From owner-plants@net.bio.net Sat Feb 01 22:00:00 1997 Path: biosci!agate!howland.erols.net!vixen.cso.uiuc.edu!uwm.edu!lll-winken.llnl.gov!fnnews.fnal.gov!lakesis.fapesp.br!bee.uspnet.usp.br!swan.uspnet.usp.br!afer From: Fernando Morais Newsgroups: bionet.plants Subject: Wax : ketones Date: Fri, 31 Jan 1997 10:36:54 -0300 Organization: Universidade de Sao Paulo / Brasil Lines: 10 Message-ID: References: <01bc0e04$7a3ff080$c02d74cf@rpiekuto.cac.psu.edu> NNTP-Posting-Host: swan.uspnet.usp.br Mime-Version: 1.0 Content-Type: TEXT/PLAIN; charset=US-ASCII X-Sender: afer@swan.uspnet.usp.br In-Reply-To: I need information about identification of ketones (GC-MS) in epicuticular wax. Tanks in advanced Fernando Morais Universy of Sao Paulo Lab. of phytochemistry Brazil From owner-plants@net.bio.net Sat Feb 01 22:00:00 1997 Path: biosci!agate!usenet.kornet.nm.kr!howland.erols.net!news.sprintlink.net!news-peer.sprintlink.net!uunet!in2.uu.net!138.95.18.2!wilbur.sequent.com!newsfeed.orst.edu!news.orst.edu!news From: chend@ucs.orst.edu (Don Chen) Newsgroups: bionet.plants Subject: RFI: agrobacterium-mediated transformation of wheat/cereals? Date: Sun, 02 Feb 1997 03:17:01 GMT Organization: Oregon State University Lines: 9 Message-ID: <5d10v7$jtu@news.orst.edu> NNTP-Posting-Host: slip212.ucs.orst.edu X-Newsreader: Forte Free Agent 1.0.82 Can someone point out recent papers on attempts (successes) in using Agrobacterium to transform cereals such as wheat? Thanks for any leads. Don From owner-plants@net.bio.net Sat Feb 01 22:00:00 1997 Path: biosci!agate!howland.erols.net!EU.net!sun4nl!easy4.worldaccess.nl!news From: muntingh@worldaccess.nl Newsgroups: bionet.plants Subject: improvement of the soil of a kitchen-garden. Date: Sun, 02 Feb 97 20:14:38 GMT Organization: World Access Lines: 5 Message-ID: NNTP-Posting-Host: hrv2-2.worldaccess.nl X-Newsreader: Quarterdeck Message Center [2.00] Around my house there is a big beech some oaks and some maple-trees. I want to use the leaves of them to improve the soil of my kitchen-garden. Can the leaves of the oak and the beech improve the soil or is it making it worse. Maybe it will help together with some lime??? From owner-plants@net.bio.net Sat Feb 01 22:00:00 1997 Path: biosci!agate!spool.mu.edu!uwm.edu!msunews!gvsu!river.it.gvsu.edu!friedj From: "Jessica T. Fried" Newsgroups: bionet.plants Subject: a question Date: Sun, 2 Feb 1997 16:55:16 -0500 Organization: Grand Valley State University Lines: 12 Message-ID: NNTP-Posting-Host: river.it.gvsu.edu Mime-Version: 1.0 Content-Type: TEXT/PLAIN; charset=US-ASCII It's easy to see why some plants produce poisonous chemicals. What I'd like to know is how they benifit from the production of chemicals which we, as humans, harvest for medicinal purposes. What is the role of these chemicals in the life of a plant? If anyone has any ideas or sources, please e-mail me. Jessica Fried Grand Valley State University Allendale, MI From owner-plants@net.bio.net Sat Feb 01 22:00:00 1997 Path: biosci!agate!ihnp4.ucsd.edu!swrinde!howland.erols.net!news.sprintlink.net!news-peer.sprintlink.net!gail.ripco.com!news.tds.net!news From: "Gary Wayner" Newsgroups: bionet.plants Subject: Scholarly Natural History Books Date: 2 Feb 1997 18:51:07 GMT Organization: Natural History Books Lines: 13 Message-ID: <01bc113a$08180ae0$a6d331cf@mypc.peop.tdsnet.com> NNTP-Posting-Host: fpal0-a05.peop.tds.net Mime-Version: 1.0 Content-Type: text/plain; charset=ISO-8859-1 Content-Transfer-Encoding: 7bit X-Newsreader: Microsoft Internet News 4.70.1155 My latest catalog #78 with 700 items is now available. Sections on botany, cryptogams, general, inverts, verts, & ornithology. I can send winword, ascii, snail-mail, or a zip file with winword & ascii. Thank you, Gary Wayner Natural History Books 1002 Glenn Blvd, SW Fort Payne, Alabama 35967-8442 U.S.A. Phone: (205) 845-7828 Fax: (205) 845-2070 Email: gwayner@peop.tdsnet.com From owner-plants@net.bio.net Sat Feb 01 22:00:00 1997 Path: biosci!news.Stanford.EDU!su-news-hub1.bbnplanet.com!news.bbnplanet.com!cpk-news-hub1.bbnplanet.com!worldnet.att.net!howland.erols.net!rill.news.pipex.net!pipex!dispatch.news.demon.net!demon!ionia.demon.co.uk!not-for-mail From: Mike Hardman Newsgroups: bionet.plants,uk.rec.gardening,rec.gardens Subject: Viola localities in S.Spain ? Date: Sun, 02 Feb 1997 16:23:30 +0000 Organization: At Home Message-ID: <32F4BF82.42B5@ionia.demon.co.uk> Reply-To: mike@ionia.demon.co.uk NNTP-Posting-Host: ionia.demon.co.uk X-NNTP-Posting-Host: ionia.demon.co.uk X-Mailer: Mozilla 2.02 (Macintosh; I; 68K) MIME-Version: 1.0 CC: mike@ionia.demon.co.uk Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit Lines: 17 Xref: biosci bionet.plants:14306 rec.gardens:155715 I am looking for localities for Viola in southern Spain (field trip in June). Can you help me ? - Localities, or names of people who might know ??? Naturally, the greater detail, the better! The area is Sierra Nevada to Sierra de Cazorla plus or minus a hundred miles. I'd be especially pleased to hear from anyone who has done field work there, either with Univesity or with Alpine Garden Society (eg). Viola cazorlensis, I can probably find (but still would like comments on). But I'd love clues on: VV. crassiuscula, arborescens, and any others Many thanks Mike ------------------------------------------------------------------------ Mike Hardman , Aldershot, Hampshire, UK. International Violet Association, Butterfly Conservation, WWFN, etc... Freelance Photographer, Writer, and Computer Consultant. From owner-plants@net.bio.net Sat Feb 01 22:00:00 1997 Path: biosci!agate!howland.erols.net!spool.mu.edu!torn!nott!cunews!freenet-news.carleton.ca!FreeNet.Carleton.CA!de310 From: de310@FreeNet.Carleton.CA (Michael Roberts) Newsgroups: bionet.plants Subject: Re: Fungicides and Mycorrhizae Date: 2 Feb 1997 14:20:41 GMT Organization: National Capital Freenet, Ottawa, Canada Lines: 6 Message-ID: <5d27rp$bss@freenet-news.carleton.ca> NNTP-Posting-Host: freenet5.carleton.ca X-Given-Sender: de310@freenet5.carleton.ca (Michael Roberts) yes, & then they will come back -- goto www.ncf.carleton.ca/~de310 for consultation & lowest prices on Hydroponics,Aquarium,High efficiency lighting (MH,HPS,sulphur), CO2 alternatives & related equipment & information From owner-plants@net.bio.net Sat Feb 01 22:00:00 1997 Path: biosci!news.Stanford.EDU!su-news-hub1.bbnplanet.com!news.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news-peer.gsl.net!news.gsl.net!news-hk.gsl.net!news.gsl.net!newsgate.cuhk.edu.hk!serv.hinet.net!netnews.hinet.net!news From: tsicchen@ms2.hinet.net (tsicchen) Newsgroups: tw.bbs.rec.entertainment,tw.bbs.sci.biology,aus.education.bio-newtech,aus.environment.conservation,bionet.general,bionet.microbiology,bionet.plants Subject: "problem about microalgae harvest" Date: 2 Feb 1997 00:13:57 GMT Organization: DCI HiNet Lines: 6 Message-ID: <5d0m85$jla@netnews.hinet.net> NNTP-Posting-Host: 168.95.230.180 X-Newsreader: Winspan < ¤¤¤ċ version 3.10 > Xref: biosci bionet.general:25440 bionet.microbiology:8741 bionet.plants:14297 I am cultured a microalgae called Haematococcus. Now I have some problem of harvesting. Does there any one can give me suggestion about what kinds of equipmemt I should used, where is the manufacture....etc. Any informations and suggestion are welcome. Thanks. My e mail:tsicchen@ms2.hinet.net From owner-plants@net.bio.net Sat Feb 01 22:00:00 1997 Path: biosci!news.Stanford.EDU!su-news-hub1.bbnplanet.com!news.bbnplanet.com!cam-news-hub1.bbnplanet.com!howland.erols.net!ix.netcom.com!news From: rb1000@ix.netcom.com (Ron Bennett) Newsgroups: alt.drugs.culture,alt.drugs.pot.cultivation,alt.drugs.usenet,alt.hemp,alt.hemp.politics,alt.hemp.recreational,alt.sustainable.agriculture,bionet.plants,sci.agriculture Subject: hemp plantation - SCAM ALERT!!! Date: 2 Feb 1997 04:09:05 GMT Organization: Netcom Lines: 77 Message-ID: <5d1411$l5p@dfw-ixnews10.ix.netcom.com> NNTP-Posting-Host: rea-pa3-37.ix.netcom.com Mime-Version: 1.0 Content-Type: Text/Plain; charset=US-ASCII X-NETCOM-Date: Sat Feb 01 10:09:05 PM CST 1997 X-Newsreader: WinVN 0.99.8 (x86 32bit) Xref: biosci bionet.plants:14301 sci.agriculture:16323 The hemp plantation thread which was recently posted in this newsgroup appears to be a scam...also the public sales of unregistered stocks over the internet seems suspect! The origin ISP (global.co.za) has been notified. Anyone who sends money to a foreign country for what is described below is a FOOL and deserves to lose their money! I'm sure there's some idiots out there who'll send this guy money...this scam reminds of the Nigerian scam where a person sends money to another country in order to claim a larger amount. Of course the person never gets their money back and there's no recourse! Ron http://www.netcom.com/~rb1000/ In article <32dfacaf.15002375@news>, grissel@global.co.za says... > >Low THC content hemp is an accepted agricultural crop. Its uses are >infinite - from extra strength fibre to paper to clothing. > >For the first time on the net you have the option of becoming a >shareholder in a legal hemp plantation in South Africa. > >The objective of this message is to attract shareholders to >participate in a fully interactive real company with real assets. > >The object of the company is to use shareholders money to acquire >tracts of land in S.Africa (where the hemp plant prospers) and >cultivate a plantation. > >The legal, low toxic hemp plant will then initially be sold to wiiling >buyers who have a necessity for the fibre. With a view to growing the >company into a refiner and producer of hemp by-products. > >All shareholders will be able to spend time on the plantation for >free. This is a perk to you, the shareholder. The plantation is >envisaged to be located in the Transkei where the climate is tropical >and the land is cheap. Furthemore, as a prerequisite, the plantation >will be situated on the coast for the benefit of visiting >shareholders. > >I envisage growth of 60% - 100% per annum over the next 7 years. > >The structure of the company will be fully democratic. All >resolutions, propositions and decisions will be e-mailed to you for >your vote. Your say in the day to day running of the company will be >large (you may abstain from participation - this is your choice). > >Each share will contain 1 voting right. Shares are denominated in $10 >per share (or equivalent local currency). You need only own 1 share to >stay on the plantation for free. You can subscribe for one or more >shares. > >The amount of capital we are raising is $100,000. This is considered >adequate to begin a plantation due to the recent devaluation of the >Rand. At present, we have raised $18310. > >If you would like to subscribe for shares you can send $10 / equvalent >in local currency (or more if more shares required) to : > >H.Plant >c/o Greg Fox - Accountant >37 Felix Road >Fairmount Ridge >Johannesburg 2192 >South Africa > >On receipt we will send you a share certificate. > >If you are presently a shareholder, our next vote will be on a Company >name. You will be e-mailed with details. > >I am of the opinion that if you have enough faith to send money, the >least I can do is be of great integrity and honesty in return. > >E-mail me with any questions. > >Thank you. From owner-plants@net.bio.net Sat Feb 01 22:00:00 1997 Path: biosci!agate!spool.mu.edu!uwm.edu!newsfeeds.sol.net!newspump.sol.net!howland.erols.net!worldnet.att.net!news.dra.com!supernews.com!news From: Doreen Howard Newsgroups: bionet.plants Subject: Fungicides and Mycorrhizae Date: Sat, 01 Feb 1997 19:08:53 -0800 Organization: Perfectly Attuned Chaos Lines: 6 Message-ID: <32F40545.4D34@mastnet.net> NNTP-Posting-Host: mds111.mastnet.net Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 2.02 (Win16; I) If one sprays their veggies with fungicides to prevent early blight or a host of other fungal diseases prevelant in the hot, humid south, will the fungicide destroy mycorrhizae in the soil under the plant and surrounding it???? Opinions PLEASE Doreen Howard doreen@mastnet.net From owner-plants@net.bio.net Sat Feb 01 22:00:00 1997 Path: biosci!maclan.mcgill.ca!thomas_bureau From: thomas_bureau@maclan.mcgill.ca (Thomas Bureau) Newsgroups: bionet.plants Subject: Two Post-Doc Positions Date: 1 Feb 1997 17:35:00 -0800 Organization: McGill University, Department of Biology Lines: 41 Sender: daemon@net.bio.net Distribution: world Message-ID: <32F3EF84.3D05@maclan.mcgill.ca> Reply-To: 1205@sirocco.CC.McGill.CA, Dr.@sirocco.CC.McGill.CA, Penfield@sirocco.CC.McGill.CA, Avenue@sirocco.CC.McGill.CA, Montreal@sirocco.CC.McGill.CA, QC@sirocco.CC.McGill.CA, H3A@sirocco.CC.McGill.CA, 1B1@sirocco.CC.McGill.CA NNTP-Posting-Host: net.bio.net POSTDOCTORAL POSITIONS AVAILABLE Two postdoctoral positions are available immediately to work on the identification and characterization of transposable elements associated with wild-type plant genes. Many plant genes are associated with members of an unusual superfamily of transposable elements called Miniature Inverted-repeat Transposable Elements or MITEs. Possible projects include investigating the role of MITEs and other transposable elements in gene and genome evolution, characterizing the mechanism of MITE mobility, and using MITEs and other transposable elements in designing novel plant genome mapping and gene isolation protocols [Plant Cell 6, 907-916 (1994); PNAS 93, 8524 (1996)]. Candidates must be highly motivated and have a strong background in molecular biology and/or molecular genetics. Expertise in genome mapping or computational biology is desirable but not a prerequisite. Every effort will be made to facilitate the development of future careers in academia or industry. Please send CV, a brief statement of research goals, and the names of three referees to: Dr. Thomas E. Bureau McGill University Department of Biology 1205 Dr. Penfield Avenue Montreal, Quebec H3A 1B1 Canada. Email: thomas_bureau@maclan.mcgill.ca. Montreal is located in the Canadian province of Quebec. It is the second largest French speaking city in the world with Paris, France being the largest. Despite the strong French presence, Montreal is a multicultural multiethnic community. As such there is a great diversity of cultures, festivals, shops, and restaurants. Montreal also provides easy access to wilderness areas in eastern Canada and the northeast US. Housing is very reasonable with an average two bedroom apartment renting for approximately US$500/month. McGill University is a world class institution and one of the top universities in Canada. The Department of Biology is well rounded with faculty specializing in areas of ecology, evolutionary biology, molecular biology, genetics, developmental biology, cell biology, and neurobiology. Plant research is also well supported with a modern Phytotron facility and easy access to experimental field stations. From owner-plants@net.bio.net Sat Feb 01 22:00:00 1997 Path: biosci!agate!howland.erols.net!surfnet.nl!ruu.nl!news From: M.vanKleunen@stud.biol.ruu.nl (Mark van Kleunen) Newsgroups: bionet.plants Subject: blocking xylem transport? Date: Mon, 03 Feb 1997 04:14:34 GMT Organization: Academic Computer Centre Utrecht, (ACCU) Lines: 6 Message-ID: <32f565b0.2124718@news.cc.ruu.nl> NNTP-Posting-Host: warande1025.warande.ruu.nl X-Newsreader: Forte Free Agent 1.1/16.230 Does anyone know a method to block the xylem transport in stolons (plagiotropic stems) which connect two ramets of a clonal plant? The method may not affect the phloem transport between the ramets. Please send your suggestions to M.vanKleunen@stud.biol.ruu.nl From owner-plants@net.bio.net Sun Feb 02 22:00:00 1997 Path: biosci!daresbury!nntp-trd.UNINETT.no!nntp.uio.no!newsfeeds.sol.net!newspump.sol.net!howland.erols.net!newsxfer3.itd.umich.edu!portc01.blue.aol.com!audrey01.news.aol.com!not-for-mail From: ifsin@aol.com (Ifsin) Newsgroups: bionet.plants Subject: Re: hemp plantation - SCAM ALERT!!! Date: 3 Feb 1997 08:08:47 GMT Organization: AOL http://www.aol.com Lines: 2 Message-ID: <19970203080800.DAA18495@ladder01.news.aol.com> References: <5d1411$l5p@dfw-ixnews10.ix.netcom.com> NNTP-Posting-Host: ladder01.news.aol.com X-Admin: news@aol.com well those dumb enought ot smoke the stuff-might surly be dumb enough to buy into this. From owner-plants@net.bio.net Sun Feb 02 22:00:00 1997 Path: biosci!news.Stanford.EDU!su-news-hub1.bbnplanet.com!news.