From owner-population-bio@net.bio.net Tue Feb 01 22:00:00 1994 Path: biosci!bcm!cs.utexas.edu!uunet!bloom-beacon.mit.edu!senator-bedfellow.mit.edu!athena.mit.edu!bwporter From: bwporter@athena.mit.edu (Brandon W Porter) Newsgroups: bionet.population-bio Subject: Re: Populus Software Date: 2 Feb 1994 00:57:16 GMT Organization: Massachusetts Institute of Technology Lines: 16 Distribution: world Message-ID: <2imtpc$5ed@senator-bedfellow.MIT.EDU> References: <2ieg94$nf4@athena.cs.uga.edu> NNTP-Posting-Host: w20-575-90.mit.edu In article <2ieg94$nf4@athena.cs.uga.edu>, shepard@phoenix.cs.uga.edu () writes: |> Greetings, |> |> I am trying to find the ftp site for a piece of software which models |> populations. It is called populus, but I don't know where it's at. |> Does anybody know where to get this? |> |> Thanks, |> Erik Shepard |> shepard@phoenix.cs.uga.edu Another suggestion is the RAMAS family of matrix models from Applied Biomathematics. Contact Exeter Software, 100 North Country Rd, Setauket, NY 11733; telephone: (516)-689-7838. -Brad Porter From owner-population-bio@net.bio.net Sun Feb 06 22:00:00 1994 Newsgroups: bionet.population-bio From: david@lewin.demon.co.uk (David Lewin) Path: biosci!daresbury!bioftp.unibas.ch!rc1.vub.ac.be!ub4b!EU.net!howland.reston.ans.net!pipex!uknet!demon!dis.demon.co.uk!lewin.demon.co.uk!david Subject: help sought for population biologist Organization: Amron Ltd Reply-To: David@lewin.demon.co.uk X-Newsreader: Demon Internet Simple News v1.27 Lines: 32 Date: Mon, 7 Feb 1994 14:47:26 +0000 Message-ID: <760632446snz@lewin.demon.co.uk> Sender: usenet@demon.co.uk Can someone please guide me? I have befriended a population biologist - Dr Aroutioun Agadjanian - from Armenia who has sought political asylum in the UK. His prime interest, as I understand it, seems to be in the way reproduction rates can be influenced by making use of natural mechanisms investigation on phenomena such as when violent death will cause a sudden increase in reproduction among the survivors. It appears that this phenomenon leads to a Universal possibility to control reproduction rates in all species of living organisms and creatures with which humans have contact beginning with viruses and up to mammals. Reproduction cycles can be reduced to zero or can be increased to the biologically possible maximum. He has carried out feasibility studies in the former USSR which showed the viability of the theory, but no quantitative/qualitative experiments have so far been conducted. He is hoping to find a way to continue his research work and has asked me to guide him to the addresses of institutions where: 1. research is carried out into population biology on the reproduction level 2. Commercial Companies 'using' bio-technology and genetic engineering. 3. Agencies involved with new research into population biology. -- David Lewin david@lewin.demon.co.uk From owner-population-bio@net.bio.net Mon Feb 07 22:00:00 1994 Path: biosci!bcm!news.msfc.nasa.gov!sol.ctr.columbia.edu!hamblin.math.byu.edu!news.Arizona.EDU!violet.ccit.arizona.edu!fcgong From: fcgong@violet.ccit.arizona.edu Newsgroups: bionet.population-bio Subject: Program/Registration Call on International Meeting of Bio-Diversity Date: 8 Feb 94 16:00:30 MST Organization: University of Arizona, CCIT Lines: 512 Message-ID: <1994Feb8.160030.1@violet.ccit.arizona.edu> NNTP-Posting-Host: violet.ccit.arizona.edu Please bring this to the attention of any persons that you feel might be interested. Any questions should be directed to me (dgalbrai@ccit.arizona.edu). Thanks! David Galbraith University of Arizona ************* Program and Registration Announcement BIOLOGICAL DIVERSITY EXPLORING THE COMPLEXITIES An International Conference March 25, 26, & 27, 1994 Tucson, Arizona The University of ARIZONA Tucson, Arizona In Conjunction with National Energy Law & Policy Institute University of Tulsa College of Law Deadline for Pre-Registration March 1, 1994 Conference Director Lakshman D. Guruswamy Director, National Energy Law and Policy Institute Professor of Law, University of Tulsa College of Law Tulsa, Oklahoma 74104, U.S.A. Tel: 1-918-631-2431; Fax: 1-918-631-3556 e-mail: law_ldg@vax1.utulsa.edu The Local Organizing Committee Elizabeth Baker Hans Bohnert (Co-Director) David Galbraith Conrad Istock Mari Jensen Rita Manak Juanita Simpson Robert Robichaux Edella Schlager Barbara Timmermann Please Address All Correspondence to: Biodiversity Conference The University of Arizona Biosciences West 516 Tucson, Arizona 85721 U.S.A. Tel: 1-602-621-7961; Fax: 1-602-621-9288 e-mail: bohnert@biosci.arizona.edu What Is Biological Diversity? "Biological diversity refers to the variety and variability among living organisms and the ecological complexes in which they occur. Diversity can be defines as the number of different items and their relative frequency. For biological diversity, these items are organized at many levels, ranging from complete ecosystems to the chemical structures that are the molecular basis of heredity. Thus, the term encompasses different ecosystems, species, genes, and their relative abundance." Biodiversity diversity possesses intrinsic value, in addition to supporting human life which depends on the Earth's biological resources. Our material well-being and prosperity depend on biological diversity, the ultimate source of much of our food, shelter, clothing, and medicine. Moreover, the protection of biological diversity addresses the continuation of our cultural, psychological, and spiritual health. CONFERENCE PURPOSE: The goal of the Conference on Biological Diversity is to explore, within an interdisciplinary framework, available national, transnational, and international options for solving the critical global problems arising from the loss of biological diversity. The conference will probe the following areas: What is biological diversity? Is the loss of biological diversity a problem? What scientific measures can be employed to stem the loss? What socio-political measures can be enacted to manage the loss? Will property rights protect biological diversity? Particular emphasis will be given to the nature and extent of the interface between intellectual property rights and biological diversity. CONFERENCE FORMAT: In papers submitted in advance of the conference, keynote speakers will provide an overview of major issues and controversies falling within their designated subject area. These areas will be covered in greater depth in parallel discussion sessions. Invited discussants will raise additional issues, offer different viewpoints, and guide the discussions. Conference registrants are encouraged to indicate if they are willing to make a contribution at the breakout discussion sessions. THE CONFERENCE WILL ADDRESS: WHAT SCIENTIFIC MEASURES ARE CAPABLE OF REVERSING THE POSSIBLE DESTRUCTION OF BIODIVERSITY? Scientists from a variety of disciplines have suggested ways to respond to the loss of genetic and biological diversity. The conference will explore some of these possible responses, including cataloguing, biotechnology, and changing land-use patterns. WHAT SOCIO-POLITICAL MEASURES ARE CAPABLE OF REVERSING THE POSSIBLE DESTRUCTION OF BIODIVERSITY? The gene-rich centers of biodiversity such as rainforests, coral reefs, and wetlands are frequently located in tropical regions. The countries in these regions are often economically depressed, and as a result, may have few resources or incentives to preserve their biota. Historically, international economic markets have provided disincentives for preservation. What are the alternatives? DO PROPERTY RIGHTS PROTECT BIODIVERSITY? Property rights are inextricably woven into the current discourse on the protection of biodiversity. The conference will seek to clarify relevant issues on the nature of ownership and patent rights. CONFERENCE PROGRAM Thursday, March 24, 1994 3:00-9:00 p.m. Registration at the Westward Look Resort (continued on Friday morning) Friday, March 25, 1994 10:30-11:30 a.m. Invited Plenary address 11:30-1:00 p.m. Lunch 1:30-2:30 p.m. Keynote Speaker-Session 1 Biological Diversity:A Scientific Overview Peter Raven*, Director, Missouri Botanical Garden, St. Louis, Missouri 2:30-3:00 p.m. Break 3:00-6:45 p.m. Concurrent Discussion Sessions A. How Serious is the Loss of Biodiversity: B. What are the Scientific Measures Capable of Reducing or Alleviating the Loss of Biodiversity? 