number signals. With a whole-plasmid probe, every band in Brl's ladder will light up like gangbusters. I routinely cut the marker lane off even before blotting, although this will not cure your sensitivity problem except that you can leave the blot on the film for a long exposure. You might also try a biotin-labelled probe; they really are more sensitive IF you use the right kit. (Oops, did I just start another kit flame war?) ******************** HAVE GENES, WILL TRAVEL ******************** Joe Bagshaw, Worcester Polytechnic Institute jbagshaw@wpi.edu Roadkill on the information superhighway. On Fri, 3 Jul 1998 sarah_petersen@yahoo.com wrote: > I'd like some advice: > > I'm trying to detect a low-copy number sequence in a genomic DNA Southern. > The genome size is ~100Mb, and I've loaded 7-10 micrograms of RE-digested DNA > per lane on nylon. The probe is a cloned fragment ~300bp long which I have > prepared by PCR-ing the fragment out of its vector (using fragment-specific, > not vector-specific, primers), ppting with EtOH, resuspending in HOH, and > random primed labeling with 32P (using B-M High Prime) - used about 50-100ng > for labeling. I filtered the probe through a G-50 gravity column, and hybed > O/N in a 7% SDS phosphate buffer. The probe (eluted from the G-50 column) was > in about 1/2 ml of TE, and was added to 3 mls of the hyb. solution (hyb in > roller bottle). The membrane was about 5X10 CM (5 lanes). Hybed O/N at 60C, > washed 2X5 min at RT, 2XSSPE, 0.1%SDS, 3X5 min at 60C, 1XSSPE, 0.1%SDS. On > film at -80 with intensifying screen O/N. Before putting the blot to film, I > had to cut off the two marker lanes (BRL 1Kb+) because the signal was too hot > there. I left one of the cut-out lanes on the film (away from the genomic > blot). > > Results? The genomic part of the film was blank. Little noise, no signal. The > cut-off marker lane showed *every* band. I guess I overloaded it but didn't > think I'd have enough vector stuff labeled to show it up that brightly (it is > vector bits that light that up, isn't it?) > > Anyway, I'm thinking that 300bp must be marginal for random-primed labeling > and that I'd be better off end-labeling, or treating the random-primed probe > as an oligo and lowering the hyb. temp to 50 or so. But perhaps I'm missing > something fundamental here? > > Thanks for any suggestions, especially the *good* ones :-) > > -----== Posted via Deja News, The Leader in Internet Discussion ==----- > http://www.dejanews.com/rg_mkgrp.xp Create Your Own Free Member Forum > > From owner-methds-reagnts@net.bio.net Mon Jul 06 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!news.bbnplanet.com!newsfeed.wli.net!newsfeed.sgi.net!nntp.itis.com!news.doit.wisc.edu!svetlov From: svetlov@oncology.wisc.edu (Vladimir Svetlov) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Cheaper alternative to Centrisep Spincolumns? Date: Tue, 07 Jul 1998 17:22:09 -0600 Organization: Burgess' Holy Church of Protein Refolding Lines: 24 Sender: reguser@144.92.82.32 Message-ID: References: <359D63EF.2475@bccancer.bc.ca> NNTP-Posting-Host: 144.92.82.32 Mime-Version: 1.0 Content-Type: text/plain; charset=ISO-8859-1 Content-Transfer-Encoding: 8bit X-Newsreader: Yet Another NewsWatcher 2.4.0 In article <359D63EF.2475@bccancer.bc.ca>, pkowalsk@bccancer.bc.ca wrote: > we've found a very significant cost involved in fluorescent sequencing > is the Princeton Seperations CentriSep spincolumns for purifying the > PerkinElmer BigDye reactions prior to loading on the ABI. Currently they > cost us a bit over $350CDN/100 tubes. We've tried using Biorad G50 > spincols (much cheaper) but they don't work well. Does anyone have > suggestions for a cheaper