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news.mindspring.com!mindspring!usenet From: sdlooker@mindspring.com (FRANK HOCZA) Newsgroups: bionet.plants Subject: Any Herbs or Plants useful in treating Muscular Dystrophy - Please !! Date: Mon, 03 Feb 1997 01:35:22 GMT Organization: MindSpring Enterprises Lines: 1 Message-ID: <32f5409f.15400314@news.mindspring.com> Reply-To: sdlooker@mindspring.com NNTP-Posting-Host: 38.12.222.107 Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Server-Date: 3 Feb 1997 01:30:06 GMT X-Newsreader: Forte Agent .99g/32.339 From owner-plants@net.bio.net Sun Feb 02 22:00:00 1997 Path: biosci!daresbury!nntp-trd.UNINETT.no!sn.no!hermod.uio.no!nntp.uio.no!news.maxwell.syr.edu!news.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news.sprintlink.net!news-peer.sprintlink.net!uunet!in2.uu.net!128.250.1.21!munnari.OZ.AU!comp.vuw.ac.nz!canterbury.ac.nz!kauri.lincoln.ac.nz!pc097175.lincoln.ac.nz!vaughag From: vaughag@lincoln.ac.nz (Vaughan, Gillian Ruth) Newsgroups: bionet.plants Subject: Re: Do houseplants filter air? Date: Mon, 3 Feb 1997 23:16:33 Organization: Lincoln University, New Zealand Lines: 23 Message-ID: References: <32EEFABA.2D13@uthscsa.edu> NNTP-Posting-Host: pc097175.lincoln.ac.nz X-Newsreader: Trumpet for Windows [Version 1.0 Rev A] >Michael Peterson wrote: >> >> Hello, >> I'm not sure if this is the appropriate place to ask but here goes. Do >> houseplants improve the air quality within a home. Aside from producing >> oxygen, do they also filter out any toxins or irritants? Are there any >> publications that rate or suggest different types of houseplants for this >> purpose? I'm not looking for very technical information, just comparitive >> stuff that would help someone that wants to select plants on more than >> just asthetics. >> >> Thanks, >> Michael Peterson There is actually a book on this now that I found in my local book store. It's called something along the lines of Eco-friendly house plants, and goes over about 50 species of houseplant, in addition to going over some of the theory behind it. Unfortuneatly I gave the book to my Dad for Christmas, so I can't give the reference. If you can find it, it seems like a really interesting book. Gillian From owner-plants@net.bio.net Sun Feb 02 22:00:00 1997 Path: biosci!WPI.EDU!buer From: buer@WPI.EDU (Charles S Buer) Newsgroups: bionet.plants Subject: Re: a question Date: 3 Feb 1997 01:26:45 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 43 Sender: daemon@net.bio.net Distribution: world Message-ID: References: Reply-To: Charles S Buer NNTP-Posting-Host: net.bio.net Most of the chemicals we humans exploit plants for are what are known as secondary metabolites. They perform several functions for plants, or at least plant physiologists believe their functions are: 1. Since plants cannot pick up and move if an insect or pathogenic invasion begins, they need to resort to chemical warfare. 2. Some of the chemicals are used by plants to entice pollinators. 3. Some of the chemicals make plants taste bad, some release hydrogen cyanide upon being crushed, and some are poisonous in other ways, thus, reducing herbivory. There is a good chapter on secondary metabolites in: Taiz and Zeiger, 1991. Plant Physiology (Benjamin Cummings, Redwood City, CA) pp. 318-345. :):):):):):):):):):):):):):):):):):):):):):):):):):):):):):):):):):):):):):):) | Charles S. Buer |E-mail: buer@wpi.edu Biology/Biotechnology Dept. |Phone: (508) 831-5052 Worcester Polytechnic Institute |FAX: (508) 831-5936 100 Institute Rd. |http://www.wpi.edu/~buer Worcester, MA 01609 | | :):):):):):):):):):):):):):):):):):):):):):):):):):):):):):):):):):):):):):):) On Sun, 2 Feb 1997, Jessica T. Fried wrote: > > It's easy to see why some plants produce poisonous chemicals. > What I'd like to know is how they benifit from the production of chemicals > which we, as humans, harvest for medicinal purposes. What is the role of > these chemicals in the life of a plant? > > If anyone has any ideas or sources, please e-mail me. > > Jessica Fried > Grand Valley State University > Allendale, MI > > > From owner-plants@net.bio.net Sun Feb 02 22:00:00 1997 Path: biosci!news.Stanford.EDU!news.bbnplanet.com!su-news-hub1.bbnplanet.com!newsxfer3.itd.umich.edu!portc01.blue.aol.com!audrey01.news.aol.com!not-for-mail From: f6green@aol.com (F6GREEN) Newsgroups: bionet.plants Subject: Re: Discouraging bunnies Date: 3 Feb 1997 08:18:53 GMT Organization: AOL http://www.aol.com Lines: 2 Message-ID: <19970203081800.DAA18701@ladder01.news.aol.com> References: NNTP-Posting-Host: ladder01.news.aol.com X-Admin: news@aol.com A fertilizer based on blood will deter them - you have to put it out every few days, though! From owner-plants@net.bio.net Sun Feb 02 22:00:00 1997 Path: biosci!daresbury!nntp-trd.UNINETT.no!sn.no!www.nntp.primenet.com!nntp.primenet.com!newsxfer3.itd.umich.edu!portc01.blue.aol.com!audrey01.news.aol.com!not-for-mail From: f6green@aol.com (F6GREEN) Newsgroups: bionet.plants Subject: Re: Do houseplants filter air? Date: 3 Feb 1997 08:15:55 GMT Organization: AOL http://www.aol.com Lines: 4 Message-ID: <19970203081501.DAA18637@ladder01.news.aol.com> References: NNTP-Posting-Host: ladder01.news.aol.com X-Admin: news@aol.com Yes, NASA did the research to determine the feasability of using plants in space. Besides providing oxygen, certain ones also act as bio-filters. I remember a few: Epipremnum aureum (pothos,) Aglaonema commutatum (Chinese evergreen,) Brassaia actinophylla (Umbrella tree.) From owner-plants@net.bio.net Sun Feb 02 22:00:00 1997 Path: biosci!daresbury!nntp-trd.UNINETT.no!nntp.uio.no!news.maxwell.syr.edu!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!su-news-hub1.bbnplanet.com!newsxfer3.itd.umich.edu!portc01.blue.aol.com!audrey01.news.aol.com!not-for-mail From: f6green@aol.com (F6GREEN) Newsgroups: bionet.plants Subject: Re: Indoor "ficus" plants: Help! Date: 3 Feb 1997 08:10:48 GMT Organization: AOL http://www.aol.com Lines: 3 Message-ID: <19970203081001.DAA18530@ladder01.news.aol.com> References: <5cg67e$jic@tor-nn1-hb0.netcom.ca> NNTP-Posting-Host: ladder01.news.aol.com X-Admin: news@aol.com To everything else I add this: give your fig a bright place and LEAVE it there. People don'e realize that moving fig trees around the room induces shock. From owner-plants@net.bio.net Sun Feb 02 22:00:00 1997 Path: biosci!daresbury!nntp-trd.UNINETT.no!nntp.uio.no!news.maxwell.syr.edu!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!su-news-hub1.bbnplanet.com!newsxfer3.itd.umich.edu!portc01.blue.aol.com!audrey01.news.aol.com!not-for-mail From: ifsin@aol.com (Ifsin) Newsgroups: bionet.plants Subject: Re: Market Size of Horticultural Crops Date: 3 Feb 1997 07:55:40 GMT Organization: AOL http://www.aol.com Lines: 41 Message-ID: <19970203075501.CAA18121@ladder01.news.aol.com> References: <32E3D766.5A04@wfu.edu> NNTP-Posting-Host: ladder01.news.aol.com X-Admin: news@aol.com ,,,,<<<<<<< From: taguebw@wfu.edu Date: Mon, 20 Jan 1997 15:36:54 -0500 Message-ID: <32E3D766.5A04@wfu.edu> Greetings, Could anyone direct me to a source for information on the national and/or international size of markets for (relatively) obscure plants? Not major commodities like wheat, rice, corn, barley, etc but more along the lines of bedding plants, annuals, herbs and seeds. Does there exist, for example, a listing of the amount of money spent on/the market size of (picking a random example) Lobularia maritima (sweet alyssum)? Any on-line or library resources would be most appreciated. My agricultural economics (economic agriculture?) is poor so any help would be appreciated. Thanks Just a little ol' plant molecular biologist, Brian W. Tague Department of Biology Wake Forest University Winston-Salem NC 27109 taguebw@wfu.edu>>> "Grower Talks" is a trade gernal for the growers of floriculture beding plants and greenhouse operations genral offices : P.O box 9, 335 N river ST. Batavia IL 60510-0009 U.S.A. Tel 708-208-9080 fax 708-208-9350 E-mail GrowerTalk@Aol.com the last issue had some very good stats on the break down on what was spent on cut flowers and annauls and perennilas and potting plants. From owner-plants@net.bio.net Sun Feb 02 22:00:00 1997 Path: biosci!daresbury!nntp-trd.UNINETT.no!nntp.uio.no!www.nntp.primenet.com!nntp.primenet.com!howland.erols.net!news.bbnplanet.com!cam-news-hub1.bbnplanet.com!uunet!in3.uu.net!205.228.248.26!news.vcnet.com!news From: don@bio-organics.com Newsgroups: bionet.plants Subject: Re: Fungicides and Mycorrhizae Date: Mon, 03 Feb 1997 11:21:05 +0000 Organization: Internet Access of Ventura County 805.383.3500 Lines: 19 Message-ID: <32F5CA20.B83@bio-organics.com> References: <32F40545.4D34@mastnet.net> Reply-To: don@bio-organics.com NNTP-Posting-Host: port13.vcnet.com Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 3.0 (Macintosh; I; 68K) Doreen Howard wrote: > > If one sprays their veggies with fungicides to prevent early > blight or a host of other fungal diseases prevelant in the hot, > humid south, will the fungicide destroy mycorrhizae in the soil under > the plant and surrounding it???? Opinions PLEASE > Doreen Howard > doreen@mastnet.net In general, the contact-type fungicides (those that are sprayed on the foliage) will not cause any significant harm to mycorrhizae. The Benlate type soil drenches will do considerable harm, and should not be used by anyone following good organic practices. We have a fairly complete listing of better/worse fungicides available. Don Chapman Bio/Organics Supply Center Camarillo CA From owner-plants@net.bio.net Sun Feb 02 22:00:00 1997 Path: biosci!bloom-beacon.mit.edu!news.starnet.net!news.starnet.net!spool.mu.edu!uwm.edu!www.nntp.primenet.com!nntp.primenet.com!newsxfer3.itd.umich.edu!howland.erols.net!torn!nott!cunews!freenet-news.carleton.ca!FreeNet.Carleton.CA!de310 From: de310@FreeNet.Carleton.CA (Michael Roberts) Newsgroups: bionet.plants Subject: Re: improvement of the soil of a kitchen-garden. Date: 2 Feb 1997 23:31:11 GMT Organization: National Capital Freenet, Ottawa, Canada Lines: 7 Message-ID: <5d383v$rkn@freenet-news.carleton.ca> NNTP-Posting-Host: freenet5.carleton.ca X-Given-Sender: de310@freenet5.carleton.ca (Michael Roberts) the leaves will lower pH, add some dolomite lime as well to balance & add Mg & Ca -- goto www.ncf.carleton.ca/~de310 for consultation & lowest prices on Hydroponics,Aquarium,High efficiency lighting (MH,HPS,sulphur), CO2 alternatives & related equipment & information From owner-plants@net.bio.net Sun Feb 02 22:00:00 1997 Path: biosci!agate!howland.erols.net!newsxfer3.itd.umich.edu!portc01.blue.aol.com!audrey01.news.aol.com!not-for-mail From: faganjohns@aol.com (FaganJohns) Newsgroups: bionet.plants Subject: Re: a question Date: 3 Feb 1997 14:40:19 GMT Organization: AOL http://www.aol.com Lines: 11 Message-ID: <19970203144001.JAA29621@ladder01.news.aol.com> References: NNTP-Posting-Host: ladder01.news.aol.com X-Admin: news@aol.com These chemicals could have almost any bennefit to the plant. Many times, however, these chemicals are used in defense from some other organism (microbial, insect, etc...). The reason that they have bennificial effects on humans is usually coincidental (food plants are nutrisious because we have genetically selected them to be). The reason that very similar chemicals, that are used for very different purposes, are found both in plants and animals is because nature tends to be stingy. That is, since we are essentially dealing with organic molecules (carbon based, complex glucose and benzine based) nature tends to use the same molecules for different things. The plants produce the same chemicals that are beneficial to another organism, but for a completely different purpose. From owner-plants@net.bio.net Sun Feb 02 22:00:00 1997 Path: biosci!daresbury!nntp-trd.UNINETT.no!sn.no!nntp.uio.no!newsfeeds.sol.net!hammer.uoregon.edu!arclight.uoregon.edu!feed1.news.erols.com!news.bbnplanet.com!cpk-news-hub1.bbnplanet.com!portc02.blue.aol.com!audrey01.news.aol.com!not-for-mail From: faganjohns@aol.com (FaganJohns) Newsgroups: bionet.plants Subject: Re: Fungicides and Mycorrhizae Date: 3 Feb 1997 14:32:00 GMT Organization: AOL http://www.aol.com Lines: 7 Message-ID: <19970203143100.JAA29160@ladder01.news.aol.com> References: <5d27rp$bss@freenet-news.carleton.ca> NNTP-Posting-Host: ladder01.news.aol.com X-Admin: news@aol.com Most fungicides that are used to treat garden plants do not go far into the soil. It takes a pretty powerful and soluble fungicide to get through all those soil particles to get to the micorrhizae. Unless you are using one that is designed to kill root fungus diseases, I wouldn't worry about it. Fungicides like "Captan" and others that are designed to keep fungus off fruits and vegetables may stunt them a little, but it is not a big problem. From owner-plants@net.bio.net Sun Feb 02 22:00:00 1997 Path: biosci!agate!spool.mu.edu!howland.erols.net!newsxfer3.itd.umich.edu!portc01.blue.aol.com!audrey01.news.aol.com!not-for-mail From: faganjohns@aol.com (FaganJohns) Newsgroups: bionet.plants Subject: Re: Mosses - Source? Date: 3 Feb 1997 14:17:11 GMT Organization: AOL http://www.aol.com Lines: 6 Message-ID: <19970203141700.JAA28537@ladder01.news.aol.com> References: <32F2469D.5C6F@magicnet.net> NNTP-Posting-Host: ladder01.news.aol.com X-Admin: news@aol.com The only other source that I know of is Carilina Biologic. This is a big company, that supplies schools and universities with a wide range of biologic material. I'm sure that they have true mosses, and probably kits to grow them in sold along with them. I don't have the adress, but any high school biology teacher or local university HAS to have it. Good Luck. From owner-plants@net.bio.net Sun Feb 02 22:00:00 1997 Path: biosci!daresbury!nntp-trd.UNINETT.no!sn.no!nntp.uio.no!news-feed.inet.tele.dk!not-for-mail From: Sten Porse Newsgroups: bionet.plants Subject: Re: improvement of the soil of a kitchen-garden. Date: Mon, 03 Feb 1997 20:15:36 +0100 Organization: Beder Gartnerskole Lines: 15 Message-ID: <32F63958.1FAC@post3.tele.dk> References: <5d383v$rkn@freenet-news.carleton.ca> Reply-To: porse@post3.tele.dk NNTP-Posting-Host: ppp61.arh.tele.dk Mime-Version: 1.0 Content-Type: text/plain; charset=iso-8859-1 Content-Transfer-Encoding: 8bit X-Mailer: Mozilla 3.0Gold (Win95; I) Michael Roberts wrote: > > the leaves will lower pH, add some dolomite lime as well to > balance & add Mg & Ca On a danish heathland near Flynder Sĝ in the nortern part of Jutland where the pH was 4.5 the invasion of oaks and the leaves shed by them changed the pH to almost 7.0. I am not aware if this datum can be supported from elsewhere in the world, but so it is. As to the original question: Yes you might - and you should in my opinion - use the leaves as a compost in your garden. A small amount of lime will speed up the decomposition and balance the pH. Sten Porse From owner-plants@net.bio.net Sun Feb 02 22:00:00 1997 Path: biosci!agate!howland.erols.net!news.sprintlink.net!news-peer.sprintlink.net!news-pull.sprintlink.net!news.sprintlink.net!news-dc-9.sprintlink.net!hermes.is.co.za!hawk.pix.za!news From: "Jacques van der Merwe" Newsgroups: bionet.molbio.plant,bionet.plants,bionet.plants.education Subject: Venus Flytrap (Dionaea muscipula) Growing Info? Date: 3 Feb 1997 17:49:56 GMT Organization: Proxima Information X-change (PiX) Lines: 17 Message-ID: <01bc11fa$79bf2f00$0b2317c4@196.23.35.11> NNTP-Posting-Host: 196.23.35.11 X-Newsreader: Microsoft Internet News 4.70.1155 Xref: biosci bionet.plants:14323 bionet.plants.education:1664 Looking for more information on growing these perculiar and interesting plants. Any of the follwing information will be appreciated: - Ground compound - Water - Temperature - Light - Nutritional information - Ground PH - Environment Regards Ludwig Brecher The plant Maniac From owner-plants@net.bio.net Sun Feb 02 22:00:00 1997 Path: biosci!daresbury!nntp-trd.UNINETT.no!nntp.uio.no!newsfeeds.sol.net!news.maxwell.syr.edu!