3:00-3:45 p.m. A. Loss Estimates are Vastly Exaggerated-Policy Should Not be Based on Such Exaggeration. B. Can Science Help Identify Where to Put Limited Financial Resources? Francesca Grifo*, Program Director International Cooperative Biodiversity Group Fogarty International Center, National Institutes of Health, Bethesda, Maryland 3:45-4:00 p.m. Break 4:00-4:45 A. Loss Estimates are Not Exaggerated-Loss of Species of this Magnitude is and Will Continue to be a Problem B. Can Genetic Engineering of Plants and Animals Counteract the Loss of Biodiversity? Robert Fraley*, Director, Biotechnology Research Unit Monsanto Corporation, St. Louis, Missouri 4:45-5:00 Break 5:00-5:45 A. Loss Estimates May be Exaggerated-at Least in Certain Circumstances Ariel E. Lugo*, Institute of Tropical Forestry, U.S. Forest Service, Puerto Rico B. How Can Land Use Practices Facilitate the Maintenance of Biological Diversity? What is the Role of Ecological Restoration? Laura Jackson*, Professor, Department of Biology, University of Northern Iowa, Cedar Falls, Iowa 5:45-6:00 Break 6:00-6:45 A. Loss of Biological Diversity has Ethical Ramifications Bryan Norton*, Professor, School of Public Policy, Georgia Institute of Technology, Atlanta, Georgia B. A Summary of Scientific Measures Robert Watson*, Associate Director, Environment Office of Science and Technology Policy The White House, Washington, D.C. 7:00-8:30 p.m. Dinner Reception sponsored by the University of Arizona Saturday, March 26, 1994 7:30-8:45 a.m. Breakfast 9:00-10:00 a.m. Keynote Speaker-Session 2 Reversing the Loss of Biodiversity: Socio-political Measures and Implementation Jeffrey McNeely, *Chief Biodiversity Officer, IUCN, Geneva, Switzerland 10:00-10:15 Break 10:15-3:45 p.m. Concurrent Discussion Sessions 10:15-11:00 A. International Measures An Overview of International Measures Walter V. Reid*, Vice President for Program World Resources Institute, Washington, D.C. B. Transnational & National Initiatives Debt-for-Nature Arrangements Elver Umana, Former Vice-Minister for Natural Resources, Currently at INCAO, Costa Rica 11:15-Noon A. The Need for International Obligations Governing Biodiversity: The Biodiversity Convention Lakshman Guruswamy*, Director National Energy Law & Policy Institute University of Tulsa, Oklahoma B. Development Organizations and Biodiversity 12:00-2:00 p.m. Lunch 2:00-2:45 p.m. A. Rights of Indigenous People & Biodiversity Jim Anaya*, Professor of Law University of Iowa, Iowa City, Iowa B. Private Enterprise and Biodiversity Ana Sittenfeld*, Director of Biodiversity Prospecting, INBIO, Santo Domingo, Costa Rica 2:45-3:00 p.m. Break 3:00-3:45 p.m. A. Development and Biodiversity Graciela Chichilinsky* Department of Economics, Stanford University Stanford, California B. Local and National Initiatives Elinor Ostrom*, Arthur F. Bentley Professor of Political Science, Department of Political Science, Indiana University, Bloomington, Indiana 3:45-4:00 p.m. Break 4:00-5:00 p.m. Keynote Speaker-Session 3 Property Rights, Public Goods, & the Earth's Biological Resources Christopher Stone*, Ray P. Crocker Professor of Law, Law Center, University of Southern California, Los Angeles, California 5:15-6:45 p.m. Discussion Session Commercial Exploitation of Biodiversity Jeff Kushan*, Legislative & International Intellectual Property Specialist Patent and Trademark Office U.S. Department of Commerce, Washington, D.C. Property Rights and Patents in Different Countries - How to Share the Benefits? David Downes* Center for International Environmental Law (CIEL), Washington, D.C. 7:15-9:00 p.m. Dinner Sunday, March 27, 1994 7:00-8:15 a.m. Breakfast 8:30-Noon Concurrent Discussion Sessions A Is there a Right to Exploit Biodiversity for Commercial Purposes? B. How Should Intellectual Property Rights Be Created, Distributed, and Exercised? C. Existing Models/Mechanisms for Implementing Property Rights. 8:30-9:15 A. A Philosophical View Mark Sagoff*, Director The Institute for Philosophy and Public Policy, University of Maryland, College Park, Maryland B. The Commercialization of Indigenous Genetic Resources: Values, Institutions, and Instruments R. David Simpson*, Roger A. Sedjo*, and John W. Reid*, Resources for the Future, Washington, D.C. C. Countries and Companies Pamela Demain*, Senior Director of Corporate Licensing, Merck & Company, Whitehouse Station, New Jersey 9:15-9:30 a.m. Break 9:30-10:15 A. Legal Aspects Yvonne Cripps* Lecturer in Law and Fellow of Emmanuel College, Cambridge University, Cambridge, England B. Maintaining Incentives for Research and Development Gary Toennisson*, Director International Rice Research Project The Rockefeller Foundation, New York C. Non-governmental Organizations: Compensating Local Communities for Conserving Biodiversity Anil Gupta*, Chair Center for Educational Innovation Indian Institute of Management, Ahmedabad Gujurat, India 10:15-Open Conference Summary Lunch * Indicates confirmed speakers REGISTRATION FORM To register, please mail by February 15, 1994 To: Phone: U.S. 1-602-621-7961 Biodiversity Conference The University of Arizona Fax: U.S. 1-602-621-9288 Biosciences West 516 Tucson, Arizona 85721 U.S.A. E-mail:bohnert@biosci.arizona.edu (Please print clearly or type information; please indicate your choices below) ____ I am registering for the conference. (U.S. $_____ for _____ person(s).) ____ I would like to participate in Discussion Sessions on the following topic(s): __________________________________________________________ __________________________________________________________ __________________________________________________________ __________________________________________________________ Full Name: _________________________________ (please put your name as you would like it to appear on your badge) Title: _________ Organization: _________________________________ Address: _________________________________ _________________________________ _________________________________ Phone: ______________ Fax: ______________ E-mail:______________ Interests:_____________________________________________________ _______________________________________________________________ _______________________________________________________________ Method of Payment: (U.S. $ only; please check one of the spaces below): ___ Check (please make payable to Biodiversity Conference, ___ University of Arizona) ___ Visa/Mastercard (Circle One) Card Number __________________ Expiration Date ____ Signature ___________________ ___ International Money Order Registration Fee The conference fee is $250 per person (prior to March 1), thereafter $350. The conference fee for participants from corporations is $950 (part of which will be used to waive fees for qualifying participants from outside the U.S.). This fee includes all conference sessions, the reception, conference dinners on Friday and Saturday, two continental breakfasts, and three lunches. For those attending from the University of Arizona, a special fee of $50 is offered, but this does not cover the reception and meals. WHO SHOULD ATTEND Attendance at the conference will be governed by registration on a "first-come, first-served" basis. About 200 invited national and international policy-makers, biological