alternative? Pharmacia AutoSeq G-50 spin columns work very well and they come pre-hydrated. In our heck of the woods they are ~twice as cheap as Princeton. Pretty much everybody, including on-site sequencers, switched to the AutoSeq. Regards, V. -- Vladimir Svetlov, Ph. D. McArdle Lab for Cancer Research UW-Madison 1400 University Ave. Madison, WI 53705 From owner-methds-reagnts@net.bio.net Mon Jul 06 23:00:00 1998 Path: biosci!agate!howland.erols.net!woodstock.news.demon.net!demon!news.demon.co.uk!demon!cammol1.demon.co.uk!NewsWatcher!user From: see_sig@cmtech.co.delete.uk (Richard P. Grant) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: resuspending high molecular weight genomic DNA: a problem? Date: Tue, 07 Jul 1998 08:19:20 +0100 Organization: Cambridge Molecular Distribution: world Message-ID: References: <3B675D1AC3E1D111BC1600805FEACC6701FB55@lauimls05.qc.dfo.ca> NNTP-Posting-Host: cammol1.demon.co.uk X-NNTP-Posting-Host: cammol1.demon.co.uk:212.228.79.177 X-Trace: news.demon.co.uk 899796062 nnrp-04:29304 NO-IDENT cammol1.demon.co.uk:212.228.79.177 X-Complaints-To: abuse@demon.net Lines: 41 Basically, if it dissolves in seconds it's RNA. Having said that, you will get some genomic DNA going into solution in about 30 minutes at RT without assistance. Of course if you /want/ to shear the DNA then it will go a lot more quickly. :-) We use a rapid method for preparation from blood that does /not/ use phenol/chloroform, the final step is an isopropanol ppt followed by a EtOH wash. It's then dried to give an almost completely clear pellet (half hour ish). Add water/TE and sit on bench for 10 - 20 minutes. Gentle pipet up and down and transfer to eppendorf. After 30 minutes there's enough DNA in solution to do PCR. If you want to be sure that everything has dissolved, then leave it a couple of days in the cold room. I guess that it is conceivable that our method leaves behind some protein which may aid solubilization, whereas the phenol/chloroform method completely removes protein and makes the DNA more difficult to resuspend. Something to do with ion balance. In article <3B675D1AC3E1D111BC1600805FEACC6701FB55@lauimls05.qc.dfo.ca>, ParentE@dfo-mpo.gc.ca ("Parent, Eric") wrote: : Hello all. : : I ha a simple question. I got in an argument (kind of) with a visiting : scientist in our lab. He was telling me that is genomic DNA use to disolve : in seconds. My experience is that genomic always take some time to : dissolve(up to some days). Anybody had any experience with fast respension : of genomic DNA. Does the quality of the phenol or the chloroform can make : the difference? -- Richard P. Grant MA DPhil | rgrant at cmtech.co.uk Senior R&D Scientist | work: http://www.cmtech.co.uk/ Cambridge Molecular | home: http://www.avnet.co.uk/adastra -- Standard corporate disclaimers apply -- From owner-methds-reagnts@net.bio.net Mon Jul 06 23:00:00 1998 Path: biosci!XTRA.CO.NZ!jdong From: jdong@XTRA.CO.NZ Newsgroups: bionet.molbio.methds-reagnts Subject: Absolutely a Great Email Business/150K per Year'' Date: 7 Jul 1998 00:22:11 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 16 Sender: daemon@net.bio.net Distribution: world Message-ID: <199807070722.AAA02626@net.bio.net> NNTP-Posting-Host: net.bio.net It will only take a minute Go to this site: http://www.global-pacific.co.nz/newsletter/TPOL-index.htm You must include the 4 digit number to order! 