From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!bcm!cs.utexas.edu!wupost!darwin.sura.net!Sirius.dfn.de!chx400!bernina!ruba From: ruba@molbio.ethz.ch (Rudolf Baumann) Newsgroups: bionet.molbio.proteins Subject: Re: Protein Structure Display Message-ID: Date: 6 Dec 91 08:38:25 GMT References: <1991Nov29.004339.752@kakwa.ucs.ualberta.ca> Sender: news@bernina.ethz.ch (USENET News System) Organization: Swiss Federal Institute of Technology (ETH), Zurich, CH Lines: 23 Nntp-Posting-Host: odin Chris_Upton@darwin.biochem.ualberta.ca writes: >Hi, > I looking for a program that will display protein structures on a Sparc2. >I don't need to do anything fancy just look at the structures and twirl them >around! >I tried the demo version of Mac-Mimic, worked great but was very slow >(unusable) for a 300 aa protein when using a Mac IIcx. I guess it was meant for >the new fast-macs! I have a demo version of a program here, which seem to be quite usable. It is from a company which is called PHI-SQUARED (Philip S. Cohen, Philip J. Mercurio) Send mail to phil@scripps.edu for information. I am not connected in any way to this company, I only looked into the demo program and was quite impressed with what I saw. Ruedi -- Rudolf E. Baumann ruba@molbio.ethz.ch Institut fuer Molekularbiologie & Biophysik MOLEKULA@CZHETH5A.bitnet ETH Hoenggerberg (HPM G6) Tel. ++41 1 377 33 97 CH-8093 Zuerich/Switzerland Fax ++41 1 371 48 73 From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!s.u-tokyo!ccut!sun-barr!cs.utexas.edu!wupost!micro-heart-of-gold.mit.edu!news.bbn.com!bbn.com!prophet.bbn.com!hperry From: hperry@prophet.bbn.com Newsgroups: bionet.molbio.genbank,bionet.molbio.proteins,bionet.molbio.gene-org Subject: New Kabat Book - Correction to prices Message-ID: <67720@bbn.BBN.COM> Date: 5 Dec 91 18:45:07 GMT Sender: news@bbn.com Reply-To: hperry@prophet.bbn.com. () Followup-To: bionet.molbio.genbank Organization: Bolt Beranek and Newman Inc., Cambridge MA Lines: 60 Xref: bionet bionet.molbio.genbank:594 bionet.molbio.proteins:208 bionet.molbio.gene-org:60 In our recently posted announcement that the new 5th edition of "Sequences of Proteins of Immunological Interest" is now available, we inadvertently omitted additional book charges and other ordering information. Please consult the corrected order form appended below. We regret any inconvenience. ------------------------------------------------------------------ NTIS Order Form U.S. Department of Commerce National Technical Information Service 5285 Port Royal Road Springfield, VA 22161 Name: Title: Company/Organization: Address: City/State/Zip: Telephone: Here is my order form and payment for ___ copy(ies) of "Sequences of Proteins of Immunological Interest" (NTIS Order No. PB91-192898/GEG) U.S., Canada and Mexico Delivery $30 ________ International Delivery - Surface Mail $51 ________ International Delivery - Air Express $67 ________ Add $3 handling to your order for domestic; $4 foreign. Add $7.50 for purchase order or if you wish to be billed P.O. Number________________ Payment Options: Charge Visa___ MasterCard___ American Express___ Credit Card No. ______________________________ Signature ______________________________ Check or money order made payable to NTIS for $________ (include handling charge) NTIS Deposit Account No.