From owner-methds-reagnts@net.bio.net Sat Aug 01 23:00:00 1998 Path: biosci!news.stanford.edu!logbridge.uoregon.edu!news-peer.gip.net!news.gsl.net!gip.net!news-peer.sprintlink.net!news-backup-west.sprintlink.net!news.sprintlink.net!192.220.250.21!netnews1.nw.verio.net!netnews.nwnet.net!reuter.cse.ogi.edu!news.nero.net!not-for-mail From: "Bryan L. Ford" Newsgroups: bionet.molbio.methds-reagnts Subject: Re: While we're on Acrylamide.... Date: Sun, 02 Aug 1998 15:12:26 -0700 Organization: Marine/Freshwater Biomedical Sciences Center, Oregon State University, Corvallis OR 97331-6603 Lines: 43 Message-ID: <35C4E44A.2C43@bcc.orst.edu> References: <6q0r1j$32e$1@nnrp1.dejanews.com> Reply-To: fordb@bcc.orst.edu NNTP-Posting-Host: loveland-228-f.fst.orst.edu Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 3.04Gold (WinNT; I) To: Peter Peter wrote: > > In article <6q0r1j$32e$1@nnrp1.dejanews.com>, weazel@blarg.net wrote: > > > Any of you chemistry-saavy types know what sort of nastiness one is exposedt > > to from BURNING acrylamide? Say....when your gel box arcs and catches on > > fire? Not that this has ever happened to me, of course (heh heh!) > > > > An arc would not be sufficent to cause the acryilamide to burn because > Arylamide is not flamable by nature. But if you placed the gel in a bomb > calorimeter and ignited it, you would find CO, CO2, and CN. > The original question says acrylamide, but of course most if not all of a mature gel will be polyacrylamide. Even if polyacrylamide were flammable, it would be very hard to openly ignite a polyacrylamide gel containing 90 to 95% water. But, if we were really talking about the monomer, then consider that the heating of unpolymerized acrylamide solid to its melting point leads to rapid, and if the quantity involved is larger, to explosive polymerization. This is perhaps another argument for using the, available and actually less costly, pre-prepared 40% acrylamide/bis-acrylamide solutions, for example from Amresco-- (no connection to me)-- and store in the fridge after opening. A lab fire is bad enough without extra explosions. The bomb calorimetry seems a bit incomplete here. CO (carbon monoxide, often a fuel of industrial origin and use) will readily burn to CO2 in the calorimeter. CN or C2N2 (cyanogen) "burns with a pink flame" according to the Merck Index, the complete combustion products of which I would guess to be CO2 again and one or another nitrogen oxide such as NO or NO2. If by chance the accidental burning of polyacrylamide led to the evolution of CN or HCN then the questioner should be concerned. But a good fire (supplying the oxygen and heat of activation) would likely leave little free CN... cyanogen and oxygen produce one of the hottest flames known-- well above oxyacetylene or oxyhydrogen torches in temperature. Of course the toxicity of CN (similar to cyanide) keeps it even from consideration as a practical flame, anyway these days there are much better ways to heat stuff way hot! Bryan Ford (chemistry afficionado) From owner-methds-reagnts@net.bio.net Sat Aug 01 23:00:00 1998 Path: biosci!CMGM.STANFORD.EDU!schneema From: schneema@CMGM.STANFORD.EDU (Markus Schneemann) Newsgroups: bionet.molbio.methds-reagnts Subject: restriction enzymes Date: 2 Aug 1998 17:57:03 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 19 Sender: daemon@net.bio.net Distribution: world Message-ID: NNTP-Posting-Host: net.bio.net Hi all: I'm looking for a restriction enzyme that cuts human (eukaryotic) genomic DNA into smaller pieces than it does with bacterial (gram + actinomyces, GC-rich) chromosomal DNA. The purpose is to generate a bacterial chromosomal library from intracellularly grown bacteria (grown inside human macrophages) and to get rid of the human genomic DNA that may contaminate the bacterial DNA. If the human DNApieces are considerably smaller (let's say, below 10-15kb) than the bacterial ones (>25kb) the packaging of cosmids (Stratagene SuperCos) should exclude any DNA below 20kb (so they promise...). Does anybody know of such a restriction enzyme ? Or of a easily to deactivate DNAse ? Cheers, Markus schneema@cmgm.stanford.edu From owner-methds-reagnts@net.bio.net Sat Aug 01 23:00:00 1998 Message-ID: <35C4E0BA.1D5E@waite.adelaide.edu.au> Date: Sun, 02 Aug 1998 21:57:14 +0000 From: Greg Nattrass Organization: University of Adelaide X-Mailer: Mozilla 3.01 (Macintosh; I; 68K) MIME-Version: 1.0 Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Acrylamide with coffee... References: <9807309017.AA901778204@smtpgwy.agric.nsw.gov.au> <*-3007982152570001@j.keeling.sbs.auckland.ac.nz> Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit NNTP-Posting-Host: mc-ger3.waite.adelaide.edu.au Lines: 7 Path: biosci!news.stanford.edu!newsfeed.berkeley.edu!nntp-out.monmouth.com!newspeer.monmouth.com!intgwpad.nntp.telstra.net!nsw.nntp.telstra.net!news1.optus.net.au!yorrell.saard.net!hakea.services.adelaide.edu.au!mc-ger3.waite.adelaide.edu.au Yeah I remember one of the PhD students pinning this article up in the lab a few years ago. It would have been around 1994 when it occurred. The guy was a professor and he was poisoned by a disgruntled lover who worked in his lab. I'm not sure how she got the acrylamide into his coffee but I do remember that he ended up blind after the incident. Greg Nattrass From owner-methds-reagnts@net.bio.net Sat Aug 01 23:00:00 1998 Path: biosci!pravda.ucr.edu!ihnp4.ucsd.edu!news.scripps.edu!kunitake From: kunitake@salk.edu (Koichi Kunitake) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Electrophoresis safety question Date: 2 Aug 1998 20:10:16 GMT Organization: The Salk Institute Lines: 24 Distribution: world Message-ID: References: <3586E885.1C1B@chugaibio.com> NNTP-Posting-Host: valelabsm.salk.edu Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Newsreader: MT-NewsWatcher 2.4.4 In article <3586E885.1C1B@chugaibio.com>, dspinella@chugaibio.com, @chugaibio.com wrote: While I have never touched a 100V agarose gel when it was running, we had a guy who worked in the lab who was running a sequencing gel at about 2000V. We of course ran the gel with a metal plate behind it to soak up the heat, but it turns out that the upper reservoir was leaking and it leaked onto the metal plate, which was also contacting the lower reservoir, since the buffer in the lower reservoir was wicked up the back of the plate. Anyway, this guy had his hand on the underside of the lab bench, (which was metal), and he grabbed the metal heat sink. He described it to me as getting a "tremendous blast", and he said his arms were numb for about 10 minutes. Seems like other than that, there were no long-lasting effects, neurological or otherwise, and he's now in grad school, doing fine. seems pretty scary, since the current traveled between both hands, basically right near his heart. So I tend to think that agarose gels at 100V (I actually run them at 150V) are mostly harmless. (Not that I would test this empirically, though) Koichi From owner-methds-reagnts@net.bio.net Sat Aug 01 23:00:00 1998 Path: biosci!news.stanford.edu!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!portc02.blue.aol.com!pitt.edu!not-for-mail From: pxpst2@SPAM.SUXS.unixs.cis.pitt.edu (Peter) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: While we're on Acrylamide.... Date: Sun, 02 Aug 1998 12:19:39 -0500 Organization: University of Pittsburgh Lines: 20 Message-ID: References: <6q0r1j$32e$1@nnrp1.dejanews.com> NNTP-Posting-Host: pelli.pathology.pitt.edu Mail-Copies-To: pxpst2@SPAM.SUXS.unixs.cis.pitt.edu X-Newsreader: MT-NewsWatcher 2.4.4 In article <6q0r1j$32e$1@nnrp1.dejanews.com>, weazel@blarg.net wrote: > Any of you chemistry-saavy types know what sort of nastiness one is exposedt > to from BURNING acrylamide? Say....when your gel box arcs and catches on > fire? Not that this has ever happened to me, of course (heh heh!) > An arc would not be sufficent to cause the acryilamide to burn because Arylamide is not flamable by nature. But if you placed the gel in a bomb calorimeter and ignited it, you would find CO, CO2, and CN. Peter -- "Don't you eat that yellow snow watch out where the Huskies go" FZ --------------------------------------------------------------------- From owner-methds-reagnts@net.bio.net Sat Aug 01 23:00:00 1998 Path: biosci!daresbury!not-for-mail From: "Wolfgang Schechinger" Newsgroups: bionet.molbio.methds-reagnts Subject: Re: oligo secondary strucure program? Date: 2 Aug 1998 13:57:37 +0100 Organization: Med Clinic iV, Dept. of Pathobiochemistry, Lines: 33 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <6q1no1$6ik@mserv1.dl.ac.uk> Reply-To: wgschech@med.uni-tuebingen.de Comments: Authenticated sender is X-Authentication-Warning: drakkar.med.uni-tuebingen.de: smap set sender to using -f X-mailer: Pegasus Mail for Windows (v2.52) MIME-Version: 1.0 In-reply-to: <98731234743.~INN-VNGa00189.bionet-news@dl.ac.uk> Original-To: "Jeffrey A. Cohlberg" , cohlberg@csulb.edu, methods@dl.ac.uk Hello Jeffrey, Would it make sense running the sequence through an RNA folds calculation program? There also a program called oligo.exe. I used it for finding primers. It shows you self hybridization and loop formation. You may download it from these addresses. ftp://ftp.ebi.ac.uk/pub/software/dos/ ftp://ftp.embl-heidelberg.de/ftp.ebi.ac.uk/pub/software/dos/ Maybe the links on PCR primer computing are helpful, too. http://www.med.uni-tuebingen.de/~wgschech/molbio.htm#computing Enjoy! Wolfgang > Is there a web-accessible program to check oligos for secondary > structure? -- Jeffrey A. Cohlberg, Professor Department of Chemistry > and Biochemistry California State University, Long Beach 1250 > Bellflower Blvd. Long Beach, CA 90840 phone (562) 985-4944 fax (562) > 985-8557 > > Dr.Ceol Monica University Tuebingen Med. Clinic. IV Lab. B2/537 email: wgschech@med.uni-tuebingen.de ! please indicate in the subject that the mail is for Dr. Ceol From owner-methds-reagnts@net.bio.net Sat Aug 01 23:00:00 1998 Path: biosci!news.stanford.edu!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!chicago-news-feed2.bbnplanet.com!news.bbnplanet.com!news.itis.com!aiyar.dyn.ml.org!aiyar From: aiyar@aiyar.dyn.ml.org (Ashok Aiyar) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: restriction enzymes Date: 3 Aug 1998 01:48:02 GMT Organization: Sugden Lab, McArdle Laboratory for Cancer Research, UW-Madison Lines: 33 Distribution: world Message-ID: References: Reply-To: aiyar@ebv.oncology.wisc.edu NNTP-Posting-Host: mptc1-cas-22.dial.midplains.net X-Newsreader: slrn (0.9.5.1 UNIX) On 2 Aug 1998 17:57:03 -0700, Markus Schneemann wrote: >I'm looking for a restriction enzyme that cuts human (eukaryotic) >genomic DNA into smaller pieces than it does with bacterial (gram + >actinomyces, GC-rich) chromosomal DNA. >The purpose is to generate a bacterial chromosomal library from >intracellularly grown bacteria (grown inside human macrophages) and to get >rid of the human genomic DNA that may contaminate the bacterial DNA. >If the human DNApieces are considerably smaller (let's say, below 10-15kb) >than the bacterial ones (>25kb) the packaging of cosmids (Stratagene >SuperCos) should exclude any DNA below 20kb (so they promise...). >Does anybody know of such a restriction enzyme ? If the genomic DNA in your bacteria is dam-methylated, then you can digest the total "genomic" DNA preparation with DpnII, a four-cutter that cuts the sequence GATC when it is unmethylated. There is no equivalent to dam-methylase in mammalian cells, and therefore human DNA is cut efficiently by DpnII. In contrast, many eubacteria dam-methylate their genome, and the resultant GAmTC is resistant to DpnII. If the bacterial genomic DNA is indeed methylated, you could first digest exhaustively with DpnII, to cut the contaminating human genomic DNA into fragments far smaller than 10 kb, and then cut the undigested bacterial genomic DNA with the enzyme of your choice to yield fragments that can be packaged into phage heads after ligation with lambda arms. Later, Ashok -- Ashok Aiyar, Ph.D. McArdle Laboratory for Cancer Research aiyar@ebv.oncology.wisc.edu From owner-methds-reagnts@net.bio.net Sat Aug 01 23:00:00 1998 Path: biosci!news.stanford.edu!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!chicago-news-feed1.bbnplanet.com!news.bbnplanet.com!newsfeed.enteract.com!nntp.abs.net!uunet!uunet!in2.uu.net!news.blarg.net!not-for-mail From: weazel@animal.blarg.net (Beth Wapelhorst) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: While we're on Acrylamide.... Date: 2 Aug 1998 19:56:12 -0700 Organization: Blarg! Online Services - 206/441-9109 Lines: 56 Message-ID: <6q38sc$3er$1@animal.blarg.net> References: <6q0r1j$32e$1@nnrp1.dejanews.com> <35C4E44A.2C43@bcc.orst.edu> NNTP-Posting-Host: animal.blarg.net X-Newsreader: NN version 6.5.1 (NOV) In my original post, I forgot to add that this is a denaturing polyacrylamide gel, so there's Urea in there too (and lots of it), also the Tris/Borate/EDTA....just making things more complicated for ya :) beth "Bryan L. Ford" writes: >Peter wrote: >> >> In article <6q0r1j$32e$1@nnrp1.dejanews.com>, weazel@blarg.net wrote: >> >> > Any of you chemistry-saavy types know what sort of nastiness one is exposedt >> > to from BURNING acrylamide? Say....when your gel box arcs and catches on >> > fire? Not that this has ever happened to me, of course (heh heh!) >> > >> >> An arc would not be sufficent to cause the acryilamide to burn because >> Arylamide is not flamable by nature. But if you placed the gel in a bomb >> calorimeter and ignited it, you would find CO, CO2, and CN. >> >The original question says acrylamide, but of course most if not all of >a mature gel will be polyacrylamide. Even if polyacrylamide were >flammable, it would be very hard to openly ignite a polyacrylamide gel >containing 90 to 95% water. But, if we were really talking about the >monomer, then consider that the heating of unpolymerized acrylamide >solid to its melting point leads to rapid, and if the quantity involved >is larger, to explosive polymerization. This is perhaps another argument >for using the, available and actually less costly, pre-prepared 40% >acrylamide/bis-acrylamide solutions, for example from Amresco-- (no >connection to me)-- and store in the fridge after opening. A lab fire is >bad enough without extra explosions. >The bomb calorimetry seems a bit incomplete here. CO (carbon monoxide, >often a fuel of industrial origin and use) will readily burn to CO2 in >the calorimeter. CN or C2N2 (cyanogen) "burns with a pink flame" >according to the Merck Index, the complete combustion products of which >I would guess to be CO2 again and one or another nitrogen oxide such as >NO or NO2. >If by chance the accidental burning of polyacrylamide led to the >evolution of CN or HCN then the questioner should be concerned. But a >good fire (supplying the oxygen and heat of activation) would likely >leave little free CN... cyanogen and oxygen produce one of the hottest >flames known-- well above oxyacetylene or oxyhydrogen torches in >temperature. Of course the toxicity of CN (similar to cyanide) keeps it >even from consideration as a practical