7478 From owner-methds-reagnts@net.bio.net Mon Jul 06 23:00:00 1998 Message-ID: <35A1C7F3.8EF80ACD@chclu.chemie.uni-konstanz.de> Date: Tue, 07 Jul 1998 09:02:11 +0200 From: "Frank O. Fackelmayer" Reply-To: fof1@chclu.chemie.uni-konstanz.de X-Mailer: Mozilla 4.04 (Macintosh; I; PPC) MIME-Version: 1.0 Newsgroups: bionet.molbio.methds-reagnts Subject: Re: BL21(DE3)pLys and chloramphenicol References: Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit NNTP-Posting-Host: 134.34.126.40 X-Trace: 7 Jul 1998 09:01:00 +0100, 134.34.126.40 Organization: University of Constance, Germany Lines: 18 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!howland.erols.net!frankfurt.de.uu.net!news.uni-stuttgart.de!news.belwue.de!news.uni-konstanz.de!134.34.126.40 No. Chloramphenicol resistance is on the pLys plasmid, and has nothing to do with expression levels of your protein. You can easily leave it out of the culture medium for expression, without the risk of losing pLys. It is a good idea, though, to have chloramphenicol in the medium you use for growing bacteria before transformation, so you can be sure all bacteria have the pLys plasmid. AKi Hoji wrote: > > Dear, > > Is the presence of chloramphenicol absolutely essential druing growth of > BL21(DE3)pLys for induction of a target protein ? I have two kinds of > mixed opinions. > > -- > Aki Hoji (akhst7+@pitt.edu) > Dept. Infectious Diseases & Microbiology > University of Pittsburgh From owner-methds-reagnts@net.bio.net Mon Jul 06 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!sunqbc.risq.qc.ca!news.mcgill.ca!pawelek From: pawelek@arlo.medcor.mcgill.ca (Peter D. Pawelek) Newsgroups: bionet.molbio.methds-reagnts Subject: proR-[2H]-NADPH Any Commercial Sources? Date: 7 Jul 1998 21:43:03 GMT Organization: McGill Lines: 12 Message-ID: Reply-To: pawelek@arlo.medcor.mcgill.ca NNTP-Posting-Host: arlo.medcor.mcgill.ca X-Newsreader: slrn (0.9.5.2 UNIX) I'm looking for a commercial vendor of proR-[2H]-NADPH (or proR-NADPD, if you will). Does anyone know of a supplier? I've tried places like Cambridge Isotope Laboratories, but to no avail. Thanks in advance. Peter Pawelek (pawelek@arlo.medcor.mcgill.ca) From owner-methds-reagnts@net.bio.net Mon Jul 06 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!news.bbnplanet.com!xfer.kren.ne.kr!xfer.kren.nm.kr!news.maxwell.syr.edu!nntp2.dejanews.com!nnrp1.dejanews.com!not-for-mail From: stebby@welchlink.welch.jhu.edu Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Pittsburgh: Great Science. Quality of Life? Date: Tue, 07 Jul 1998 20:39:41 GMT Organization: Deja News - The Leader in Internet Discussion Lines: 58 Message-ID: <6nu12d$5ju$1@nnrp1.dejanews.com> References: <1998070121335000.RAA20977@ladder03.news.aol.com> NNTP-Posting-Host: 128.220.79.153 X-Article-Creation-Date: Tue Jul 07 20:39:41 1998 GMT X-Http-User-Agent: Mozilla/2.0 (Macintosh; I; 68K) In article , scorey+@PITT.EDU (seth corey) wrote: > > This is not really the venue to comment on cities, Why not? You're the one who gave the plug for Pittsburgh. I've actually been enjoying this thread. How often do you see a commercial followed by a rebuttal? Personally, I liked Pittsburgh when I dropped by one week to visit a friend at Carnegie Mellon and a buddy who worked on the production staff of Mr Roger's Neighborhood (no joke). However, I did not get a feel for public transportation, neighborhoods, etc. and that's a reasonable thing for a post-doc to want to know. Why sugar coat and risk things turning out to be less than advertised? If someone's got a different opinion...bring it on! The beauty of working at Johns Hopkins is that you *can't* sugar coat Baltimore ;o) The biggest annoyance I experienced during my visit to Pittsburgh was that every time we wanted to get somewhere, we were always on the *other* side of a river and we had travel to a bridge and cut backwards...no big deal for a visitor, but maybe that grates after a while. > my apt and my car loan was still less than what i paid for apt rent > in newton or