__________ For fastest service: Call NTIS at (703) 487-4650 FAX (completed order form) to NTIS (703) 321-8547. TDD (703) 487-4639 From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!bio.embnet.se!biobase!jnb From: jnb@bio.aau.dk Newsgroups: bionet.molbio.proteins Subject: protein crystallization Summary: network for protein crystallizers? Keywords: protein crystallization Message-ID: <1992Jan27.175944.280@bio.aau.dk> Date: 27 Jan 92 16:59:43 GMT Expires: 30 Apr 92 18:01:18 MET Organization: BIOBASE, Denmark Lines: 9 Protein crystallization Is there any interest of establishing some kind of "network" for people working in the field. Since experience is so important here in particulary, it would be very useful to have something like a "bulletinboard" for rapid excchange of experience, recipes and advice. If interested, answer using the bionet or mail me directly In%"gregers@kemi.aau.dk" Gregers From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!GUNBRF.bitnet!POSTMAST From: POSTMAST@GUNBRF.bitnet Newsgroups: bionet.molbio.proteins Subject: PIR Help in Spanish and French Message-ID: <9201091522.AA29405@genbank.bio.net> Date: 8 Jan 92 22:03:00 GMT Sender: daemon@genbank.bio.net Distribution: bionet Lines: 15 The PIR Network Server now has help available in Spanish and French. "Help_en_Espanol" and "Help_en_francais" have been added to the list of topics available with the HELP command. To obtain these foreign language instructions send the command HELP Help_en_Espanol or HELP Help_en_francais in the body of an e-mail message to FILESERV@GUNBRF.BITNET. ------------------------------------------------------------------------ Dr. John S. Garavelli Database Coordinator Protein Identification Resource National Biomedical Research Foundation Washington, DC 20007 POSTMASTER@GUNBRF.BITNET From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!news.cs.indiana.edu!spool.mu.edu!hri.com!ukma!aunro!nstn.ns.ca!morgan.ucs.mun.ca!csd.unb.ca!utgpu!cunews!nrcnet0!MBDS.NRC.CA!NUM208WW From: num208ww@MBDS.NRC.CA (Warren Wakarchuk) Newsgroups: bionet.molbio.proteins Subject: test please ignore Message-ID: <1992Jan9.221524.10161@nrcnet0.nrc.ca> Date: 9 Jan 92 22:15:24 GMT Sender: root@nrcnet0.nrc.ca (Operator) Reply-To: num208ww@MBDS.NRC.CA Organization: NRC, OTTAWA, ONTARIO, CANADA. Lines: 8 Nntp-Posting-Host: mbds.nrc.ca this is a test Dr. Warren Wakarchuk Prefered email: wakarchu@biologysx.lan.nrc.ca Alternate : NUM208WW@MBDS.NRC.CA IBS-Protein Structure and Design National Research Council Canada Ottawa, Ont., Canada K1A 0R6 ***THESE ARE MY OPINIONS NOT THOSE OF NRC*** From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!uwm.edu!wupost!darwin.sura.net!uvaarpa!murdoch!cyclops.micr.Virginia.EDU!wrp From: wrp@cyclops.micr.Virginia.EDU (Bill Pearson) Newsgroups: bionet.software,bionet.molbio.proteins,bionet.molbio.pir,bionet.molbio.genbank Subject: FASTA 1.6 deja vu again Message-ID: <1992Jan10.161651.1180@murdoch.acc.Virginia.EDU> Date: 10 Jan 92 16:16:51 GMT Sender: usenet@murdoch.acc.Virginia.EDU Followup-To: bionet.software Organization: University of Virginia Lines: 32 Xref: bionet bionet.software:1772 bionet.molbio.proteins:225 bionet.molbio.genbank:629 Originator: wrp@cyclops.micr.Virginia.EDU It is with some embarrasment that I announce yet another revison of the FASTA 1.6 version - 1.6b2. Now available on uvaarpa.virginia.edu is: fasta16b2.shar and fasta16b2.shar.Z These versions fix a trivial problem with numbers in alignments (which arose because fasta now allows negative offsets in alignments; this is useful for aligning upstream 5'-flanking regions) and a somewhat more serious problem which occured when one was optimizing every sequence in a library. The optimization problem appeared because for the first time, doing a search with ktup=1 and optimizing every sequence in the library takes only about twice as long as doing the search with ktup=1 and optimizing only a few sequences. (In the past, it usually took about 5 times longer to do a fully optimized search). As a result, for protein sequences, it is very practical to search an entire database with ktup=1, optimizing every sequence (This takes about 15 min on a 25 Mhz Sun 4 with a 200 residue query sequence against PIR release 30 - 10,000,000 residues in 34,000 entries). When I started