and social scientists, lawyers, ad representatives from industry and non- governmental organizations will participate. CONFERENCE LOCATION The conference will take place at the Westward Look Resort, located on the northwest side of Tucson in the Santa Catalina foothills, with spectacular views of the city and the mountains of the Coronado National Forest. The Westward Look is spread over 80 acres of beautifully landscaped grounds and offers all the amenities of a modern resort as well as the ambiance of the southwest. Please call the hotel direct at 1-800-722-2500 or 1- 602-297-1151 (fax: 1-602-742-1573) to register for your room. Ask for the "Biodiversity Conference" rate. Wheelchair access to the conference is provided. TRANSPORTATION Tucson International Airport is served by several airlines with service from major cities, including New York, Chicago, Denver, Dallas, Los Angeles, and Phoenix. Taxis or the 24-hour-Arizona Stagecoach shuttle service (1-602-881-4111) can take you from Tucson International Airport to the hotel. You may wish to pick up a rental car at the airport. Call for advance reservations with any national car rental company. The proceedings of this conference will be published either as a book or as a separate volume in a scholarly journal. TUCSON, ARIZONA Tucson is a beautiful city and winter resort due to its temperate climate, mountainous surroundings, and the rich cultural heritage of the American Southwest. In the balmy days of March, one might visit the forests of giant cactus at the Saguaro National Monument, explore the water-filled desert oasis at Sabino Canyon in the Coronado National Forest, or travel from Tucson's valley floor (2,500 ft.) to the pine forest of Mt. Lemmon (9,000 ft.). For those interested in the natural world, Tucson is home to the internationally renowned "living" museum, the Arizona-Sonora Desert Museum, described by The New York Times as "the most distinctive zoo in the United States." For cultural attractions, Tucson spans the centuries. Native American reservations adjoin the city. From the Spanish Colonial era comes the San Xavier Mission, an outstanding example of Spanish-American architecture. Tucson is also a center for contemporary art, with a burgeoning downtown arts district and symphony, theater, ballet, and opera companies. Tucson offers the visitor a wide variety of activities, and the conference will take place during the spring season when the city comes most alive and the surrounding desert is at its most beautiful. From owner-population-bio@net.bio.net Mon Feb 07 22:00:00 1994 Newsgroups: bionet.population-bio Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!vixen.cso.uiuc.edu!uwm.edu!fnnews.fnal.gov!ornl!cs.utk.edu!martha.utcc.utk.edu!UTKVM1.UTK.EDU!PA120028 From: PA120028@UTKVM1.UTK.EDU (Stephen C. Nodvin: [nodvin@utk.edu]) Subject: Position Annou. Chair of Forestry, Wildlife & Fisheries Message-ID: <16F57FFE3.PA120028@UTKVM1.UTK.EDU> Sender: usenet@martha.utcc.utk.edu (USENET News System) Organization: The University of Tennessee, Knoxville X-Newsreader: NNR/VM S_1.3.2 Date: Tue, 8 Feb 1994 23:11:47 GMT Lines: 35 ======================= POSITION ANNOUNCEMENT ======================= PROFESSOR AND HEAD - Department of Forestry, Wildlife & Fisheries, The University of Tennessee, Knoxville. QUALIFICATIONS: Ph.D. in forestry, wildlife, fisheries, wood science or related field; national recognition in teaching, research and/or extension, experience in fiscal and personnel management; must be an effective communicator with ability to provide professional leadership for multidisciplinary programs; involvement in appropriate professional societies; a strong commitment to professional development of faculty, staff and students; and evidence of effective interaction with industry and governmental agencies. JOB DESCRIPTION: The Head is responsible for providing leadership for a multidisciplinary natural resource program in forestry, wildlife, fisheries and wood science; administering and coordinating departmental programs in research, teaching and extension, including personnel, facilities and finances; developing and maintaining strong working relationships with the Institute of Agriculture administrators, the Graduate Program in Ecology, other University departments and programs, governmental agencies, industry and the private sector. The Head is required to uphold the Affirmative Action policy of the University of Tennessee. APPLICATION AND NOMINATION: Inquiries, requests for formal application materials and nominations should be directed to: Dr. Carroll J. Southards, Chairman, Forestry, Wildlife & Fisheries Search/Advisory Committee, The University of Tennessee, P.O. Box 1071, Knoxville, TN. 37901-1071. Tel: 615-974-7136, FAX 615-974-4744. UTK is an EEO/AA/Title IX/Section 504/ADA employer. From owner-population-bio@net.bio.net Tue Feb 08 22:00:00 1994 Newsgroups: bionet.population-bio Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!torn!news.ccs.queensu.ca!earl-mac206.biol.queensu.ca!BOAGP From: Peter T. Boag Subject: Synthetic DNA Sequence Trees Message-ID: X-Xxmessage-Id: X-Xxdate: Wed, 9 Feb 94 10:09:52 GMT Sender: news@knot.ccs.queensu.ca (Netnews control) Organization: Queen's University X-Useragent: Version 1.1.3 Date: Wed, 9 Feb 1994 15:05:59 GMT Lines: 17 We are interested in papers or software dealing with the generation of artificial DNA sequence data designed to emulate the evolution of lineages. The goal is to generate data that can be input into various tree-building algorithms to see how good various approaches are at recovering the "true tree". This is partly as a teaching exercise, partly to develop into a research tool. ****************************************************************** ******************** Peter T. Boag TEL: (613) 545-6160 Department of Biology FAX: (613) 545-6617 QueenÕs University EMAIL: BOAGP@QUCDN.QUEENSU.CA Kingston, Ontario Canada K7L3N6 ****************************************************************** ******************** From owner-population-bio@net.bio.net Tue Feb 08 22:00:00 1994 Newsgroups: bionet.population-bio Path: biosci!bcm!cs.utexas.edu!uunet!envoy!knapp From: knapp@cs.unr.edu (Steve Knapp) Subject: Re: US 1965 population Message-ID: <1994Feb9.194908.10482@news.unr.edu> Sender: Steve Knapp Date: Wed, 9 Feb 1994 19:49:08 GMT Distribution: na References: Nntp-Posting-Host: pyramid.cs.unr.edu Organization: University of Nevada, Reno Department of Computer Science Keywords: US population Lines: 23 In article , Paul Shames wrote: >I am interested in finding out what the population of the US was in 1965. I >recall going to the Worlds Fair in New York and seeing the large sign that >showed the present population (it was constantly changing). The number that >sticks in my head was 115 million. Now that seems awfully low to me. That >would mean in thirty years we have more than doubled our population. > >Anybody have some numbers they know (or recall) from that time? > >Thanks, >Paul The number 1.02 raised to the 30th power is about 1.81. In other words, at a population increase of 2% per year, in thirty years, the increase is 81%. Add immigratiion, and we are where we are, roughly speaking. The decline in the death rate has not been met by a corresponding decline in the birth rate. Steve Knapp From owner-population-bio@net.bio.net Tue Feb 08 22:00:00 1994 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!wupost!news.miami.edu!not-for-mail From: kramer@oj.rsmas.miami.edu (Jack Kramer) Newsgroups: bionet.population-bio Subject: Re: Synthetic DNA Sequence Trees Date: 9 Feb 1994 14:45:41 -0500 Organization: R.S.M.A.S. Lines: 14 Message-ID: <2jbeh5$i4j@oj.rsmas.miami.edu> References: NNTP-Posting-Host: oj.rsmas.miami.edu In article , Peter T. Boag wrote: >We are interested in papers or