brookline. Jeez, I'd hope so! When I was a post-doc I paid over $600.00/month for one bed-room apartments in Watertown and Cambridge. Worse yet, these were considered good deals. Brookline and Newton??? If they were nice I'm guessing you were $100.00 over me, no? When I moved to Baltimore my rent dropped $200.00/mo. for a comparable space. Someone other than Seth wrote: > >And Pgh is one town where a fat guy without a tan can take his shirt > >off and feel right at home! Well now we're talking quality of life! As I continue to work on developing my belly roll this is becoming more and more important! Seriously, a potential post-doc in an academic setting has already accepted the fact that after 4--7 years of graduate training they will now be rewarded with a salary below or equal to that of a technician and frequently without the benefits. There is nothing wrong with considering the quality of one's life during this time. As I tell those looking at our lab or any other...consider the science, the reputation of the lab, the interactions between people in the lab/department and the city in which you'll live. The weightings one gives these components depends on personal goals and needs. There is no shame in choosing a post-doc based on cost of living, amenable surroundings, or lifestyle decisions. Regards, Steve Dahl -----== Posted via Deja News, The Leader in Internet Discussion ==----- http://www.dejanews.com/rg_mkgrp.xp Create Your Own Free Member Forum From owner-methds-reagnts@net.bio.net Mon Jul 06 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!newsfeed.atl.bellsouth.net!news.acsu.buffalo.edu!srv1.drenet.dnd.ca!crc-news.crc.ca!nott!uottawa!P5.uottawa.ca!junwu From: Jun Wu Newsgroups: bionet.molbio.methds-reagnts Subject: cell lysates-help please Date: Tue, 7 Jul 1998 15:45:06 -0700 Organization: University d'/of Ottawa Lines: 6 Message-ID: References: <1998070604444300.AAA06462@ladder01.news.aol.com> NNTP-Posting-Host: 137.122.233.13 Mime-Version: 1.0 Content-Type: TEXT/PLAIN; charset=US-ASCII In-Reply-To: <1998070604444300.AAA06462@ladder01.news.aol.com> X-X-Sender: junwu@cliff.uottawa.ca Does anyone out there know how to make C2C12 cell lysates for in vitro translation, e.g. what lysis buffer to use? Your help is greatly appreciated. Jun From owner-methds-reagnts@net.bio.net Mon Jul 06 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!news.maxwell.syr.edu!firehose.mindspring.net!cssun.mathcs.emory.edu!cronkite.cc.uga.edu!cronkite.cc.uga.edu From: Jenn Brofft Newsgroups: bionet.molbio.methds-reagnts Subject: blunt end cloning into lambda Date: Tue, 07 Jul 1998 13:18:09 -0500 Organization: The University of Georgia Lines: 10 Message-ID: <35A2665F.91D637B8@uga.cc.uga.edu> Reply-To: jbrofft@uga.cc.uga.edu NNTP-Posting-Host: megalarry.mib.uga.edu Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii; x-mac-type="54455854"; x-mac-creator="4D4F5353" Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 4.05 (Macintosh; I; PPC) Has anyone out there sucessfully blunt end cloned into lambda? If so, any hints as to reaction conditions, ligase type, molar ratios of insert/vector, etc.. would be greatly appreaciated. I've been working Stratagene's Lambda Zap II express which has a unique SmaI site. Thank you - Jenn Brofft jebrofft@arches.uga.edu From owner-methds-reagnts@net.bio.net Mon Jul 06 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!feeder.qis.net!newshub.northeast.verio.net!news3.cac.psu.edu!news.tc.cornell.edu!newsstand.cit.cornell.edu!syntom.plbr.cornell.edu!user From: alm13@cornell.edu (Andreas Matern) Newsgroups: bionet.molbio.methds-reagnts Subject: Ginko biloba DNA extraction Date: Tue, 07 Jul 1998 12:00:05 -0400 Organization: Cornell