flame, anyway these days there >are much better ways to heat stuff way hot! >Bryan Ford (chemistry afficionado) -- sugar beth wapelhorst "I don't think I'm alone when I say I'd weazel@blarg.net like to see more and more planets fall www.blarg.net/~weazel under the ruthless domination of our solar system." - Jack Handey From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!news.stanford.edu!newsfeed.berkeley.edu!newsfeed.enteract.com!chicago-news-feed2.bbnplanet.com!news.bbnplanet.com!news.itis.com!aiyar.dyn.ml.org!aiyar From: aiyar@aiyar.dyn.ml.org (Ashok Aiyar) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: restriction enzymes Date: 3 Aug 1998 14:26:35 GMT Organization: Sugden Lab, McArdle Laboratory for Cancer Research, UW-Madison Lines: 22 Distribution: world Message-ID: References: <6q3uo8$fvl@scotsman.ed.ac.uk> Reply-To: aiyar@ebv.oncology.wisc.edu NNTP-Posting-Host: mptc1-cas-12.dial.midplains.net X-Newsreader: slrn (0.9.5.1 UNIX) On 3 Aug 1998 09:09:28 GMT, Chris Boyd wrote: >Where is your evidence for this assertion? I'd be surprised if >dam-methylation were present in more than a minority of species outside >the Enterobacteriacae. You're right, I don't have evidence that the genomic DNA of most eubacteria is dam-methylated. What I do know is that the DNA of Escherichia coli and Serratia marcescens is methylated, and that dam methylases have been cloned, functionally or by sequence identity (or both), from several other taxa including Serratia, Salmonella, Haemophilus, Moraxella, Methanococcus, Porphyromonas, Streptococcus, Lactococcus, Treponema. and a few others. Some of the taxa that I have listed are enterobacteria (Escherichia, Serratia, Salmonella), but all the others are not, indicating that this enzymatic activity is rather widely distributed among eubacterial species. Cheers, Ashok -- Ashok Aiyar, Ph.D. McArdle Laboratory for Cancer Research aiyar@ebv.oncology.wisc.edu From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!IMM2.IMM.UTH.TMC.EDU!dhavilan From: dhavilan@IMM2.IMM.UTH.TMC.EDU ("David L. Haviland, Ph.D.") Newsgroups: bionet.molbio.methds-reagnts Subject: Re: C3d complement factor !!!! help !!!! Date: 3 Aug 1998 07:35:19 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 28 Sender: daemon@net.bio.net Distribution: world Message-ID: <3.0.32.19980803093129.006d9a88@imm2.imm.uth.tmc.edu> NNTP-Posting-Host: net.bio.net At 10:16 7/31/98 -0400, Rick A. Bright wrote: >The actual sequence has not been published, to my knowledge, but has >been submitted to PDB and is in final review. I have been waiting for >months and the paper came out a month ago on the crystal structure, but >still no published sequence. It is full of repeats, so it must be >complicated. Maybe I'm missing something... what sequence of C3 or C3d... As stated previously, the cDNA was done in '85 by deBruijn. MAbs to Cd3 by Tanuma in 89, and gene structure worked out by Barnum '89 and by Fong in '90. If someone wanted the just the C3d DNA sequence (and translated sequence), its been out for quite some time... Having some history in complement, David ============================= David L. Haviland, Ph.D. Asst. Prof. Immunology University of Texas - Houston, H.S.C. Institute of Molecular Medicine 2121 W. Holcombe Blvd. Houston, TX 77030 Internet:"dhavilan@imm2.imm.uth.tmc.edu" Voice: 713.500.2413 FAX: 713.500.2424 ------------------------------------------------------ Never take life seriously. Nobody gets out alive anyway. ============================= From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Newsgroups: bionet.molbio.methds-reagnts Path: biosci!news.stanford.edu!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!newsfeed.internetmci.com!194.72.7.126!btnet-peer!btnet!demeter.clara.net!news.clara.net!nntp.news.xara.net!xara.net!server5.netnews.ja.net!server3.netnews.ja.net!ucl.ac.uk!bcc.ac.uk!chen From: chen@bsm.bioc.ucl.ac.uk (Chen Ho An) Subject: Re: dicistronic plasmid - help Message-ID: <1998Aug3.135916.72627@ucl.ac.uk> Date: Mon, 3 Aug 1998 13:59:16 GMT References: <6pspj1$ncm@ds2.acs.ucalgary.ca> Organization: University College London X-Newsreader: TIN [version 1.2 PL2] Lines: 23 Jillian Johnston (johnstoj@acs2.acs.ucalgary.ca) wrote: : I have been trying unsuccessfully to make a plasmid that will : express both GFP as a marker and another gene. Both genes are : driven by identical CMV promoters and terminated with identical : SV40 polyA. I know that repeated sequences are difficult to : clone so I am trying to have the genes going in opposite : directions. The plasmid I've been using is pBluesciptSK : (Stratagene) and DH5a for transformations. I get no colonies but : the ligation reaction is working, as seen on a gel. Without : going into all the details, which I am certainly willing to : provide, I was wondering if anyone has any insights into a : solution. Try using just one promoter and put the 2 genes in tandem. See Schoner et al Methods in Enzymology 185, 94-103, Ito & Kurosawa, Gene 118, 87-91. Also see Shen et al, PNAS 90, 8108-8112. Here 3 genes (alpha and beta globins and methionine aminopeptidase) are expressed under control of 2 promoters. There are also many other references you can find. Just do a literature search but there should be enough in the references above to start with. From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!IMM2.IMM.UTH.TMC.EDU!dhavilan From: dhavilan@IMM2.IMM.UTH.TMC.EDU ("David L. Haviland, Ph.D.") Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Q: Can you random prime a 250bp PCR product? Date: 3 Aug 1998 07:48:08 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 26 Sender: daemon@net.bio.net Distribution: world Message-ID: <3.0.32.19980803094423.006e0c00@imm2.imm.uth.tmc.edu> NNTP-Posting-Host: net.bio.net At 03:02 8/1/98 GMT, ELADER@AMBION.COM wrote: >Frank, this really does not work as relaibly as random priming. I know, I am >product manager for such a product.Problem is that the efficiency of priming >is lower since you have only one shot at it. Better yet to label it with Taq, >3 cold, 1 hot dNTP, 1 primer, bunch of cycles, 20 ng template. Curious, unless I read it wrong, this isn't much different that what your colleage originally proposed. Did you mean to use 2 oligos? Then I'd agree one can get a hot probe this way, but one can also get a contaminated machine... for the sake of everyone's sanity, we don't allow radioactive PCRs in our lab as the risk of having but one slob doesn't outweigh the need of a super hot probe. David ============================= David L. Haviland, Ph.D. Asst. Prof. Immunology University of Texas - Houston, H.S.C. Institute of Molecular Medicine 2121 W. Holcombe Blvd. Houston, TX 77030 Internet:"dhavilan@imm2.imm.uth.tmc.edu" Voice: 713.500.2413 FAX: 713.500.2424 ------------------------------------------------------ Never take life seriously. Nobody gets out alive anyway. ============================= From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!news.stanford.edu!logbridge.uoregon.edu!newsfeed1.swip.net!swipnet!masternews.telia.net!news-stkh.gip.net!news-lond.gip.net!news.gsl.net!gip.net!nntp.news.xara.net!xara.net!rill.news.pipex.net!pipex!server1.netnews.ja.net!pegasus.csx.cam.ac.uk!hgmp.mrc.ac.uk!gmorley From: gmorley@hgmp.mrc.ac.uk (Mr. G. Morley) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: acrylamide with coffee Date: 3 Aug 1998 14:02:40 GMT Organization: MRC Human Genome Mapping Project Resource Centre Lines: 14 Message-ID: <6q4fu0$bru$1@niobium.hgmp.mrc.ac.uk> NNTP-Posting-Host: tin.hgmp.mrc.ac.uk >> I remember that incident well, as word of it spread rapidly through the >> scientific community here. I also recall an incident at NIH involving a >> water cooler spiked with 32P. >> >> Antonin Tutter >Aargh! Don't remind me about that. I worked in that building and >the resulting fuss made working with any kind of radioactivity >very difficult for a long time after. > Bernard How on earth did the water cooler get spiked with 32P? and how did anyone find out about it? From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!news.stanford.edu!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!news-peer.gip.net!news-lond.gip.net!news.gsl.net!gip.net!nntp.news.xara.net!xara.net!rill.news.pipex.net!pipex!server1.netnews.ja.net!pegasus.csx.cam.ac.uk!hgmp.mrc.ac.uk!gmorley From: gmorley@hgmp.mrc.ac.uk (Mr. G. Morley) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: acrylamide with coffee Date: 3 Aug 1998 14:02:37 GMT Organization: MRC Human Genome Mapping Project Resource Centre Lines: 14 Message-ID: <6q4ftt$brt$1@niobium.hgmp.mrc.ac.uk> NNTP-Posting-Host: tin.hgmp.mrc.ac.uk >> I remember that incident well, as word of it spread rapidly through the >> scientific community here. I also recall an incident at NIH involving a >> water cooler spiked with 32P. >> >> Antonin Tutter >Aargh! Don't remind me about that. I worked in that building and >the resulting fuss made working with any kind of radioactivity >very difficult for a long time after. > Bernard How on earth did the water cooler get spiked with 32P? and how did anyone find out about it? From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!NOVALON.COM!phamilton From: phamilton@NOVALON.COM (Paul Hamilton) Newsgroups: bionet.molbio.methds-reagnts Subject: degP strain of E. coli Date: 3 Aug 1998 07:13:31 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 9 Sender: daemon@net.bio.net Distribution: world Message-ID: <71CA6653199AD111BFB5006008A39A53D96D@dns.Novalon.com> NNTP-Posting-Host: net.bio.net Hello, I'm trying to get a hold of a strain of E. coli lacking the periplasmic protease degP. I've checked the Coli Genetic Stock Collection (CGSC) at Yale and they don't have one. If anybody knows where I can find this strain, I would appreciate your help. Thanks, Paul Hamilton From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!PGH.AUHS.EDU!RDUDLEY From: RDUDLEY@PGH.AUHS.EDU (Richard Dudley) Newsgroups: bionet.molbio.methds-reagnts Subject: Protection of n-terminus during SDS-PAGE? Date: 3 Aug 1998 07:21:32 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 8 Sender: daemon@net.bio.net Distribution: world Message-ID: NNTP-Posting-Host: net.bio.net I once read somewhere that if you want to sequence proteins after SDS-PAGE, you should use thioglycolic acid during electrophoresis to protect the N-terminus. Has anyone ever tried this, or does anyone have a reference for this? Alternatively, does anyone have soem good advice to offer on protecting the N-terminus? Thanks! rich From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Message-ID: <35C5B66D.2D6D91CF@chclu.chemie.uni-konstanz.de> Date: Mon, 03 Aug 1998 15:09:01 +0200 From: "Frank O. Fackelmayer" Reply-To: fof1@chclu.chemie.uni-konstanz.de X-Mailer: Mozilla 4.04 (Macintosh; I; PPC) MIME-Version: 1.0 Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Blotting onto PVDF References: Content-Type: text/plain; charset=iso-8859-1 Content-Transfer-Encoding: 8bit NNTP-Posting-Host: 134.34.126.40 X-Trace: 3 Aug 1998 15:06:46 +0100, 134.34.126.40 Organization: University of Constance, Germany Lines: 32 Path: biosci!agate!newsfeed.berkeley.edu!howland.erols.net!frankfurt.de.uu.net!news.uni-stuttgart.de!news.belwue.de!news.uni-konstanz.de!134.34.126.40 Hi Karen, I don´t know about your protein, but blotting in CAPS buffer has never been a problem for me, neither onto PVDF nor onto nitrocellulose. It is actually much faster than blotting in Tris-glycine buffer. OK, what might be the problem? 1. Did you prepare the buffer just before use? This is important as CAPS is instable and will be degraded within days when stored at room temperature. So, the buffer must be prepared fresh each time (which is actually the major drawback of this blotting buffer). 2. Does your protein migrate to the electrode where your membrane is? This is not a trivial question, as migration in this buffer is not driven by SDS (so that the protein always "Runs to Red"). Rather, the protein migrates according to its own charge at pH11.0. In the worst case, the protein might migrate to the other side of the gel, or precipitate in the gel (if its isoelectric point is close to 11.0) Hope this helps, Frank Karen spink wrote: > > Has anyone had any problems Western blotting onto PVDF in CAPS buffer? I am > trying to get a sequence on my protein and it appears that the efficiency > of transfer is letting me down. Could it be the buffer, (10mM CAPS, 10% > methanol, pH 11) ? I have had no problems blotting onto nitrocellulose > using tris-glycine buffers. > > Thanks for your time > > Karen Spink From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!agate!newsfeed.berkeley.edu!newsfeed.nyu.edu!btnet-peer!btnet!nntp.news.xara.net!xara.net!rill.news.pipex.net!pipex!server1.netnews.ja.net!pegasus.csx.cam.ac.uk!not-for-mail From: Ian Roberts Newsgroups: bionet.molbio.methds-reagnts Subject: Archival CGH Date: Mon, 03 Aug 1998 13:17:42 +0000 Organization: University of Cambridge Lines: 41 Message-ID: <35C5B873.5A1B6A99@mole.bio.cam.ac.uk> Reply-To: ir210@mole.bio.cam.ac.uk NNTP-Posting-Host: jwmac4.path.cam.ac.uk Mime-Version: 1.0 Content-Type: multipart/mixed; boundary="------------E807849FF01187170CFB9FF3" X-Mailer: Mozilla 4.05 (Macintosh; I; PPC) This is a multi-part message in MIME format. --------------E807849FF01187170CFB9FF3 Content-Type: text/plain; charset=us-ascii; x-mac-type="54455854"; x-mac-creator="4D4F5353" Content-Transfer-Encoding: 7bit Dear All, I'm trying to undertake comparative genomic hybridisation on formalin fixed paraffin embedded material. Does anyone have experience in this field? I am particularly interested in knowing the quantatities of DNA required for this process, as most of my samples are fine needle biopsies for which tissue is verging on the invisible! Many thanks for any suggestions. Ian --------------E807849FF01187170CFB9FF3 Content-Type: text/x-vcard; charset=us-ascii; name="vcard.vcf" Content-Transfer-Encoding: 7bit Content-Description: Card for Ian Roberts Content-Disposition: attachment; filename="vcard.vcf" begin: vcard fn: Ian Roberts n: Roberts;Ian org: University of Cambridge adr;dom: ;;Department of Pathology, Tennis Court Road,;Cambridge;UK;CB2 1QP; email;internet: ir210@mole.bio.cam.ac.uk tel;work: +44 (0)1223 333735 tel;fax: +44 (0)1223 333730 x-mozilla-cpt: ;0 x-mozilla-html: TRUE version: 2.1 end: vcard --------------E807849FF01187170CFB9FF3-- From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!news.stanford.edu!logbridge.uoregon.edu!news-peer.gip.net!news.gsl.net!gip.net!news-peer.sprintlink.net!news-backup-east.sprintlink.net!news.sprintlink.net!128.218.95.22!itssrv1.ucsf.edu!macmac-2.ucsf.edu!user From: bpmurray*STUFFER*@socrates.ucsf.edu (Bernard P. Murray, PhD) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Acrylamide with coffee... Date: Mon, 03 Aug 1998 02:40:46 -0700 Organization: University of California, San Francisco Lines: 23 Message-ID: References: <9807309017.AA901778204@smtpgwy.agric.nsw.gov.au> <6pr1at$i56$1@nnrp1.dejanews.com> <6ptv0b$6lj$1@news1.ucsd.edu> NNTP-Posting-Host: macmac-2.ucsf.edu In article <6ptv0b$6lj$1@news1.ucsd.edu>, "Antonin