software dealing with the generation >of artificial DNA sequence data designed to emulate the evolution of >lineages. The goal is to generate data that can be input into >various tree-building algorithms to see how good various approaches >are at recovering the "true tree". This is partly as a teaching >exercise, partly to develop into a research tool. Look up David Penny as author in your library. He did several projects identical to this a few years ago. I believe he is at Massey University in New Zealand. From owner-population-bio@net.bio.net Tue Feb 08 22:00:00 1994 Path: biosci!rutgers!concert!inxs.concert.net!taco!ellner From: ellner@stat.ncsu.edu (Steve Ellner) Newsgroups: sci.math,sci.math.stat,bionet.population-bio,sci.bio.ecology Subject: Conference: math/stat ecology Message-ID: <1994Feb9.170740.11959@ncsu.edu> Date: 9 Feb 94 17:07:40 GMT Sender: news@ncsu.edu (USENET News System) Distribution: usa Organization: Statistics, NCSU, Raleigh Lines: 8 Originator: ellner@esssse.stat.ncsu.edu Xref: biosci sci.math:25187 sci.math.stat:3514 bionet.population-bio:565 sci.bio.ecology:1712 The official announcment and registration form are now being mailed to all recent attendees of the conference. If you would like to be added to the mailing list, you can send me your (surface mail) address by email, or call Ann Ethridge at 919-515-1906. Registrations should be returned by March 18. Steve Ellner ellner@stat.ncsu.edu From owner-population-bio@net.bio.net Tue Feb 08 22:00:00 1994 Newsgroups: bionet.population-bio Path: biosci!bloom-beacon.mit.edu!spool.mu.edu!agate!msuinfo!harbinger.cc.monash.edu.au!bruce.cs.monash.edu.au!merlin!mel.dit.csiro.au!its.csiro.au!dmssyd.syd.dms.CSIRO.AU!metro!usage!NewsWatcher!user From: L.Worland@unsw.edu.au (Linda Worland) Subject: morphometric analyses Message-ID: Followup-To: bionet.population-bio Sender: news@usage.csd.unsw.OZ.AU Nntp-Posting-Host: biopath30.babs.unsw.edu.au Organization: University of New South Wales Date: Mon, 7 Feb 1994 03:19:41 GMT Lines: 21 I am currently a graduate student working on the stock discrimination of the Australian pilchard. I am using genetic criteria as well as morphometric data. However, I am unsure about the type of morphometric data to collect. I initially thought that it would be worthwhile to collect landmark data for truss network analyses as well as do some conventional measurements then analyse that using discriminant and principal component analyses. However, Bookstein (1990: Morphometric Tools for Landmark Data) (one of the founders of the truss network) disputes the validity of using discriminant analysis and discounts the use of truss analysis and recommends using "Centroid Size and shape coordinates". As yet, I have not been able to source any papers using these methods on fish. (I am still waiting for the "Proceedings of the Michigan Morphometrics workshop"). I personally have misgivings about using the truss network because pilchard shape varies with gonad development and spawning seasons differ throughout Australian waters, so I thought that I would be bound to find both temporal and spatial variation. Hence, I am confused about which method is appropriate to use. Does anyone out there have any experience/opinions/advice on these issues or know of any software available to analyse data using the centroid size method? I would appreciate any replies to be sent to my e-mail address viz: L.Worland@unsw.EDU.AU From owner-population-bio@net.bio.net Wed Feb 09 22:00:00 1994 Newsgroups: bionet.population-bio From: david@lewin.demon.co.uk (David Lewin) Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!pipex!uknet!demon!dis.demon.co.uk!lewin.demon.co.uk!david Subject: Help wanted for population biologist Organization: Amron Ltd Reply-To: David@lewin.demon.co.uk X-Newsreader: Demon Internet Simple News v1.27 Lines: 30 Date: Thu, 10 Feb 1994 00:51:50 +0000 Message-ID: <760841510snz@lewin.demon.co.uk> Sender: usenet@demon.co.uk Can someone please guide me? I have befriended a population biologist - Dr Aroutioun Agadjanian - from Armenia who has sought political asylum in the UK. His prime interest, as I understand it, seems to be in the way reproduction rates can be influenced by making use of natural mechanisms investigation on phenomena such as when violent death will cause a sudden increase in reproduction among the survivors. It appears that this phenomenon leads to a Universal possibility to control reproduction rates in all species of living organisms and creatures with which humans have contact beginning with viruses and up to mammals. Reproduction cycles can be reduced to zero or can be increased to the biologically possible maximum. He has carried out feasibility studies in the former USSR which showed the viability of the theory, but no quantitative/qualitative experiments have so far been conducted. He is hoping to find a way to continue his research work and has asked me to guide him to the addresses of institutions where: 1. research is carried out into population biology on the reproduction level 2. Commercial Companies 'using' bio-technology and genetic engineering. 3. Agencies involved with new research into population biology. From owner-population-bio@net.bio.net Wed Feb 09 22:00:00 1994 Path: biosci!bcm!cs.utexas.edu!sdd.hp.com!col.hp.com!csn!rutgers!concert!lester.appstate.edu!cs.cs.appstate.edu!tga From: tga@cs.cs.appstate.edu (Terry Anderson) Newsgroups: bionet.population-bio Subject: US 1965 population Message-ID: <2jcatj$7s0@lester.appstate.edu> Date: 10 Feb 94 03:50:11 GMT Organization: Appalachian State University Lines: 18 NNTP-Posting-Host: cs.cs.appstate.edu From Nagle & Saff's DE book: Year U.S. Census, 10^6 's 1960 179.32 1970 203.21 For fun with nonlinear least squares, scaling, and Newton's method, try fitting a logistic curve through U.S. census data going back to 1790. Cheers, -- Terry Anderson tga@math.appstate.edu Math Sciences Dept. Appalachian State University Boone, NC 28608 USA (704) 262 - 2357 tga@flyer.ncsc.org tga@cardinal.ncsc.org From owner-population-bio@net.bio.net Fri Feb 11 22:00:00 1994 Path: biosci!NET.BIO.NET!biosci-help From: biosci-help@NET.BIO.NET (BIOSCI Administrator) Newsgroups: bionet.population-bio Subject: test of pop-bio@net.bio.net Date: 12 Feb 1994 02:43:50 -0000 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 2 Sender: daemon@net.bio.net Distribution: bionet Message-ID: Reply-To: biosci-help@net.bio.net NNTP-Posting-Host: net.bio.net test of pop-bio@net.bio.net From owner-population-bio@net.bio.net Fri Feb 11 22:00:00 1994 Path: biosci!NET.BIO.NET!biosci-help From: biosci-help@NET.BIO.NET (BIOSCI Administrator) Newsgroups: bionet.population-bio Subject: test 2 of pop-bio@net.bio.net Date: 12 Feb 1994 05:27:57 -0000 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 2 Sender: daemon@net.bio.net Distribution: bionet Message-ID: Reply-To: biosci-help@net.bio.net NNTP-Posting-Host: net.bio.net test 2 of pop-bio@net.bio.net From owner-population-bio@net.bio.net Tue Feb 15 22:00:00 1994 Path: biosci!parc!decwrl!ames!sgiblab!munnari.oz.au!uniwa!newsman!Jim.Cummins From: cummins@possum.murdoch.edu.au (Jim Cummins) Newsgroups: bionet.population-bio Subject: Hamsters, bottlenecks and "inbreeding depression" Date: 16 Feb 1994 01:23:56 GMT Organization: Murdoch University, Western Australia Lines: 18 Sender: -Not-Authenticated-[6523] Message-ID: <2jrsjcINN2fa@newsman.csu.murdoch.edu.au> NNTP-Posting-Host: vetmac3.csu.murdoch.edu.au X-Posted-From: InterNews 1.0@newsman.csu.murdoch.edu.au. Xdisclaimer: No attempt was made to authenticate the sender's name. Some time ago I read that all laboratory hamsters derive from three litter mates trapped in the Middle East in the 20's (?). Apparently there was an attempt to bring in new strains at one stage, but I haven't been able to find