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!cam-news-hub1.bbnplanet.com!howland.erols.net!rill.news.pipex.net!pipex!dish.news.pipex.net!pipex!dircon!not-for-mail From: "Cactus" Newsgroups: bionet.plants Subject: Re: Acacia dealbata - from cutting? Date: 3 Feb 1997 19:24:44 GMT Organization: via Direct Connection News service Lines: 32 Message-ID: <01bc11ec$4116d260$c52670c2@triobus.dircon.co.uk> References: <01bc0add$17ad1300$4c2970c2@triobus.dircon.co.uk> NNTP-Posting-Host: du4-197.pool.dircon.co.uk X-Newsreader: Microsoft Internet News 4.70.1157 Cactus wrote in article <01bc0add$17ad1300$4c2970c2@triobus.dircon.co.uk>... > I live in the Uk, on the outskirts of South London, and have been creating > an been trying to create an "exotic" effect for our climate. One plant I'm > keen to incorporate is an Acacia Dealbata. I grew one from seed which was > slow to start and so was given away to a friend when I found a thriving > nursery grown specimen to replace it. > > Sadly, the nursery specimen is devastated, though not killed, each winter, > and suffers severe die back. However, the given away plant has come through > the last two winters with impunity and is starting to look beautiful. > Clearly, it much more cold tolerance. I am going to try some cuttings from > this plant to bring back into my garden, but the literature I have seen > suggests that most acacias are not ready to strike from cutting. > > Does anyone have particular knowledge of acacias from cutting and any hints > (over and above the obvious) which could help my cuttings to take. Maybe > someone down under can put me right! > > Many thanks > > > Chris Miller > From owner-plants@net.bio.net Mon Feb 03 22:00:00 1997 Path: biosci!agate!howland.erols.net!news.sprintlink.net!news-peer.sprintlink.net!news-pull.sprintlink.net!news.sprintlink.net!news-dc-9.sprintlink.net!newsvr.cyberway.com.sg!ftpsvr.cyberway.com.sg!newsadmin@cyberway.com.sg From: "Gum" Newsgroups: bionet.plants Subject: Help with common problems. Date: 29 Jan 1997 15:00:33 GMT Organization: Pre-installed Company Lines: 11 Message-ID: <01b8b0b7$e5dda2e0$750474cb@default> NNTP-Posting-Host: d4117.ppp4.cyberway.com.sg X-Newsreader: Microsoft Internet News 4.70.1155 Hi, can anyone help me? My friend's Mum likes to grow those 'Mandrine Oranges Plants', but there's always some caterpillar munching at the leaves. Is there any 'traditional methods' to get rid of them? I think herbecides are not having a great effect. I there methods like placing some thing near them to drive off the pests? Thanks a million! Gum From owner-plants@net.bio.net Mon Feb 03 22:00:00 1997 Path: biosci!daresbury!nntp-trd.UNINETT.no!sn.no!www.nntp.primenet.com!nntp.primenet.com!news.maxwell.syr.edu!insync!news.azstarnet.com!news.sprintlink.net!news-ana-7.sprintlink.net!newsvr.cyberway.com.sg!ftpsvr.cyberway.com.sg!newsadmin@cyberway.com.sg From: cooldude@cyberway.com.sg (Lucas) Newsgroups: bionet.plants Subject: Need help with venus-flytrap Date: Tue, 28 Jan 1997 10:12:08 GMT Organization: CyberWay Internet Lines: 9 Message-ID: <5ckjdl$lck@ftpsvr.cyberway.com.sg> Reply-To: cooldude@cyberway.com.sg NNTP-Posting-Host: d57086.ppp57.cyberway.com.sg X-Newsreader: Forte Free Agent 1.0.82 Hi! I have recently bought a pot of Venus Fly-trap from an exhibition. After 1 day, the plant show yellowing at the edges. Now into the second day, some leaves have turned brown and more leaves are turning yellow. Can anyone advise me on the favourable conditions for Venus fly-trap? Thanks. From owner-plants@net.bio.net Mon Feb 03 22:00:00 1997 Path: biosci!rutgers!gatech!csulb.edu!news.sgi.com!howland.erols.net!torn!nott!cunews!freenet-news.carleton.ca!FreeNet.Carleton.CA!de310 From: de310@FreeNet.Carleton.CA (Michael Roberts) Newsgroups: bionet.plants Subject: Re: hydroponics Date: 4 Feb 1997 13:03:50 GMT Organization: National Capital Freenet, Ottawa, Canada Lines: 89 Message-ID: <5d7c3m$qat@freenet-news.carleton.ca> NNTP-Posting-Host: freenet3.carleton.ca X-Given-Sender: de310@freenet3.carleton.ca (Michael Roberts) 1-buy a wading pool or build a flow tray out of 2X4's and line with vapour-barrier plastic & use garbage pails with hardboard or a table for a stand goto www.ncf.carleton.ca/~de310 2-buy a 12V bilge pump which can than be connected to a car battery charger or other 12V power supply (or sump pump) goto www.ncf.carleton.ca/~de310 3-buy a bilge-pump thru-hull fitting and connect to your pump which is now in your Rubbermade or other reservoir goto www.ncf.carleton.ca/~de310 4-fill the res. with water and leave the pump on full blast to see if it is going to overflow the tray, if it does, drill sa couple of holes in the hose which will reduce the flow, or use plastic insert `T' fittings, reduce it enough so that your pump doesn't run dry goto www.ncf.carleton.ca/~de310 5-fill the tray to 4-8 inches with Perlite & soilless mix at 10:1, I know it will float at first, so leave your reservoir empty and top fill to moisten, it will stop floating in a while,make sure to add some dolomitic limestone to balance pH, ,also use plastic patio door screen on your fill/drain fitting goto www.ncf.carleton.ca/~de310 6-mix a complete soluble fertilizer according to the instrucions on the label,(I didn't say non-organic), also add a super-concentrated soluble Kelp tablet to your reservoir to ensure all trace elements & minerals (Zinc,Silicon,Selenium,etc.etc.) are present and grow away, add a 400 or 1000 Watt MH or HPS light on a mover & supllemental CO2 for best results goto www.ncf.carleton.ca/~de310 -- goto www.ncf.carleton.ca/~de310 for consultation & lowest prices on Hydroponics,Aquarium,High efficiency lighting (MH,HPS,sulphur), CO2 alternatives & related equipment & information From owner-plants@net.bio.net Mon Feb 03 22:00:00 1997 Path: biosci!daresbury!nntp-trd.UNINETT.no!sn.no!nntp.uio.no!newsfeeds.sol.net!news.maxwell.syr.edu!news.bbnplanet.com!cpk-news-hub1.bbnplanet.com!worldnet.att.net!news.dra.com!news.inlink.com!not-for-mail From: raiar@inlink.com (Gary V. Deutschmann, Sr.) Newsgroups: bionet.plants Subject: Re: hydroponics Date: Tue, 04 Feb 1997 04:37:22 GMT Organization: Inlink Lines: 19 Message-ID: <5d6enf$77j$1@news1.inlink.com> References: <01bc0e04$7a3ff080$c02d74cf@rpiekuto.cac.psu.edu> NNTP-Posting-Host: pm01114.inlink.com X-Newsreader: Forte Free Agent 1.0.82 Amy Knutson wrote: >Forgive me if I'm misunderstanding this thread, but there is a electronic >mailing list on hydroponics already in operation. If you want info on >subscribing, let me know. >-Amy K. >On 29 Jan 1997, Richard piekutowski wrote: >> How does one start a news group >> >> Why would it be under electronics? TTUL Gary From owner-plants@net.bio.net Mon Feb 03 22:00:00 1997 Path: biosci!agate!howland.erols.net!news.sprintlink.net!news-peer.sprintlink.net!news.sprintlink.net!news-hub.sprintlink.net!news.sprintlink.net!news-dc-9.sprintlink.net!newsvr.cyberway.com.sg!newsadmin@cyberway.com.sg From: "Gum" Newsgroups: bionet.plants Subject: Re: Canon P133 Computer for Sale Date: 2 Feb 1997 03:30:21 GMT Organization: Pre-installed Company Lines: 7 Message-ID: <01bc10b9$b314a4c0$5e0574cb@default> References: <5cqv0i$5f@mtinsc04.worldnet.att.net> NNTP-Posting-Host: d5094.ppp5.cyberway.com.sg X-Newsreader: Microsoft Internet News 4.70.1155 Would you mind, try posting this to comp.for.sale Instead of bionet.plants? Please.... Thank You Gum From owner-plants@net.bio.net Mon Feb 03 22:00:00 1997 Path: biosci!agate!howland.erols.net!rill.news.pipex.net!pipex!warwick!bignews.shef.ac.uk!usenet From: m.j.phillips@shef.ac.uk (Marcus Phillips) Newsgroups: bionet.plants Subject: Carnivorous Plants & Passion Flowers Date: 4 Feb 1997 12:39:25 GMT Organization: University of Sheffield Lines: 10 Message-ID: <5d7alt$oui@bignews.shef.ac.uk> NNTP-Posting-Host: pc037038.shef.ac.uk Mime-Version: 1.0 Content-Type: Text/Plain; charset=US-ASCII X-Newsreader: WinVN 0.99.7 I have started some web pages dedicated to Carnivorous Plants, Cacti and Passion flowers. It is a small site at present, but will grow! If you are interested in these plants look at: http://www.geocities.com/RainForest/4677/index.html cheers Marcus From owner-plants@net.bio.net Mon Feb 03 22:00:00 1997 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!www.nntp.primenet.com!nntp.primenet.com!su-news-hub1.bbnplanet.com!news.bbnplanet.com!cam-news-hub1.bbnplanet.com!howland.erols.net!portc02.blue.aol.com!newstf02.news.aol.com!audrey01.news.aol.com!not-for-mail From: phlomis@aol.com Newsgroups: bionet.plants Subject: Phlomis americana H. Gaud. Date: 4 Feb 1997 22:22:35 GMT Organization: AOL, http://www.aol.co.uk Lines: 13 Message-ID: <19970204222200.RAA00765@ladder01.news.aol.com> NNTP-Posting-Host: ladder01.news.aol.com X-Admin: news@aol.com X-Newsreader: AOL Offline Reader Can anyone help with a botanical reference for Phlomis americana H. Gaud.? The plant is not in Index Kewensis and H. Gaud. is not in Brummitt's 'Authors of Plant Names'. It is listed by Bolumu Botanic Garden, Bornova, Turkey in their current Index Seminum, but they have not replied to an e-mail. I presume it is a Turkish species, found and named by an American, but could be wrong. Thank you. Jim Mann Taylor United Kingdom e-mail: Phlomis@aol.com From owner-plants@net.bio.net Tue Feb 04 22:00:00 1997 Path: biosci!agate!spool.mu.edu!uwm.edu!www.nntp.primenet.com!nntp.primenet.com!howland.erols.net!torn!nott!cunews!freenet-news.carleton.ca!FreeNet.Carleton.CA!de310 From: de310@FreeNet.Carleton.CA (Michael Roberts) Newsgroups: bionet.plants Subject: Re: Hydroponics on the Seas/Oceans Date: 5 Feb 1997 16:28:46 GMT Organization: National Capital Freenet, Ottawa, Canada Lines: 8 Message-ID: <5dacfu$aol@freenet-news.carleton.ca> NNTP-Posting-Host: freenet5.carleton.ca X-Given-Sender: de310@freenet5.carleton.ca (Michael Roberts) I think we should dump fertilizer into all the lakes that have been stripped of life by acid rain and grow hydroponic hemp & veggies on them -- goto www.ncf.carleton.ca/~de310 for consultation & lowest prices on Hydroponics,Aquarium,High efficiency lighting (MH,HPS,sulphur), CO2 alternatives & related equipment & information From owner-plants@net.bio.net Tue Feb 04 22:00:00 1997 Path: biosci!rutgers!uwm.edu!news-peer.gsl.net!news.gsl.net!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!cam-news-hub1.bbnplanet.com!howland.erols.net!swrinde!ihnp4.ucsd.edu!munnari.OZ.AU!news.mel.connect.com.au!news.netspace.net.au!not-for-mail From: Frank MARTIN Newsgroups: bionet.plants Subject: Re: Easy to find ephedrine source needed! Date: Wed, 05 Feb 1997 18:25:42 +1000 Organization: General Chemical Company Lines: 15 Message-ID: <32F84406.2156@netspace.net.au> References: <1997Jan29.111212.36302@ludens> Reply-To: GPO, Box, 1684, P, MELBOURNE, 3001, AUSTRALIA NNTP-Posting-Host: dialup-m5-101.melbourne.netspace.net.au Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 3.0 (Win95; I) havasi@ludens.elte.hu wrote: > > Hi everybody! > > I need some help on ephedrine. Can anybody tell me sources of ephedrine witch > are easily available. I'm thinking about diet pills (avail without perscri- > ption) or any other medicine or herbal source. > > If you know one, please let me know at: havasi@ludens.elte.hu > > Thanks! Try the "Merck Index" (eleventh edition) on page 3561. Yours... Frankie From owner-plants@net.bio.net Tue Feb 04 22:00:00 1997 Path: biosci!rutgers!uwm.edu!news-peer.gsl.net!news.gsl.net!news.bbnplanet.com!cpk-news-hub1.bbnplanet.com!feed1.news.erols.com!howland.erols.net!rill.news.pipex.net!pipex!uunet!in2.uu.net!129.63.1.1!ulowell.uml.edu!news.wizvax.net!not-for-mail From: Joseph Zorzin Newsgroups: bionet.plants Subject: need clip art of Amaranth + Salvia Date: Wed, 05 Feb 1997 20:33:53 -0500 Organization: A poorly-installed InterNetNews site Lines: 5 Message-ID: <32F93501.3A77@forestmeister.com> NNTP-Posting-Host: blpm20.vgernet.net Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 3.0Gold (Win95; I) I realize this isn't the best place to seek clipart, but I've tried elsewhere with no luck. A horiticulturist friend need clip art of these 2 plants for his newsletter. Thanks and sorry for intruding on your discussions. From owner-plants@net.bio.net Tue Feb 04 22:00:00 1997 Path: biosci!GAES.GRIFFIN.PEACHNET.EDU!mvanier From: mvanier@GAES.GRIFFIN.PEACHNET.EDU (Marc van Iersel) Newsgroups: bionet.plants Subject: need clip art of Amaranth + Salvia Date: 5 Feb 1997 06:11:29 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 22 Sender: daemon@net.bio.net Distribution: world Message-ID: <199702051411.GAA29197@net.bio.net> NNTP-Posting-Host: net.bio.net >To: plantbio@net.bio.net >From: Joseph Zorzin >Subject: need clip art of Amaranth + Salvia >Date: Wed, 05 Feb 1997 20:33:53 -0500 >NNTP-Posting-Host: blpm20.vgernet.net > >I realize this isn't the best place to seek clipart, but I've tried >elsewhere with no luck. A horiticulturist friend need clip art of these >2 plants for his newsletter. > >Thanks and sorry for intruding on your discussions. > Check the site 'http://www.flowerweb.nl/flowerbase/' for a searchable database with many pictures, including salvia and amaranth. Marc van Iersel E-mail: mvanier@gaes.griffin.peachnet.edu Assistant Professor Department of Horticulture Tel: (770) 412-4766 University of Georgia Fax: (770) 412-4764 Georgia Station Griffin, GA 30223-1797 From owner-plants@net.bio.net Tue Feb 04 22:00:00 1997 Path: biosci!rutgers!gatech!EU.net!Ireland.EU.net!arclight.uoregon.edu!nobel.pacific.net.sg!raffles.technet.sg!demerzel.dso.gov.sg!news From: ckengche@demerzel.dso.gov.sg (Chuang Keng Chee) Newsgroups: bionet.plants Subject: Hydroponics on the Seas/Oceans Date: 5 Feb 1997 17:12:10 +0800 Organization: Defence Science Organisation Lines: 2 Message-ID: <5d9ita$mqu@demerzel.dso.gov.sg> NNTP-Posting-Host: demerzel.dso.gov.sg X-Newsreader: TIN [version 1.2 PL2] Sorry for the return address error. Should be : ckengche@dso.gov.sg Thanks. From owner-plants@net.bio.net Tue Feb 04 22:00:00 1997 Path: biosci!daresbury!nntp-trd.UNINETT.no!nntp.uio.no!news.maxwell.syr.edu!