optimizing large libraries, I uncovered some bugs in how the best scores were saved with optimization. A FASTA search with ktup=1, optimizing all sequences, compares very favorably with a rigorous Smith-Waterman search (ssearch, see Pearson (1991) Genomics, 11:635) and takes about 1/7 as long with this version. With luck, fasta16b2 will be stable for more than a few days. Bill Pearson From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!bcm!cs.utexas.edu!sdd.hp.com!samsung!tulane!ukma!zaphod From: zaphod@ms.uky.edu (David E. Fields) Newsgroups: bionet.molbio.proteins Subject: Looking for program Summary: I am looking for a program which uses the PROSITE db Keywords: PROSITE, program Message-ID: <1992Jan20.171545.6809@ms.uky.edu> Date: 20 Jan 92 22:15:45 GMT Organization: University Of Kentucky, Dept. of Math Sciences Lines: 13 X-Bytes: 539 Does anyone out there know of a program (DOS, Unix) which uses the PROSITE database to compare the sequences described in PROSITE with other protein sequences? Any help would be greatly appreciated. Also, are there any anonymous ftp'able sites out there with MS-DOS programs for molbio research? /---------------------------------------------------------------------------\ \---------------------------------------------------------------------------/ From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!uwm.edu!zaphod.mps.ohio-state.edu!magnus.acs.ohio-state.edu!usenet.ins.cwru.edu!cleveland.Freenet.Edu!bl275 From: bl275@cleveland.Freenet.Edu (Dan Diaz) Newsgroups: bionet.molbio.proteins Subject: Chromatography on Heparin-sepharose Message-ID: <1992Jan15.225404.4319@usenet.ins.cwru.edu> Date: 15 Jan 92 22:54:04 GMT Sender: news@usenet.ins.cwru.edu Organization: Case Western Reserve University, Cleveland, Ohio, (USA) Lines: 8 Nntp-Posting-Host: cwns1.ins.cwru.edu I am having a devil of a time getting my enzyme (an exonuclease) to behave consistently on Hep-Seph CL-6B (Pharmacia). On some home-made H-S the enzyme eluted at about 250 mM NaCl. Using the Pharmacia material, the enzyme elutes much later (closer to 350 mM. I would appreciate any email from other protein types who have used heparin chromatography. From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!sass.sari.ac.uk!frank From: frank@sass.sari.ac.uk (Frank Wright) Newsgroups: bionet.molbio.proteins Subject: AA composition histogram Message-ID: <8190.9112201629@sass.sari.ac.uk> Date: 20 Dec 91 16:29:09 GMT Sender: daemon@genbank.bio.net Distribution: bionet Lines: 20 I wonder if there is any already available programs that can look through all the protein sequences in the protein database (e.g. PIR/NBRF, or SWISSPROT) and calculate (say) % Cys and then output a frequency table e.g. No of proteins with between 0.0% and 0.1% Cys No of proteins with between 0.1% and 0.2% Cys etc etc No of proteins with between 99.9% and 100.0% Cys I'm interested in biased amino acid composition. Dr. Frank Wright Molecular Biology Consultant Scottish Agricultural Statistics Service University of Edinburgh, Scotland frank @ sass.sari.ac.uk From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!agate!spool.mu.edu!uwm.edu!wupost!darwin.sura.net!mars.rm.fccc.edu!castor!laub From: laub@castor.fccc.edu (Paul Laub) Newsgroups: bionet.molbio.proteins Subject: molecular dynamics Summary: molecular dynamics Keywords: molecular dynamics Message-ID: <1991Dec18.131720.9650@fccc.edu> Date: 18 Dec 91 13:17:20 GMT Sender: news@fccc.edu (USENET News System) Organization: Fox Chase Cancer Center, Philadelphia PA Lines: 22 Nntp-Posting-Host: castor.rm.fccc.edu Hello, I am interested in knowing whether anyone has experience determining peptide or protein structures using CHARMM and distance restraints determined from NMR 2D NOESY experiments. While NMR derived structures are regularly the