out anything about it. The topic came up in a discussion of "inbreeding depression" and infertility in animals that have been through population bottlenecks, such as Cheetahs. Clearly infertility affects some spec ies more than others, as one couldn't catagorise hamsters (or laboratory mice, for that matter) as infertile! The Cheetah story is complicated by selectiv e culling of cubs by males, of course. What's the latest thinking on this from Geneticists? Jim Cummins School of Veterinary Studies Murdoch University Western Australia 6150 Tel +61-9-360 2668 Fax +61-9-310 4144 "An inordinate fondness for Beetles" From owner-population-bio@net.bio.net Tue Feb 15 22:00:00 1994 Path: biosci!headwall.Stanford.EDU!agate!library.ucla.edu!europa.eng.gtefsd.com!howland.reston.ans.net!pipex!zaphod.crihan.fr!jussieu.fr!univ-lyon1.fr!ghost.dsi.unimi.it!batcomputer!news.reed.edu!gaia.ucs.orst.edu!news.uoregon.edu!bsl.uoregon.edu!user From: slkiser@oregon.uoregon.edu (Stacey Kiser) Newsgroups: bionet.population-bio Subject: Classroom Experiment Followup-To: bionet.population-bio Date: Tue, 15 Feb 1994 15:24:02 +0000 Organization: U of O Lines: 16 Message-ID: NNTP-Posting-Host: bsl.uoregon.edu We are running a non-Biology majors human populations class Spring term and are looking for a good experiment on population growth. Last spring we ran a nutrient experiment with several different media and a population of organisms from a sewage settling pond. We ran into problems trying to estimate the population at the end of the term using a spectrophotometer. Much of the algae grew on the sides of our gallon jars and did not make a large enough difference in the spectrophotometer readings for the students to observe. Has anyone run an experiment that a) clearly showed a population growth curve to students and/or b) worked with different nutrient levels? Any suggestions for improvement on the above experiment? Our limitations are mostly due to time: we only have three months in which to take readings and observations. Any suggestions are appreciated. From owner-population-bio@net.bio.net Tue Feb 15 22:00:00 1994 Path: biosci!headwall.Stanford.EDU!agate!howland.reston.ans.net!wupost!gumby!newsxfer.itd.umich.edu!destroyer!caen!usenet.cis.ufl.edu!usenet.ufl.edu!gnv.ifas.ufl.edu!afc From: afc@gnv.ifas.ufl.edu (Andrew Cockburn) Newsgroups: bionet.population-bio Subject: Re: Classroom Experiment Message-ID: <1994Feb16.110502.3781@tower> Date: 16 Feb 94 11:05:02 -0500 References: Followup-To: bionet.population-bio Organization: USDA/ARS Lines: 28 In article , slkiser@oregon.uoregon.edu (Stacey Kiser) writes: > We are running a non-Biology majors human populations class Spring term and > are looking for a good experiment on population growth. > > Last spring we ran a nutrient experiment with several different media and a > population of organisms from a sewage settling pond. We ran into problems > trying to estimate the population at the end of the term using a > spectrophotometer. Much of the algae grew on the sides of our gallon jars > and did not make a large enough difference in the spectrophotometer > readings for the students to observe. > > Has anyone run an experiment that a) clearly showed a population growth > curve to students and/or b) worked with different nutrient levels? Any > suggestions for improvement on the above experiment? > > Our limitations are mostly due to time: we only have three months in which > to take readings and observations. Any suggestions are appreciated. Why not use E. coli? You could set up an experiment that would give a growth curve in one afternoon. It is easy to follow growth using a spec and with a doubling time of 20 to 30 minutes it is pretty easy to get data. I presume that a lower nutrient broth would give a smaller r. I know that it gives a smaller k (hence the use of superbroth for growing plasmids). Andrew Cockburn From owner-population-bio@net.bio.net Wed Feb 16 22:00:00 1994 Path: biosci!bcm!cs.utexas.edu!news.unt.edu!news.oc.com!news.kei.com!newsstand.cit.cornell.edu!newsstand.cit.cornell.edu!usenet From: Kathie Hodge Newsgroups: bionet.population-bio Subject: Re: Synthetic DNA Sequence Trees Date: 17 Feb 1994 00:31:26 GMT Organization: Cornell University Lines: 25 Sender: kh11@cornell.edu (Verified) Distribution: world Message-ID: <2judsuINN663@newsstand.cit.cornell.edu> References: NNTP-Posting-Host: 128.253.27.147 X-UserAgent: Version 1.1.3 X-XXDate: Wed, 16 Feb 94 22:36:19 GMT Peter T. Boag, BOAGP@QUCDN.QUEENSU.CA writes: >We are interested in papers or software dealing with the generation >of artificial DNA sequence data designed to emulate the evolution of >lineages. This may be a bit tangential, but you might check out some of David Hillis' recent stuff. Instead of using computers to generate sequence data, he used real organisms (T7 bacteriophage) and let them evolve for a while in the lab so that he knew the "true" phylogeny. Then he tested different tree-making procedures to see which ones came closest to the truth. Here are two papers for which I have the references handy, I suspect there are, or will be, more: Hillis, D. M., Bull, J. J., White, M. E., Badgett, M. R., and Molineux, I. J. 1992. Experimental phylogenetics: generation of a known phylogeny. Science 255: 589-592. Hillis, D. M. and Bull, J. J. 1993. An empirical test of bootstrapping as a method for assessing confidence in phylogenetic analysis. Syst. Biol. 42(2):182-192. Kathie Hodge kh11@cornell.edu From owner-population-bio@net.bio.net Wed Feb 16 22:00:00 1994 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!europa.eng.gtefsd.com!library.ucla.edu!agate!msuinfo!harbinger.cc.monash.edu.au!uniwa!newsman!Jim.Cummins From: cummins@possum.murdoch.edu.au (Jim Cummins) Newsgroups: bionet.population-bio Subject: Chromosome number in Dolphins? Date: 17 Feb 1994 01:23:20 GMT Organization: Murdoch University, Western Australia Lines: 10 Sender: -Not-Authenticated-[6523] Message-ID: <2jugu8INN5f6@newsman.csu.murdoch.edu.au> NNTP-Posting-Host: vetmac3.csu.murdoch.edu.au X-Posted-From: InterNews 1.0@newsman.csu.murdoch.edu.au. Xdisclaimer: No attempt was made to authenticate the sender's name. Anyone know the chromosome number for any species in the family Delphinidae? Or can point me at a source reference? Thanks Jim Cummins School of Veterinary Studies Murdoch University Western Australia 6150 Tel +61-9-360 2668 Fax +61-9-310 4144 "An inordinate fondness for Beetles" From owner-population-bio@net.bio.net Wed Feb 16 22:00:00 1994 Newsgroups: bionet.population-bio Path: biosci!bcm!cs.utexas.edu!swrinde!sgiblab!darwin.sura.net!rouge!tjk1846 From: tjk1846@ucs.usl.edu (Kim Timothy J) Subject: Re: Classroom Experiment Message-ID: <1994Feb17.144140.21377@usl.edu> Sender: anon@usl.edu (Anonymous NNTP Posting) Organization: Univ. of Southwestern Louisiana Date: Thu, 17 Feb 1994 14:41:40 GMT Lines: 31 In article slkiser@oregon.uoregon.edu (Stacey Kiser) writes: >We are running a non-Biology majors human populations class Spring term and ... .... > >Has anyone run an experiment that a) clearly showed a population growth >curve to students and/or b) worked with different nutrient levels? Any >suggestions for improvement on the above experiment? The easiest experiment would be probably bacterial growth in broth media. Since your post stated that a spectrophotometer is available to you, this should be simple. Use good ole' Escherichia coli (or any other relatively safe bacteria available in most microbiology or genetic engineering labs) and some rich, sterile broth media. Log phase growth should be easy to follow using the spec. and you shouldn't have any problems with growth on the glass tubes (shake b/4 taking the spec. reading). Different growth curves can be achieved by changing the growth conditions (temperature, media type, salts or