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!cam-news-hub1.bbnplanet.com!news.idt.net!cdc2.cdc.net!news.texas.net!node2.frontiernet.net!usenet From: chris freeman Newsgroups: bionet.plants Subject: Re: Hydroponics on the Seas/Oceans Date: Wed, 05 Feb 1997 16:54:27 -0500 Organization: Frontier Internet Lines: 13 Message-ID: <32F90193.2DA9@frontiernet.net> References: <5dacfu$aol@freenet-news.carleton.ca> NNTP-Posting-Host: usr1-99.dial.roc.frontiernet.net Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 2.01KIT (Win95; U) Michael Roberts wrote: > > I think we should dump fertilizer into all the > lakes that have been stripped of life by acid rain > and grow hydroponic hemp & veggies on them > -- > goto www.ncf.carleton.ca/~de310 for consultation & lowest prices > on Hydroponics,Aquarium,High efficiency lighting (MH,HPS,sulphur), > CO2 alternatives & related equipment & information Did you just smoke your latest harvest or what?!?!?!? C- From owner-plants@net.bio.net Tue Feb 04 22:00:00 1997 Path: biosci!rutgers!uwm.edu!newsfeeds.sol.net!news.maxwell.syr.edu!news.bbnplanet.com!cpk-news-hub1.bbnplanet.com!newsfeed.internetmci.com!compuserve.com!news.compuserve.com!newsmaster From: Martin Schatz <100603.2313@compuserve.com> Newsgroups: bionet.plants Subject: Re: Do houseplants filter air? Date: Wed, 05 Feb 1997 13:54:06 +0100 Organization: CompuServe Incorporated Lines: 34 Message-ID: <32F882EE.64E6@compuserve.com> References: <32EEFABA.2D13@uthscsa.edu> NNTP-Posting-Host: hd60-159.compuserve.com Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 2.02 (WinNT; I) To: "Vaughan, Gillian Ruth" Vaughan, Gillian Ruth wrote: > > >Michael Peterson wrote: > >> > >> Hello, > >> I'm not sure if this is the appropriate place to ask but here goes. Do > >> houseplants improve the air quality within a home. Aside from producing > >> oxygen, do they also filter out any toxins or irritants? Are there any > >> publications that rate or suggest different types of houseplants for this > >> purpose? I'm not looking for very technical information, just comparitive > >> stuff that would help someone that wants to select plants on more than > >> just asthetics. > >> > >> Thanks, > >> Michael Peterson > > There is actually a book on this now that I found in my local book store. > It's called something along the lines of Eco-friendly house plants, and goes > over about 50 species of houseplant, in addition to going over some of the > theory behind it. Unfortuneatly I gave the book to my Dad for Christmas, so I > can't give the reference. If you can find it, it seems like a really > interesting book. > > Gillian Hi! I found a web site, that might be interesting to you: http://www.zone10.com/wsdocs/tech/NASA/fyh.htm Martin (Vienna, Austria) http://ourworld.compuserve.com/homepages/MartinSch atz From owner-plants@net.bio.net Tue Feb 04 22:00:00 1997 Path: biosci!rutgers!gatech!csulb.edu!hammer.uoregon.edu!arclight.uoregon.edu!europa.clark.net!worldnet.att.net!howland.erols.net!news.sprintlink.net!news-peer.sprintlink.net!news-pull.sprintlink.net!news.sprintlink.net!news-stk-11.sprintlink.net!hermes.is.co.za!news From: Clyde@infruit2.agric.za (Clyde S. Snyders) Newsgroups: bionet.plants Subject: Plant Biotechnology. Date: Wed, 05 Feb 1997 08:16:49 GMT Organization: Institue for Fruit Technology Lines: 25 Message-ID: <5d9f5a$s24@hermes.is.co.za> Reply-To: Clyde@infruit2.agric.za NNTP-Posting-Host: gauntlet.agric.za X-Newsreader: Forte Free Agent 1.0.82 I am currently attemping to develope a DNA cassette for the expression of mutiple gene using the NIa gene from (+)ssRNA virus Potato Virus Y (PVY). I would like to obtain a clone with the complete PVY strain (any strain) or a clone with the complete NIa gene and possibly including the heptapepetide cleavage siignal on both 5 prime and 3' primer regions. Clyde S. Snyders Department of Plant Biotechnology and Plant Pathology INFRUITEC Stellenbosch Private Bag X5013 Cape Town 8000 Rebulic of South Africa Telephone :- (021) 883 9090 Inter + 27 21 883 9090 Tel Fax :- (021) 883 8669 Inter + 27 21 883 8669 Email Clyde@infruit2.agric.za From owner-plants@net.bio.net Tue Feb 04 22:00:00 1997 Path: biosci!daresbury!nntp-trd.UNINETT.no!nntp.uio.no!news.maxwell.syr.edu!europa.clark.net!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!cam-news-hub1.bbnplanet.com!www.nntp.primenet.com!nntp.primenet.com!mr.net!news-peer.gsl.net!news.gsl.net!news-paris.gsl.net!news.gsl.net!news.glo.be!usenet From: <> Newsgroups: bionet.plants Subject: bio-technology, genetic engeneering Date: 5 Feb 1997 19:27:28 GMT Organization: Customer of Globe Internet NV Lines: 8 Message-ID: <5damv0$vji@rhea.glo.be> NNTP-Posting-Host: p8-25.z03.glo.be Hallo, What do you think about bio-technology, more specific genetic engeneering ? It is about food (tomatoes, apples, etc. ) Please send your opinion to : gd30024@glo.be Thank you. From owner-plants@net.bio.net Wed Feb 05 22:00:00 1997 Path: biosci!bloom-beacon.mit.edu!eru.mt.luth.se!www.nntp.primenet.com!nntp.primenet.com!howland.erols.net!vixen.cso.uiuc.edu!news.uoregon.edu!news.rediris.es!news.upc.es!lilith.uab.es!newsmgr From: "Charles A. Abella" Newsgroups: tw.bbs.rec.entertainment,tw.bbs.sci.biology,aus.education.bio-newtech,aus.environment.conservation,bionet.general,bionet.microbiology,bionet.plants Subject: Re: "problem about microalgae harvest" Date: Thu, 06 Feb 1997 17:17:31 +0000 Organization: University of Girona Lines: 12 Distribution: inet Message-ID: <32FA122A.20F0@fc.udg.es> References: <5d0m85$jla@netnews.hinet.net> Reply-To: dbcaa@fc.udg.es NNTP-Posting-Host: 130.206.128.93 Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 3.0 (Macintosh; I; PPC) Xref: biosci bionet.general:25516 bionet.microbiology:8792 bionet.plants:14354 Dear Tsicchen, I do not know exactly what is your problem about the microalgae harvesting. I guess you are looking for a good and practica method for large volumes. We have used a special type of centrifuge (rather weird in appearence) called Centrifuge Separator from Westfalia Separator AG D-4740 Oelde. Postfach 3720. Phone (02522)77-1. This machine allows you to harvest in lab with a centrifuge similar to thouse used in dairy industries. Charles A. Abella University of Girona Dept. Biology E-17071 Girona Spain E-mail: dbcaa@fc.udg.es From owner-plants@net.bio.net Wed Feb 05 22:00:00 1997 Path: biosci!rutgers!gatech!csulb.edu!hammer.uoregon.edu!news-peer.gsl.net!news.gsl.net!news-penn.gsl.net!news.gsl.net!news.belnet.be!news.sri.ucl.ac.be!NewsWatcher!user From: fifibio@hotmail.com (Yannick Dewael) Newsgroups: bionet.plants Subject: LOOKING FOR informations about PHOTOTOXINS Date: Thu, 06 Feb 1997 12:56:44 +0000 Organization: UCL Lines: 8 Message-ID: NNTP-Posting-Host: 130.104.128.142 I'm Yannick Dewael. I'm a student in third year in biology in the Universite Catholique de Louvain-La-Neuve in Belgium. I must realize a work in vegetal cell biology: it's a synthesis about the PHOTOTOXIN. If you could give me some references of articles or (better) synthesis already done (in English or in French), it would be a great help for me. Thank you so much Yannick Dewael E-mail: fifibio@hotmail.com From owner-plants@net.bio.net Wed Feb 05 22:00:00 1997 Path: biosci!daresbury!nntp-trd.UNINETT.no!nntp.uio.no!www.nntp.primenet.com!nntp.primenet.com!enews.sgi.com!news.sgi.com!newsfeed.internetmci.com!news.infi.net!solaris.cc.vt.edu!newsgate.duke.edu!news-relay.ncren.net!news.wfu.edu!news From: taguebw@wfu.edu Newsgroups: bionet.plants Subject: Re: Effects of Sound on Plants Date: Thu, 06 Feb 1997 07:29:43 -0500 Organization: Wake Forest University Lines: 16 Message-ID: <32F9CEB7.712@wfu.edu> References: <5dbi2a$1u@sjx-ixn3.ix.netcom.com> NNTP-Posting-Host: taguebw.winston.wfu.edu Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 2.02 (Macintosh; I; PPC) J. Steinbrenner wrote: > > Looking for any research done on the effects of sound on plants for a > elementary school science project. Any ideas? There is absolutely no reliable evidence that sound has any effect on plants. There is one published paper from Janet Braam of Rice University in the journal Cell a few years ago that indicates that music (Talking Heads at about 80 decibels as I remember) has no effect on gene expression while touch, wind and rain DO effect gene expression. Best idea would be to give up this project. Brian From owner-plants@net.bio.net Wed Feb 05 22:00:00 1997 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!www.nntp.primenet.com!nntp.primenet.com!howland.erols.net!news.bbnplanet.com!cam-news-hub1.bbnplanet.com!uunet!in2.uu.net!128.250.1.21!munnari.OZ.AU!news.ecn.uoknor.edu!news.cis.okstate.edu!usenet From: Mary Ann Cushman Newsgroups: bionet.plants Subject: Re: Effects of Sound on Plants Date: 6 Feb 1997 15:26:19 GMT Organization: Oklahoma State University Lines: 10 Message-ID: <5dct6s$jc7@news.cis.okstate.edu> References: <5dbi2a$1u@sjx-ixn3.ix.netcom.com> NNTP-Posting-Host: dialin3.remote.okstate.edu Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 1.1N (Macintosh; I; 68K) To: jts3@ix.netcom.com X-URL: news:5dbi2a$1u@sjx-ixn3.ix.netcom.com Hi- Can you change the project to the effect of touch or wind on plants? Maybe sound, if it were loud enough at the right frequency would shake the plants, but that might be bad for little eardrums. There is real research on genes expressed when plants are touched (sprayed with water) by Janet Braam at Rice Univ. in Houston. But that wouldn't make a very good demo for little kids unless they're *very* up on modern biology. How about the sensitive plant, Mimosa pudica? It can be grown from seed if there's time. Good luck, Mer From owner-plants@net.bio.net Wed Feb 05 22:00:00 1997 Path: biosci!rutgers!news.sgi.com!news.maxwell.syr.edu!insync!Gamma.RU!srcc!demos!news.florin.ru!usenet From: Konstantin Savov Newsgroups: bionet.plants Subject: improved Web access to botanical databases Date: Thu, 06 Feb 1997 21:52:44 -0500 Organization: DataX/FLORIN, Inc. Lines: 32 Message-ID: <32FA98FC.446B@florin.ru> NNTP-Posting-Host: alpha.florin.ru Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 3.01 (X11; I; OSF1 V4.0 alpha) DataX/FLORIN ANNOUNCES IMPROVED WEB ACCESS TO BOTANICAL DATABASES Web access to the databases published on our site has been adjusted with a new revision of FLORIN Taxonomy Web Application. The latter is customizable for needs of a particular database now. The following databases are currently available on http://www.florin.ru/florin/db/: - Catalogue of Authentic Specimens of Moscow State University Herbarium (MW); - Mosses of the former USSR, by Dr. Michael Ignatov; - A Taxonomic Revision of Pseudodracontium (Araceae - Aroideae - Thomsonieae), by Dr. Michael Serebryanyi; - Lotus database, by Dr. Tatyana Kramina. Now, you may - search for data using customized query forms, - get lists of taxa and browse through them without filling in a query form, - get reports (synopsis, taxonomic tree) generated from a database by clicking one button. Any feedback is appreciated. Thank you in advance. ------------------------------------------------------- Konstantin Savov E-mail: kps@florin.ru FLORIN Project Leader Voice: +7(095)158-9520 Fax: +7(095)158-5700 DataX/FLORIN, Inc. Moscow, Russia ------------------------------------------------------- FLORIN Home Page: From owner-plants@net.bio.net Wed Feb 05 22:00:00 1997 Path: biosci!daresbury!nntp-trd.UNINETT.no!nntp.uio.no!www.nntp.primenet.com!nntp.primenet.com!su-news-hub1.bbnplanet.com!news.bbnplanet.com!cpk-news-hub1.bbnplanet.com!worldnet.att.net!news.maxwell.syr.edu!insync!uunet!in2.uu.net!165.87.194.248!news-m01.ny.us.ibm.net!news-s01.ny.us.ibm.net!not-for-mail From: Eirik Korsell Newsgroups: bionet.plants Subject: Crassula Horntree Date: Thu, 06 Feb 1997 18:38:54 +0000 Lines: 5 Message-ID: <32FA253E.646@ibm.net> NNTP-Posting-Host: slip139-92-16-200.pt.uk.ibm.net Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 3.01 (Win95; I) Can someone please help me with information on a plant which, as far as I know, is called: "Crassula Horntree". It is a massive green plant with tube like thick leaves and wood like stems. Information on where its from and what kind of conditions it lives under would be greatly appreciated. From owner-plants@net.bio.net Wed Feb 05 22:00:00 1997 Path: biosci!bcm.tmc.edu!cs.utexas.edu!news.swt.edu!newsmaster From: Ari Kahn Newsgroups: bionet.plants Subject: Crustacean ITS Phylogeny and PCR Date: Thu, 06 Feb 1997 02:36:41 +0000 Organization: Southwest Texas State University Lines: 39 Message-ID: <32F943B5.7ECA@swt.edu> Reply-To: ak01706@swt.edu NNTP-Posting-Host: port6.modem3.cc.swt.edu Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 3.01 (Macintosh; I; PPC) I am looking at the phylogeny of the crustacean Triops using rDNA (ITS) sequences. DNA isolations of high molecular weight have been successful. However, our ITS amplifications are not working. The primers used were originally developed for fungus** and work in plants very well. We fear that amplification is not possible because of the primer sequences. Has anyone done any PCR work with crustaceans or other animals on the ITS region and if so, can you suggest some alternative primer sequences or a proven PCR method? The sequences we are using have the following sequences: P1: GGAAGTAAAAGTCGTAACAAGG P4: TCCTCCGCTTATTGATATGC and was taken from the following reference: Kim, K-J. and Jansen, R.K. (1994) Comparison of phylogenetic hypotheses among different data sets in dwarf dandelions (Krigia ): additional information from internal transcribed spacer sequences of nuclear ribosomal DNA. Plant Syst. Evol. 190: 157-185. **White, T. J., Burns, T., Lee, S., Taylor, J. (199). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In Innis, M. A., Gelfand, D. H., Sninsky, J. J., White, T. J., (eds.), PCR protocols: a guide to methods and applications, pp. 315-322. SanDiego, California. Thank you, -- "There is a theory which states that if ever anybody discovers exactly what the Universe is for and why it is here, it will instantly disappear and be replaced by something even more bizarre and inexplicable. There is another theory which states that this has already happened." *Douglas Adams Ari Kahn ak01706@swt.edu http://www.swt.edu/~ak01706 http://www.bio.swt.edu/PE/pelab.html From owner-plants@net.bio.net Wed Feb 05 22:00:00 1997 Path: biosci!agate!howland.erols.net!ix.netcom.com!news From: jts3@ix.netcom.com(J. Steinbrenner) Newsgroups: bionet.plants Subject: Effects of Sound on Plants Date: 6 Feb 1997 03:10:02 GMT Organization: Netcom Lines: 3 Message-ID: <5dbi2a$1u@sjx-ixn3.ix.netcom.com> NNTP-Posting-Host: tok-ca6-38.ix.netcom.com X-NETCOM-Date: Wed Feb 05 7:10:02 PM PST 1997 Looking for any research done on the effects of sound on plants for a elementary school science project. Any ideas? From owner-plants@net.bio.net Wed Feb 05 22:00:00 1997 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!europa.clark.net!news.maxwell.syr.edu!news-peer.gsl.net!news.gsl.net!EU.net!news2.EUnet.fr!Belgium.EU.net!chaos.kulnet.kuleuven.ac.be!news.belnet.be!news.sri.ucl.ac.be!NewsWatcher!user From: fifibio@hotmail.com (Yannick Dewael) Newsgroups: bionet.plants Subject: LOOKING FOR informations about PHOTOTOXINS Date: Thu, 06 Feb 1997 12:55:31 +0000 Organization: UCL Lines: 8 Message-ID: NNTP-Posting-Host: 130.104.128.142 I'm Yannick Dewael. I'm a student in third year in biology in the Universite Catholique de Louvain-La-Neuve in Belgium. I must realize a work in vegetal cell biology: it's a synthesis about the PHOTOTOXIN. If you could give me some references of articles or (better) synthesis already done (in English or in French), it would be a great help for me. Thank you so much Yannick Dewael E-mail: fifibio@hotmail.com From owner-plants@net.bio.net Wed Feb 05 22:00:00 1997 Path: biosci!fcs280s.ncifcrf.gov!usenet From: Tom McCloud Newsgroups: bionet.plants Subject: Re: LOOKING FOR informations about PHOTOTOXINS Date: Thu, 06 Feb 1997 08:31:05 -0500 Organization: SAIC Frederick Lines: 7 Message-ID: <32F9DD19.5902@dtpax2.ncifcrf.gov> References: Reply-To: McCloud@dtpax2.ncifcrf.gov NNTP-Posting-Host: 129.43.28.131 Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 3.01Gold (WinNT; I) To: Yannick Dewael Yannick Dewael wrote: > a synthesis about the PHOTOTOXIN? Several years ago I recall reading something about some polyacetylenic compounds, I believe isolated from Umbelliferae, that were toxic to mosquito larvae only in the presence of light. Is this the sort of compound you are seeking information about? Tom McCloud From owner-plants@net.bio.net Wed Feb 05 22:00:00 1997 Path: biosci!daresbury!nntp-trd.UNINETT.no!sn.no!Oslo2.Norway.EU.net!Norway.EU.net!nntp.uio.no!news.maxwell.syr.edu!insync!Gamma.RU!srcc!sovam!not-for-mail From: Vladimir RUMYNIN Newsgroups: bionet.plants Subject: Looking for Twyford Plant Laboratoty Date: Thu, 06 Feb 1997 21:16:35 +0300 Organization: Main Bot. Garden Ru.Acad.Sci., Plant Biotechnology Lab. Lines: 4 Message-ID: <32FA2002.3A3B@online.ru> Reply-To: rumynin@online.ru NNTP-Posting-Host: ts1-a13.dial.sovam.com Mime-Version: 1.0 Content-Type: text/plain; charset=iso-8859-2 Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 3.0Gold (Win95; I) Hello colleques, I'm looking for Twyford Plant Laboratory links in the WWW. Would be greatefull for any information. Vladimir Rumynin, Moscow From owner-plants@net.bio.net Thu Feb 06 22:00:00 1997 Newsgroups: bionet.plants Path: biosci!daresbury!nntp-trd.UNINETT.no!Oslo2.Norway.EU.net!Norway.EU.net!nntp.uio.no!www.nntp.primenet.com!nntp.primenet.com!howland.erols.net!rill.news.pipex.net!pipex!btnet!btnet-feed2!news.compulink.co.uk!cix.compulink.co.uk!usenet From: rwhitehead@cix.compulink.co.uk ("Roger Whitehead") Subject: Re: need clip art of Amaranth + Salvia Message-ID: Organization: Compulink Information eXchange X-Newsreader: Virtual Access Date: Fri, 7 Feb 1997 01:07:35 GMT Lines: 22 << Check the site 'http://www.flowerweb.nl/flowerbase/' for a searchable database with many pictures, including salvia and amaranth. >> There seems to be some problem with that site. You get this message when you try to search the database: "HTTP/1.0 403 Access Forbidden (Execute Access Denied - This Virtual Directory does not allow objects to be executed.)". While it's heartening to learn that the death penalty for objects has been repealed, this is not much help otherwise. 8-) Never mind, the Dutch have another solution, which is Marco Bleeker's superb Web encyclopaedia of plant photos and information ("site" is too feeble a word). Go to http://www.euronet.nl/users/mbleeker/ and give yourself a treat. Roger - - - - - - - - - - - - - - - - - - - - - - - - - - - - Roger Whitehead, 14 Amy Road, Oxted, Surrey RH8 0PX Tel: +44 1883 713074; fax +44 1883 716793 . From owner-plants@net.bio.net Thu Feb 06 22:00:00 1997 Path: biosci!agate!spool.mu.edu!uwm.edu!news-peer.gsl.net!news.gsl.net!news.maxwell.syr.edu!europa.clark.net!news.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news.mindspring.com!usenet From: sdlooker@mindspring.com (FRANK HOCZA) Newsgroups: bionet.plants Subject: Question - > Best Medium for Starting Seeds? Date: Fri, 07 Feb 1997 14:17:12 GMT Organization: MindSpring Enterprises Lines: 1 Message-ID: <32fb3751.2067611@news.mindspring.com> Reply-To: sdlooker@mindspring.com NNTP-Posting-Host: ip135.san-diego.ca.pub-ip.psi.net Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Server-Date: 7 Feb 1997 14:11:57 GMT X-Newsreader: Forte Agent .99g/32.339 From owner-plants@net.bio.net Thu Feb 06 22:00:00 1997 Path: biosci!rutgers!csn!nntp-xfer-1.csn.net!news.bbnplanet.com!su-news-hub1.bbnplanet.com!arclight.uoregon.edu!super.zippo.com!zdc!szdc!news From: dwr@nornet.on.ca Newsgroups: bionet.plants Subject: Re: Crassula Horntree Date: Thu, 06 Feb 1997 18:58:32 GMT Organization: None Lines: 18 Message-ID: <5de4mu$qeh@lori.zippo.com> References: <32FA253E.646@ibm.net> X-Newsreader: Forte Free Agent 1.0.82 Eirik Korsell wrote: >Can someone please help me with information on a plant which, as far as >I know, is called: "Crassula Horntree". It is a massive green plant with >tube like thick leaves and wood like stems. Information on where its >from and what kind of conditions it lives under would be greatly >appreciated. For growing, follow the Jade plant rules. Other than that, I can't help you much. Mine is doing fine, water every two weeks, prunings about every 3 months. DAve (Think small, grow a bonsai) Zone 6B, Southern Ontario, Canada From owner-plants@net.bio.net Thu Feb 06 22:00:00 1997 Path: biosci!agate!spool.mu.edu!uwm.edu!newsfeeds.sol.net!hunter.premier.net!uunet!in3.uu.net!192.233.85.167!shore!pm2-75.lynnma.shore.net!user From: biobarge@shore.net (Will Warren) Newsgroups: bionet.plants Subject: Re: Hydroponics on the Seas/Oceans Date: Fri, 07 Feb 1997 06:00:40 -0500 Organization: Shore.Net/Eco Software, Inc; (info@shore.net) Lines: 4 Message-ID: References: <5d9ita$mqu@demerzel.dso.gov.sg> NNTP-Posting-Host: pm2-75.lynnma.shore.net X-Newsreader: Yet Another NewsWatcher 2.0.6b4 Check out the biobarge... http://www.shore.net/~wbw From owner-plants@net.bio.net Thu Feb 06 22:00:00 1997 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!europa.clark.net!newsfeeds.sol.net!news.maxwell.syr.edu!news.bc.net!rover.ucs.ualberta.ca!news.agtac.net!not-for-mail From: Kelcarde@bordercity.com (C.D.) Newsgroups: bionet.plants Subject: test Date: Fri, 07 Feb 1997 15:31:49 GMT Organization: Telus Advanced Communications Lines: 1 Message-ID: <32fb4ab3.1730089@news.bordercity.com> NNTP-Posting-Host: 207.34.111.15 X-Newsreader: Forte Free Agent 1.1/32.230 test From owner-plants@net.bio.net Thu Feb 06 22:00:00 1997 Path: biosci!agate!spool.mu.edu!newspump.sol.net!howland.erols.net!rill.news.pipex.net!pipex!warwick!bignews.shef.ac.uk!usenet From: m.j.phillips@shef.ac.uk (Marcus Phillips) Newsgroups: bionet.molbio.plant,bionet.plants,bionet.plants.education Subject: Re: Venus Flytrap (Dionaea muscipula) Growing Info? Date: 7 Feb 1997 15:58:09 GMT Organization: University of Sheffield Lines: 28 Message-ID: <5dfjeh$nk0@bignews.shef.ac.uk> References: <01bc11fa$79bf2f00$0b2317c4@196.23.35.11> NNTP-Posting-Host: pc037038.shef.ac.uk Mime-Version: 1.0 Content-Type: Text/Plain; charset=US-ASCII X-Newsreader: WinVN 0.99.7 Xref: biosci bionet.plants:14368 bionet.plants.education:1688 >plants. Any of the follwing information will be appreciated: Try http://www.geocities.com/RainForest/4677/index.html >- Ground compound Use Pure Sphagnum moss peat >- Water Use soft water (distilled or rainwater), keep them standing in it >- Temperature Keep frost free. A cool to warm greenhouse / room is fine >- Light They like as much as possible! >- Nutritional information Don't give them any fertilizers at all >- Ground PH This should be acid, but if you use moss peat, then it will automatically be so. I hope this helps, Marcus Phillips (m.j.phillips@shef.ac.uk) From owner-plants@net.bio.net Thu Feb 06 22:00:00 1997 Path: biosci!agate!spool.mu.edu!howland.erols.net!feed1.news.erols.com!hunter.premier.net!uunet!in1.uu.net!192.174.65.41!01-newsfeed.univie.ac.at!cmir.arnes.si!kanja.arnes.si!not-for-mail From: Primoz Jurko Newsgroups: bionet.plants Subject: HELP! English names of fungi Date: Fri, 07 Feb 1997 15:05:38 +0100 Organization: University of Ljubljana, Slovenia Lines: 19 Message-ID: <32FB36B2.6F83@guest.arnes.si> NNTP-Posting-Host: ppp1-lj10-x.arnes.si Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 3.0 (Win95; I) Dear colleagues from the Dept. of biology: I have a translation problem - I'm stuck with Latin names for the following fungi: - Amanita caesarea - Boletus regius - Boletus fragrans - Boletus Dupaini - Boletus torosus - Clitocybe maxima - Coprinus picaceus - Tricholoma colossus - Cantharellus cibarius, var. amethystea I would appreciate any help with English terms for these fungi. Please email me your replies. Thanx in advance, Primoz From owner-plants@net.bio.net Thu Feb 06 22:00:00 1997 Path: biosci!daresbury!yama.mcc.ac.uk!liv!rgu.ac.uk!news From: 933467u@app_science.rgu.ac.uk Newsgroups: bionet.plants Subject: Biosynthetic Pathways of Indole Alkaloids Date: 7 Feb 1997 13:57:05 GMT Organization: Computer Sevices Unit, The Robet Gordon University, Aberdeen, Scotland Lines: 10 Message-ID: <5dfcbh$45c@news.rgu.ac.uk> NNTP-Posting-Host: novixint.rgu.ac.uk Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 1.1N (Windows; I; 16bit) To Anyone Who Can Help Me, I'm a 4th year student at the Robert Gordon University, Aberdeen, Scotland. I'd like to find information on the Biosynthetic Pathways of Indole Alkaloids. I realise that I may be writing to the wrong newsgroup but I'd really appreciate it if anyone can point me in the right direction. Yours, Alan Mercer. From owner-plants@net.bio.net Thu Feb 06 22:00:00 1997 Path: biosci!agate!nntpfeed.doc.ic.ac.uk!sunsite.doc.ic.ac.uk!warwick!bignews.shef.ac.uk!usenet From: m.j.phillips@shef.ac.uk (Marcus Phillips) Newsgroups: bionet.plants Subject: Re: Need help with venus-flytrap Date: 7 Feb 1997 16:53:22 GMT Organization: University of Sheffield Lines: 27 Message-ID: <5dfmm2$nk0@bignews.shef.ac.uk> References: <5ckjdl$lck@ftpsvr.cyberway.com.sg> NNTP-Posting-Host: pc037038.shef.ac.uk Mime-Version: 1.0 Content-Type: Text/Plain; charset=US-ASCII X-Newsreader: WinVN 0.99.7 >Hi! >I have recently bought a pot of Venus Fly-trap from an exhibition. >After 1 day, the plant show yellowing at the edges. Now into the >second day, some leaves have turned brown and more leaves are turning >yellow. >Can anyone advise me on the favourable conditions for Venus fly-trap? For general infomation try http://www.geocities.com/RainForest/4677/index.html This will give you some general advice on growing these plants. In order to help you further, however, I need more info about the plant you bought... How big was it? How dry was the compost? How healthy did it look? Was it very draughty / dry at the show? How are you currently growing it? It sounds as if the plant got too dry / cold at the show! If you now treat them reasonably, they should recover. Try repotting them, ensuring you remove any dead material. Good luck Marcus From owner-plants@net.bio.net Thu Feb 06 22:00:00 1997 Path: biosci!agate!spool.mu.edu!uwm.edu!cs.utexas.edu!howland.erols.net!worldnet.att.net!hunter.premier.net!uunet!in1.uu.net!198.82.160.249!solaris.cc.vt.edu!newsgate.duke.edu!news-relay.ncren.net!nntp-xfer.ncsu.edu!news From: Chris Simms Newsgroups: bionet.plants Subject: Chris's Agriculture News Date: Thu, 06 Feb 1997 22:55:43 -0800 Organization: North Carolina State University Lines: 3 Message-ID: <32FAD1EF.7EA5@unity.ncsu.edu> NNTP-Posting-Host: b001h242.rh.ncsu.edu Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 3.01 (Win16; I) Wanted to let everyone know that I just updated my website and have added a few new things. Stop by and let me know what you think. The URL is http://www4.ncsu.edu/~ctsimms/web/index.htm From owner-plants@net.bio.net Thu Feb 06 22:00:00 1997 Path: biosci!agate!spool.mu.edu!newspump.sol.net!howland.erols.net!portc02.blue.aol.com!audrey01.news.aol.com!not-for-mail From: kdav97@aol.com (KDav97) Newsgroups: bionet.plants Subject: Tree Diseases Date: 7 Feb 1997 03:59:21 GMT Organization: AOL http://www.aol.com Lines: 5 Message-ID: <19970207035900.WAA07768@ladder01.news.aol.com> NNTP-Posting-Host: ladder01.news.aol.com X-Admin: news@aol.com Am looking for info on any tree which has experienced severe decline in the last fifty years - ie, Elms, Cornus florida, Ash, etc. I need to know which trees and or shrubs have been widely affected and any other info I can get on this. This is for publication. If you would like to assist, please email me at KDav97@aol.com. From owner-plants@net.bio.net Thu Feb 06 22:00:00 1997 Path: biosci!rutgers!news.sgi.com!howland.erols.net!rill.news.pipex.net!pipex!oleane!jussieu.fr!cea.fr!news From: Albrecht Roscher Newsgroups: bionet.plants Subject: Histidine biosynthesis in plants Date: 7 Feb 1997 18:32:07 GMT Organization: CEA Commissariat a l'Energie Atomique, France. Lines: 5 Message-ID: <5dfsf7$fi6@news.cea.fr> NNTP-Posting-Host: lera.ceng.cea.fr Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 1.1IS (X11; I; IRIX 5.3 IP22) X-URL: news:bionet.plants My 1988 textbook on plant biochemistry states that the pathway for histidine biosynthesis in plants still is not elucidated. Can anyone tell me if this state of the art has evolved, if possible with a literature reference? Thanks a lot, Albrecht From owner-plants@net.bio.net Thu Feb 06 22:00:00 1997 Path: biosci!bcm.tmc.edu!cs.utexas.edu!howland.erols.net!news.bbnplanet.com!cam-news-hub1.bbnplanet.com!news.maxwell.syr.edu!news.bc.net!rover.ucs.ualberta.ca!news.agtac.net!not-for-mail From: Kelcarde@bordercity.com (C.D.) Newsgroups: bionet.plants Subject: Help me with my croton... Date: Fri, 07 Feb 1997 15:37:21 GMT Organization: Telus Advanced Communications Lines: 4 Message-ID: <32fb4b88.1942941@news.bordercity.com> NNTP-Posting-Host: 207.34.111.15 X-Newsreader: Forte Free Agent 1.1/32.230 I have a Croton and all the leaves have drooped downward all of a sudden. It was a very healthy palnt before this. Does anyone know what I can do to get the leaves back to their original formation...it looks so sad this way. From owner-plants@net.bio.net Thu Feb 06 22:00:00 1997 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!www.nntp.primenet.com!nntp.primenet.com!su-news-hub1.bbnplanet.com!news.bbnplanet.com!arclight.uoregon.edu!news.bc.net!torn!nott!cunews!freenet-news.carleton.ca!FreeNet.Carleton.CA!de310 From: de310@FreeNet.Carleton.CA (Michael Roberts) Newsgroups: bionet.plants Subject: Re: Question - > Best Medium for Starting Seeds? Date: 7 Feb 1997 19:06:55 GMT Organization: National Capital Freenet, Ottawa, Canada Lines: 8 Message-ID: <5dfugf$16i@freenet-news.carleton.ca> NNTP-Posting-Host: freenet5.carleton.ca X-Given-Sender: de310@freenet5.carleton.ca (Michael Roberts) depends on the seed I like peat/perlite mix with a thin layer of vermiculite over the seeds as this allows for easy sprouting -- goto www.ncf.carleton.ca/~de310 for consultation & lowest prices on Hydroponics,Aquarium,High efficiency lighting (MH,HPS,sulphur), CO2 alternatives & related equipment & information From owner-plants@net.bio.net Fri Feb 07 22:00:00 1997 Path: biosci!rutgers.rutgers.edu!uwm.edu!www.nntp.primenet.com!nntp.primenet.com!su-news-hub1.bbnplanet.com!cam-news-hub1.bbnplanet.com!news.bbnplanet.com!news.maxwell.syr.edu!news.bc.net!info.ucla.edu!nnrp.info.ucla.edu!news.ucdavis.edu!chip.ucdavis.edu!not-for-mail From: ez041475@chip.ucdavis.edu (Eric Dobratz) Newsgroups: bionet.plants,bionet.population-bio,sci.bio.ecology,sci.bio.entomology.misc Subject: Re: anthills and profuse growth of shrub Spirea media (Rosaceae) Followup-To: bionet.plants,bionet.population-bio,sci.bio.ecology,sci.bio.entomology.misc Date: 8 Feb 1997 20:27:07 GMT Organization: University of California, Davis Lines: 10 Message-ID: <5dinir$j8a$1@mark.ucdavis.edu> References: <5dh3i6$ss0@onlink3.onlink.net> NNTP-Posting-Host: chip.ucdavis.edu X-Newsreader: TIN [UNIX 1.3 950824BETA PL0] Xref: biosci bionet.plants:14389 bionet.population-bio:2202 sci.bio.ecology:23827 sci.bio.entomology.misc:4261 I also wouldn't discount the possibility that these ants may be protecting the shrubs that grow immediately over their colonies. @>------<@ @>------<@ @>------<@ @>------<@ Eric A. Dobratz U.C. Davis Veterinary School Class of '99 Reptile and insect enthusiast at large. @>------<@ @>------<@ @>------<@ @>------<@ From owner-plants@net.bio.net Fri Feb 07 22:00:00 1997 Path: biosci!agate!howland.erols.net!news.sprintlink.net!news-peer.sprintlink.net!news.maxwell.syr.edu!nntp.uio.no!Norway.EU.net!nntp-oslo.UNINETT.no!nntp-trd.UNINETT.no!daresbury!not-for-mail From: erickson@sas.upenn.edu (Ralph O. Erickson) Newsgroups: bionet.plants Subject: private life of plants Date: 8 Feb 1997 19:26:48 -0000 Lines: 11 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <5dik1o$1kq@mserv1.dl.ac.uk> MIME-Version: 1.0 Original-To: plantbio@dl.ac.uk Three or four months ago there were many inquiries on this newsgroup about video-cassettes of David Attenborough's "The Private Life of Plants," (sometimes wrongly called "The Secret Life..."). But no information appeared about where to buy the cassettes. A new PBS Home Video catalog has just come in which the 6-cassette set of "The Private Life..." is listed for $80. The set can be ordered by 'phone, 1-800-645-4PBS; or online, at http://www.pbs.org/shop BTW, Attenborough's accompanying book, "The Private Life of Plants," was published in 1995 by Princeton University Press. R. O. Erickson From owner-plants@net.bio.net Fri Feb 07 22:00:00 1997 Path: biosci!agate!spool.mu.edu!uwm.edu!www.nntp.primenet.com!nntp.primenet.com!newsxfer3.itd.umich.edu!su-news-hub1.bbnplanet.com!