University Lines: 15 Sender: alm13@cornell.edu (Verified) Message-ID: NNTP-Posting-Host: syntom.plbr.cornell.edu Does anyone have any experience extracting DNA from Ginko biloba? Will a basic CTAB extraction protocol work? Sincerely, -- Andreas Matern alm13@cornell.edu 266 Emerson Hall Dept of Plant Breeding and Biometry Cornell University Ithaca, NY 14853 http://www.people.cornell.edu/pages/alm13/ From owner-methds-reagnts@net.bio.net Mon Jul 06 23:00:00 1998 Path: biosci!news.Stanford.EDU!logbridge.uoregon.edu!europa.clark.net!198.138.0.5!newshub.northeast.verio.net!news3.cac.psu.edu!news.tc.cornell.edu!newsstand.cit.cornell.edu!syntom.plbr.cornell.edu!user From: alm13@cornell.edu (Andreas Matern) Newsgroups: bionet.molbio.methds-reagnts Subject: Ginko biloba DNA extraction Date: Tue, 07 Jul 1998 11:55:48 -0400 Organization: Cornell University Lines: 15 Sender: alm13@cornell.edu (Verified) Message-ID: NNTP-Posting-Host: syntom.plbr.cornell.edu Does anyone have any experience extracting DNA from Ginko biloba? Will a basic CTAB extraction protocol work? Sincerely, -- Andreas Matern alm13@cornell.edu 266 Emerson Hall Dept of Plant Breeding and Biometry Cornell University Ithaca, NY 14853 http://www.people.cornell.edu/pages/alm13/ From owner-methds-reagnts@net.bio.net Mon Jul 06 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!news.bbnplanet.com!newsfeed.direct.ca!news.maxwell.syr.edu!nntp2.dejanews.com!nnrp1.dejanews.com!not-for-mail From: rdudley@aherf.edu Newsgroups: bionet.molbio.methds-reagnts Subject: Re: problem with NA45 DEAE Cellulose membrane Date: Tue, 07 Jul 1998 14:21:02 GMT Organization: Deja News - The Leader in Internet Discussion Lines: 17 Message-ID: <6ntase$1qs$1@nnrp1.dejanews.com> References: <199807061530.JAA47408@nestor.NMSU.Edu> NNTP-Posting-Host: 199.234.107.24 X-Article-Creation-Date: Tue Jul 07 14:21:02 1998 GMT X-Http-User-Agent: Mozilla/4.03 [en] (WinNT; I) In article <199807061530.JAA47408@nestor.NMSU.Edu>, hroychow@NMSU.EDU (Hiranya Roychowdhury) wrote: > > At 12:29 PM 7/6/98 GMT, Gael Le Pennec wrote: > >I get some problems to eluate DNA insert from NA 45 DEAE cellulaose > >membrane. Does anybody get such trouble. > > > > I have never had a problem with NA-45 membrane following the protocol on S&S's web site (www.s-and-s.com). How many bp is your fragment? rich rdudley@aherf.edu -----== Posted via Deja News, The Leader in Internet Discussion ==----- http://www.dejanews.com/rg_mkgrp.xp Create Your Own Free Member Forum From owner-methds-reagnts@net.bio.net Mon Jul 06 23:00:00 1998 Path: biosci!agate!howland.erols.net!netnews.com!news.maxwell.syr.edu!nntp.news.xara.net!xara.net!server5.netnews.ja.net!server3.netnews.ja.net!willow.cc.kcl.ac.uk!cdolphin.pcy.kcl.ac.uk!colin.dolphin From: Colin Dolphin Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Bac-to-Bac system Date: 7 Jul 1998 14:19:13 GMT Organization: King's College London Lines: 23 Distribution: world Message-ID: <6ntap1$410$1@willow.cc.kcl.ac.uk> References: <359C9B08.98BF295C@uni-muenster.de> NNTP-Posting-Host: cdolphin.pcy.kcl.ac.uk Mime-Version: 1.0 Content-Type: text/plain; charset=ISO-8859-1 Content-Transfer-Encoding: 8bit X-Newsreader: Nuntius 2.0.4_PPC X-XXMessage-ID: X-XXDate: Tue, 7 Jul 1998 15:23:06 GMT In article <359C9B08.98BF295C@uni-muenster.de> Andreas Vogel, vogela@uni-muenster.de writes: >Subject: Bac-to-Bac system >From: Andreas Vogel, vogela@uni-muenster.de >Date: Fri, 03 Jul 1998 10:49:12 +0200 >>Hi all, > >I am going to start with baculovirus expression and decided to use the >Bac-to-Bac system from life technologies. They say you dont have to >waste your time with plaque purification because you can generate 100 >percent recombinant