other inhibitors etc.) > >Our limitations are mostly due to time: we only have three months in which >to take readings and observations. Any suggestions are appreciated. This should take about a day or so. Bacteria grow quite easily and rapidly. I hope this helps. Timothy Kim Dept. of Biology University of S.W. Louisiana tjk1846@usl.edu From owner-population-bio@net.bio.net Thu Feb 17 22:00:00 1994 Path: biosci!rutgers!concert!lester.appstate.edu!usenet From: KH8324@CONRAD.APPSTATE.EDU (Heafner, Kerry Donald ) Newsgroups: bionet.population-bio Subject: allozymes in ferns, again Message-ID: <2k1b13$fkh@lester.appstate.edu> Date: 18 Feb 94 03:00:51 GMT Organization: APPALACHIAN STATE UNIVERSITY Lines: 15 NNTP-Posting-Host: alf.appstate.edu X-News-Reader: VMS NEWS 1.24 I am doing an allozyme analysis on the two North Carolina populations of Pellaea wrightiana. I am also running the two proposed parentals on my gels. I am having trouble locatin diploid Pellaea ternifolia. If anyone out there can point me in the right direction of live material of P. ternifolia, please correspond. Kerry Heafner Department of Biology Appalachian State University Boone, NC 28608 (704) 262-3025 KH8324@Conrad.AppState.Edu From owner-population-bio@net.bio.net Thu Feb 17 22:00:00 1994 Path: biosci!daresbury!keele!uknet!pipex!zaphod.crihan.fr!jussieu.fr!univ-lyon1.fr!ghost.dsi.unimi.it!batcomputer!cornell!uw-beaver!netnews.nwnet.net!news.uoregon.edu!bsl.uoregon.edu!user From: slkiser@oregon.uoregon.edu (Stacey Kiser) Newsgroups: bionet.population-bio Subject: Re: Classroom Experiment Followup-To: bionet.population-bio Date: Thu, 17 Feb 1994 10:27:31 +0000 Organization: University of Oregon Lines: 4 Message-ID: References: NNTP-Posting-Host: bsl.uoregon.edu Thank you all for your replies both here and via e-mail. I have gotten some great ideas for working with E.coli, duck weed, and the Daphnia/Scenedesmus system. If anyone would like to read some of the replies I received on e-mail, please let me know. From owner-population-bio@net.bio.net Thu Feb 17 22:00:00 1994 Newsgroups: bionet.population-bio Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!torn!spartan.ac.BrockU.CA!wcade From: wcade@spartan.ac.BrockU.CA (W. H. Cade) Subject: Re: test 2 of pop-bio@net.bio.net Message-ID: <1994Feb18.094451.20302@spartan.ac.BrockU.CA> Organization: Brock University, St. Catharines Ontario X-Newsreader: TIN [version 1.1 PL9] References: Distribution: bionet Date: Fri, 18 Feb 1994 09:44:51 GMT Lines: 3 BIOSCI Administrator (biosci-help@NET.BIO.NET) wrote: : test 2 of pop-bio@net.bio.net From owner-population-bio@net.bio.net Fri Feb 18 22:00:00 1994 Path: biosci!daresbury!doc.ic.ac.uk!warwick!uknet!pipex!howland.reston.ans.net!cs.utexas.edu!usc!yeshua.marcam.com!zip.eecs.umich.edu!caen!batcomputer!cornell!uw-beaver!netnews.nwnet.net!news.u.washington.edu!meir From: meir@zoology.washington.edu (Eli Meir) Newsgroups: bionet.population-bio Subject: Re: Populus Software Date: 19 Feb 1994 20:31:46 GMT Organization: Dept. of Zoology, Univ. of Washington Lines: 27 Sender: -Not-Authenticated-[7936] Message-ID: <2k5svi$nlv@news.u.washington.edu> References: <2ieg94$nf4@athena.cs.uga.edu> <2imtpc$5ed@senator-bedfellow.MIT.EDU> NNTP-Posting-Host: quaternary.zoology.washington.edu X-Posted-From: InterNews 1.0@news.u.washington.edu. Xdisclaimer: No attempt was made to authenticate the sender's name. Here's a notice I just got from Donald Alstad, the creator of populus, announcing a new version, >Dear Populus User: > I have just posted Populus ver 3.4 in the directory /pub/populus of >the >Minnesota Ecology Server, ecology.ecology.umn.edu. This is a major update >with >the following new features: <... etc. He goes on to describe a bunch of new features... > >Best wishes, >Don Alstad >Donald N. Alstad >Ecology, Evolution & Behavior >University of Minnesota >1987 Upper Buford Circle >St. Paul, MN 55108 >DNA@ecology.ecology.umn.edu >612-624-2748 Its a pretty nice program. Good luck. Eli Meir Dept of Zoology, Univ of Washington meir@zoology.washington.edu From owner-population-bio@net.bio.net Sun Feb 20 22:00:00 1994 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!usenet.ins.cwru.edu!lerc.nasa.gov!magnus.acs.ohio-state.edu!dsammata From: dsammata@magnus.acs.ohio-state.edu (Diana Sammataro) Newsgroups: bionet.molbio.evolution,bionet.molbio.rapd,bionet.population-bio,sc Subject: RAPDs and arthropods Date: 21 Feb 1994 21:22:22 GMT Organization: The Ohio State University Lines: 27 Distribution: bionet Message-ID: <2kb8me$8ks@charm.magnus.acs.ohio-state.edu> NNTP-Posting-Host: top.magnus.acs.ohio-state.edu Summary: Call for papers Xref: biosci bionet.molbio.evolution:1481 bionet.molbio.rapd:448 bionet.population-bio:583 SYMPOSIUM ANNOUNCEMENT RAPDs and Arthropods Entomological Society of America Dallas, TX Dec. 13-17, 1994 A symposium is proposed to discuss the techniques, pitfalls and successes in using the molecular technique known as RAPDs for arthropods. A call for papers for the 1994 program to any researchers using this technique in their work on insects, spiders, mites or related organisms. Deadline: March 15, 1994 If you think you want to participate, please contact: Diana Sammataro Phone: 614 292 9089 Fax: 614 292 2180 Dept. Entomology 103 Botany & Zoology Bldg. 1735 Neil Avenue Columbus, OH 43210-1220 E-mail: dsammata@magnus.acs.ohio-state.edu From owner-population-bio@net.bio.net Mon Feb 21 22:00:00 1994 Path: biosci!daresbury!not-for-mail From: "Stefan Vetter" Newsgroups: bionet.population-bio Subject: heredity Date: 22 Feb 1994 10:18:05 -0000 Organization: Vet.Med.Uni Wien Lines: 7 Sender: daemon@mserv1.dl.ac.uk Distribution: bionet Message-ID: <2kcm4t$buc@mserv1.dl.ac.uk> Original-To: pop-bio@dl.ac.uk Hello, I am looking for a forum for disputation and discussion of the heredtiy of different characters within plants (natural and articial hybrids), i.e. morphological, physiological, cytological &c. Am I right here? SteVe Stefan.Vetter@vu-wien.ac.at From owner-population-bio@net.bio.net Mon Feb 21 22:00:00 1994 Newsgroups: bionet.population-bio Path: biosci!bcm!cs.utexas.edu!sdd.hp.com!vixen.cso.uiuc.edu!uchinews!quads!ecec From: ecec@quads.uchicago.edu (Eric Cabot) Subject: Re: Classroom Experiment Message-ID: <1994Feb22.190533.3108@midway.uchicago.edu> Sender: news@uchinews.uchicago.edu (News System) Reply-To: ecec@midway.uchicago.edu Organization: University of Chicago References: <1994Feb17.144140.21377@usl.edu> Date: Tue, 22 Feb 1994 19:05:33 GMT Lines: 20 I recall a memorable experiment that we performed in high school. It was a yeast growth/respiration experiment. Yeast growth was measured using through direct enumeration with a haemocytometer and respiration was determined by estimating the volume of the bubble formed in a small test tube that was inverted within the main culture tube. The main experimental treatments were density of innoculum, sugar content in the broth and temperature. The set up for a temperature gradient was a long cardboard cylinder about 5 inches in diameter that had a ordinary (but low wattage) light bulb inserted in one end. The cylinders were oriented horizonally and had regularly spaced holes piercing the upper surface in order to hold the culture tubes. If you can get a hold of one of the old (>20 years ago) BSCS textbooks (I think either the blue or the black one) it should have a more detailed protocol for an experiment of this kind. -Eric Cabot of this kind descri From owner-population-bio@net.bio.net Tue Feb 22 22:00:00 1994 Path: biosci!bcm!cs.utexas.edu!swrinde!ihnp4.ucsd.edu!network.ucsd.edu!sdcc12!cs!fil From: fil@cs.ucsd.edu (Filippo Menczer) Newsgroups: bionet.population-bio Subject: LEE V1.1 ALife Model/Simulator Message-ID: <62058@sdcc12.ucsd.edu> Date: 23 Feb 94 04:05:21 GMT Sender: news@sdcc12.ucsd.edu