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!worldnet.att.net!newsadm From: Hortus Newsgroups: bionet.plants Subject: Re: Fast growing trees? Date: Fri, 07 Feb 1997 23:24:05 -0800 Organization: Hortus USA Corp Lines: 30 Message-ID: <32FC2A15.46E@worldnet.att.net> References: <32FBF18D.3A22@ix.netcom.com> NNTP-Posting-Host: 207.116.35.5 Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 3.01Gold (Win16; I) To: "V. Scalo" V. Scalo wrote: > > I was wondering what is the fastest commercially or legal tree > that would grow in New England. > > I recieved a mailing about Austrees, a fast growing tree, and > remember other trees being mentioned. > > Thank you > -- > V. Scalo > Signal Station 71 > 128 Henry Street, East Haven, CT 06512-4757 > FAX 1-(203)458-0560 http://pw2.netcom.com/~vinscal/ Fast growing and short lived are the hybrid poplars. These are available as pyramidal upright forms as well as bush varieties. Since they are easy to propagate and grow you can start with smallest whips. After extablished in a year many will grow 5ft/yr+ regards Joel -- ****************** Hortus USA Corp. ***************** PO Box 1956 Old Chelsea Station, New York NY 10113 USA Rhizopon AA Dry Powders & Tablets for Solutions Plant Growth Regulator-Rooting Hormones **************** hortus@worldnet.att.net ************** From owner-plants@net.bio.net Fri Feb 07 22:00:00 1997 Path: biosci!agate!spool.mu.edu!uwm.edu!newsfeeds.sol.net!news.maxwell.syr.edu!ix.netcom.com!news From: "V. Scalo" Newsgroups: bionet.plants Subject: Fast growing trees? Date: Fri, 07 Feb 1997 22:22:53 -0500 Organization: Signal Station Lines: 12 Message-ID: <32FBF18D.3A22@ix.netcom.com> NNTP-Posting-Host: nhv-ct1-03.ix.netcom.com Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-NETCOM-Date: Fri Feb 07 9:01:59 PM CST 1997 X-Mailer: Mozilla 3.0C-NC320 (Win95; I) I was wondering what is the fastest commercially or legal tree that would grow in New England. I recieved a mailing about Austrees, a fast growing tree, and remember other trees being mentioned. Thank you -- V. Scalo Signal Station 71 128 Henry Street, East Haven, CT 06512-4757 FAX 1-(203)458-0560 http://pw2.netcom.com/~vinscal/ From owner-plants@net.bio.net Fri Feb 07 22:00:00 1997 Path: biosci!agate!spool.mu.edu!uwm.edu!www.nntp.primenet.com!nntp.primenet.com!cpk-news-hub1.bbnplanet.com!news.bbnplanet.com!worldnet.att.net!newsadm From: Hayden James Newsgroups: bionet.plants Subject: Life Support System Date: Fri, 07 Feb 1997 21:56:23 -0500 Organization: AT&T WorldNet Services Lines: 24 Message-ID: <32FBEB57.2D45@worldnet.att.net> NNTP-Posting-Host: 207.116.35.140 Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 3.01Gold (Win95; I) I am doing research for my high school along the same lines. I was thinking of setting up an aquarium tank and putting devices in there to control temperature. I would use a cover to seal the aquarium. I would have plants in there growing hydrophoically. The plants would supply oxygen and water for the inclosed system through respiration and photosythesis. I would use a lab rat of similiar organism to test the system to correct any flaws found. For an energy source I would just use an outlet representing a energy source that would be used on Mars which would be the combining of Hydrogen and oxygen, Methane from Carbon and Hydrogen, or solar panels. The problem I have is the recycling system that would need to be built to recycle solid and liquid waste. I am writing this to give you a description of my project. I would greatly appreciate any suggestions that you could give or if you could find a better way to run the project. A question I have is how would a recycling system be built in this system. Thank You Hayden A. James P.S. Please e-mail at REHJames@worldnet.att.net From owner-plants@net.bio.net Fri Feb 07 22:00:00 1997 Path: biosci!daresbury!nntp-trd.UNINETT.no!nntp.uio.no!www.nntp.primenet.com!nntp.primenet.com!howland.erols.net!feed1.news.erols.com!news.enteract.com!ix.netcom.com!news From: "V. Scalo" Newsgroups: bionet.plants Subject: Re: Histidine biosynthesis in plants Date: Fri, 07 Feb 1997 19:51:41 -0500 Organization: Signal Station Lines: 16 Message-ID: <32FBCE1D.3085@ix.netcom.com> References: <5dfsf7$fi6@news.cea.fr> NNTP-Posting-Host: nhv-ct1-03.ix.netcom.com Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-NETCOM-Date: Fri Feb 07 6:30:48 PM CST 1997 X-Mailer: Mozilla 3.0C-NC320 (Win95; I) Albrecht Roscher wrote: > > My 1988 textbook on plant biochemistry states that the pathway for histidine > biosynthesis in plants still is not elucidated. Can anyone tell me if this > state of the art has evolved, if possible with a literature reference? My text doesn't mention that much more its from 1991 Once assimilated into glutamate, the nitrogen can be transfered to other amino acids, but the refs are from 1980 and 1976 -- V. Scalo Signal Station 71 128 Henry Street, East Haven, CT 06512-4757 FAX 1-(203)458-0560 http://pw2.netcom.com/~vinscal/ From owner-plants@net.bio.net Fri Feb 07 22:00:00 1997 Path: biosci!rutgers.rutgers.edu!uwm.edu!math.ohio-state.edu!howland.erols.net!torn!onlink3.onlink.net!usenet From: robert.liebermann@wmich.edu (robert liebermann) Newsgroups: bionet.plants,bionet.population-bio,sci.bio.ecology,sci.bio.entomology.misc Subject: anthills and profuse growth of shrub Spirea media (Rosaceae) Date: 8 Feb 1997 05:39:18 GMT Organization: Lake Baikal-Lake Superior Institute Lines: 29 Sender: -Not-Authenticated-[3708] Message-ID: <5dh3i6$ss0@onlink3.onlink.net> NNTP-Posting-Host: wawa1_onlink3.onlink.net X-Newsreader: InterNews 2.0.2@wawa1_onlink3.onlink.net[R] XDisclaimer: User not authenticated Xref: biosci bionet.plants:14379 bionet.population-bio:2197 sci.bio.ecology:23808 sci.bio.entomology.misc:4255 Can someone give me some advice on this- I'm working on my thesis-comparative phytogeography of islands in Lake Baikal and Lake Superior. On one of the islands in Lake Baikal [Bolshoi Ushkanii] there is a very dense population of ants/anthills [the medium sized black BITING ones, sorry I can't be more precise]. The Island is forested with a boreal predominately Larix czekanowskii-Pinus sylvestris forest, on mesic carbonate-derived podzols. I frequently found that growth of vegetation was quite lush near the anthills, especially of the shrub Spirea media (Rosceae). After some time I could expect to find [or avoid] ants from a distance in the field by looking at the S. media shrubs. My question: why are the plants so lush? Is it the increased aeration to the roots? Some sort of chemistry of the ants? Soil fertilization by the wastes of the ants? Where can I learn more [literature]? I know more about plants than ants! Thanks, Robert J. Liebermann Lake Baikal-Lake Superior Institute RR#1, Site 6, Box 5, Lake Superior Wawa, Ontario, P0S 1K0, Canada Department of Geography Western Michigan University Kalamazoo, Michigan, 49008 5056 USA From owner-plants@net.bio.net Fri Feb 07 22:00:00 1997 Path: biosci!rutgers.rutgers.edu!uwm.edu!news-peer.gsl.net!news.gsl.net!news.maxwell.syr.edu!cam-news-hub1.bbnplanet.com!news.bbnplanet.com!howland.erols.net!rill.news.pipex.net!pipex!netcom.net.uk!peernews.ftech.net!telehouse1.frontier-networks.co.uk!Aladdin!aladdin.net!ns2.aladdin.net!innotts!news From: simonc@innotts.co.uk (Simon Chamberlain) Newsgroups: bionet.plants Subject: Question about Codiaeum variegatum pictum (Croton) Date: Sat, 08 Feb 1997 12:16:05 GMT Organization: The Internet in Nottingham Lines: 19 Message-ID: <32fc6d52.13658060@news.innotts.co.uk> NNTP-Posting-Host: serialb0a.innotts.co.uk X-Newsreader: Forte Agent .99c/16.141 I have (according to the photo my wife's book) the above plant and I'd be grateful if anyone could settle a bet between me & my wife. I am sure that when we first had the plant it had a big red flower but that was 6 years ago. My wife thinks I'm just loosing it :-) So, if any can confirm or deny that ths plant will produce a flower then I'd be very grateful. BTW the bet is that whoever looses has to make the sandwiches for a week so there's obviously a lot riding on the answer. Thanks, Simon ----------------=Home Page=----------------- http://www.innotts.co.uk/~simonc/ -------------------------------------------------------- From owner-plants@net.bio.net Fri Feb 07 22:00:00 1997 Path: biosci!daresbury!nntp-trd.UNINETT.no!sn.no!www.nntp.primenet.com!nntp.primenet.com!news.mathworks.com!fu-berlin.de!cs.tu-berlin.de!news.uni-hamburg.de!news.uni-mainz.de!NewsWatcher!user From: KMEYER@mzdmza.zdv.uni-mainz.de (Karsten Meyer) Newsgroups: bionet.plants,bionet.population-bio,sci.bio.ecology,sci.bio.entomology.misc Subject: Re: anthills and profuse growth of shrub Spirea media (Rosaceae) Date: 8 Feb 1997 15:32:24 GMT Organization: Institute of Systematic Botany, Uni Mainz Lines: 21 Message-ID: References: <5dh3i6$ss0@onlink3.onlink.net> NNTP-Posting-Host: affine.biologie.uni-mainz.de Xref: biosci bionet.plants:14382 bionet.population-bio:2198 sci.bio.ecology:23823 sci.bio.entomology.misc:4260 Hello, I guess itıs the soil fertilization by the ants. If the soil is a podzol, it shall nutrient-poor, so some extra nutrients may have a big effect. As for the Spiraea, the seeds are collected by the ants for the nutrient-rich elaiosome that is attached to the seeds. Hope that helps, Karsten robert.liebermann@wmich.edu (robert liebermann) wrote: > [snip] > I frequently found that growth of vegetation was quite lush > near the anthills, especially of the shrub Spirea media (Rosceae). > [snip] -- Karsten Meyer Institute of Systematic Botany, University of Mainz 55099 Mainz - Germany Tel: +49 6131-39 25 91, Fax: +49 6131- 39 35 24 From owner-plants@net.bio.net Fri Feb 07 22:00:00 1997 Path: biosci!agate!spool.mu.edu!uwm.edu!www.nntp.primenet.com!nntp.primenet.com!cpk-news-hub1.bbnplanet.com!cam-news-hub1.bbnplanet.com!news.bbnplanet.com!howland.erols.net!ix.netcom.com!tor-nn1.netcom.ca!news From: Dennis L Williams Newsgroups: bionet.plants Subject: Treating indoor fig tree for scale Date: Sat, 08 Feb 1997 16:13:45 GMT Organization: Netcom Canada Lines: 1 Message-ID: <5di8sd$iq4@tor-nn1-hb0.netcom.ca> NNTP-Posting-Host: cal-ab4-21.netcom.ca X-NETCOM-Date: Sat Feb 08 11:16:13 AM EST 1997 X-Newsreader: NETCOMplete/3.2 Does anyone have some advise for getting rid of scale on indoor fig trees? From owner-plants@net.bio.net Fri Feb 07 22:00:00 1997 Path: biosci!agate!ihnp4.ucsd.edu!swrinde!howland.erols.net!newsfeed.internetmci.com!newsfeed.direct.ca!usenet From: Frank Larose Newsgroups: bionet.plants Subject: ACUPUNCTURE EDUCATIONAL TOUR TO CHINA Date: Sat, 08 Feb 1997 07:52:14 -0800 Organization: Vancouvair Services Lines: 47 Message-ID: <32FCA12E.6980@vancouvair-services.com> NNTP-Posting-Host: van-as-05a16.direct.ca Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 2.02 (Win16; I) Traditional Chinese Medicine and Cultural Tour to the People's Republic of China Join a group of TCM students on this exciting educational adventure. Explore how TCM is being practiced in China. This unique program focuses on the clinical practice of acupuncture and other TCM healing arts taught under the guidance of highly skilled physicians at the Hangzhou Hospital of TCM and the Hangzhou Red Cross Hospital. This program is designed to meet the needs of serious students as well as those with a more casual interest in TCM healing arts and Chinese culture. Our introduction to China involves touring historic sites in Beijing, Qufu, Shanghai and Suzhou; and finally Hangzhou where serious TCM studies begin. Students can extend this tour for further training. Les Moncrieff has conducted TCM tours annually to China for the past 6 years. Departure May 5 - 19, 1997 (15 Days) for $2,659 US (including air from Vancouver). Air add-on could be available from your gateway city on request. Land only: $1,959 US Includes roundtrip airfare from Vancouver, first class hotel accommodations, ground transportation, meals and special banquets, guided comprehensive sightseeing, cultural shows, baggage handling, and more...Also includes TCM training and treatments if required. In collaboration with VANCOUVAIR SERVICES, Les Moncrieff and the Vancouver Community College. FOR MORE INFORMATION, CONTACT: LES (604)520-3505. or Frank Larose,Vancouvair Services/Cruises by Design e-mail: holiday@vancouvair-services.com or other addresses in signature. ___________________________________________________ Vancouvair Services>Your International Reservation Centre Internet: http://www.vancouvair-services.com/tourism e-mail: holiday@vancouvair-services.com Toll Free: 1-800-665-9120 (Cruises by Design-Canada and USA) Phone: (604)606-1711 FAX: (604) 606-1718 Address 100-5301 Airport Road South Richmond, BC, Canada V7B 1B5 From owner-plants@net.bio.net Fri Feb 07 22:00:00 1997 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!www.nntp.primenet.com!nntp.primenet.com!howland.erols.net!newsxfer3.itd.umich.edu!portc01.blue.aol.com!audrey01.news.aol.com!not-for-mail From: mclase@aol.com (MClase) Newsgroups: bionet.plants Subject: Looking for Twyford Date: 8 Feb 1997 21:10:05 GMT Organization: AOL http://www.aol.com Lines: 2 Message-ID: <19970208210900.QAA04437@ladder01.news.aol.com> NNTP-Posting-Host: ladder01.news.aol.com X-Admin: news@aol.com I don't know the web link for Twyford, but Oglesby Plant Labs is at WWW.Zone10.com/nursery/Oglesby. From owner-plants@net.bio.net Fri Feb 07 22:00:00 1997 Path: biosci!bcm.tmc.edu!cs.utexas.edu!swrinde!ihnp4.ucsd.edu!munnari.OZ.AU!news.ecn.uoknor.edu!news.cis.okstate.edu!usenet From: Mary Ann Cushman Newsgroups: bionet.plants Subject: Re: Biosynthetic Pathways of Indole Alkaloids Date: 8 Feb 1997 22:02:00 GMT Organization: Oklahoma State University Lines: 7 Message-ID: <5dit4o$f91@news.cis.okstate.edu> References: <5dfcbh$45c@news.rgu.ac.uk> NNTP-Posting-Host: dialin6.remote.okstate.edu Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 1.1N (Macintosh; I; 68K) To: 933467u@app_science.rgu.ac.uk X-URL: news:5dfcbh$45c@news.rgu.ac.uk