Tutter" wrote: > >I'm surprised no one has brought up the incident in San Diego where a lab was > >poisoned with acrylamide in the coffee. (or did I miss this part of the > >thread?) It was written in the "News" section of _Science_ awhile ago. I > >know some of the people involved, and it seemed to have no long-lasting > >effects. > > > > I remember that incident well, as word of it spread rapidly through the > scientific community here. I also recall an incident at NIH involving a > water cooler spiked with 32P. > > Antonin Tutter Aargh! Don't remind me about that. I worked in that building and the resulting fuss made working with any kind of radioactivity very difficult for a long time after. Bernard -- Bernard P. Murray, PhD Dept. Cell. Mol. Pharmacol., UCSF, San Francisco, USA From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!daresbury!not-for-mail From: "Wolfgang Schechinger" Newsgroups: bionet.molbio.methds-reagnts Subject: Re. XR Film Fixer Date: 3 Aug 1998 10:38:39 +0100 Organization: Med Clinic iV, Dept. of Pathobiochemistry, Lines: 28 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <6q40ev$nk4@mserv1.dl.ac.uk> Reply-To: wgschech@med.uni-tuebingen.de Comments: Authenticated sender is X-Authentication-Warning: drakkar.med.uni-tuebingen.de: smap set sender to using -f X-mailer: Pegasus Mail for Windows (v2.52) MIME-Version: 1.0 Original-To: methods@dl.ac.uk Hi Hanson, as long the film emulsion is based on silver halogenides, probably an B&W film fixer (from the foto store next door) will do. Fix double clearing time as rule of thumb. Maybe just a - say 5% - solution of thiosulfate will do. wolfgang > Hi there, > > Please tell me where to buy x-film fixer? I know perhaps Kodak > company is a good source but I can't find their product catalog. I > would be very appreciate any suggestions. Especially from one who > has trustable fixer supply. I need it immergently to develop our > Northern blot. (We have ordered Kodak D-19 as developer). > > Thanks a lot! > > Hanson > > Dr.Ceol Monica University Tuebingen Med. Clinic. IV Lab. B2/537 email: wgschech@med.uni-tuebingen.de ! please indicate in the subject that the mail is for Dr. Ceol From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!daresbury!not-for-mail From: "Wolfgang Schechinger" Newsgroups: bionet.molbio.methds-reagnts Subject: Looking for antibody against 5'-nucleotidase Date: 3 Aug 1998 10:37:46 +0100 Organization: Med Clinic iV, Dept. of Pathobiochemistry, Lines: 15 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <6q40da$nhi@mserv1.dl.ac.uk> Reply-To: wgschech@med.uni-tuebingen.de Comments: Authenticated sender is X-Authentication-Warning: drakkar.med.uni-tuebingen.de: smap set sender to using -f X-mailer: Pegasus Mail for Windows (v2.52) MIME-Version: 1.0 Original-To: methods@dl.ac.uk Hi all, Is anyone aware of a source of an antibody against 5'-nucleotidase? couldn't find it at the major companies. Any hints are appreciated! A nice weekend, Wolfgang Dr.Ceol Monica University Tuebingen Med. Clinic. IV Lab. B2/537 email: wgschech@med.uni-tuebingen.de ! please indicate in the subject that the mail is for Dr. Ceol From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!news.stanford.edu!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!london-news-feed1.bbnplanet.com!news.bbnplanet.com!diablo.theplanet.net!rill.news.pipex.net!pipex!server1.netnews.ja.net!newsfeed.ed.ac.uk!aultmore!chrisb From: chrisb@hgu.mrc.ac.uk (Chris Boyd) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: restriction enzymes Date: 3 Aug 1998 09:09:28 GMT Organization: MRC Human Genetics Unit Lines: 69 Distribution: world Message-ID: <6q3uo8$fvl@scotsman.ed.ac.uk> References: NNTP-Posting-Host: aultmore.hgu.mrc.ac.uk X-Newsreader: TIN [version 1.2 PL2] Ashok Aiyar (aiyar@aiyar.dyn.ml.org) wrote: : On 2 Aug 1998 17:57:03 -0700, Markus Schneemann wrote: : >I'm looking for a restriction enzyme that cuts human (eukaryotic) : >genomic DNA into smaller pieces than it does with bacterial (gram + : >actinomyces, GC-rich) chromosomal DNA. : >The purpose is to generate a bacterial chromosomal library from : >intracellularly grown bacteria (grown inside human macrophages) and to get : >rid of the human genomic DNA that may contaminate the bacterial DNA. : >If the human DNApieces are considerably smaller (let's say, below 10-15kb) : >than the bacterial ones (>25kb) the packaging of cosmids (Stratagene : >SuperCos) should exclude any DNA below 20kb (so they promise...). : >Does anybody know of such a restriction enzyme ? : If the genomic DNA in your bacteria is dam-methylated, then you can : digest the total "genomic" DNA preparation with DpnII, a four-cutter : that cuts the sequence GATC when it is unmethylated. : There is no equivalent to dam-methylase in mammalian cells, and therefore : human DNA is cut efficiently by DpnII. In contrast, many eubacteria : dam-methylate their genome, and the resultant GAmTC is resistant to DpnII. Where is your evidence for this assertion? I'd be surprised if dam-methylation were present in more than a minority of species outside the Enterobacteriacae. : If the bacterial genomic DNA is indeed methylated, you could first : digest exhaustively with DpnII, to cut the contaminating human genomic DNA : into fragments far smaller than 10 kb, and then cut the undigested : bacterial genomic DNA with the enzyme of your choice to yield fragments : that can be packaged into phage heads after ligation with lambda arms. It's a nice idea, but in this case take a look at... TI: RESTRICTION ANALYSIS OF ACTINOMYCETES CHROMOSOMAL DNA AU: NOVELLA_IS, MARIN_I, SANCHEZ_J JN: CANADIAN JOURNAL OF MICROBIOLOGY, 1996, Vol.42, No.2, pp.201-206 AB: Actinomycetes DNAs were digested with restriction enzymes to study the presence of methylated bases. Analysis showed that the enterobacterial Dam and Dcm systems are absent. Methylation at the internal cytosine in CCGG sequences, typical of eukaryotes, was also absent. We also tested 18 restriction endonucleases recognizing six base pair sequences (all of which were inhibited by methylation). Results showed a higher number of restriction sites for enzymes recognizing CG-rich sequences (CG endonucleases) than for enzymes patterns with CG endonucleases were quite uniform, with the remarkable exception of XhoI, which yielded a small number of DNA bands. The study performed with AT endonucleases allowed differentiation of three groups of enzymes based on different degrees of chromosomal sensitivity. One group (BglII and BglII) produced restriction patterns with more abundant restriction sites than expected, a second group (ClaI, EcoRI, and EcoRV) yielded the predicted number of DNA fragments, and the third group (HpaI, HindIII, XbaI, and DraI) produced an unexpectedly low number of fragments. Some individual cases of resistance to particular enzymes could be explained by the presence of restriction-modification systems with the same specificity. Your best bet is either to take not of the results of the above or repeat this kind of study with a panel of (four-cutter?) enzymes against chromosomal DNA from your particular actinomycete and identify one that didn't cut. Use this to chop up the human DNA preferentially as Ashok suggested. Best wishes, -- Chris Boyd | from, but not \ MRC Human Genetics Unit, Christopher.Boyd@hgu.mrc.ac.uk | on behalf of / Western General Hospital, http://www.hgu.mrc.ac.uk/Users/Christopher.Boyd \ Edinburgh, EH4 2XU, SCOTLAND From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!agate!newsfeed.berkeley.edu!howland.erols.net!rill.news.pipex.net!pipex!server1.netnews.ja.net!news.nott.ac.uk!pdxkgs From: pdxkgs@pdn1.gene.nott.ac.uk (Karen spink) Newsgroups: bionet.molbio.methds-reagnts Subject: Blotting onto PVDF Date: Mon, 03 Aug 1998 09:59:42 +0100 Organization: University of Nottingham Lines: 9 Message-ID: NNTP-Posting-Host: ppdirg.nottingham.ac.uk Mime-Version: 1.0 Content-Type: text/plain; charset=ISO-8859-1 Content-Transfer-Encoding: 8bit X-Newsreader: Yet Another NewsWatcher 2.4.0 Has anyone had any problems Western blotting onto PVDF in CAPS buffer? I am trying to get a sequence on my protein and it appears that the efficiency of transfer is letting me down. Could it be the buffer, (10mM CAPS, 10% methanol, pH 11) ? I have had no problems blotting onto nitrocellulose using tris-glycine buffers. Thanks for your time Karen Spink From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!news.stanford.edu!logbridge.uoregon.edu!newsfeed.ecrc.net!news-fra1.dfn.de!news-ber1.dfn.de!news-ham1.dfn.de!news.mu-luebeck.de!not-for-mail From: "Lars Komorowski" Newsgroups: bionet.molbio.methds-reagnts Subject: 25kDa-band in pET-System-Expression Date: Mon, 3 Aug 1998 10:27:52 +0100 Organization: Med. Universitaet zu Luebeck Lines: 13 Message-ID: <6q3shl$dmk$1@gwsun.medinf.mu-luebeck.de> NNTP-Posting-Host: 141.83.167.168 X-Newsreader: Microsoft Outlook Express 4.71.1712.3 X-MimeOLE: Produced By Microsoft MimeOLE V4.71.1712.3 I am trying to overexpress a 17kDa-Protein in E.coli BL21 with Novagens pET24a Vector. I inocculate my LB medium from an overnight culture, let the culture grow until the OD reaches 0.6 and induce with 1 mM IPTG. After one night there is a band at 25 kDa in SDS-PAGE made with total cell protein. When I try to separate cytosolic proteins from the rest and make another SDS-PAGE with both fractions there is no band there. I have two questions: 1. If the protein band is not the desired protein what can it be ? 2. If the band represents the protein, is it possible that it is proteolysed within minutes ? From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!news.stanford.edu!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!portc02.blue.aol.com!pitt.edu!not-for-mail From: pxpst2@SPAM.SUXS.unixs.cis.pitt.edu (Peter) Newsgroups: bionet.molbio.methds-reagnts Subject: Rat coagulation factors Date: Mon, 03 Aug 1998 09:40:31 -0500 Organization: University of Pittsburgh Lines: 17 Message-ID: NNTP-Posting-Host: pelli.pathology.pitt.edu Mail-Copies-To: pxpst2@SPAM.SUXS.unixs.cis.pitt.edu X-Newsreader: MT-NewsWatcher 2.4.4 Is there anybody out there who has worked with Rat Coagulation factors? If so, I would like advice on whether antibodies for them are readily available. I am very aware of the fact that the human coagulation factors have lots of antibodies but I have found that most do not work well with the rat proteins. Thanks in advance Peter Pediaditakis -- "Don't you eat that yellow snow watch out where the Huskies go" FZ --------------------------------------------------------------------- From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!news.stanford.edu!logbridge.uoregon.edu!priori!news.idt.net!newsfeed.internetmci.com!204.238.120.130!news-feeds.jump.net!nntp2.dejanews.com!nnrp1.dejanews.com!not-for-mail From: ELADER@AMBION.COM Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Recipe for Phenol:guanidinium mix? Date: Mon, 03 Aug 1998 15:12:19 GMT Organization: Deja News - The Leader in Internet Discussion Lines: 26 Message-ID: <6q4k0k$632$1@nnrp1.dejanews.com> References: <35bd89e6.2551097@news.cica.es> <6pnhc0$8qn$1@bubba.NMSU.Edu> <6pu16e$fpk$1@nnrp1.dejanews.com> NNTP-Posting-Host: 208.240.147.82 X-Article-Creation-Date: Mon Aug 03 15:12:19 1998 GMT X-Http-User-Agent: Mozilla/4.04 [en] (Win95; U ;Nav) I > > E. > > No, I don't think so ... or not unless the poster wants to *sell* > the resulting solution. Simply preparing it for your own use is > just fine and doesn't break the patent. Sorry Ambion. > > Bernard > -- Unfortunately, that is simply not true. A patent covers *all* rights to a technique and formulation. Do you think that it would be legal for you to grow Taq in your lab for your own use? Now, whether a company chooses to take legal action against someone in violation of their patent is another matter. Except as an 'example', suing an academic lab for infringement wouldn't be worth the companies time (not to mention being bad for customer relations) because there's virtually no damages to be collected to offset legal fees. There's even something called contributory infringement. If you tell someone how to violate a patent (e.g.`psst, check out this formula for TriZol), you are also breaking the law. Clearly, patent law and the openness and coopertivity in academia are quite alien to each other. Eric -----== Posted via Deja News, The Leader in Internet Discussion ==----- http://www.dejanews.com/rg_mkgrp.xp Create Your Own Free Member Forum From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!GENVEC.COM!lou_cantolupo From: lou_cantolupo@GENVEC.COM ("Lou Cantolupo") Newsgroups: bionet.molbio.methds-reagnts Subject: Heat Shock DH5a Date: 3 Aug 1998 08:34:00 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 13 Sender: daemon@net.bio.net Distribution: world Message-ID: <19980803113120.468f1e43.in@genvec.com> Reply-To: "Lou Cantolupo" NNTP-Posting-Host: net.bio.net Settle an argument for me. Does the heat shock step in a CaCl2 transformation of DH5a (or whatever bug of choice) activate heat shock proteins for recovery or make the cells more porous? ================================= Lou Cantolupo GenVec, Inc. Department of Molecular Virology 12111 Parklawn Drive Rockville, MD, USA 20852 lou_cantolupo@genvec.com From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!news.stanford.edu!newsfeed.concentric.net!207.155.183.80.MISMATCH!global-news-master From: "James Wick" Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Recipe for Phenol:guanidinium mix? Date: 03 Aug 1998 18:56:55 EDT Organization: Concentric Internet Services Lines: 67 Message-ID: <6q5f7n$gi2@examiner.concentric.net> References: <3.0.32.19980803122051.006e8758@imm2.imm.uth.tmc.edu> NNTP-Posting-Host: ts001d13.mke-wi.concentric.net X-Newsreader: Microsoft Outlook Express 4.72.2106.4 X-MimeOLE: Produced By Microsoft MimeOLE V4.72.2106.4 Not sure this pertains, but as part of the patent process an inventor must archive materials that are part of the patent application. As a result numerous materials have been deposited, I believe, at instutitutions such as ATCC to fullfill this requirement. I am not a patent attorney so I am not definite on the legalize that surrounds this part of the patent process. Can anyone add any detail? "David L. Haviland, Ph.D." wrote in message <3.0.32.19980803122051.006e8758@imm2.imm.uth.tmc.edu>... >At 15:12 8/3/98 GMT, ELADER@AMBION.COM wrote: >>I >>> > E. >>> >>> No, I don't think so ... or not unless the poster wants to *sell* >>> the resulting solution. Simply preparing it for your own use is >>> just fine and doesn't break the patent. Sorry Ambion. >>> >>> Bernard >>> -- Unfortunately, that is simply not true. A patent covers *all* rights >to a >> >>technique and formulation. Do you think that it would be legal for you to >>grow Taq in your lab for your own use? Now, whether a company chooses to take >>legal action against someone in violation of their patent is another matter. >>Except as an 'example', suing an academic lab for infringement wouldn't be >>worth the companies time (not to mention being bad for customer relations) >>because there's