Organization: CSE Dept., U.C. San Diego Lines: 170 Nntp-Posting-Host: beowulf.ucsd.edu ========================== LEE release 1.1 Latent Energy Environments ========================== The LEE artificial life simulator is available via public ftp. This is the latest release: the code is under continuous development, so further stable releases will be made available in the future at the same site. You may download the software (Unix/Mac souces and/or executables, documentation, and a technical report) as follows: ftp cs.ucsd.edu (132.239.51.3) login: anonymous password: your_email_address cd pub/LEE get ... bye Filename Format Content ---------------------------------------------------------------- README ASCII general info lee.doc ASCII documentation pinep.ps.Z compressed PostScript LEE model/results paper lee11.Unix.sh ASCII shar archive LEE 1.1 Unix source lee11.Mac.sh mixed shar archive LEE 1.1 Mac add'l source lee11exe.Mac.sh binhexed shar archive LEE 1.1 Mac executables ---------------------------------------------------------------- Please read README for general information, and lee.doc for specific information on how to compile and run the program. To get the PostScript paper, use the Unix utility 'uncompress'. To unpack the source and/or Mac executables you must use the Unix utility 'unshar'. After this, to get the binary Mac executables and/or resource file, use, eg, 'BinHex 4.0'. LEE is (c) University of California, San Diego. Authors: Richard Belew and Filippo Menczer (Cognitive Computer Science Research Group, CSE Dept, UC San Diego). Please send important comments, suggestions, and bugs to the latter (fil@ucsd.edu). You may freely copy/distribute the software, except for commercial purposes, and as long and the notices in the source headers are preserved. Other contributions to the code are from: Stefano Nolfi and Jeff Elman; Greg Linden (Mac interactive version); and Federico Cecconi (sensory system). OVERVIEW OF LEE (from lee.doc) ============================== LEE (Latent Energy Environments) is both an Alife model and a software tool to be used for simulations within the framework of that model. We hope that LEE will help us understand a broad range of issues in theoretical, behavioral, and evolutionary biology. The LEE tool described here consists of approximately 7,000 lines of C code and runs in both Unix and Macintosh platforms. The modeling of environmental complexity across different Alife experiments is perhaps the main motivation behind this project. LEE allows the specification of environments of graduated complexity. A spacially distributed series of "atomic elements" must be combined to transform their "latent potential energy" into "work" necessary for survival. Behavioral strategies must be evolved by the population such as to allow an efficient exploitation of the available energy. This latent energy can be used to measure the environment complexity with respect to the survival task. A steady-state genetic algorithm is used in the LEE model rather then a lock-step generational one. The progression of the adaptive process is measured in terms of time rather than generations. At any one time step possibly all the organisms in the population may live, use and/or acquire energy, and reproduce or die. Consequently, the size of the population varies with time. If latent energy is not made available at a rate sufficient to support the energy expense of the population, extintion may occur. An organism is implemented by a feed-forward neural network plus a sensory-motor system and a gut, i.e. a reservoir for energy, both in work (usable) and latent (atomic elements) form. The sensory system consists of a user-specified set of sensors that are mapped onto the network input units. The network may have as many hidden layers as desired. The output layer maps its activation values onto the motor system, made of a set of user-specified motors. Learning can occur in the current version by means of standard back-propagation of error. The error is computed on an input prediction task. Each organisms lives by moving in a world consisting of a rectangular grid with toroidal edge conditions. Each basic life cycle (sweep) consists of 5 steps: 1. Gather information about the surrounding world by means of a set of sensors. 2. Elaborate the sensory information to produce a motor action. 3. Make a movement in the world by means of a set o motors. 4. (Optional) Use the new sensory information as teaching input for a prediction task learned during an organism's lifetime on a subset of the neural net. 5. Consequences of the movement: there is an energy cost, there may be an energy increase or decrease (depending on the contents of the new world position and the reactions caused by the acquisition of such contents), and finally these energy changes may result in death or reproduction. Different sensor systems implemented in the current version are: GUT, CONTACT, and AMBIENT. The first senses elements present in an organism's own gut; the second senses those present in the world cell in front of the position currently occupied by the organism; the third senses those present in a local range, weighed according to their distange in number of steps. Each sensor has a complex that identifies which elements can be sensed by it. There is one simple motor system currently implemented: BINARY. It allows the organism to make one of four possible moves: stay still, turn left or right 90 degrees, or move ahead. Each motor has a power that specifies how far the organism can be moved by it. LIST OF RELATED PAPERS (as of February 1994) ============================================ Menczer F and Belew RK 'Latent Energy Environments: A Model for Artificial Life Complexity' Technical Report CS93-298, July 1993, University of California, San Diego Menczer F and Belew RK 'Latent Energy Environments: A Tool for Artificial Life Simulations' Technical Report CS93-301, July 1993, University of California, San Diego Menczer F 'Changing Latent Energy Environments: A Case for the Evolution of Plasticity' Technical Report CS94-336, January 1994, University of California, San Diego (*) Menczer F and Belew RK 'Latent Energy Environments' to appear in "Plastic Individuals in Evolving Populations", Santa Fe Institute Studies in the Sciences of Complexity, Addison-Wesley (*) This paper is available on the LEE ftp site as 'pinep.ps.Z'. An abstract follows: A novel ALife model and simulator, called LEE, is introduced and described. The motivation lies in the need for a measure of complexity across different ALife experiments. This goal is achieved through a careful characterization of environments in which different forms of energy are well-defined and conserved. A steady-state genetic algorithm is used to model the evolutionary process. Organisms in the population are modeled by neural networks with non-Lamarckian learning during life. Behaviors are shown to be crucial in the interactions between organisms and their environment. The flexibility of LEE for the study of a variety of problems related to complex evolutionary systems is illustrated by some general emerging properties of the model, and by preliminary results of a number of experiment currently under way. === Filippo Menczer and Richard K. Belew Cognitive Computer Science Research Group Dept. of Computer Science and Engineering, 0114 University of California, San Diego La Jolla, CA 92093-0114 USA Fax: (619)534-7029 Email: fil@ucsd.edu === From owner-population-bio@net.bio.net Tue Feb 22 22:00:00 1994 Path: biosci!biosci!not-for-mail From: Davison@UH.EDU (Dan Davison) Newsgroups: bionet.announce,bionet.molbio.evolution,bionet.molbio.methds-reagnts,bionet.biology.computational,bionet.population-bio,bionet.molbio.genome-program Subject: Summer Course in Molecular Evolution Date: 22 Feb 1994 