virus DNA. >But, are there really no difficulties with this system? Does anyone have >experience with it? > >Thanks in advance for your help, >Andreas Has worked very well for me. The most disficult thing, which is common to all baculo systems, was getting a relaible plaque assay sorted, otherwisw it seems very good although their transfer vector range is at present a little limited. Colin From owner-methds-reagnts@net.bio.net Mon Jul 06 23:00:00 1998 Message-ID: <35A229B4.18B3B8A3@chclu.chemie.uni-konstanz.de> Date: Tue, 07 Jul 1998 15:59:08 +0200 From: "Frank O. Fackelmayer" Reply-To: fof1@chclu.chemie.uni-konstanz.de X-Mailer: Mozilla 4.04 (Macintosh; I; PPC) MIME-Version: 1.0 Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Desalting of Plasmid DNA after Cesium Preps References: <6nt0me$gof@singer.cent.gla.ac.uk> Content-Type: text/plain; charset=iso-8859-1 Content-Transfer-Encoding: 8bit NNTP-Posting-Host: 134.34.126.40 X-Trace: 7 Jul 1998 15:58:05 +0100, 134.34.126.40 Organization: University of Constance, Germany Lines: 48 Path: biosci!news.Stanford.EDU!newsfeed.concentric.net!netnews.com!europa.clark.net!194.162.162.196!newsfeed.nacamar.de!fu-berlin.de!news.uni-stuttgart.de!news.belwue.de!news.uni-konstanz.de!134.34.126.40 Hi Obaid, We do it in the following way: 1. extract EtBr with CsCl-saturated isopropanol (4 extractions with equal volume) 2. then extract 3 times with NaCl-saturated isopropanol. Very vigorous mixing is required. 3. determine volume of DNA solution. 4. add 3 volumes of water 5. precipitate DNA by adding ethanol (room temperature). 2.5 volumes (taking the volume after step 4 as reference) of ethanol is sufficient. example: 1ml of DNA solution, add 3ml of water. Then add 2.5x4ml=10ml of ethanol. 6. let stand at room temperature for 30min 7. recover DNA by centrifugation (15min, 10000g) 8. allow DNA pellet to air-dry 9. dissolve in TE If you see CsCl precipitating after ethanol addition (white precipitate), extraction with NaCl-saturated isopropanol was not vigorously enough. Don´t panic. Centrifuge as in step 7, discard supernatant, dissolve pellet (do not dry before) in 3ml of TE, and perform a "normal" ethanol precipitation. Hope this helps, Frank Obaid Yusuf Khan wrote: > > Hi, > > Does anyone know about a method to remove Cesium from the plasmid DNA > after a Cesium Chloride-Ethidium Bromide density centrifugation. I have been > using dialysis for desalting but its time comsuming. I have also used Centricon > columns, but they can only take upto 500 mcg of DNA and you usually get over a > mg of DNA in cesium preps. I have also used ethanol ppt method, but I tend to > loose a lot of DNA this way. > > I will appreciate any help/tips for desalting the plasmid DNA, which consumes > less time and does not damage the supercoiled structure of DNA. > > Thanks very much > > Obaid Khan From owner-methds-reagnts@net.bio.net Mon Jul 06 23:00:00 1998 Path: biosci!agate!howland.erols.net!sunqbc.risq.qc.ca!carnaval.risq.qc.ca!not-for-mail Newsgroups: bionet.molbio.methds-reagnts From: Mounir Izallalen Sender: mounir@eukaryota Subject: Re: hybridization to HindIII lambda In-Reply-To: Message-ID: References: MIME-Version: 1.0 Content-Type: TEXT/PLAIN; charset=US-ASCII Lines: 47 Date: Tue, 07 Jul 1998 13:52:41 GMT NNTP-Posting-Host: 132.203.160.3 NNTP-Posting-Date: Tue, 07 Jul 1998 09:52:41 EDT Check the stringency washing steps On Mon, 6 Jul 1998, Marc Crepeau wrote: > In the lab next door an attempt to probe a Southern blot resulted in very > dark bands corresponding to the HindIII lambda fragments used for > molecular weight markers, but only very faint bands in the lanes > containing Drosophila genomic DNA. Such hybidization to lambda