virtually no damages to be collected to offset legal fees. > >Umm.. then why are the clones for Taq polymerase available from ATCC? ATCC >40336 is a phage encoding the cDNA for Taq and ATCC 67421 and 67422 are >phagmids encoding two parts of Taq. Instructions are supplied for taking >the two inserts of 421 and 422 to make a complete cDNA. It is all on the >web page. And I vaguely recall a email note posted to this group within >the last year (someone from Yale???) who stated that a proofreading version >had been placed with ATCC as well. Just use "Taq" in the ATCC web search >area of bacteria and clones. > >In any case, if we weren't supposed to be able to make our own (if we >wanted) why would they be avialable through ATCC? Kinda dumb to expect >that no one would obtain the clones and *not* make any of it... Of course >the idea goes that what we get from companies would be cleaner more cost >effective that trying to make it ourselves. > >It boils down that if I wanted to make it for my lab, I can. If I then >wanted to sell what I made to the other labs on the hall, I would then >garner the wrath of Roche and all the others that already over charge us >for Taq as it is. > >'bout every two years this discussion crops up... > >David >============================= > David L. Haviland, Ph.D. > Asst. Prof. Immunology > University of Texas - Houston, H.S.C. > Institute of Molecular Medicine > 2121 W. Holcombe Blvd. > Houston, TX 77030 > Internet:"dhavilan@imm2.imm.uth.tmc.edu" > Voice: 713.500.2413 FAX: 713.500.2424 > ------------------------------------------------------ >Never take life seriously. Nobody gets out alive anyway. >============================= From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!daresbury!not-for-mail From: "Wolfgang Schechinger" Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Electrophoresis safety question Date: 3 Aug 1998 23:09:41 +0100 Organization: Med Clinic iV, Dept. of Pathobiochemistry, Lines: 27 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <6q5cf5$iik@mserv1.dl.ac.uk> Reply-To: wgschech@med.uni-tuebingen.de Comments: Authenticated sender is X-Authentication-Warning: drakkar.med.uni-tuebingen.de: smap set sender to using -f X-mailer: Pegasus Mail for Windows (v2.52) MIME-Version: 1.0 In-reply-to: <9883224550.~INN-NMHa00189.bionet-news@dl.ac.uk> Original-To: "D. KIM" , dkim@NMSU.Edu, methods@dl.ac.uk Hi to all hazardeur! You always were so lucky no to get enough current to be harmed. If you place one finger in the agarose bath and the other hand in your pocket, normally nothing is likely to happen. Under adverse conditions (wet hands, leaky chamber, bad wire isolation, the other hand not in the pocket but touching a grounded piece of metal, having a bad power supply...) might lead to a deadly electrical shock. Why playing around with open gel trays if working safely really is so easy here? Anyone here who yet touched mains with two wet hands? Do you fan your hair while sitting in the bathtube or having a shower? There are 110 Volt only, too (in the US). You can imagine now what I'm talking about? Enjoy! No! Not electricity:-) Wolfgang ----- usual disclaimers apply * This message is RNAse free - please don't touch! ----- Wolfgang Schechinger University of Tuebingen, Germany email: wgschech@med.uni-tuebingen.de * wwWait: http://www.medizin.uni-tuebingen.de/~wgschech/start.htm ------- From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!DARWIN.BIO.UCI.EDU!vrdefili From: vrdefili@DARWIN.BIO.UCI.EDU (Victor DeFilippis) Newsgroups: bionet.molbio.methds-reagnts Subject: Positive control human PCR primers needed Date: 3 Aug 1998 15:12:00 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 11 Sender: daemon@net.bio.net Distribution: world Message-ID: <3.0.32.19980803151239.006f5948@darwin.bio.uci.edu> NNTP-Posting-Host: net.bio.net Hello, I need to obtain some very reliable PCR primers for human DNA that amplify an approximately 1 kb long region. My intention is to use these as a positive control. Any help regarding where I should look (e.g. retailers, references, etc.) or references discussing this issue would be greatly appreciated. Thanks in advance! vrdefili@darwin.bio.uci.edu From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!PUBLIC.HR.HL.CN!hpgc From: hpgc@PUBLIC.HR.HL.CN ("kuotai") Newsgroups: bionet.molbio.methds-reagnts Subject: request reagent Date: 3 Aug 1998 14:53:39 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 26 Sender: daemon@net.bio.net Distribution: world Message-ID: <01bdbf29$0f4cd5e0$1cf161ca@default> NNTP-Posting-Host: net.bio.net This is a multi-part message in MIME format. ------=_NextPart_000_000B_01BDBF6C.1D7015E0 Content-Type: text/plain; charset="gb2312" Content-Transfer-Encoding: quoted-printable ------=_NextPart_000_000B_01BDBF6C.1D7015E0 Content-Type: text/html; charset="gb2312" Content-Transfer-Encoding: quoted-printable
 
------=_NextPart_000_000B_01BDBF6C.1D7015E0-- From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!agate!newsfeed.berkeley.edu!howland.erols.net!news.idt.net!netnews.com!dca1-hub1.news.digex.net!digex!lynx.unm.edu!news.NMSU.Edu!NMSU.Edu!dkim From: D. KIM Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Electrophoresis safety question Date: 3 Aug 1998 21:21:06 GMT Organization: New Mexico State University Lines: 29 Distribution: world Message-ID: <6q59k2$aqi$1@bubba.NMSU.Edu> References: <3586E885.1C1B@chugaibio.com> NNTP-Posting-Host: hector.nmsu.edu X-Trace: bubba.NMSU.Edu 902179266 11090 128.123.34.9 (3 Aug 1998 21:21:06 GMT) X-Complaints-To: usenet@bubba.NMSU.Edu NNTP-Posting-Date: 3 Aug 1998 21:21:06 GMT X-Newsreader: TIN [UNIX 1.3 unoff BETA 970324; AIX 4.2] While I don't want the world to think of me as some kind of idiot :), I have placed unprotected fingers in 100 V agarose/TAE minigel rigs while running, with no ill effects. The setup described below in the previous post sounds like it would yield a dangerous work environment and also no sequence data. With a major short circuit, all the current would run through the aluminum plate and very little would make it through the more resistant gel. Now, I am not an engineer (that's why I eat cheap ramen, while my brother goes out to lunch :)), so don't flame me for poor electrical knowledge, but it kind of makes sense, doesn't it? Daniel Kim Koichi Kunitake wrote: : In article <3586E885.1C1B@chugaibio.com>, dspinella@chugaibio.com, : @chugaibio.com wrote: : : : While I have never touched a 100V agarose gel when it was running, we : had a guy who worked in the lab who was running a sequencing gel at about : 2000V. We of course ran the gel with a metal plate behind it to soak up : the heat, but it turns out that the upper reservoir was leaking and it : leaked onto the metal plate, which was also contacting the lower : reservoir, since the buffer in the lower reservoir was wicked up the back : of the plate. From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!daresbury!not-for-mail From: "Mr. Chirag Joshi" Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Re. XR Film Fixer Date: 3 Aug 1998 21:46:15 +0100 Lines: 21 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <6q57in$drf@mserv1.dl.ac.uk> MIME-Version: 1.0 Original-To: Wolfgang Schechinger Hi! We use the same x-ray films, developers and fixers that are used in the hospital (medical stuff) for routine exposures. even for special films (hyperfilms/xomat etc), the same dev/fix works fine. time might vary. Check out in the radiology dept. of nearest hospital.(may be you can borrow a litre of solutions for trial ;-). CJ ______________________________________________________________________________ Chirag V. Joshi Department of Microbiology and Cell Biology Indian Institute of Science Bangalore 560 012, India Phone : ++91-080-309 2344, -334 4668 Fax : ++91-080-344 4697, -334 1683 Email : chirag@cge.iisc.ernet.in Internet: http://144.16.78.192/~chirag/ ______________________________________________________________________________ From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!news.stanford.edu!newsfeed.berkeley.edu!island.idirect.com!newsfeed.internetmci.com!199.0.154.208!news2.ais.net!jamie!ais.net!NewsNG.Chicago.Qual.Net!newsspool.doit.wisc.edu!news.doit.wisc.edu!svetlov From: svetlov@oncology.wisc.edu (Vladimir Svetlov) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Cloning of GST-E2F-1: HELP! Date: Mon, 03 Aug 1998 15:24:13 -0600 Organization: Burgess' Holy Church of Protein Refolding Lines: 30 Sender: reguser@144.92.82.32 Message-ID: References: NNTP-Posting-Host: 144.92.82.32 Mime-Version: 1.0 Content-Type: text/plain; charset=ISO-8859-1 Content-Transfer-Encoding: 8bit X-Newsreader: Yet Another NewsWatcher 2.4.0 In article , Andrew Ippolito wrote: > I did not get much of anything when i stained a SDS PAGE of the > samples. Help! please send me a personal e-mail, as I do > not frequent this newsgroup very often. Thank you in > advance, > Andrew From my personal experience and that of people in the building I know that E2F-1 induces fine in BL21 cells either as GCT or His6 fusion (full-length or C-terminal domain alone) and has been purified using Gth- or Ni-NTA columns using standard procedures. Do you monitor the induction using SDS-PAGE of samples from addition of IPTG in 30 min intervals and throughout your purification (e.g. washes, eluate, 6 M GuaCl wash of column after elution etc.)? This will tell you whether you had a protein in the beginning and where you are loosing it. Regards, V. -- Vladimir Svetlov, Ph. D. McArdle Lab for Cancer Research UW-Madison 1400 University Ave. Madison, WI 53705 From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!chugaibio.com!dspinella From: dspinella@chugaibio.com (Dom Spinella) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: While we're on Acrylamide.... Date: 3 Aug 1998 13:22:58 -0700 Organization: Chugai Biopharmaceuticals, Incorporated Lines: 13 Sender: daemon@net.bio.net Distribution: world Message-ID: <35C61DB8.633@chugaibio.com> Reply-To: dspinella@chugaibio.com, @chugaibio.com NNTP-Posting-Host: net.bio.net To Bryan and Peter: Have you guys ever considered careers in professional wrestling? It's been entertaining watching you two young bucks sharpen your antlers but, as we are now into a new month on this well-worn thread, maybe the time has come to call an end to the rutting season. Neither of you are quite ready to take over the herd just yet, and as you mature in this game you're likely to find that all the ad hominem attacks and egotistical strutting aren't going to get you into the National Academy after all. You'll just earn yourselves a reputation as arrogant a**holes -- and then you'll wonder why you can't attract good post docs or technicians. Ah well...good luck anyway --Dom Spinella From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!news.stanford.edu!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!fu-berlin.de!mg183.rz-berlin.mpg.DE!not-for-mail From: Konrad Buessow Newsgroups: bionet.molbio.methds-reagnts Subject: Re: replicator? Date: Mon, 03 Aug 1998 19:50:25 +0100 Organization: Max-Planck-Institut für Molekulare Genetik Lines: 36 Message-ID: <35C60671.900D18FD@mpimg-berlin-dahlem.mpg.de> References: <199807292010.QAA09374@sirocco.CC.McGill.CA> NNTP-Posting-Host: mg183.rz-berlin.mpg.de (141.14.131.154) Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Access: 16 25 816 X-Trace: fu-berlin.de 902166660 20044 (none) 141.14.131.154 X-Mailer: Mozilla 4.05 [en] (WinNT; I) To: dalex@microimm.mcgill.ca Hello David, 96 and 384 pin metal replicators are also sold by Nunc http://nunc.nalgenunc.com You can get plastic ones from Genetix http://www.genetix.co.uk/ All the best Konrad , David Alexander wrote: > Hello Netters! > > I am searching for a replicator device to be used > for replica plating bacterial colonies on solid media. > Ideally this would be something with 48 (6 X 8) tines > that could be dipped into a 96 well plate > > We have one such device - but the manufacturer is unknown. > Also, we have attempted to producing our own, > by hammering pins into a wooden block > but it has been difficult to get the pins level. > > Any help with this matter would be very much appreciated > > David Alexander > > dalex@microimm.mcgill.ca From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!agate!newsfeed.berkeley.edu!island.idirect.com!newsfeed.internetmci.com!207.69.200.14!firehose.mindspring.net!cssun.mathcs.emory.edu!cronkite.cc.uga.edu!twopaths From: russell@dogwood.botany.uga.edu (Russell Malmberg) Newsgroups: bionet.molbio.methds-reagnts Subject: Trbls - timed run blast search utility for win95/NT4 Date: Mon, 03 Aug 1998 17:24:00 GMT Organization: Botany Department, University of Georgia Lines: 49 Message-ID: <6q4rmt$smf$3@cronkite.cc.uga.edu> NNTP-Posting-Host: twopaths.botany.uga.edu X-Newsreader: News Xpress 2.01 There is a new version of Trbls (version 0.55), the Timed-Run-Blast -Search accessory program for Windows 95 or NT4. Versions are available for both intel and alpha CPUs. Trbls is a utility designed to partially automate some aspects of routine blast searches. The user can select multiple sequences, set their blast search parameters, and then schedule runs for some time. You might set your favorite sequences to be run every Saturday at 4 AM, for example. Trbls will perform both regular and gapped blast searches, and it will return output in HTML format, which leads to direct links to the sequences of interest. I wanted to have a timed program like Trbls for my own blast searches, so I wrote this, and am distributing it in the hope that others will find it useful. Trbls uses slightly modified two blast clients from NCBI to actually perform the search (blastcl2 and blastcl3). All the credit for the blast functionality should thus go to NCBI (with particular thanks from me to Tom Madden). You can get Trbls by entering these references directly into your web browser, or by going to my software page. for Windows 95 or Windows NT4 (intel processor): http://www.botany.uga.edu/malmberg/programs/Trbls-intel.zip for Windows NT4 (alpha processor): http://www.botany.uga.edu/malmberg/programs/Trbls-alpha.zip my software web page page: http://dogwood.botany.uga.edu/malmberg/software.html What to do when you get it: -- unzip in some useful directory (C:\Program Files\Trbls, for example) -- follow the directions in Setup.txt file. -- read the "getting started" section of the Trbls.hlp file. sample input and output files are included. Please send me your comments on the program, the help file, or anything else about Trbls. ----- Russell L. Malmberg russell@dogwood.botany.uga.edu http://dogwood.botany.uga.edu/malmberg/ From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!med.monash.edu.au!David.Nikolic-Paterson From: David.Nikolic-Paterson@med.monash.edu.au (David Nikolic-Paterson) Newsgroups: bionet.molbio.methds-reagnts Subject: Rat anesthesia Date: 3 Aug 1998 22:27:05 -0700 Organization: Monash University Lines: 7 Sender: daemon@net.bio.net Distribution: world Message-ID: <35C69566.3E07@med.monash.edu.au> Reply-To: David.Nikolic-Paterson@med.monash.edu.au NNTP-Posting-Host: net.bio.net We are looking for an 'Ether alternative' for rat anesthesia, due to impending Animal ethics bans. We would like it to be fast acting (less than 3mins) and will keep the rat sedated for at least 5-10 mins. (preferably not longer than 20 mins) We have trialed Halothane but find the rats recover too rapidly and if the dose is increased they do not recover. (We do not use a nebulizer). Any suggestions or recommendations would be greatly appreciated. From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Newsgroups: bionet.molbio.methds-reagnts Path: biosci!news.stanford.edu!