16:33:24 -0800 Organization: University of Houston Lines: 73 Sender: kristoff@net.bio.net Approved: bionews-moderator@net.bio.net Distribution: bionet Message-ID: <2kdv59$dqn@menudo.uh.edu> NNTP-Posting-Host: net.bio.net Xref: biosci bionet.announce:967 bionet.molbio.evolution:1484 bionet.molbio.methds-reagnts:11752 bionet.biology.computational:544 bionet.population-bio:586 bionet.molbio.genome-program:667 Workshop on Molecular Evolution August 7-19, 1994 Special Extended Topic Session August 21-28, 1994 Marine Biological Laboratory Woods Hole, MA 02543 A series of lectures and discussions exploring multiple approaches to molecular evolution, and a computer laboratory for phylogenetic and sequence analysis. This two-week program is designed for established investigators, postdoctoral fellows, and advanced graduate students. Scientists with a strong interest in molecular evolution including organismic biologists, molecular biologists, and ecologists are encouraged to apply. Because a major goal of this program is to provide a forum for exchange of information between organismic and molecular biologists, students will be asked to actively participate in evening discussion sessions. Limited to 60 students. Topics to be covered include (1) the theoretical basis for comparative sequence analysis of proteins and nucleic acids, (2) the analysis of genomic sequence data and identification of homologous sequences, (3) the applicability of macromolecular sequences to phylogenetic analyses and contemporary approaches to molecular systematics, (4) the impact of molecular phylogeny data on understanding the evolutionary history of living systems, (5) the use of model systems for the study of micro-evolution, (6) the evolution of chromosomes and genomes, (7) molecular population genetics, and (8) current views on the evolution of mutation rates, introns, transposable elements, repeated DNA sequences, and multi-gene families. Fifteen students will be admitted to a special research topics session August 21-28 for the purpose of analyzing their research data sets. This course is supported in part by grants from the National Science Foundation and Merck and Co., Inc. Director: Mitchell L. Sogin, Marine Biological Laboratory Faculty: Daniel Davison, University of Houston; Joseph Felsenstein, University of Washington; Walter Fitch, University of California, Irvine; George Fox, University of Houston; Richard Hudson, University of California, Irvine; Laura Landwebber, Harvard University; David Maddison, Harvard University; Roger Milkman, University of Iowa; Stephen O'Brien, National Cancer Institute, MD; Gary Olsen, University of Illinois; Norman Pace, Indiana University; Margaret Riley, Yale University; Monica Riley, Marine Biological Laboratory; Terry Speed, University of California, Berkeley; David Swofford, Smithsonian, Washington, DC; Peter Waddell, University of Melbourne, Australia; Bruce Walsh, University of Arizona; and others to be announced. Tuition: US$675.00 (includes room and board) Application Deadline: June 1, 1994 For Admission Application and Information Contact: Admissions Coordinator Marine Biological Laboratory Woods Hole, MA 02543 +1 508-548-3705 x 401 Internet: admissions@mbl.edu -- dr. dan davison/dept. of biochemical and biophysical sciences/univ. of Houston/4800 Calhoun/Houston,TX 77204-5934/davison@uh.edu/DAVISON@UHOU Disclaimer: As always, I speak only for myself, and, usually, only to myself. From owner-population-bio@net.bio.net Wed Feb 23 22:00:00 1994 Path: biosci!daresbury!not-for-mail From: semerz@lmcp.jussieu.fr (Michel Semertzidis) Newsgroups: bionet.population-bio Subject: OMEGA_2 data bank announcement Date: 24 Feb 1994 10:15:27 -0000 Lines: 79 Sender: daemon@mserv1.dl.ac.uk Distribution: bionet Message-ID: <2khunv$i2s@mserv1.dl.ac.uk> Original-To: gnome-pr@dl.ac.uk, info-gcg@dl.ac.uk, methods@dl.ac.uk OMEGA_2 data bank for Mac is now at the genome.inserm-vjf.fr (192.134.32.20) /pub/OMEGA. Log in as `anonymous' and enter your email address as your password. OMEGA_2 data bank is a compilation of recent structural information on proteins. OMEGA_2 data bank was compiled by Michel T. SEMERTZIDIS*, Sylvia DEPLANQUE and Jean-Paul MORNON Département des Macromolécules Biologiques, Laboratoire de Minéralogie - Cristallographie, Université Pierre et Marie Curie (Paris 6) et Denis Diderot (Paris 7), CNRS URA 09, Tour 16, 4 place Jussieu, CASE 115, F-75252 Paris Cedex 05, FRANCE E-mail: "semerz@lmcp.jussieu.fr" *To whom correspondence should be addressed Suggested citations for use of this data bank are: Michel T. SEMERTZIDIS, Sylvia DEPLANQUE and Jean-Paul MORNON (1993) "OMEGA: A 3D Databank for Protein Structures (a complement to PDB)", CABIOS 9, 667-670. RELEASE 1: JUNE, 1993: 401 proteins. RELEASE 2: JANUARY, 1994: 537 proteins. ABSTRACT OMEGA is a compilation of recent structural information on proteins derived from X-ray crystallography or NMR and published in journals referenced by Current Contents. To date, 401 entries have been included ( 334 X-ray, 28 NMR, 5 NMR + X-ray, 5 electron microscopy, 3 neutron scattering, 2 neutron diffraction, 1 electron microscopy + X-ray, 12 model, 11 miscellaneous ), with 5-10 new proteins being added each week. OMEGA can be accessed on Macintosh and is interrogated through 32 key words (space group, resolution, secondary structure, number of residues, etc). This pool of proteins could be used for various purposes, including searches for proteins with a particular set of secondary structures. OMEGA will be continuously updated (every 6 months) and may later include all proteins already reported in the PDB, as well as structures reported in journals with smaller readerships. We would greatly appreciate any ideas for improving future releases. We also apologize in advance for any errors or omissions that may appear in the database, and would be grateful to be informed of any errors. We also welcome submission for entry in OMEGA of any new publication related to the determination of a protein structure, as well as the citing of this paper as a reference for the OMEGA databank. We would appreciate receiving reprints of publications making use of OMEGA. ACKNOWLEDGEMENTS: This work was supported by the Universités Paris 6 and Paris 7, CNRS, INSERM (contrats 889009 et 910912), and Fondation pour la Recherche Médicale. M.T.S. has a Ph.D. grant from the French government (MRE). !!! The first time you will use omega it will take some time for special 4D decompression !!! TTGATTGCTAAACACTGGGCGGCGAATCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG MICHEL T. SEMERTZIDIS Internet: SEMERZ@LMCP.JUSSIEU.FR University of Paris 6 Bitnet: CNRS URA 09, CASE 115 Phone: Tour 16, 4 place Jussieu, Fax: 75252 Paris Cedex 05, System managers do it with PRIVILEGES! F R A N C E DISCLAIMER:As always,I speak only for myself,and,usually,only to myself. LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu From owner-population-bio@net.bio.net Mon Feb 28 22:00:00 1994 Path: biosci!DARWIN.BIO.UCI.EDU!aescalan From: aescalan@DARWIN.BIO.UCI.EDU ("Ananias A. Escalante M.") Newsgroups: bionet.population-bio Subject: DISTANCE Date: 1 Mar 1994 20:20:56 -0000 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 15 Sender: daemon@net.bio.net Distribution: bionet Message-ID: NNTP-Posting-Host: net.bio.net I am interested in the programs DISTANCE and TRANSECT made by J. L. Laake, does somebody in the list know how can I get more information about them? Ananias =========================================================================== Ananias Escalante | E-Mail: Dept. Ecology and Evolutionary Biology | aescalan@uci.edu University of California Irvine | aescalan@dino.conicit.ve Irvine, CA 92717, USA | PHONE: (714) 856-8295 ---------------------------------------------------------------------------