Hi- Try tryptophan - tryptamine - gramine, for example. Do you have Goodwin and Mercer Plant Biochemistry at your university? Take a look there. Good luck, Mer From owner-plants@net.bio.net Fri Feb 07 22:00:00 1997 Path: biosci!rutgers.rutgers.edu!uwm.edu!newsfeeds.sol.net!hunter.premier.net!news.maxwell.syr.edu!cam-news-hub1.bbnplanet.com!news.bbnplanet.com!uunet!in1.uu.net!194.119.128.129!news.u-net.com!newsmaster From: mark@beecham.u-net.com (Mark Beecham) Newsgroups: bionet.plants Subject: Re: Do houseplants filter air? Date: Sat, 08 Feb 1997 18:03:38 GMT Organization: U-NET Ltd Lines: 31 Message-ID: <32fcbdab.11333948@news.u-net.com> References: <32EEFABA.2D13@uthscsa.edu> NNTP-Posting-Host: p35.ascend3.is2.u-net.net X-Newsreader: Forte Free Agent 1.1/32.230 On Mon, 3 Feb 1997 23:16:33, vaughag@lincoln.ac.nz (Vaughan, Gillian Ruth) wrote: >>Michael Peterson wrote: >>> >>> >>> Do houseplants improve the air quality within a home. Aside from producing >>> oxygen, do they also filter out any toxins or irritants? Are there any >>> publications that rate or suggest different types of houseplants for this >>> purpose? > >There is actually a book on this now that I found in my local book store. >It's called something along the lines of Eco-friendly house plants, and goes >over about 50 species of houseplant, in addition to going over some of the >theory behind it. Yep, I just found It too and bought it for myself... It's "Eco Friendly House Plants" by B.C. Wolverton, and as mentioned elsewhere, is based on the 25 years of research at NASA. In Britain, It's published by Weidenfeld & Nicholson and costs £14.99 Elsewhere, give your bookstore the ISBN number 0 297 83484 3 and they should be able to help... Spoiling the plot, the top plant of those that DO absorb all sorts of nasties is the Areca Palm...I'm now off on a plant hunt around my local Garden Centres!... Mark Beecham, Lincoln, England... From owner-plants@net.bio.net Fri Feb 07 22:00:00 1997 Newsgroups: bionet.plants Path: biosci!rutgers.rutgers.edu!uwm.edu!cs.utexas.edu!swrinde!howland.erols.net!cam-news-hub1.bbnplanet.com!news.bbnplanet.com!news.maxwell.syr.edu!insync!uunet!in3.uu.net!204.74.114.90!news.genuity.net!news.lafn.org!lafn.org!lafn.org!bb389 From: bb389@lafn.org (Frank Kolwicz) Subject: "Potassium salts of Fatty Acids" as herbicides??? X-Nntp-Posting-Host: lafn.org Message-ID: <1997Feb8.175103.1432@lafn.org> Sender: news@lafn.org Reply-To: bb389@lafn.org (Frank Kolwicz) Organization: The Los Angeles Free-Net Date: Sat, 8 Feb 1997 17:51:03 GMT Lines: 18 I picked up a "safer" herbicide the other day composed, so the label says, of "potassium salts of fatty acids". The label has no warnings about food plants and says it works on anything, +\-. I'm looking for a better alternative to Roundup for crabgrass, nut grass, quack grass and other jointed grasses that are overrunning my southern California lawn and garden. Any information will be appreciated, especially efficacy, toxicity, and soil longevity. Frank -- Frank Kolwicz F.H.P.Kolwicz Photography, 271 Mesa Ave. Newbury Park, CA 91320, (805)499-2237 f/64ART From owner-plants@net.bio.net Sat Feb 08 22:00:00 1997 Path: biosci!bcm.tmc.edu!cs.utexas.edu!howland.erols.net!cam-news-hub1.bbnplanet.com!news.bbnplanet.com!uunet!in1.uu.net!151.99.250.2!server-b.cs.interbusiness.it!shark From: shark@mail.tau.it (Alessio Eduardo Pusateri) Newsgroups: bionet.plants Subject: Advertisement Date: Sun, 09 Feb 1997 01:28:14 +0200 Organization: Centro Servizi Interbusiness Lines: 11 Message-ID: NNTP-Posting-Host: 151.99.169.179 Mime-Version: 1.0 Content-Type: text/plain; charset=ISO-8859-1 Content-Transfer-Encoding: 8bit X-Newsreader: Yet Another NewsWatcher 2.3.2 There is a new site on the Net. You can find here some interesting advice books about Natural Sciences: Malacology, Botany, Biology, Marine biology etc. Then, you can put your request in our personal notice board and exchange specimen from your collection and ideas with many people with your own interest. You are welcome to visit this site at: http://www.dada.net/naturama -- shark From owner-plants@net.bio.net Sat Feb 08 22:00:00 1997 Path: biosci!rutgers.rutgers.edu!uwm.edu!www.nntp.primenet.com!nntp.primenet.com!howland.erols.net!newsfeed.internetmci.com!nntp.cntfl.com!usenet From: "GH" Newsgroups: bionet.plants Subject: position available Date: 8 Feb 1997 13:56:19 GMT Organization: CMDS News machine Lines: 6 Message-ID: <01bc15c7$3658dd80$768931cc@default> NNTP-Posting-Host: dial-71.marianna.fl.digitalexp.net X-Newsreader: Microsoft Internet News 4.70.1155 Oglesby Plant Laboratories, a world leader in plant tissue culture technologies has a Greenhouse Manager position available. Horticulture education/experience required. Located in rural north Florid, USA. Send email to oglesby@digitalexp.com for complete job description. From owner-plants@net.bio.net Sat Feb 08 22:00:00 1997 Path: biosci!rutgers.rutgers.edu!uwm.edu!newsfeeds.sol.net!news.maxwell.syr.edu!pumpkin.pangea.ca!news.mira.net.au!news.netspace.net.au!news.mel.connect.com.au!news.uwa.edu.au!cyllene.uwa.edu.au!not-for-mail From: lmiguel@cyllene.uwa.edu.au (Leon Miguel) Newsgroups: bionet.plants Subject: Re: Effects of Sound on Plants Date: 9 Feb 1997 11:52:30 GMT Organization: The University of Western Australia Lines: 18 Message-ID: <5dkdpu$bd7$1@enyo.uwa.edu.au> References: <5dbi2a$1u@sjx-ixn3.ix.netcom.com> NNTP-Posting-Host: cyllene.uwa.edu.au X-Newsreader: TIN [UNIX 1.3 950824BETA PL0] : Looking for any research done on the effects of sound on plants for a : elementary school science project. Any ideas? There is a book in our library as below: AUTHOR Retallack, Dorothy L. TITLE The sound of music and plants / by Dorothy Retallack. PUBLISHED Santa Monica, Calif : DeVorss, [1973] SUBJECT Sound. Music -- Physiological effect. DESCRIPTION 96 p. : illus ; 21 cm. BIBLIOG. Inclu2Y.$,-,+s Although I do not really beleive it myself :) Leon From owner-plants@net.bio.net Sat Feb 08 22:00:00 1997 Path: biosci!internet!biosci!not-for-mail From: biohelp (BIOSCI Administrator) Newsgroups: bionet.plants Subject: BIOSCI/bionet miniFAQ & Fundraiser Date: 9 Feb 1997 02:00:13 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 239 Sender: daemon@net.bio.net Distribution: world Message-ID: <199702091000.CAA08904@net.bio.net> NNTP-Posting-Host: net.bio.net (LAST REVISION: 30-JUL-95) This BIOSCI "miniFAQ" is designed to answer the questions that come up the *most frequently*. The main BIOSCI FAQ (Frequently Asked Questions) is accessible on the World Wide Web at URL http://www.bio.net/. If you can not find an answer to your question in this or other documentation, the BIOSCI technical support staff answers e-mail queries sent to biosci-help@net.bio.net We can only answer questions about the use of the newsgroups and mailing lists. We unfortunately do not have the staff to do Internet information searches or answer scientific questions. Please post those to the appropriate BIOSCI/bionet newsgroups. Contents: -------- 0) BIOSCI NEEDS YOUR SUPPORT!! 1) Using the WWW to access the BIOSCI/bionet newsgroups. 2) What to do about "spams," i.e., junk mail, ads, etc. 3) Examples of subscribing and unsubscribing to the mailing lists. 4) The BIOSCI user address and research interest directory. 0) BIOSCI NEEDS YOUR SUPPORT!! ------------------------------ BIOSCI's government funding has been expended, and we are now operating solely from advertising revenue that we have raised from our Web site at http://www.bio.net/. We need just a few minutes of your time to help us serve you. You can do two important things which will take very little time for you individually and will immensely help us continue to help you. First, please use our WWW system at http://www.bio.net/ to access the archives. You can post or reply to messages via your Web browser as described in item #1 below. Your usage helps attract sponsors. If you contact any of our sponsors, please be sure to thank them for supporting BIOSCI. It is critical for them to get this feedback if they are to continue their sponsorship for the long term. Second, if you work for a company or organization that provides products or services of interest to the biology community, please pass this message on to your marketing or marketing communications department or other appropriate group. Please ask them to help support BIOSCI by sponsoring our Web site and explain the uses and benefits of the system to the biology community. If they are interested, they can then contact us for further information at our tech support address, biosci-help@net.bio.net. 1) Using the WWW to access the BIOSCI/bionet newsgroups. -------------------------------------------------------- As of 10 December 1995, all BIOSCI/bionet full newsgroups are accessible through the World Wide Web (WWW) at URL http://www.bio.net. One can read and reply publicly or privately to both recent postings and archived messages through one's Web browser if it is configured properly to send e-mail. Each newsgroup is equipped with its own WAIS index. The main BIOSCI home page also has access to the BIO-JOURNALS Table of Contents database WAIS index and the BIOSCI user address database described in another item further below. 2) What to do about "spams," i.e., junk mail, ads, etc. ------------------------------------------------------- BIOSCI is a set of parallel USENET newsgroups (the "bionet" groups), mailing lists, and a hypermail archive at URL http://www.bio.net/. The same postings are distributed on all media (except for a small number of mailing-list-only groups at net.bio.net). Unfortunately it is becoming a despicable practice on the Internet (by a few people out to make a fast buck) to do automated mass postings to thousands of newsgroups and mailing lists. These attempts to grab free advertising are refered to as "spams" in the usual, somewhat boneheaded, net terminology. USENET is more susceptible to this practice, and many spams originate on the USENET groups and then are passed on to the mailing lists. However, spammers also get lists of mailing addresses and hit these too, so neither medium is immune. What should you do personally if you get junk mail? --------------------------------------------------- Just delete it and move on without reading it further. Filing a protest is becoming increasingly useless because spammers are often disguising the addresses where the messages are sent from. Unless you really understand Internet mail systems, your attempt at protest by sending replies to the message will often end up being sent to the address of an innocent person that the spammer is victimizing. What can BIOSCI/bionet do to protect its newsgroups? ---------------------------------------------------- The only solution currently available is to moderate the newsgroup. If this newsgroup is already moderated, then you are in good shape. Moderation protects the USENET distribution from about 95% of the spams that are being sent to date and protects the mailing lists completely. Moderation means, however, that someone has to take the time to review each message before it goes out. We have set up software here that simply allows the moderator to forward to an address at net.bio.net messages that (s)he wishes to have distributed. This takes no more time than that needed to read the message and pass it on, say about 1 min. per message. Most newsgroups currently have a discussion leader who is responsible for their newsgroup. The discussions leaders and their e-mail addresses are listed in the BIOSCI Information Sheet which is available on the Web at http://www.bio.net/. If a newsgroup is being hit with too many junk postings, please contact the discussion leader for that group and see if there is interest in moderating the group. Please do not assume that by simply posting a complaint to the newsgroup itself, anyone on the BIOSCI staff will act on your complaint. With close to 100 newsgroups to run, the BIOSCI staff has to rely on the discussion leaders of each newsgroup to report problems directly to us at biosci-help@net.bio.net. We will moderate any of our newsgroups if the discussion leader tells us that the readership of the group wishes to do so and if a moderator is willing to do the work. For most BIOSCI/bionet groups, this entails only a few minutes of work each day. Moderating a newsgroup will resolve probably 95% of the junk postings on the USENET distribution. Unfortunately there are easy ways for determined spammers to override the moderation mechanism on USENET, but we can protect our e-mail subscribers from unwanted postings if the newsgroup is moderated. You can also access our newsgroups over the WWW at URL http://www.bio.net. While this Web interface will not stop spammers from trying to post to the groups, this will give you yet another way, besides using USENET news, to keep the junk out of your personal mail files. For those of you with local USENET news systems, the Web interface will also give you faster access to new newsgroups and recent postings. 3) Examples of subscribing and unsubscribing to the mailing lists. ------------------------------------------------------------------ PLEASE NOTE: The BIOSCI management does NOT act on subscription/unsubscription requests that are posted improperly to the newsgroups and mailing lists. People who do this only bother everyone on the lists to no avail. Please be sure to follow the proper procedures below. Gory details are in the BIOSCI Information sheets on the Web at http://www.bio.net. Below we give an example utilizing the METHODS-AND-REAGENTS list at both of our two BIOSCI sites: Users in the Americas and Pacific Rim countries who use the BIOSCI ------------------------------------------------------------------ node at computer net.bio.net: ---------------------------- A) Determine the "listname" which is the <=8 character mail address ^^^^^^^^^^^^^ for the group. These can be found in the BIOSCI Info. Sheet. For the METHODS-AND-REAGENTS group the mailing address is methods@net.bio.net. The listname is the portion of the address to the left of the @ sign, i.e., "methods". The listname is used with the "subscribe" and "unsubscribe" commands illustrated below. B) Mail all commands in the body of a mail message addressed to biosci-server@net.bio.net. Do NOT send commands to the newsgroup posting addresses! Leave the Subject: line blank, any text on it will be ignored. C) In the body of your message put one or more of the following commands with an "end" command on the last line, e.g., subscribe methods unsubscribe methods end Do NOT put your e-mail address or other text on these lines. The server only allows you to cancel your subscription if the address on your mail header matches the address on our mailing list. Please ask for help at biosci-help@net.bio.net if your address has changed, e.g., if you know you are on the list but the server tells you that you are not a member. Users in Europe, Africa, and Central Asia who use the BIOSCI node at -------------------------------------------------------------------- computer daresbury.ac.uk (also known as dl.ac.uk): ------------------------------------------------- To subscribe and unsubscribe to/from the BIOSCI lists, you need to specify the full USENET newsgroup name with "bionet-news." prepended. The USENET newsgroup names are listed in the BIOSCI Information sheet on the Web at http://www.bio.net/. For the METHODS-AND-REAGENTS list the USENET newsgroup name is bionet.molbio.methds-reagnts, thus the appropriate commands are