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!sunqbc.risq.qc.ca!news.uow.edu.au!news.nsw.CSIRO.AU!Keith.Rand From: Keith.Rand@molsci.csiro.au (Keith Rand) Subject: Re: Heat Shock DH5a X-Nntp-Posting-Host: goldeneagle.dbe.csiro.au Message-ID: Sender: news@news.nsw.CSIRO.AU Organization: Sydney X-Newsreader: MT-NewsWatcher 2.4 References: <19980803113120.468f1e43.in@genvec.com> Date: Tue, 4 Aug 1998 03:10:49 GMT Lines: 17 In article <19980803113120.468f1e43.in@genvec.com>, "Lou Cantolupo" wrote: > Settle an argument for me. Does the heat shock step in a CaCl2 > transformation of DH5a (or whatever bug of choice) activate heat shock proteins for > recovery or make the cells more porous? Well, it seems to be generally believed that the heat shock is involved in some way with the entry of the DNA into the cells. So 'making the cells more porous' would be the correct answer. It would be interesting to hear the case for the induction of heat shock proteins, but I don't think anyone has reported an increase in viability due to the heat shock. -- Keith Rand, Sydney Australia From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!agate!usenet From: "Jeff E. Janes" Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Recipe for Phenol:guanidinium mix? Date: Mon, 03 Aug 1998 21:01:32 -0700 Organization: Unorganized Lines: 8 Message-ID: <35C6879C.167E@silibone.cchem.berkeley.edu> References: <35bd89e6.2551097@news.cica.es> <6pnhc0$8qn$1@bubba.NMSU.Edu> <6pu16e$fpk$1@nnrp1.dejanews.com> <6q4nv5$b9q$1@nnrp1.dejanews.com> NNTP-Posting-Host: silibone.cchem.berkeley.edu Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 2.01 (X11; I; IRIX 5.3 IP20) ELADER@AMBION.COM wrote: > > > There's even something called contributory infringement. If you tell someone > how to violate a patent (e.g.`psst, check out this formula for TriZol), you > are also breaking the law. Isn't the patent itself supposed to tell someone how to violate it? From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!news.stanford.edu!newsfeed.berkeley.edu!howland.erols.net!math.ohio-state.edu!news.physics.uiowa.edu!newsrelay.iastate.edu!news.iastate.edu!not-for-mail From: ckafer@iastate.edu (my name) Newsgroups: bionet.molbio.methds-reagnts Subject: patent infringement again...was Re: Recipe for Phenol:guanidinium mix? Date: Tue, 04 Aug 1998 03:21:21 GMT Organization: Lacking! Lines: 55 Message-ID: <35c67b93.31746476@news.iastate.edu> References: <3.0.32.19980803122051.006e8758@imm2.imm.uth.tmc.edu> <6q5f7n$gi2@examiner.concentric.net> NNTP-Posting-Host: thornlab2.bb.iastate.edu X-Newsreader: Forte Free Agent 1.11/32.235 The fact that clones are available, along with instructions, implies nothing about the legality of their subsequent use. My understanding is that you can purify kilograms of Taq polymerase if ya want. The patent infringement begins when you use it for sequencing, amplification yadda yadda yadda... However, isn't the govt. exempt from patent protections and doesn't nearly all of our (academic labs that is) collective funding come from the federal govt... Has anybody actually ASKED a REAL patent attorney about these issues or do we keep hashing this over every year or so for fun?? >"David L. Haviland, Ph.D." wrote in message >> >>Umm.. then why are the clones for Taq polymerase available from ATCC? ATCC >>40336 is a phage encoding the cDNA for Taq and ATCC 67421 and 67422 are >>phagmids encoding two parts of Taq. Instructions are supplied for taking >>the two inserts of 421 and 422 to make a complete cDNA. It is all on the >>web page. And I vaguely recall a email note posted to this group within >>the last year (someone from Yale???) who stated that a proofreading version >>had been placed with ATCC as well. Just use "Taq" in the ATCC web search >>area of bacteria and clones. >> >>In any case, if we weren't supposed to be able to make our own (if we >>wanted) why would they be avialable through ATCC? Kinda dumb to expect >>that no one would obtain the clones and *not* make any of it... Of course >>the idea goes that what we get from companies would be cleaner more cost >>effective that trying to make it ourselves. >> >>It boils down that if I wanted to make it for my lab, I can. If I then >>wanted to sell what I made to the other labs on the hall, I would then >>garner the wrath of Roche and all the others that already over charge us >>for Taq as it is. >> >>'bout every two years this discussion crops up... >> >>David >>============================= >> David L. Haviland, Ph.D. >> Asst. Prof. Immunology >> University of Texas - Houston, H.S.C. >> Institute of Molecular Medicine >> 2121 W. Holcombe Blvd. >> Houston, TX 77030 >> Internet:"dhavilan@imm2.imm.uth.tmc.edu" >> Voice: 713.500.2413 FAX: 713.500.2424 >> ------------------------------------------------------ >>Never take life seriously. Nobody gets out alive anyway. >>============================= > > From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!news.stanford.edu!newsfeed.berkeley.edu!howland.erols.net!news-peer.sprintlink.net!news-backup-east.sprintlink.net!news.sprintlink.net!128.218.95.22!itssrv1.ucsf.edu!macmac-2.ucsf.edu!user From: bpmurray*STUFFER*@socrates.ucsf.edu (Bernard P. Murray, PhD) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: acrylamide with coffee Date: Mon, 03 Aug 1998 19:50:09 -0700 Organization: University of California, San Francisco Lines: 30 Message-ID: References: <6q4fu0$bru$1@niobium.hgmp.mrc.ac.uk> NNTP-Posting-Host: macmac-2.ucsf.edu In article <6q4fu0$bru$1@niobium.hgmp.mrc.ac.uk>, gmorley@hgmp.mrc.ac.uk (Mr. G. Morley) wrote: > >> I remember that incident well, as word of it spread rapidly through the > >> scientific community here. I also recall an incident at NIH involving a > >> water cooler spiked with 32P. > >> > >> Antonin Tutter > > >Aargh! Don't remind me about that. I worked in that building and > >the resulting fuss made working with any kind of radioactivity > >very difficult for a long time after. > > Bernard > > How on earth did the water cooler get spiked with 32P? and how did anyone > find out about it? Although we had numerous meetings where the investigation was described we were never told the actual outcome. The incident apparently revolved around a poor relationship between a researcher and her boss. From the few facts we were given it was apparent that someone *did* ingest 32P, a water cooler *was* contaminated (but nowhere near enough to explain the human contamination) and the contamination/ingestion *was* deliberate. The major debate was self-administration vs. "poisoning". Nasty business all around.... Bernard -- Bernard P. Murray, PhD Dept. Cell. Mol. Pharmacol., UCSF, San Francisco, USA From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!news.stanford.edu!newsfeed.berkeley.edu!newsfeed.wli.net!newsfeed.corridex.com!newsfeed.internetmci.com!138.95.18.2!wilbur.sequent.com!newsfeed.orst.edu!news.nero.net!not-for-mail From: "Bryan L. Ford" Newsgroups: bionet.molbio.methds-reagnts Subject: Re: While we're on Acrylamide.... Date: Mon, 03 Aug 1998 19:01:12 -0700 Organization: Marine/Freshwater Biomedical Sciences Center, Oregon State University, Corvallis OR 97331-6603 Lines: 128 Message-ID: <35C66B68.2FA1@bcc.orst.edu> References: <6q0r1j$32e$1@nnrp1.dejanews.com> <35C4E44A.2C43@bcc.orst.edu> Reply-To: fordb@bcc.orst.edu NNTP-Posting-Host: loveland-228-f.fst.orst.edu Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 3.04Gold (WinNT; I) To: Peter Peter seems to have once again taken my measured and accurate response as a personal affront to his chemical prowess. Here is the original question from Beth: > > > > Any of you chemistry-saavy types know what sort of nastiness one is > exposedt > > > > to from BURNING acrylamide? Say....when your gel box arcs and catches on > > > > fire? Not that this has ever happened to me, of course (heh heh!) Here is the portion of his response Peter chose to emphasize: > > > An arc would not be sufficent to cause the acryilamide to burn because > > > Arylamide is not flamable by nature. But if you placed the gel in a bomb > > > calorimeter and ignited it, you would find CO, CO2, and CN. Here is the portion of my response Peter includes: > > The original question says acrylamide, but of course most if not all of > > a mature gel will be polyacrylamide. Even if polyacrylamide were > > flammable, it would be very hard to openly ignite a polyacrylamide gel > > containing 90 to 95% water. But, if we were really talking about the > > monomer, then consider that the heating of unpolymerized acrylamide > > solid to its melting point leads to rapid, and if the quantity involved > > is larger, to explosive polymerization. Peter, who has demonstrated some amazing reading ability here before, is about to interpret the the wording for us: > This is not what was asked. >Man are you just being wordy or what? You *do* have some problems with words, I am sorry. > As for what you are saying...What unadulterated garbage. Unadulterated garbage in your mind. See numerous references to this "garbage" widely available even in your highly vaunted MSDSs. Or, on the Web, for example at http://www.qrc.com/hhmi/science/labsafe/lcss/lcss7.htm). Or even on your lab bench "rapid polymerization on melting" (for example in the acrylamide monograph in the Merck Index). > since I have no > intention of teaching you about reaction kinectics, I am grateful for this small favor. Perhaps the world will be wiser as well. > Suffice to say that as > a gas the molecules that will not polymerize faster than a liquid. Unlike you, Peter, I don't pretend to know more than the references. But then again I also don't interpret melting as boiling. And from our preceding discussions on the subject of acrylamide I would wonder if you have much of a grasp of the kinetic processes seen in acrylamide as it melts. But let me guess from my meager chemical training that the density of liquid acrylamide is only slightly less than that of the solid. So that on melting the collisional frequency of acylamide molecules and their orientational freedom would greatly increase. Added to this, the available activation energy would certainly increase as one raised temperature. So mechanistically the fact of explosive polymerization of molten acrylamide is no great surprise. Once you have combed your references and quizzed your old profs or chemistry pals you will no doubt have something more meaningful to say on this subject as on some previous occasions. > > This is perhaps another argument > > for using the, available and actually less costly, pre-prepared 40% > > acrylamide/bis-acrylamide solutions, for example from Amresco-- (no > > connection to me)-- and store in the fridge after opening. A lab fire is > > bad enough without extra explosions. > > More words with little said > Listen up, Peter! A number of individuals responding to this thread have indicated that they are regularly using powdered (that is solid, for you Peter) acrylamide. So the advice to use the solutions is relevant, it is economically sound, and it is a reasonably charitable thing for one scientist to suggest to another on safety grounds. What do you think this newsgroup is for? Just a place where you, with your apparently poor understanding of practical chemistry, can ridicule those who may not have taken quite as much theoretical chemistry? If so, that seems to be quite regularly backfiring on you, Peter. > > The bomb calorimetry seems a bit incomplete here. CO (carbon monoxide, > > often a fuel of industrial origin and use) will readily burn to CO2 in > > the calorimeter. CN or C2N2 (cyanogen) "burns with a pink flame" > > according to the Merck Index, the complete combustion products of which > > I would guess to be CO2 again and one or another nitrogen oxide such as > > NO or NO2. In a moment of rare magnanimity Peter yields: > Well I will admit that NO2 should be included but while we are at it, PNAs > will be formed as well and the amount of each product formation will be > dependant on the pressure and the percent oxygen in the gas phase of the > Bomb. PNAs? I can think of a couple of definitions fitting this acronym. Let's have the full wording Peter, or is the spelling too much? We, the readers, are used to doing the interpretive labor, so let us have your interpretation of the full name. > > If by chance the accidental burning of polyacrylamide led to the > > evolution of CN or HCN then the questioner should be concerned. But a > > good fire (supplying the oxygen and heat of activation) would likely > > leave little free CN... cyanogen and oxygen produce one of the hottest > > flames known-- well above oxyacetylene or oxyhydrogen torches in > > temperature. Of course the toxicity of CN (similar to cyanide) keeps it > > even from consideration as a practical flame, anyway these days there > > are much better ways to heat stuff way hot! > More words with little said. Once again Bryon's mouth is moving right along. More words (typed, the mouth is quite still, thanks) that completely contradict any assumption that CN would not combust in a bomb calorimeter. More words that answer part of the original question from Beth. But, of course, this is of "little" importance to Peter. -Bryan (Is that better, Susan Jane?) From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 From: Cornelius Krasel Subject: Re: Recipe for Phenol:guanidinium mix? Newsgroups: bionet.molbio.methds-reagnts References: <35bd89e6.2551097@news.cica.es> <6pnhc0$8qn$1@bubba.NMSU.Edu> <6pu16e$fpk$1@nnrp1.dejanews.com> <6q4nv5$b9q$1@nnrp1.dejanews.com> User-Agent: tin/pre-1.4-980514 (UNIX) (Linux/2.0.34 (i486)) Date: Mon, 3 Aug 1998 23:23:16 +0200 Message-ID: <4o95q6.ou2.ln@wpxx02.toxi.uni-wuerzburg.de> NNTP-Posting-Host: wpxx02.toxi.uni-wuerzburg.de Lines: 32 Path: biosci!news.stanford.edu!