subject of articles in journals like Biochemistry, few people I have noticed still use CHARMM. It is difficult with the version of CHARMM (21) I have to include NMR-derived distance and torsion constraints. So my question is whether it is a better investment of my time to abandon CHARMM for these purposes and learn to use AMBER, XPLOR, GROMOS, or CONGEN **or** to try to make CHARMM work (though not elegantly). CHARMM came with our molecular graphics software (Polygen's Quanta), so I naturally started to use it. What is important to realize is that my time is quite limited; I don't want to spend much time learning an new dynamics package when the familiar old one might be made to work. Second question: Has anyone used Robert Bruccoleri's CONGEN as a molecular dynamics tool with the inclusion of user-defined constraints? Final question (naively asked): Is this the best newsgroup for questions such as these? Sincerely, Paul Laub Institute for Cancer Research, Philadelphia, USA (215)728-2748/-2840 From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!VAX1.COMPUTER-CENTRE.BIRMINGHAM.AC.UK!LUNDPA From: LUNDPA@VAX1.COMPUTER-CENTRE.BIRMINGHAM.AC.UK Newsgroups: bionet.molbio.proteins Subject: (none) Message-ID: <9112111810.AA13503@genbank.bio.net> Date: 12 Dec 91 02:00:00 GMT Sender: daemon@genbank.bio.net Distribution: bionet Lines: 32 Having got some pretty useful tips already from networkland, I'm wondering if anyone out there has had any experience of using tagging systems for protein purification, such as the Histidine tag purified on NTA resin, or the FLAG fusion system marketed by IBI where the fusion protein is affinity-purified on an antibody column. We are looking for a suitable method to purify variants of a protein, constructed by directed mutagenesis, in a cell where the wild type protein is also present (it has to be as its essential for viability and the mutant proteins may well be inactive). Also, the protein needs to be kept in its native form throughout the purification if possible. Making the mutant forms with a tag on that allows them to be separated from the wild type seems a suitable route to try. Anyone out there had a go with this? Does the presence of the tag tend to have a major effect on activity, and is there any a priori reason for having it at the N or C terminus? (This is a cytoplasmic protein so we're not interested in trying to secrete it). Just how valid are the claims of IBI and Qiagen that you can get good one step purification? Etc, etc, etc. All reponses gratefully received, and I'll post a summary. (This is the second attempt to post this message; apologies to all concerned if it appears twice!) Many thanks, Pete Lund Biological Sciences University of Birmingham Birmingham B15 2TT UK LUNDPA@UK.AC.BHAM.VAX1 From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!GUNBRF.bitnet!POSTMAST From: POSTMAST@GUNBRF.bitnet Newsgroups: bionet.molbio.proteins Subject: PIR NRL_3D Database Message-ID: <9112102311.AA10604@genbank.bio.net> Date: 10 Dec 91 23:11:00 GMT Sender: daemon@genbank.bio.net Distribution: bionet Lines: 44 The last release of the NBRF Protein Identification Release in ASCII card image format failed to include the NRL_3D database of protein sequence information extracted from the Brookhaven Protein Data Bank. This file has been prepared and is available for FTP from the service maintained by Dan Davison at the University of Houston. The file is available in compressed form from menudo.uh.edu in /pub/gene-server/pir/pir_rel30/unix [On January 1 this will change to ftp.bchs.uh.edu (129.7.2.43).] Future releases of the PIR in ASCII format will include this database which has appeared in the last two PIR releases in VAX/VMS format. A brief description of the NRL_3D database follows. ------------------------------------------------------------------------ NRL_3D Release 6.1, November 18, 1991 Corresponding to Brookhaven Protein Data Bank Release 57, July 1991 1,045 sequences 177,811 residues NRL_3D is a sequence--structure database derived from the 3 dimensional structure of proteins deposited with the Brookhaven National Laboratory's Protein Data Bank. This database was conceived, developed and tested by K. Namboodiri, N. Pattabiraman, A. Lowrey, and B. Gaber at the Naval Research Laboratory, Washington, D.C. and incorporated into the *PIR System by David George at the National Biomedical Research Foundation, Washington, DC. This version was constructed via software developed by Masami Kusunoki, of the Institute for Protein Research, Osaka University, Osaka, Japan, and John S. Garavelli of the National Biomedical Research Foundation, Washington, DC. This database may be redistributed without prior consent, provided that this notice be given to each user and that the words "Derived from" shall precede this notice if the database has been altered by the redistributor. *PIR is a registered mark of NBRF. The PIR is supported by NIH and NSF. ------------------------------------------------------------------------ Dr. John S. Garavelli Database Coordinator Protein Identification Resource National Biomedical Research Foundation Washington, DC 20007 POSTMASTER@GUNBRF.BITNET From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!ere.umontreal.ca!yang From: yang@ere.umontreal.ca (Yang Jing-Hua) Newsgroups: bionet.molbio.proteins Subject: sub Message-ID: <9111240728.AA01047@alize.ERE.UMontreal.CA> Date: 24 Nov 91 07:28:29 GMT Sender: daemon@genbank.bio.net Distribution: bionet Lines: 2 subscribe proteins Jinghua YANG From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!uwm.edu!spool.mu.edu!uunet!zephyr.ens.tek.com!uw-beaver!uw-june!june.cs.washington.edu!dhubbell From: dhubbell@june.cs.washington.edu (David Hubbell) Newsgroups: bionet.molbio.proteins,bionet.molbio.bio-matrix Subject: Wanted: simulator source Message-ID: <15354@june.cs.washington.edu> Date: 6 Mar 91 20:59:26 GMT Sender: dhubbell@cs.washington.edu Reply-To: dhubbell@june.cs.washington.edu (David Hubbell) Distribution: bionet Organization: U of Washington, Computer Science, Seattle Lines: 7 Xref: bionet bionet.molbio.proteins:80 bionet.molbio.bio-matrix:201 Posted: Wed Mar 6 14:59:26 1991 I'm looking for the source code to a molecular dynamical simulator that uses either the Beeman, Verlet, or SHAKE integration methods. The more recent, the better. I'm trying to get an idea of how simple one could make the processors in an array processor and still map one atom (or extended atom) per processor. Thanks in advance, Dave Hubbell From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!frups51.bitnet!TAUPIN From: TAUPIN@frups51.bitnet Newsgroups: bionet.molbio.proteins Subject: (none) Message-ID: <9107161219.AA06359@genbank.bio.net> Date: 16 Jul 91 13:17:45 GMT Sender: daemon@genbank.bio.net Distribution: bionet Lines: 40 X-Ray Powder Diffraction Pattern Indexing. Daniel Taupin's program for indexing x-ray powder patterns is freely available throught `ftp'. See paper in J.Appl.Cryst (1989) <22> 455 459 To get it: ftp rsovax.circe.fr (or 130.84.128.100) user: anonymous password: your name ! cwd powder (or [.powder]) get pwd_jac.tex (notice and paper in TeX) cwd get Available for: IBM/MVS UNIX/SUN UNIX/AIX VAX/VMS HP/RTEA PC/MSDOS If wanted, I can make if for IBM/VM-CMS and CDC/NOS-VE This is all freeware... D. Taupin Physique des Solides Centre Universitaire Batiment 510 91405 ORSAY Cedex France Tel: 33 (1) 69 41 60 79 Fax: 33 (1) 69 41 60 86 From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!uwm.edu!zaphod.mps.ohio-state.edu!sol.ctr.columbia.edu!bronze!sunflower.bio.indiana.edu!gilbertd From: gilbertd@sunflower.bio.indiana.edu (Don Gilbert) Newsgroups: bionet.molbio.proteins Subject: Re: software to locate given amino acid composition in sequence Message-ID: <1991Oct30.180622.22661@bronze.ucs.indiana.edu> Date: 30 Oct 91 18:06:22 GMT References: <9110301632.AA04859@genbank.bio.net> Sender: news@bronze.ucs.indiana.edu (USENET News System) Distribution: bionet Organization: Biology, Indiana University - Bloomington Lines: 9 Nntp-Posting-Host: sunflower.bio.indiana.edu In article <9110301632.AA04859@genbank.bio.net> MACRIDES@WFEB2.BITNET (Foteos Macrides) writes: > What about on-line help (GENHELP & GENMANUAL)? Is it MAN-like or >VMS_HELP-like? The Unix and VMS versions of GCG are very much alike. The online help user interfaces are essentialy the same (that is, like VMS HELP). -- Don Gilbert gilbert@bio.indiana.edu biocomputing office, biology dept., indiana univ., bloomington, in 47405 From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!lhc!ncifcrf!darwin.sura.net!jvnc.net!yale.edu!spool.mu.edu!uwm.edu!psuvax1!rutgers!stanford.edu!rock!mcnc!duke!news.duke.edu!canctr.mc.duke.edu!CJS From: cjs@canctr.mc.duke.edu Newsgroups: bionet.molbio.proteins Subject: Re: Chromatography on Heparin-sepharose Message-ID: <858@news.duke.edu> Date: 17 Jan 92 20:35:19 GMT References: <1992Jan15.225404.4319@usenet.ins.cwru.edu> Sender: news@news.duke.edu Reply-To: cjs@canctr.mc.duke.edu Organization: Duke U. Med. Ctr., Durham, NC Lines: 17 Nntp-Posting-Host: canctr.mc.duke.edu In article <1992Jan15.225404.4319@usenet.ins.cwru.edu>, bl275@cleveland.Freenet.Edu (Dan Diaz) writes: > >I am having a devil of a time getting my enzyme (an exonuclease) >to behave consistently on Hep-Seph CL-6B (Pharmacia). On some >home-made H-S the enzyme eluted at about 250 mM NaCl. Using the >Pharmacia material, the enzyme elutes much later (closer to 350 >mM. I would appreciate any email from other protein types who >have used heparin chromatography. I used to use Heparin Sepharose in a purification protocol and found it to be quite variable, as well. I'm not sure what type of samples you're running on this column, but I found that checking the conductivity of the samples aided in the consistency of my results. However, there is always variation between the preparations of resin, with regards to the amount of heparin conjugated to the resin and I believe that this is what leads to the variability in binding and it's very difficult to correct for this. From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!JHUHYG.bitnet!DANJ From: DANJ@JHUHYG.bitnet (Dan Jacobson) Newsgroups: bionet.molbio.proteins Subject: *Brookhaven Protein Structure Database Message-ID: <9112012225.AA15988@genbank.bio.net> Date: 1 Dec 91 21:20:27 GMT Sender: daemon@genbank.bio.net Distribution: bionet Lines: 108 A request was made for an ftp site for the Brookhaven database (PDB). I don't know of a anonymous ftp site as yet but the PDB is on the EMBL net server. As EMBL is scheduled to switch over to internet and (I believe) become an ftp site soon, it will probably be ftp'able from there in the not to distant future. Until then the following is a description of the PDB as available from NETSERV@EMBL. Happy Hunting, Dan Jacobson danj@jhuhyg.sph.jhu.edu (internet) danj@jhuhyg (bitnet) =============================================================================== Comments: ------------ Comments: Please note: Comments: The EMBL withdraws from Bitnet on 31-Dec-1991. Comments: After that date, EMBL will only be reachable at the Internet address: Comments: EMBL-Heidelberg.DE Comments: ------------ HELP PROTEINDATA [DIR PROTEINDATA] The service provided by the EMBL Data Library, Computer Group and Protein Design Group allows users to download the files constituting the Brookhaven protein structure database and related