sub bionet-news.bionet.molbio.methds-reagnts unsub bionet-news.bionet.molbio.methds-reagnts These commands are included in a message addressed to mxt@dl.ac.uk, NOT to the newsgroup mailing addresses. As usual, include the text in the body of the message as text on the Subject: line is ignored. To unsubscribe from all the lists at the UK node, use unsub bionet-news Please note that if the address in the list is different than the one in your mail message header, you will not be able to unsubscribe by this method. If you have problems, please mail biosci@daresbury.ac.uk. 4) The BIOSCI user address and research interest directory. ----------------------------------------------------------- Please take this opportunity to add your name, address, and research interest information to the BIOSCI User Address Database if you have not already done so. You can fill out the address form directly through our Web page at URL http://www.bio.net/adrform.html. The address database is reindexed nightly for WWW access (the URL is http://www.bio.net/). If you are not directly on the Internet but can reach it by e-mail, please use our waismail server to access the user directory. waismail use is described above. You can also request a user address form by e-mail from biosci-help@net.bio.net. Please check your database entry from time-to-time to see if your address information is still up-to-date. Because of our limited personnel resources, we ask that you resubmit a *complete* form to revise your entry; we only replace complete entries and do not have resources to edit old forms. Sincerely, Dave Kristofferson BIOSCI/bionet Manager biosci-help@net.bio.net From owner-plants@net.bio.net Sat Feb 08 22:00:00 1997 Path: biosci!rutgers.rutgers.edu!uwm.edu!www.nntp.primenet.com!nntp.primenet.com!howland.erols.net!swrinde!ihnp4.ucsd.edu!munnari.OZ.AU!comp.vuw.ac.nz!ak.netlink.co.nz!auckland.ac.nz!j.putterill.sbs.auckland.ac.nz!user From: macdiarm@sbsu1.auckland.ac.nz (Colin MacDiarmid) Newsgroups: bionet.plants Subject: Q: X-gluc sensitivity? Date: Mon, 10 Feb 1997 12:20:02 +1200 Organization: Auckland University Lines: 14 Message-ID: NNTP-Posting-Host: j.putterill.sbs.auckland.ac.nz Hello, I'm looking for information on the sensitivity of histochemical staining for GUS ( beta-glucuronidase) activity using the substrate X-gluc. I've been staining transgenic Arabidopsis tissue, primarily whole leaves and floral meristems. The transgenic plants contain a translational fusion of GUS and a putative promoter fragment. This promoter drives expression that is readily detectable by Northern analysis- should I be able to detect GUS expression from this promoter using X-gluc? Thankyou in advance for helping me with this query. Fern Ashton. (Graduate student) E-mail: f.ashton@auckland.ac.nz From owner-plants@net.bio.net Sat Feb 08 22:00:00 1997 From: orchids@acadiacom.net (Harold Olivier) Newsgroups: bionet.plants Subject: Re: Question about Codiaeum variegatum pictum (Croton) Date: Sun, 09 Feb 1997 05:11:56 GMT Message-ID: <32fd57eb.1936545@news.acadiacom.net> References: <32fc6d52.13658060@news.innotts.co.uk> X-Newsreader: Forte Free Agent 1.1/16.230 NNTP-Posting-Host: 206.104.53.129 Lines: 23 Path: biosci!agate!spool.mu.edu!howland.erols.net!vixen.cso.uiuc.edu!news.sprintlink.net!news-peer.sprintlink.net!news.sprintlink.net!news-hub.sprintlink.net!news.sprintlink.net!news-stk-3.sprintlink.net!news.acadiacom.net!206.104.53.129 On Sat, 08 Feb 1997 12:16:05 GMT, simonc@innotts.co.uk (Simon Chamberlain) wrote: >I have (according to the photo my wife's book) the above plant and I'd >be grateful if anyone could settle a bet between me & my wife. > >I am sure that when we first had the plant it had a big red flower but >that was 6 years ago. My wife thinks I'm just loosing it :-) Sorry, Simon. If you have correctly identified the plant it _couldn't_ have had a big red flower. C.v.pictum makes very small (insignificant to virtually everyone but taxonomists, really) white flowers. I don't know if your wife is right about your 'loosing it' (I'm in absolutely no position to make that judgment about anyone - just ask *my* wife), but it does look as though you've lost the bet. Harold orchids@acadiacom.net Covington, LA, USA USDA Zone 8b From owner-plants@net.bio.net Sun Feb 09 22:00:00 1997 Path: biosci!rutgers.rutgers.edu!uwm.edu!www.nntp.primenet.com!nntp.primenet.com!howland.erols.net!surfnet.nl!news.kub.nl!slip157.kub.nl!G.Frensel From: G.Frensel@kub.nl (G.Frensel) Newsgroups: bionet.plants Subject: Info ueber Mehl-Typen gesucht Date: Mon, 10 Feb 1997 21:20:29 MET Organization: Tilburg University, The Netherlands Lines: 17 Distribution: eunet Message-ID: NNTP-Posting-Host: slip157.kub.nl X-Newsreader: Trumpet for Windows [Version 1.0 Rev B final beta #4] To whom it may concern, Wer kan mir Auskunft geben ueber die Qualitaets-Bezeichnung der verschiedenen Mehl-Typen, bzw. wo oder wie kann ich darueber Naeheres finden (z.B. Type 1150: Dunkles Roggenmehl). Fuer Antworten per e-mail bereits im Voraus herzlichsten Dank, ŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻ Gerhard Frensel Sprokkelveld 34, 6596 DL MILSBEEK (NL) TEL. 0031-485-516763 e-mail < G.FRENSEL@KUB.NL > ŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻ From owner-plants@net.bio.net Sun Feb 09 22:00:00 1997 Path: biosci!EUnet.yu!mivan From: mivan@EUnet.yu (Mitrovic Ivan) Newsgroups: bionet.plants Subject: cedrus Date: 10 Feb 1997 12:25:16 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 31 Sender: daemon@net.bio.net Distribution: world Message-ID: <32FF844F.7B2@EUnet.yu> NNTP-Posting-Host: net.bio.net Hi, I work at Belgrade University as an assistant on biological research. Currently, I am working on my magistery about CEDRUS. The exact theme is "Affects of Air Pollution on Histology - Cytology and Morphology of CEDRUS". I have a great problem. Noone in my country wasnt concerned about such theme, and I have no way to found proper literature about CEDRUS in my country. I also dont know the other way to contact someone abroad my country except via Internet. So, please, if You have any work that is concerned about this theme or CEDRUS generally, or if You know where I can find it, please inform me via e-mail. Please, note that I have no aproach to biological news groups so I cant forward my mail to those groups. This is the only way I can contact someone for help. Any document, research or anything else about CEDRUS can help me. Thanks in advance and exurcese me about Your time Ivan Please, sent information on e-mail -- _/ _/ _/ _/ _/ _/ _/ _/ _/ _/_ _/ _/_/_/ _/ _/ _/ _/ _/ _/ --------------------------------- | Mitrovic Ivan | | http://SOLAIR.EUnet.yu/~mivan | --------------------------------- From owner-plants@net.bio.net Sun Feb 09 22:00:00 1997 Path: biosci!rutgers.rutgers.edu!gatech!www.nntp.primenet.com!nntp.primenet.com!su-news-hub1.bbnplanet.com!news.bbnplanet.com!arclight.uoregon.edu!leto.ou.edu!news.ou.edu!NewsWatcher!user From: mkbhattacharyya@noble.org (Madon Bhattacharyya) Newsgroups: bionet.plants Subject: Postdoctoral position Date: Mon, 10 Feb 1997 13:42:28 +0700 Organization: The Noble Foundation Lines: 16 Message-ID: NNTP-Posting-Host: 199.253.0.50 Phosphoinositide Signal Transduction Pathway in Plants A postdoctoral position is currently available to study the function(s) of phosphoinositide-specific phospholipase C (PI-PLC) in plants. We have recently characterized the multigene family encoding PI-PLCs from soybean (Shi et al., 1995: Plant J. 8, 381-390). Molecular approaches including isolation of PI-PLC-interacting proteins, and anti-sense expression of PI-PLCs are being considered in studying the function(s) of this enzyme in plants. The position is initially for two years. Interested candidates with experience in molecular biology and a publication record are encouraged to apply. Experience in yeast two-hybrid system and soybean transformation are desirable but not essential. Application by mail and fax should be addressed to Dr. Madan K. Bhattacharyya, Division Plant Biology, Noble Foundation, PO. Box 2180, Ardmore, OK 73402. Fax: 405-221-7380, Phone: 405-221-7390. The Noble Foundation is an equal opportunity employer. From owner-plants@net.bio.net Sun Feb 09 22:00:00 1997 Path: biosci!daresbury!not-for-mail From: xavier.leroy@univ-brest.fr (Xavier Leroy) Newsgroups: bionet.plants Subject: V.L. Chopra e-mail Date: 10 Feb 1997 08:04:04 -0000 Lines: 27 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <5dmkpk$5v9@mserv1.dl.ac.uk> X-Sender: xleroy@cassis-gw.univ-brest.fr Original-To: plantbio@dl.ac.uk Dear PBers, I would like to contact V.L. Chopra at Indian Agricultural Research Insitute= .. Does anyone know his E-mail or fax. Thanks in advance. Xavier ''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''' Xavier LEROY Cellular and Molecular Biology Biotechnology - Crop Improvement Laboratory ISAMOR Technopole Brest-Iroise =46-29280 Plouzane T=E9l: 33 2 98 05 61 20 (Lab) 33 2 98 31 47 51 (Pers) =46ax: 33 2 98 05 61 01 http://www.univ-brest.fr/UFR/SCIENCES/ISAMOR/ Keywords: Brassica, Somatic Embryogenesis, SSRs, Mutant characterization ''''''''''''''''''''''''' end of the message '''''''''''''''''''''''''' From owner-plants@net.bio.net Sun Feb 09 22:00:00 1997 Path: biosci!agate!spool.mu.edu!uwm.edu!www.nntp.primenet.com!nntp.primenet.com!cpk-news-hub1.bbnplanet.com!cam-news-hub1.bbnplanet.com!news.bbnplanet.com!howland.erols.net!rill.news.pipex.net!pipex!uunet!not-for-mail From: rong@salsgiver.com Newsgroups: bionet.plants Subject: Cutting cacti Date: Mon, 10 Feb 1997 04:47:25 GMT Lines: 3 Message-ID: <32ffa68d.8754604@192.48.96.23> References: <32FEBC37.7152@umoncton.ca> NNTP-Posting-Host: 206.67.234.17 Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Newsreader: Forte Agent .99g/32.339 Does anyone know the best way to take a cutting from a cactus? Please E-mail me any information. rong@salsgiver.com From owner-plants@net.bio.net Sun Feb 09 22:00:00 1997 Path: biosci!daresbury!nntp-trd.UNINETT.no!sn.no!www.nntp.primenet.com!nntp.primenet.com!su-news-hub1.bbnplanet.com!news.bbnplanet.com!arclight.uoregon.edu!news.bc.net!torn!news.unb.ca!usenet From: "Rejean Hall, ing." Newsgroups: bionet.plants Subject: Do plants "sleep"? Date: Sun, 09 Feb 1997 22:12:07 -0800 Organization: Université de Moncton Lines: 9 Message-ID: <32FEBC37.7152@umoncton.ca> NNTP-Posting-Host: stjhts04c28.nbnet.nb.ca Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 2.02 [fr] (Win16; I) Hi everyone: My grade 5 daughter Micheline took up a class project to answer that question. Any info, ref. or URL? Thanks R. Hall From owner-plants@net.bio.net Sun Feb 09 22:00:00 1997 Path: biosci!rutgers.rutgers.edu!news.sgi.com!howland.erols.net!rill.news.pipex.net!pipex!dispatch.news.demon.net!demon!zetnet.co.uk!not-for-mail From: Charlotte Anglim Newsgroups: bionet.plants Subject: Enzymes: Catalyse Date: Mon, 10 Feb 1997 00:12:05 GMT Message-ID: <1997021000120576374@zetnet.co.uk> NNTP-Posting-Host: crescent.zetnet.co.uk X-Mailer: ZIMACS Version 1.09z3 10004146 Lines: 23 I am not sure if this is the correct newsgroup to start this discussion in, but here it goes. I am currently an A-level student in England. I study biology at school and I had some serious coursework to do(it was a practical investigation). Anyway, it was about the enzyme catalyse. It is found in living organisims as it breaks down hydrogen peroxide which is a product of metabolism. (Hydrogen peroxide is a toxic chemical). Catalyse breaks it down to water and oxygen. My problem is this. My experiment did not work properly (because we only had a small amount of time). I had a bean sprout and I had to find out which section contained the most catalyse and give ratios for the parts of the plant that contained catalyse (the 4 sections are: radicle, hypocotyl, cotyledon, pumule). If anyone could solve my problem, could you please reply to the newsgroup or send me a direct E Mail Thank you. From owner-plants@net.bio.net Sun Feb 09 22:00:00 1997 Path: biosci!rutgers.rutgers.edu!uwm.edu!news-peer.gsl.net!news.gsl.net!hunter.premier.net!feed1.news.erols.com!cpk-news-hub1.bbnplanet.com!cam-news-hub1.bbnplanet.com!news.bbnplanet.com!uunet!in2.uu.net!128.250.1.21!munnari.OZ.AU!news.ecn.uoknor.edu!news.cis.okstate.edu!usenet From: Mary Ann Cushman Newsgroups: bionet.plants Subject: Re: catalase (catalyse) Date: 10 Feb 1997 15:13:00 GMT Organization: Oklahoma State University Lines: 36 Message-ID: <5dndts$4jk@news.cis.okstate.edu> NNTP-Posting-Host: dialin2.remote.okstate.edu Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 1.1N (Macintosh; I; 68K) To: anglim@zetnet.co.uk X-URL: news:1997021000120576374@zetnet.co.uk Charlotte Anglim wrote: >I am not sure if this is the correct newsgroup to start this >discussion in, but here it goes. I am currently an A-level student in England. > >I study biology at school and I had some serious coursework to do(it >was a practical investigation). > >Anyway, it was about the enzyme catalyse. It is found in living >organisims as it breaks down hydrogen peroxide which is a product of >metabolism. (Hydrogen peroxide is a toxic chemical). Catalyse breaks >it down to water and oxygen. > >My problem is this. My experiment did not work properly (because we >only had a small amount of time). I had a bean sprout and I had to >find out which section contained the most catalyse and give ratios >for the parts of the plant that contained catalyse (the 4 sections >are: radicle, hypocotyl, cotyledon, pumule). > >If anyone could solve my problem, could you please reply to the >newsgroup or send me a direct E Mail > >Thank you. > > Hi Charlotte- Oops, its spelled catalase here in the U.S., don't know if you guys spell it differently. Where would you expect a major amount of the metabolic activity in a germinating seed to be going on? That's a hint. Another hint is that catalase tends to be around where a lot of peroxisomes are....do you get it? I don't want to just tell you, because I'm sure you can figure it out. A lot of this research is actually done on castor beans, too. Give it a try, and if you still can't figure it out, let me know. The thing is the ratios will still have to be experimentally determined. Bon chance, Mer From owner-plants@net.bio.net Sun Feb 09 22:00:00 1997 Path: biosci!agate!howland.erols.net!ix.netcom.com!news From: Steve Clemants Newsgroups: bionet.plants Subject: Taxonomy Position Date: Mon, 10 Feb 1997 18:50:28 GMT Organization: Netcom Lines: 24 Message-ID: <5dnmqu$90m@sjx-ixn8.ix.netcom.com> NNTP-Posting-Host: nyc-ny18-24.ix.netcom.com X-NETCOM-Date: Mon Feb 10 9:45:02 AM PST 1997 X-Newsreader: NETCOMplete/3.2 Taxonomy Position Brooklyn Botanic Garden is seeking a taxonomist, preferably with experience and strong interests in cultivated plants. The position calls for the person to play an active role in all aspects of the Garden's horticultural taxonomy and/or to assume leadership of and develop this department. Preference given to persons with an active research program. Ph.D. required with knowledge of nomenclature and competent database skills. Salary commensurate with qualifications and experience. Generous benefits. Applications should include a curriculum vitae, a letter with statement of research interests and goals, and names and addresses of three references. The position remains open until filled. Please send applications to: Ms. R. Cabiness Personnel Director Brooklyn Botanic Garden 1000 Washington Avenue Brooklyn, New York 11225-1099 USA An equal Opportunity/Affirmative Action Employ