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!newsfeed.internetmci.com!194.162.162.196!newsfeed.nacamar.de!uni-erlangen.de!uni-wuerzburg.de!not-for-mail ELADER@AMBION.COM wrote: > Bernard Murray wrote: >> No, I don't think so ... or not unless the poster wants to *sell* >> the resulting solution. Simply preparing it for your own use is >> just fine and doesn't break the patent. Sorry Ambion. > > NOPE! Unfortunately, that is simply not true. A patent covers *all* rights to > a technique and formulation. Do you think that it would be legal for you to > grow Taq in your lab for your own use? I know several people who do this. You can get the clones from ATCC. That said, it appears that the original preparation by Chomczynski is *not* patented, despite your claims. As far as I can see, the IBM patent server turns up no patent on the Guanidinium-phenol mixture hold by Ambion. I found several recent patents by HRI Research and one patent by Chomczynski himself. What surprises me a little is the date on these patents. As far as I know, at least in Germany you cannot patent something that has already been published (i.e. you must patent it first and publish it afterwards). The patent by Chomczynski was filed 1992, whereas his publication appeared in Anal. Biochem. in 1987. Disclaimer: IANAL. --Cornelius. -- /* Cornelius Krasel, U Wuerzburg, Dept. of Pharmacology, Versbacher Str. 9 */ /* D-97078 Wuerzburg, Germany email: phak004@rzbox.uni-wuerzburg.de SP4 */ /* "Science is the game we play with God to find out what His rules are." */ From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!news.stanford.edu!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!dallas-news-feed2.bbnplanet.com!news.bbnplanet.com!worldfeed.gte.net!intgwlon.nntp.telstra.net.MISMATCH!meganews!wa.nntp.telstra.net!nsw.nntp.telstra.net!news.syd.connect.com.au!news.mel.connect.com.au!harbinger.cc.monash.edu.au!pellew.ntu.edu.au!sun1.menzies.su.edu.au!pearly From: Pearly Harumal Newsgroups: bionet.molbio.methds-reagnts Subject: Rapid cDNA synthesis - HELP! Date: Tue, 4 Aug 1998 08:33:42 +0930 Organization: Northern Territory University Lines: 29 Message-ID: Reply-To: Pearly Harumal NNTP-Posting-Host: 192.94.208.4 Mime-Version: 1.0 Content-Type: TEXT/PLAIN; charset=US-ASCII Hello out there, I'm trying to construct a cDNA library from very minute amounts of mRNA. I've tried to PCR amplify single stranded cDNA and then blunt end clone into a vector. The two methods of syntheses which I have attempted include i) G-tailing of the first strand prior to PCR and ii) ligation of an anchor molecule (short oligo with a restriction site) to the first strand before PCR. Numerous attempts at these methods have failed. If anyone has heard of or tried a protocol for rapid double stranded cDNA synthesis which doesn't involve the use of a kit and which doesn't involve too many steps (as I'm starting with very tiny amounts of material and can easily lose my sample), could you please help me out. This is fairly urgent. Thank you in advance! Regards Pearly Please reply via email: pearly@menzies.su.edu.au From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!SLIP.NET!grizzly From: grizzly@SLIP.NET (Michael Sherrell) Newsgroups: bionet.molbio.methds-reagnts Subject: Sequencers/synthesizers Date: 3 Aug 1998 16:06:37 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 55 Sender: daemon@net.bio.net Distribution: world Message-ID: <01BDBEF8.582616E0@oak-pm1-50-178.dialup.slip.net> NNTP-Posting-Host: net.bio.net I have a number of peptide and oligo synthesizers and sequencers for = sale: Licor 4200S-2 two-laser Sequencer, 4 mos. old Licor 4000L sequencer, ~$30K PerSeptive 9050, ~$6K PerSeptive Expedite 8909, <=3D $14K ABI 394, rebuilt, warranteed, Oligonet-ready, ~$12K ABI 394, rebuilt, warranteed, non-Oligonet, ~$11K ABI 391, rebuilt, warranteed, $7K ABI 430, rebuilt, warranteed, ~$12K ABI 431, ~$14K ABI 432 Synergy ABI 433, rebuilt by ABI, warranteed, < $40K ABI 373 classic, $10,500 ABI 373 stretch, 5-filter, 36-lane, $29K ABI 477, <=3D $10K ABI Catalyst 800 ABI 120, 130, $2.5K [We rebuild valve blocks for ABI 430, 431 and 39x @ $65/port, 90-day = warranty] also: LC-MS: Finnigan TSQ 7000, ~$200K Fisons VG 2000, <$100K Finnigan MAT 900, <$50K Finnigan MAT 90, ~$45K =09 MALDI-TOF: HP, masses to 500 KDa, lightly used, <=3D$60K Finnigan Laser MAT 2000, <$40K Other expensive hi-tech items: Bio-Dot sub-microliter 8-channel aspirate/dispense system (typically = 96-well microplate source, glass slide, microwell plate or membrane = target), < 1 year old Molecular Devices 445SI-MAC Phosphorimager, ~ 3 years old, currently = operating and under maintenance contact I also have available a few other synthesizers and sequencers and a = wide selection of HPLCs, mass specs, robots and other lab instruments. Please contact me to discuss any of these items, or if you have any = items you might like to sell. Michael Sherrell Grizzly Analytical (USA) 707 887 2919/fax 707 887 9834 www.grizzlyanalytical.com From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!news.stanford.edu!newsfeed.concentric.net!WCG!news-hub.interserv.net!news.sprynet.com!not-for-mail From: "Deborah" Newsgroups: bionet.molbio.methds-reagnts Subject: Origene's DuPLEX Yeast two-hybrid system Date: Mon, 3 Aug 1998 11:11:33 -0500 Organization: Sprynet News Service Lines: 5 Message-ID: <6q4nli$fh7$1@juliana.sprynet.com> Reply-To: "Deborah" NNTP-Posting-Host: hdn88-003.hil.compuserve.com X-Newsreader: Microsoft Outlook Express 4.71.1712.3 X-MimeOLE: Produced By Microsoft MimeOLE V4.71.1712.3 Does anyone who's used OriGene's DupLEX Yeast two-hybrid system have any comments about it? Thanks. My e-mail is: deborahwilkinson@sprynet.com From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!IMM2.IMM.UTH.TMC.EDU!dhavilan From: dhavilan@IMM2.IMM.UTH.TMC.EDU ("David L. Haviland, Ph.D.") Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Recipe for Phenol:guanidinium mix? Date: 3 Aug 1998 10:24:27 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 54 Sender: daemon@net.bio.net Distribution: world Message-ID: <3.0.32.19980803122051.006e8758@imm2.imm.uth.tmc.edu> NNTP-Posting-Host: net.bio.net At 15:12 8/3/98 GMT, ELADER@AMBION.COM wrote: >I >> > E. >> >> No, I don't think so ... or not unless the poster wants to *sell* >> the resulting solution. Simply preparing it for your own use is >> just fine and doesn't break the patent. Sorry Ambion. >> >> Bernard >> -- Unfortunately, that is simply not true. A patent covers *all* rights to a > >technique and formulation. Do you think that it would be legal for you to >grow Taq in your lab for your own use? Now, whether a company chooses to take >legal action against someone in violation of their patent is another matter. >Except as an 'example', suing an academic lab for infringement wouldn't be >worth the companies time (not to mention being bad for customer relations) >because there's virtually no damages to be collected to offset legal fees. Umm.. then why are the clones for Taq polymerase available from ATCC? ATCC 40336 is a phage encoding the cDNA for Taq and ATCC 67421 and 67422 are phagmids encoding two parts of Taq. Instructions are supplied for taking the two inserts of 421 and 422 to make a complete cDNA. It is all on the web page. And I vaguely recall a email note posted to this group within the last year (someone from Yale???) who stated that a proofreading version had been placed with ATCC as well. Just use "Taq" in the ATCC web search area of bacteria and clones. In any case, if we weren't supposed to be able to make our own (if we wanted) why would they be avialable through ATCC? Kinda dumb to expect that no one would obtain the clones and *not* make any of it... Of course the idea goes that what we get from companies would be cleaner more cost effective that trying to make it ourselves. It boils down that if I wanted to make it for my lab, I can. If I then wanted to sell what I made to the other labs on the hall, I would then garner the wrath of Roche and all the others that already over charge us for Taq as it is. 'bout every two years this discussion crops up... David ============================= David L. Haviland, Ph.D. Asst. Prof. Immunology University of Texas - Houston, H.S.C. Institute of Molecular Medicine 2121 W. Holcombe Blvd. Houston, TX 77030 Internet:"dhavilan@imm2.imm.uth.tmc.edu" Voice: 713.500.2413 FAX: 713.500.2424 ------------------------------------------------------ Never take life seriously. Nobody gets out alive anyway. ============================= From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!news.stanford.edu!logbridge.uoregon.edu!news2.ais.net!jamie!ais.net!ameritech.net!uunet!in3.uu.net!news.rt66.com!not-for-mail From: jparn@rt66.com (Sam Jerk) Newsgroups: bionet.molbio.methds-reagnts Subject: AMAC Co. Date: Mon, 03 Aug 1998 14:42:46 GMT Organization: Rt66.COM, New Mexico's #1 ISP Lines: 6 Distribution: world Message-ID: <35c5cbd0.163241632@news.rt66.com> NNTP-Posting-Host: pmg17.rt66.com Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Newsreader: Forte Agent 1.5/32.451 I used to buy monoclonal antibodies and their magnetic beads from AMAC, Inc. Is that company still in business or bought out by other company? sam From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!news.stanford.edu!newsfeed.berkeley.edu!newsxfer3.itd.umich.edu!news-peer.gip.net!news.gsl.net!gip.net!newsfeed.internetmci.com!204.238.120.130!news-feeds.jump.net!nntp2.dejanews.com!nnrp1.dejanews.com!not-for-mail From: ELADER@AMBION.COM Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Recipe for Phenol:guanidinium mix? Date: Mon, 03 Aug 1998 16:19:49 GMT Organization: Deja News - The Leader in Internet Discussion Lines: 30 Message-ID: <6q4nv5$b9q$1@nnrp1.dejanews.com> References: <35bd89e6.2551097@news.cica.es> <6pnhc0$8qn$1@bubba.NMSU.Edu> <6pu16e$fpk$1@nnrp1.dejanews.com> NNTP-Posting-Host: 208.240.147.82 X-Article-Creation-Date: Mon Aug 03 16:19:49 1998 GMT X-Http-User-Agent: Mozilla/4.04 [en] (Win95; U ;Nav) > > No, I don't think so ... or not unless the poster wants to *sell* > the resulting solution. Simply preparing it for your own use is > just fine and doesn't break the patent. Sorry Ambion. > > Bernard > -- > Bernard P. Murray, PhD > Dept. Cell. Mol. Pharmacol., UCSF, San Francisco, USA > NOPE! Unfortunately, that is simply not true. A patent covers *all* rights to a technique and formulation. Do you think that it would be legal for you to grow Taq in your lab for your own use? Now, whether a company chooses to take legal action against someone in violation of their patent is another matter. Except as an 'example', suing an academic lab for infringement wouldn't be worth the companies time (not to mention being bad for customer relations) because there's virtually no damages to be collected to offset legal fees. There's even something called contributory infringement. If you tell someone how to violate a patent (e.g.`psst, check out this formula for TriZol), you are also breaking the law. Clearly, patent law and the openness and coopertivity in academia are quite alien to each other. Eric -----== Posted via Deja News, The Leader in Internet Discussion ==----- http://www.dejanews.com/rg_mkgrp.xp Create Your Own Free Member Forum From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!news.stanford.edu!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!newsfeed.internetmci.com!152.163.199.19!portc03.blue.aol.com!portc02.blue.aol.com!pitt.edu!not-for-mail From: pxpst2@SPAM.SUXS.unixs.cis.pitt.edu (Peter) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Protection of n-terminus during SDS-PAGE? Date: Mon, 03 Aug 1998 11:41:03 -0500 Organization: University of Pittsburgh Lines: 26 Distribution: world Message-ID: References: NNTP-Posting-Host: pelli.pathology.pitt.edu Mail-Copies-To: pxpst2@SPAM.SUXS.unixs.cis.pitt.edu X-Newsreader: MT-NewsWatcher 2.4.4 In article , RDUDLEY@PGH.AUHS.EDU (Richard Dudley) wrote: > I once read somewhere that if you want to sequence proteins after SDS-PAGE, you should use thioglycolic acid during electrophoresis to protect the N-terminus. Has anyone ever tried this, or does anyone have a reference for this? > > Alternatively, does anyone have soem good advice to offer on protecting the N-terminus? This is completely unneeded if you allow the gel to polymerize overnight. Remeber that free radicals are short lived and will disappear quickly. If you can not wait then pre run you gels for about a half hour and the free radicals will be well ahead of any protein bands. Peter This is all on the assumption that you have sequencing in mind -- "Don't you eat that yellow snow watch out where the Huskies go" FZ --------------------------------------------------------------------- From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!news.stanford.edu!logbridge.uoregon.edu!news2.ais.net!jamie!ais.net!NewsNG.Chicago.Qual.Net!newsspool.doit.wisc.edu!news.doit.wisc.edu!rumenbugs.dfrc.wisc.edu!user From: chriso@dfrc.wisc.edu (Chris Odt) Newsgroups: bionet.molbio.methds-reagnts Subject: FISH questions Date: Mon, 03 Aug 1998 11:19:53 -0500 Organization: USDA/Dairy Forage Research Center Lines: 9 Message-ID: NNTP-Posting-Host: rumenbugs.dfrc.wisc.edu Hello.......I am developing a technique for our lab where we will identify various species of bacteria via fluorescently labeled DNA oligo probes. I am spotting 2-4 ul spots of culture suspension on 6 well, teflon coated Cell-Line slides, that have been previously "cleaned" with 10% KOH and "subbed" with gelatin and chromium. My question is, can these slides be re-used? If so, how should they be treated, etc., before I clean and sub them again? Thanks to all for any suggestions.........Chris Odt From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!uthct.edu!shaun From: shaun@uthct.edu (Shaun D. Black) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Blotting onto PVDF Date: 3 Aug 1998 09:12:04 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 29 Sender: daemon@net.bio.net Distribution: world Message-ID: <9808031609.AA02918@athena.uthct.edu> NNTP-Posting-Host: net.bio.net Hi All, pdxkgs@pdn1.gene.nottingham.ac.uk (Karen Spink) wrote... >Has anyone had any problems Western blotting onto PVDF in CAPS buffer? I am >trying to get a sequence on my protein and it appears that the efficiency >of transfer is letting me down. Could it be the buffer, (10mM CAPS, 10% >methanol, pH 11) ? I have had no problems blotting onto nitrocellulose >using tris-glycine buffers. Why not just blot to PVDF with Towbin buffer (tris/Gly)? We do this quite often to determine a sequence, and it works just fine. I'm always a bit concerned about the pH 11 of the CAPS system, as it might promote peptide chain scission, deamidation of Asn/Gln, etc. You'd think that all the Gly would be a problem with the Towbin system, but if you wash the blot well after staining (which you'd likely do anyway), essentially all the Gly is gone by then. We never see background Gly peaks on cycle 1 of sequencing. I hope this helps you a bit. Best regards, Shaun =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-= = Shaun D. Black, PhD | Internet e-mail address: shaun@uthct.edu = = Dept. of Biochemistry | University of Texas Health Center at Tyler = = Tyler, TX 75710 | World Wide Web: http://psyche.uthct.edu = =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-= From owner-methds-reagnts@net.bio.net Sun Aug 02 23:00:00 1998 Path: biosci!news.stanford.edu!