information. Files from this directory can be obtained by sending the command GET PROTEINDATA:filename to the file server. The following files are available in the ProteinData directory: o Protein Data Bank (Brookhaven) coordinate entries BRK.DIR - list of BRK entry names BRKNEW.DIR - list of new/changed entries in latest release BROOKDIR.DOC - header records for each BRK entry OBSLTE.DOC - list of obsolete entries protein.BRK - structure coordinates protein.BRK_MOD - model structure coordinates NEWSLETTER.DOC - latest PDB Newsletter NEWSLETTER.47 to NEWSLETTER.56 - NewsLetter (previous issues) examples: get PROTEINDATA:BROOKDIR.DOC get PROTEINDATA:2SEC.BRK o Coordinates of protein structures determined by x-ray crystallography at EMBL, in Brookhaven format. ROP2.BRK - rop wild type refined structure example: get PROTEINDATA:ROP2.BRK o Secondary structure digest of Protein Data Bank (Brookhaven) protein files, derived by a pattern recognition program DSSP (Definition of Protein Secondary Structure). The protein.DSSP files only exist if the entry is for a protein, and at least the backbone coordinates are known. DSSP.DIR - list of DSSP filenames protein.DSSP - secondary structure for one protein example: get PROTEINDATA:1MBN.DSSP o Database of homology-derived protein structures alias: database of protein families alias: database of multiple sequence alignments One file for each PDB protein. Associated utility programs in source code for VMS or UNIX: HSSP.DIR - list of HSSP filenames protein.HSSP - secondary structure for one protein filter_hssp.for - filters a sequence family by your own criteria metric-gcg.data - exchange matrix required for filter_hssp find_hssp.com - finds a protein sequence in the database find_hssp.csh - table for use with find_hssp hssp_swissprot.table hssp_to_insight.for - prepares coloring by variability in 3D hssp_to_sybyl.for read_hssp.for - reads HSSP files example: get PROTEINDATA:1PPT.HSSP o Model coordinates from the 1986 and 1990 EMBO courses on protein design. TINY.BRK_MOD - tiny TIM BABA.BRK_MOD - babarellin BEAL.BRK_MOD - betaalphacin BUND.BRK_MOD - bundle FXNM.BRK_MOD - mutated flavodoxin FXNI.BRK_MOD - idealized flavodoxin RCU1.BRK_MOD - copper-binding rop GRENDEL.BRK_MOD - 4-helix membrane anchor FINGERCLASP.BRK_MOD - dimer of interdigitating beta-beta-alpha units SHPILKA.BRK_MOD - four-on-four antiparallel beta sandwich AIDA.BRK_MOD - designed anti-flavodoxin antibody LEATHER.BRK_MOD - minimal NAD binding domain example: get PROTEINDATA:TINY.BRK_MOD From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!bcm!cs.utexas.edu!usc!hatysa.usc.edu!chaph.usc.edu!neuro.usc.edu!annala From: annala@neuro.usc.edu (A. J. Annala) Newsgroups: sci.chem,comp.graphics.visualization,bionet.software,bionet.molbio.proteins Subject: Brookhaven Protein Sequence Database Online? Message-ID: <22224@chaph.usc.edu> Date: 30 Nov 91 11:41:40 GMT Sender: news@chaph.usc.edu Followup-To: sci.chem Organization: University of Southern California, Los Angeles, CA Lines: 7 Xref: bionet sci.chem:4850 comp.graphics.visualization:1248 bionet.software:1562 bionet.molbio.proteins:204 Nntp-Posting-Host: neuro.usc.edu Is the Brookhaven PDB available for anonymous ftp from somewhere on the net? Thanks, AJ Annala Principal Investigator Neuroscience Image Analysis Network University of Southern California Los Angeles, CA 90089-2520 From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!bcm!cs.utexas.edu!uunet!paladin.american.edu!darwin.sura.net!mojo.eng.umd.edu!mimsy!lhc!ncifcrf!fcs260c2!toms From: toms@fcs260c2.ncifcrf.gov (Tom Schneider) Newsgroups: bionet.molbio.proteins Subject: Re: Protein Structure Display Message-ID: <2553@fcs280s.ncifcrf.gov> Date: 2 Dec 91 17:09:51 GMT References: <13071.9111291432@biochemistry.oxford.ac.uk> Sender: news@ncifcrf.gov