DNA markers > on Southern blots seems to be pretty common. I've seen it in my own work > with probes made from lambda clones, and wasn't surprised. But this probe > was made by random priming of a plasmid clone (the whole plasmid, not just > the insert). Is there some highly homologous sequence between lambda phage > DNA and E. coli plasmids? The bands were dark enough to suggest that it > was fairly specific hybridization, especially considering that almost no > signal was visible in the lanes with genemic DNA even though the student > loaded a microgram of DNA in each lane. On the other hand, all seven > lambda fragments lit up, whereas I would think a homologous vector > sequence would only hybidize selectively to one or two of the lambda > fragments. > Any ideas? > > > > > Marc Crepeau > > > . .-. .-. .-. .-. .-. .-. .-. .-. .-. .-. .-. .-. .-. .- |\ /|||X|||\ /|||X|||\ /|||X|||\ /|||X|||\ /|||X|||\ /|||X|||\ /|||X|| ||X|||/ \|||X|||/ \|||X|||/ \|||X|||/ \|||X|||/ \|||X|||/ \|||X|||/ \| -' `-' `-' `-' `-' `-' `-' `-' `-' `-' `-' `-' `-' `-' ` Mounir Izallalen Recherche en Sciences de la Vie et de la Sante Pavillon C.E. Marchand, Laboratoire 1133 Universite laval, Ste-Foy, PQ G1K 7P4 Canada Tel (418) 656-2131 ext#6785 Fax (418) 656-7176 . .-. .-. .-. .-. .-. .-. .-. .-. .-. .-. .-. .-. .-. .- |\ /|||X|||\ /|||X|||\ /|||X|||\ /|||X|||\ /|||X|||\ /|||X|||\ /|||X|| ||X|||/ \|||X|||/ \|||X|||/ \|||X|||/ \|||X|||/ \|||X|||/ \|||X|||/ \| -' `-' `-' `-' `-' `-' `-' `-' `-' `-' `-' `-' `-' `-' ` From owner-methds-reagnts@net.bio.net Mon Jul 06 23:00:00 1998 Path: biosci!news.Stanford.EDU!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!howland.erols.net!newsfeed1.telenordia.se!newsfeed.sunet.se!news01.sunet.se!news99.sunet.se!news.lth.se!merkurius.lu.se!svinbadan.medkem.lu.se!Juan_Antonio.Contreras From: Juan Antonio Newsgroups: bionet.molbio.methds-reagnts Subject: EGFP microscopy Date: 7 Jul 1998 13:04:21 GMT Organization: Lund University Lines: 15 Distribution: world Message-ID: <6nt6cl$p9b$1@merkurius.lu.se> NNTP-Posting-Host: svinbadan.medkem.lu.se Mime-Version: 1.0 Content-Type: text/plain; charset=ISO-8859-1 Content-Transfer-Encoding: 8bit X-Newsreader: Nuntius 2.0.4_PPC X-XXMessage-ID: X-XXDate: Tue, 7 Jul 1998 14:08:24 GMT Hi! I am just starting to use EGFP (from Clontech) and would like to ask if somebody out there has a good suggestion for mounting and (specially) sealing medium for coverslips . The Clontech "handbook" suggests molten agarose for sealing the coverslips....but I just hate it! (difficult to handle, samples dry whithin a few hours,...). A suggested alternative is "rubber cement", but I have not been able to find a supplier in Sweden. Does anybody know where to purchase it in Europe? I imagine that there has been some discussion about these matters in the past, but I just started now to use Nuntius. If any of you has a copy of previous threads about GFP and microscopy, please send them to me. Thanks From owner-methds-reagnts@net.bio.net Mon Jul 06 23:00:00 1998 Path: biosci!agate!newsfeed.wli.net!uunet!in4.uu.net!hearst.acc.Virginia.EDU!murdoch.acc.Virginia.EDU!not-for-mail From: "R. John Lye" Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Transfer Apparatus Date: Tue, 07 Jul 1998 08:24:44 -0700 Organization: Univ. of Virginia Health Sciences Center Lines: 13 Message-ID: <35A23DBC.3607@Virginia.edu> References: <359B2F86.6949D90C@ecc.ubc.ca> Reply-To: rjl6n@virginia.edu NNTP-Posting-Host: bootp-17-100.bootp.virginia.edu Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 3.01 (Win16; U) To: Luke Bu Luke Bu wrote: > > We want to buy a transfer apparatus for Western blot. Anybody out there > have any suggestions ? I really l