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!howland.erols.net!portc02.blue.aol.com!pitt.edu!not-for-mail From: pxpst2@SPAM.SUXS.unixs.cis.pitt.edu (Peter) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: While we're on Acrylamide.... Date: Mon, 03 Aug 1998 11:58:59 -0500 Organization: University of Pittsburgh Lines: 73 Message-ID: References: <6q0r1j$32e$1@nnrp1.dejanews.com> <35C4E44A.2C43@bcc.orst.edu> NNTP-Posting-Host: pelli.pathology.pitt.edu Mail-Copies-To: pxpst2@SPAM.SUXS.unixs.cis.pitt.edu X-Newsreader: MT-NewsWatcher 2.4.4 In article <35C4E44A.2C43@bcc.orst.edu>, fordb@bcc.orst.edu wrote: > Peter wrote: > > > > In article <6q0r1j$32e$1@nnrp1.dejanews.com>, weazel@blarg.net wrote: > > > > > Any of you chemistry-saavy types know what sort of nastiness one is exposedt > > > to from BURNING acrylamide? Say....when your gel box arcs and catches on > > > fire? Not that this has ever happened to me, of course (heh heh!) > > > > > > > An arc would not be sufficent to cause the acryilamide to burn because > > Arylamide is not flamable by nature. But if you placed the gel in a bomb > > calorimeter and ignited it, you would find CO, CO2, and CN. > > > > The original question says acrylamide, but of course most if not all of > a mature gel will be polyacrylamide. Even if polyacrylamide were > flammable, it would be very hard to openly ignite a polyacrylamide gel > containing 90 to 95% water. But, if we were really talking about the > monomer, then consider that the heating of unpolymerized acrylamide > solid to its melting point leads to rapid, and if the quantity involved > is larger, to explosive polymerization. This is not what was asked. Man are you just being wordy or what? As for what you are saying...What unadulterated garbage. since I have no intention of teaching you about reaction kinectics, Suffice to say that as a gas the molecules that will not polymerize faster than a liquid. > This is perhaps another argument > for using the, available and actually less costly, pre-prepared 40% > acrylamide/bis-acrylamide solutions, for example from Amresco-- (no > connection to me)-- and store in the fridge after opening. A lab fire is > bad enough without extra explosions. More words with little said > > The bomb calorimetry seems a bit incomplete here. CO (carbon monoxide, > often a fuel of industrial origin and use) will readily burn to CO2 in > the calorimeter. CN or C2N2 (cyanogen) "burns with a pink flame" > according to the Merck Index, the complete combustion products of which > I would guess to be CO2 again and one or another nitrogen oxide such as > NO or NO2. Well I will admit that NO2 should be included but while we are at it, PNAs will be formed as well and the amount of each product formation will be dependant on the pressure and the percent oxygen in the gas phase of the Bomb. > > If by chance the accidental burning of polyacrylamide led to the > evolution of CN or HCN then the questioner should be concerned. But a > good fire (supplying the oxygen and heat of activation) would likely > leave little free CN... cyanogen and oxygen produce one of the hottest > flames known-- well above oxyacetylene or oxyhydrogen torches in > temperature. Of course the toxicity of CN (similar to cyanide) keeps it > even from consideration as a practical flame, anyway these days there > are much better ways to heat stuff way hot! More words with little said. Once again Bryon's mouth is moving right along. Peter -- "Don't you eat that yellow snow watch out where the Huskies go" FZ --------------------------------------------------------------------- From owner-methds-reagnts@net.bio.net Mon Aug 03 23:00:00 1998 Path: biosci!agate!newsfeed.berkeley.edu!howland.erols.net!news.idt.net!newsin.iconnet.net!rutgers!news-relay.ncren.net!nntp-xfer.ncsu.edu!sjhogart From: sjhogart@cc01du.unity.ncsu.edu (Susan Jane Hogarth) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: While we're on Acrylamide.... Date: 3 Aug 1998 21:24:00 GMT Organization: North Carolina State University Lines: 29 Message-ID: References: <35C61DB8.633@chugaibio.com> NNTP-Posting-Host: cc01du.unity.ncsu.edu X-Newsreader: slrn (0.9.5.1 UNIX) In article <35C61DB8.633@chugaibio.com>, Dom Spinella wrote: >To Bryan and Peter: > >Have you guys ever considered careers in professional wrestling? It's >been entertaining watching you two young bucks sharpen your antlers but, >as we are now into a new month on this well-worn thread, maybe the time >has come to call an end to the rutting season. *snicker* *My* favorite part was when they each starting signing their names "X, PhD _candidate_" (emphasis mine, of course). Goodness, does it *get* more pathetic than that!? ;-) > Neither of you are quite >ready to take over the herd just yet, and as you mature in this game >you're likely to find that all the ad hominem attacks and egotistical >strutting aren't going to get you into the National Academy after all. >You'll just earn yourselves a reputation as arrogant a**holes -- and >then you'll wonder why you can't attract good post docs or technicians. Glad to hear you say this, Dom. I was starting to feel a little disadvantaged, 'cause I don't even *have*... ummm... _horns_. Now I feel better :-) -- Susan ( http://www4.ncsu.edu/unity/users/s/sjhogart/public/home.html ) "It is certainly true that education can do only so much, and rarely makes any change that depends on the education of the intellectually deficient." S.Hasting From owner-methds-reagnts@net.bio.net Mon Aug 03 23:00:00 1998 Message-ID: <35C6B4C2.65C9AAE4@chclu.chemie.uni-konstanz.de> Date: Tue, 04 Aug 1998 09:14:09 +0200 From: "Frank O. Fackelmayer" Reply-To: fof1@chclu.chemie.uni-konstanz.de X-Mailer: Mozilla 4.04 (Macintosh; I; PPC) MIME-Version: 1.0 Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Q: Can you random prime a 250bp PCR product? References: <3.0.32.19980803094423.006e0c00@imm2.imm.uth.tmc.edu> Content-Type: text/plain; charset=iso-8859-1 Content-Transfer-Encoding: 8bit NNTP-Posting-Host: 134.34.126.40 X-Trace: 4 Aug 1998 09:11:52 +0100, 134.34.126.40 Organization: University of Constance, Germany Lines: 41 Path: biosci!agate!newsfeed.berkeley.edu!howland.erols.net!frankfurt.de.uu.net!news.uni-stuttgart.de!news.belwue.de!news.uni-konstanz.de!134.34.126.40 At 03:02 8/1/98 GMT, ELADER@AMBION.COM wrote: >>Frank, this really does not work as relaibly as random priming. I know, I don´t doubt you know what you´re talking about. But so do I. >> I am >>product manager for such a product. well.... >> Problem is that the efficiency of priming >>is lower since you have only one shot at it. This is not really a problem as primers are in excess. >> Better yet to label it with Taq, >>3 cold, 1 hot dNTP, 1 primer, bunch of cycles, 20 ng template. David L. Haviland, Ph.D. replied: > > Curious, unless I read it wrong, this isn't much different that what your > colleage originally proposed. Did you mean to use 2 oligos? Then I'd > agree one can get a hot probe this way, but one can also get a contaminated > machine... for the sake of everyone's sanity, we don't allow radioactive > PCRs in our lab as the risk of having but one slob doesn't outweigh the > need of a super hot probe. Yes, that´s exactly why I proposed to use Klenow at room temperature instead of making "a bunch o´cycles" in a PCR machine. Thanks, David. In my hands the label in a probe prepared in the way I proposed is more than enough for most applications. HOWEVER: If you usually do radioactive PCRs in your machine, you could do PCR labelling, of course. It might then be interesting to check the radioactivity in the heating block of your machine after the PCR, especially if you´re using these "ultra-thin" PCR tubes. It seems to me they´re kind of leaky. Frank From owner-methds-reagnts@net.bio.net Mon Aug 03 23:00:00 1998 Path: biosci!agate!newsfeed.berkeley.edu!howland.erols.net!newsfeed.internetmci.com!204.71.76.137!news.campus.mci.net!uky.edu!not-for-mail From: student@pop.uky.edu (student) Newsgroups: bionet.molbio.methds-reagnts Subject: plamid prep Date: 4 Aug 1998 13:21:11 GMT Organization: University of Kentucky Lines: 5 Message-ID: <6q71s7$98b$1@service3.uky.edu> NNTP-Posting-Host: 128.163.193.143 Mime-Version: 1.0 Content-Type: Text/Plain; charset=US-ASCII X-Newsreader: WinVN 0.99.7 I need to prepare 50mg plasmid DNA. Last year, I prepared 20mg of that which took me 2 whole months. I really do not want to do it again by myself (it made me sick). Is there anyone know any commercial company that could do this for me (and better with good price)? Thanks. Wilson (wzhou0@pop.uky.edu) From owner-methds-reagnts@net.bio.net Mon Aug 03 23:00:00 1998 Path: biosci!RD.GRAME.FR!coafuojei83 From: coafuojei83@RD.GRAME.FR (def1) Newsgroups: bionet.molbio.methds-reagnts Subject: Internet-Marketing & Softwares Date: 4 Aug 1998 05:40:02 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 31 Sender: daemon@net.bio.net Distribution: world Message-ID: <199808044108AAA15199@kilometd.cse.cau.ac.kr> NNTP-Posting-Host: net.bio.net ****ONE OF THE MOST POWERFUL FORMS OF ADVERTISING KNOWN TODAY **** There is a method of marketing that costs pennies but has the same effect as direct postal mail! You can now compete with the big boys, with exposure in MASSIVE NUMBERS, without expensive investments such as those associated with television commercials, infomercials, radio advertising, direct postal mail, or tele-marketing. THE SOLUTION - Direct E-mail Marketing, via the Information Highway @ a fraction of 1cent a contact Putting your advertisement in front of 100,000, 500,000, 1,000,000 or even 50,000,000 readers can bring your Web site a ton of traffic and sell high volumes of your product(s) in a short period of time. The key to it all is having the proper tools and sending your ad to a clean, well-managed list of recipients, who do not flame and who are genuinely interested. Proper management of our address database reduces the number of undeliverables. We automatically include an additional 25% to cover bad addresses. The bottom line is that we want to make your Direct Marketing campaign a successful one. We have created a complete package including: millions of E-mail addresses, 'How-To' reports, Bulk Mail software & handy utilities, our 'secrets' to success (including the pitfalls you definitely want to avoid), phone support and a CD-ROM holder (holds 40 in rolodex fashion) to organize and maintain your addresses and other CD's. For more information or to order, please call 512-647-7138 and leave your name, phone number &/or E-mail address. o From owner-methds-reagnts@net.bio.net Mon Aug 03 23:00:00 1998 Path: biosci!agate!newsfeed.berkeley.edu!howland.erols.net!woodstock.news.demon.net!demon!news.demon.co.uk!demon!genesys.demon.co.uk!demon.co.uk!duncan From: "Dr. Duncan Clark" Newsgroups: bionet.molbio.methds-reagnts Subject: Patents: was Recipe for Phenol:guanidinium mix? Date: Tue, 4 Aug 1998 09:56:32 +0100 Organization: GeneSys Ltd. Distribution: world Message-ID: References: <3.0.32.19980803122051.006e8758@imm2.imm.uth.tmc.edu> Reply-To: "Dr. Duncan Clark" NNTP-Posting-Host: genesys.demon.co.uk X-NNTP-Posting-Host: genesys.demon.co.uk:158.152.17.110 X-Trace: news.demon.co.uk 902229687 nnrp-08:6108 NO-IDENT genesys.demon.co.uk:158.152.17.110 X-Complaints-To: abuse@demon.net MIME-Version: 1.0 X-Newsreader: Turnpike (32) Version 4.00 beta 9 Lines: 59 In article <3.0.32.19980803122051.006e8758@imm2.imm.uth.tmc.edu>, David L. Haviland, Ph.D. writes >It boils down that if I wanted to make it for my lab, I can. If I then >wanted to sell what I made to the other labs on the hall, I would then >garner the wrath of Roche and all the others that already over charge us >for Taq as it is. What it also comes down to is that the process for using the enzyme is also patented. When I sell licensed Taq it is for use for research purposes only and for use on authorised machines only ie a 10 line license disclaimer. http://www.dnamp.com/LICENSE.HTM. Also check out http://www.perkin-elmer.com/ab/pcrlicensefaq/index.html. Think of it this way. What happens if you use home made enzyme to generate something that you want to patent i.e. you have infringed another patented process to get at what you want. Does that therefore mean your patent application is invalid. Could be an expensive mistake. The issue of whether you are exempt in the US because you hold a government grant has yet to be resolved in court. I suspect the Taq issue will run and run for years from lower court to higher court, appeal and counter appeal, possibly beyond the expiry date of the patent itself. I think something is back in court at the moment. One issue being argued is that research in the US is a commercial business. Someone posted this same statement in another post on a totally different topic the other week. What is the difference between an academic doing research and myself doing research. Unless you publish you won't get grants. Anything you find that is novel invariably has a patent put on it by your college. It's effectively a business. Unless you produce your job is at stake. Remember also that US patent law and European patent laws are different and the Taq pol claims are also different. On a side line is it true in the US that permanent staff build their salaries into the grant application? In the UK academics are paid directly by the college. People employed here off a grant are never permanent staff ie 3 year posts etc. The issue of why strains are in the ATCC is simple. Anyone patenting a recombinant of any sort must deposit it in a culture collection that is signatory to some patent treaty or other. There are different ways of depositing these either allowing everyone access or restricted access. All good fun and the only people that become rich are the lawyers. As a seller of PCR reagents we will never be! Duncan -- The problem with being on the cutting edge is that you occasionally get sliced from time to time.... Duncan Clark DNAmp Ltd. Tel: +44(0)1252376288 FAX: +44(0)8701640382 http://www.dnamp.com http://www.genesys.demon.co.uk From owner-methds-reagnts@net.bio.net Mon Aug 03 23:00:00 1998 Path: biosci!ukl.uni-freiburg.de!janzen From: janzen@ukl.uni-freiburg.de (Christian Janzen) Newsgroups: bionet.molbio.methds-reagnts Subject: mouse IFN typ I ELISA? Date: 4 Aug 1998 03:43:56 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 21 Sender: daemon@net.bio.net Distribution: world Message-ID: NNTP-Posting-Host: net.bio.net Dear netters, does anybody know if there is an ELISA for mouse interferon type I available= ? thanks Janne -------------------------------------------------- Christian Janzen Albert-Ludwigs Universit=E4t Institut f=FCr med. Mikrobiologie und Hygiene Abteilung Virologie Hermann-Herder-Str. 11 D-79104 Freiburg Tel: 49-761-203-6582 janzen@ukl.uni-freiburg.de(Christian Janzen) From owner-methds-reagnts@net.bio.net Mon Aug 03 23:00:00 1998 Path: biosci!daresbury!not-for-mail From: "Wolfgang Schechinger" Newsgroups: bionet.molbio.methds-reagnts Subject: Q Toxicological properties of Wortmannin (from Penicillium fumic Date: 4 Aug 1998 11:08:33 +0100 Organization: Med Clinic iV, Dept. of Pathobiochemistry, Lines: 21 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <6q6mj1$52o@mserv1.dl.ac.uk> Reply-To: wgschech@med.uni-tuebingen.de Comments: Authenticated sender is X-Authentication-Warning: drakkar.med.uni-tuebingen.de: smap set sender to using -f X-mailer: Pegasus Mail for Windows (v2.52) MIME-Version: 1.0 Original-To: methods@dl.ac.uk Hi all, I'm using wortmannin (dissolved in DMSO - is likely to penetrate gloves and skin) for inhibiting PI-3-kinase. IC50 is quite low (5nM), so 1 mg is lasting virtually forever. My stock solution is 1mM. Has anybody out there knowledge to share about intoxication symptoms (the MSDS says nothing about this issue)? Are there long term effects? BTW - I neither want to poison coffe makers, water dispensers, sugar boxes or lovers. Wolfgang ----- usual disclaimers apply * This message is RNAse free - please don't touch! ----- Wolfgang Schechinger University of Tuebingen, Germany email: wgschech@med.uni-tuebingen.de * wwWait: http://www.medizin.uni-tuebingen.de/~wgschech/start.htm ------- From owner-methds-reagnts@net.bio.net Mon Aug 03 23:00:00 1998 Path: biosci!daresbury!not-for-mail From: deepak@bgumail.bgu.ac.il (Deepak Khandka) Newsgroups: bionet.molbio.methds-reagnts Subject: Are there reports of identifying RAPD probe for functional gene ? Date: 4 Aug 1998 10:01:58 +0100 Lines: 16 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <6q6im6$n9@mserv1.dl.ac.uk> Original-To: methods@dl.ac.uk Hi there, I would like to know if there are more reports of identifying RAPD or SCAR marker that represented (as a probe to) a functional gene. I found following reference: Garcia D.K., DharA.K. and Alcivar-Warren A. Molecular analysis of a RAPD marker (B20) reveals two microsatellites and differential mRNA expression in Penaeus vannamei. Molecular Marine Biology and Biotechnology 5(1): 71-83(1996) Deepak Khandka Campus Sede Boker Ben-Gurion University Israel From owner-methds-reagnts@net.bio.net Mon Aug 03 23:00:00 1998 Path: biosci!news.stanford.edu!newsfeed.berkeley.edu!howland.erols.net!surfnet.nl!barba.uci.kun.nl!not-for-mail From: "B. Jansen" Newsgroups: bionet.molbio.methds-reagnts Subject: Precast PAA gels... Date: Tue, 4 Aug 1998 10:55:15 +0200 Organization: Universitair Centrum Informatievoorziening, The Netherlands Lines: 11 Message-ID: <6q6hfs$j50$1@barba.uci.kun.nl> NNTP-Posting-Host: m31-005.azn.nl X-Newsreader: Microsoft Outlook Express 4.72.2106.4 X-MimeOLE: Produced By Microsoft MimeOLE V4.72.2106.4 Hello Bionetters, Does anyone of you know whether there are companies that sell precast polyacrylamide gels for the Biorad Protean II ix Cell Gel system? I use this sytem to isolate small DNA fragments. I just called Biorad, and they don't sell precast gels for this system :( Regards, Bas From owner-methds-reagnts@net.bio.net Mon Aug 03 23:00:00 1998 Path: biosci!news.stanford.edu!newsfeed.berkeley.edu!newsfeed.nyu.edu!btnet-peer!btnet!nntp.news.xara.net!xara.net!rill.news.pipex.net!pipex!server1.netnews.ja.net!bham!med180.bham.ac.uk!user From: noone@cancer.bham.ac.uk (noone) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Protection of n-terminus during SDS-PAGE? Date: Tue, 04 Aug 1998 08:56:39 +0100 Organization: noone Lines: 23 Distribution: world Message-ID: References: NNTP-Posting-Host: med180.bham.ac.uk In article , pxpst2@SPAM.SUXS.unixs.cis.pitt.edu (Peter) wrote: > In article , RDUDLEY@PGH.AUHS.EDU (Richard > Dudley) wrote: > > > I once read somewhere that if you want to sequence proteins after > SDS-PAGE, you should use thioglycolic acid during electrophoresis to > protect the N-terminus. Has anyone ever tried this, or does anyone have a > reference for this? > > Thioglycolic acid will protect your protein from oxidation (i.e. not only the aminoterminus but also Lys sidechains etc.). I would ALWAYS add it if you want to sequence your protein (maybe overcautious but thinking of the cost and effort of protein sequencing definitely worth it). If you want to protect your N-terminus, you also have to make shure that you do your Coomassie stain without acetic acid. I would also recommend that you do not boil your sample before loading. There is quite a good description of how to run SDS-PAGE for sequencing in the BioRad handbook that comes along with their PVDF-membranes. Hope this helps, Peter From owner-methds-reagnts@net.bio.net Mon Aug 03 23:00:00 1998 Path: biosci!news.stanford.edu!logbridge.uoregon.edu!newsfeed.direct.ca!sunqbc.risq.qc.ca!newsflash.concordia.ca!pitt.edu!not-for-mail From: mihalek@formula1.smtp.anes.upmc.edu (Robert M. Mihalek) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Rat anesthesia Date: 4 Aug 1998 15:32:41 GMT Organization: University of Pittsburgh Lines: 30 Sender: -Not-Authenticated-[4283] Distribution: world Message-ID: <6q79ip$4b1$2@usenet01.srv.cis.pitt.edu> References: <35C69566.3E07@med.monash.edu.au> NNTP-Posting-Host: w1311.anes.pitt.edu X-Posted-From: InterNews 1.0.1@w1311.anes.pitt.edu Xdisclaimer: No attempt was made to authenticate the sender's name. In article <35C69566.3E07@med.monash.edu.au> David.Nikolic-Paterson@med.monash.edu.au (David Nikolic-Paterson) writes: > We are looking for an 'Ether alternative' for rat anesthesia, due to > impending Animal ethics bans. > We would like it to be fast acting (less than 3mins) and will keep the > rat sedated for at least 5-10 mins. (preferably not longer than 20 mins) > We have trialed Halothane but find the rats recover too rapidly and if > the dose is increased they do not recover. (We do not use a nebulizer). > Any suggestions or recommendations would be greatly appreciated. You could try metofane (methoxyflurane: 2,2-dichloro-1,1-difluoroethyl methyl ether), unless this modified ether violates the "ether ban." (By the way, what is this ether ban based on?). Perhaps you could work out a dose of pentobarbital (given i.v.) that would knock them out for 5 or 10 minutes. I'd suggest starting with 35 mg/kg. Bob Mihalek================================================== please remove the name of the RACE SERIES for e-mail replies ============================================================= From owner-methds-reagnts@net.bio.net Mon Aug 03 23:00:00 1998 Path: biosci!news.stanford.edu!newsfeed.berkeley.edu!news.maxwell.syr.edu!cpk-news-hub1.bbnplanet.com!chicago-news-feed2.bbnplanet.com!news.bbnplanet.com!news.itis.com!aiyar.dyn.ml.org!aiyar From: aiyar@aiyar.dyn.ml.org (Ashok Aiyar) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Q:XL1RED Date: 4 Aug 1998 19:37:15 GMT Organization: Sugden Lab, McArdle Laboratory for Cancer Research, UW-Madison Lines: 18 Distribution: bionet Message-ID: References: <6q7a0q$28r@mserv1.dl.ac.uk> Reply-To: aiyar@aiyar.ml.org NNTP-Posting-Host: mptc1-cas-37.dial.midplains.net X-Newsreader: slrn (0.9.5.1 UNIX) On 4 Aug 1998 16:40:10 +0100, M.Albrecht wrote: >Has anyone here in this newsgroup ever tried to use XL1red competent cells >from Stratagene to do mutagenesis? It is quiet expensive so I would like to >know whether it is as good as Stratagene says. I tried XL1red a few years ago. I passaged a plasmid in XL1red for about 30 generations, and then sequenced ~500 bp in a dozen clones. Only one of them had a mutation within the sequenced region. Perhaps your experience will be different. Later, Ashok -- Ashok Aiyar, Ph.D. McArdle Laboratory for Cancer Research aiyar@aiyar.ml.org From owner-methds-reagnts@net.bio.net Mon Aug 03 23:00:00 1998 Path: biosci!news.stanford.edu!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!cpk-news-hub1.bbnplanet.com!london-news-feed1.bbnplanet.com!news.bbnplanet.com!diablo.theplanet.net!rill.news.pipex.net!pipex!sun4nl!surfnet.nl!newshost.vu.nl!not-for-mail From: Maria Sol Rodriguez Pena Newsgroups: bionet.molbio.methds-reagnts Subject: Re: fluoresence calcium measurements Date: Tue, 04 Aug 1998 19:59:51 +0200 Organization: Vrije Universiteit Amsterdam Lines: 10 Message-ID: <35C74C19.2912@chem.vu.nl> References: <3.0.32.19980730133802.00698cbc@imm2.imm.uth.tmc.edu> NNTP-Posting-Host: macdyn151.chem.vu.nl Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 3.01-C-MACOS8 (Macintosh; I; PPC) To: "David L. Haviland, Ph.D." Hi David, Actually you may know if the cells take Fura-3 looking at the max signal you get with a detergent such as NP-40. With CHO cells I use to get 3 to 5 times more fluorescence in loaded cells so, I asumed the cells had enough dye inside. Greatings Marisol From owner-methds-reagnts@net.bio.net Mon Aug 03 23:00:00 1998 Path: biosci!news.stanford.edu!newsfeed.berkeley.edu!newsxfer3.itd.umich.edu!news-peer.sprintlink.net!news-backup-west.sprintlink.net!news.sprintlink.net!204.238.120.130!news-feeds.jump.net!nntp2.dejanews.com!nnrp1.dejanews.com!not-for-mail From: ELADER@AMBION.COM Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Recipe for Phenol:guanidinium mix? Date: Tue, 04 Aug 1998 18:03:47 GMT Organization: Deja News - The Leader in Internet Discussion Lines: 15 Message-ID: <6q7ie2$6ok$1@nnrp1.dejanews.com> References: <3.0.32.19980803122051.006e8758@imm2.imm.uth.tmc.edu> NNTP-Posting-Host: 208.240.147.82 X-Article-Creation-Date: Tue Aug 04 18:03:47 1998 GMT X-Http-User-Agent: Mozilla/4.04 [en] (Win95; U ;Nav) In article <3.0.32.19980803122051.006e8758@imm2.imm.uth.tmc.edu>, dhavilan@IMM2.IMM.UTH.TMC.EDU ("David L. Haviland, Ph.D.") wrote: > At 15:12 8/3/98 GMT, ELADER@AMBION.COM wrote: > Umm.. then why are the clones for Taq polymerase available from ATCC? I have no idea. Actually, the patent may not cover the polymerase, only the use of it in the PCR. So, you may be free to own it, but not use it. Kinda stupid, I know. The distinction between personal use and selling it just does not exist in the legal sense of the law. Eric. -----== Posted via Deja News, The Leader in Internet Discussion ==----- http://www.dejanews.com/rg_mkgrp.xp Create Your Own Free Member Forum From owner-methds-reagnts@net.bio.net Mon Aug 03 23:00:00 1998 Path: biosci!MOLECULE.BIO.UTS.EDU.AU!michelle From: michelle@MOLECULE.BIO.UTS.EDU.AU (Michelle Gleeson) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Heat Shock DH5a Date: 4 Aug 1998 15:23:46 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 39 Sender: daemon@net.bio.net Distribution: world Message-ID: References: NNTP-Posting-Host: net.bio.net Hi, Well, in the lab I come from, people have been known to take short cuts and skip the heat shock altogether (using DH5a). It works OK, maybe not quite as many clones. I'm sure there is a reference around about it, but I don't have it on hand. I was also under the impression that heat shock makes transient pores in the membrane, though not in the same was as electroporating. AATAGGCAATGGGCCCCATATAGGAACACAGAGCTGCATGCGTATTGCATGCCAGGCTATTCATTCCAGGGAAA Michelle Gleeson Molecular Parasitology Unit Ph: (02) 9514 4043 University of Technology Fax:(02) 9514 4003 Westbourne St Gore Hill, NSW 2065 michelle.gleeson@uts.edu.au AUSTRALIA TTATCCGTTACCCGGGGTATATCCTTGTGTCTCGACGTACGCATAACGTACGGTCCGATAAGTAAGGTCCCTTT On Tue, 4 Aug 1998, Keith Rand wrote: > In article <19980803113120.468f1e43.in@genvec.com>, "Lou Cantolupo" > wrote: > > > Settle an argument for me. Does the heat shock step in a CaCl2 > > transformation of DH5a (or whatever bug of choice) activate heat shock > proteins for > > recovery or make the cells more porous? > > > Well, it seems to be generally believed that the heat shock is involved in > some way with the entry of the DNA into the cells. So 'making the cells > more porous' would be the correct answer. It would be interesting to hear > the case for the induction of heat shock proteins, but I don't think > anyone has reported an increase in viability due to the heat shock. > > -- > Keith Rand, Sydney Australia > > From owner-methds-reagnts@net.bio.net Mon Aug 03 23:00:00 1998 Path: biosci!news.stanford.edu!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!news.bbnplanet.com!newsfeed.corridex.com!ameritech.ais.net!jamie!ais.net!ameritech.net!uunet!in1.uu.net!news.blarg.net!not-for-mail From: weazel@animal.blarg.net (Beth Wapelhorst) Newsgroups: bionet.molbio.methds-reagnts Subject: Hamilton Robot Date: 4 Aug 1998 14:39:01 -0700 Organization: Blarg! Online Services - 206/441-9109 Lines: 16 Message-ID: <6q7v1l$8uo$1@animal.blarg.net> NNTP-Posting-Host: animal.blarg.net X-Newsreader: NN version 6.5.1 (NOV) We've recently gotten a Hamilton robot (used) in our lab and we wanna use it for aliquoting DNA into 384 well plates and also setting up PCR reactions. Anyone use one for these purposes? I wanted to know what sort of washing steps people used in between samples. Do you just use lots of water, or do you do a bleach step? Or something else? thanks! beth weazel@blarg.net -- sugar beth wapelhorst "I don't think I'm alone when I say I'd weazel@blarg.net like to see more and more planets fall www.blarg.net/~weazel under the ruthless domination of our solar system." - Jack Handey From owner-methds-reagnts@net.bio.net Mon Aug 03 23:00:00 1998 Path: biosci!news.stanford.edu!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!news.bbnplanet.com!newsfeed.corridex.com!ameritech.ais.net!jamie!ais.net!ameritech.net!uunet!in1.uu.net!news.blarg.net!not-for-mail From: weazel@animal.blarg.net (Beth Wapelhorst) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: While we're on Acrylamide.... Date: 4 Aug 1998 14:35:20 -0700 Organization: Blarg! Online Services - 206/441-9109 Lines: 18 Message-ID: <6q7uqo$8f9$1@animal.blarg.net> References: <6q0r1j$32e$1@nnrp1.dejanews.com> <35C4E44A.2C43@bcc.orst.edu> <35C66B68.2FA1@bcc.orst.edu> NNTP-Posting-Host: animal.blarg.net X-Newsreader: NN version 6.5.1 (NOV) you boys are so silly! I'll make it simple for ya: polyacrylamide + urea + H2O + O2 turns into what when an arc of electricity is put into the equation? Please answer in 1 or 2 sentences :) And yes, acrylamide does burn in this circumstance and it smells really gnarly - hence my question. And no, it's not just the plastic from the apparatus that I am smelling :) Heh, I lied before about it never happening to me - I've set about 10 gels on fire due to a finicky apparatus (I've got a new one now!) beth -- sugar beth wapelhorst "I don't think I'm alone when I say I'd weazel@blarg.net like to see more and more planets fall www.blarg.net/~weazel under the ruthless domination of our solar system." - Jack Handey From owner-methds-reagnts@net.bio.net Mon Aug 03 23:00:00 1998 Path: biosci!news.stanford.edu!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!cpk-news-feed4.bbnplanet.com!cpk-news-feed1.bbnplanet.com!news.bbnplanet.com!fcs280s.ncifcrf.gov!not-for-mail From: pnh@ncifcrf.gov (Paul N Hengen) Newsgroups: bionet.molbio.methds-reagnts Subject: Re: Homemade chemiluminescent reagents for alk phos detection? Date: 4 Aug 1998 21:32:47 GMT Organization: NCI-FCRDC Frederick Biomedical Supercomputing Center Lines: 25 Message-ID: <6q7ulv$mnf3@ncisun1-nf0.ncifcrf.gov> References: <35c0fa98.27763683@news.iastate.edu> NNTP-Posting-Host: 129.43.6.29 X-Newsreader: TIN [UNIX 1.3 950824BETA PL0] > Anybody out there have the recipe for Alk. phosph. detection? Go to the Tropix Homepage and download their on-line manual for the Southern Light Detection Kit. Start from there. Also see: @article{Hengen1997Augtibs, author = "P. N. Hengen", title = "Methods and reagents - Chemiluminescent detection methods", journal = "Trends in Biochemical Sciences", volume = "22", number = "8", pages = "313-314", month = "August", year = "1997"} -- Paul N. Hengen, Ph.D. National Cancer Institute Laboratory of Experimental and Computation