Distribution: bionet Organization: NCI Supercomputer Facility, Frederick, MD Lines: 18 In article <13071.9111291432@biochemistry.oxford.ac.uk> rbr@biochemistry.oxford.ac.uk (Rob Russell) writes: >We obtained a program called `nseqtool' from the EMBL file >server (just send a message saying `help' to netserv@de.embl-heidleberg). Of course, this address doesn't work for most people on the planet because England uses 'backwards' addresses! netserv@embl-heidleberg.de should work. When is this idiocy going to be cleared up? Tom Schneider National Cancer Institute Laboratory of Mathematical Biology Frederick, Maryland 21702-1201 toms@ncifcrf.gov From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!s.u-tokyo!ccut!yayoi!tansei1!kanno From: kanno@tansei.cc.u-tokyo.ac.jp (Kanno Hideo) Newsgroups: bionet.molbio.proteins Subject: Re: Brookhaven database format Message-ID: <742@tansei1.tansei.cc.u-tokyo.ac.jp> Date: 21 Jul 91 13:42:35 GMT References: <29JUN91091801@vms.huji.ac.il> Sender: news@tansei.cc.u-tokyo.ac.jp Organization: Computer Centre, University of Tokyo Lines: 26 In article <29JUN91091801@vms.huji.ac.il> yehavi@vms.huji.ac.il writes: > I don't know whether this is the forum to ask but I'll try. Does someone >have information about the files format of the Brookhaven database? > Someone at our university bought it but he doesn't remember where he put >the needed information... I'm not sure this is a information what you need or not. I know one paper on PDB format definition. F.C.Bernstein, T.F.Koetzie, G.J.B.Wiiliams, E.F.Mayer Jr., M.D.Brice, J.R.Rodgers, O.Kennard, T.Shimanouchi and M.Tasumi, 1977 The Protein Data Bank: A Computer-based Archival File for Macromolecular Structures J. Mol. Biol., 112, 535-542 Also you can easily find notes on PDB format definition, in manuals of molecular design programs, such as Biograf. KANNO Hideo Department of Biophysics and Biochemistry University of Tokyo e-mail: kanno@tansei.cc.u-tokyo.ac.jp From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!news.cs.indiana.edu!noose.ecn.purdue.edu!mentor.cc.purdue.edu!purdue!ames!elroy.jpl.nasa.gov!swrinde!zaphod.mps.ohio-state.edu!wupost!uwm.edu!psuvax1!ukma!aunro!alberta!kakwa.ucs.ualberta.ca!news From: Chris_Upton@darwin.biochem.ualberta.ca Newsgroups: bionet.molbio.proteins Subject: Re: Protein Structure Display Message-ID: <1991Dec4.002357.1282@kakwa.ucs.ualberta.ca> Date: 4 Dec 91 00:23:57 GMT References: <1991Nov29.004339.752@kakwa.ucs.ualberta.ca> Sender: news@kakwa.ucs.ualberta.ca Organization: University of Alberta Lines: 18 In article <1991Nov29.004339.752@kakwa.ucs.ualberta.ca> Chris_Upton@darwin.biochem.ualberta.ca writes: >Hi, > I looking for a program that will display protein structures on a Sparc2. Oops I posted the summary and thank-you note to bionet.software >Thanks, > Chris Upton > >Chris_Upton@darwin.biochem.ualberta.ca > >Biochemistry >University of Alberta >Edmonton >Alberta > From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!simsc.bitnet!OBANDOP From: OBANDOP@simsc.bitnet Newsgroups: bionet.molbio.proteins Subject: suscribtion Message-ID: <9105101523.AA11631@genbank.bio.net> Date: 10 May 91 15:19:00 GMT Sender: daemon@genbank.bio.net Lines: 10 My name is C.Patricia Obando and would like to suscribe to your newsgroup. My field is Physical Anthropology, and currently I am working on my dissertation project. The project deals with protein extraction and protein analysis from ancient human skeletal remains, especifically DNA analysis and identification using restriction enzymes. Any information related to my field will be certaintly very useful. Sincerely yours Patricia Obando CAL/MSC Smithsonian Institution, Washington D.C. From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!SIMSC.BITNET!HIDEW From: HIDEW@SIMSC.BITNET Newsgroups: bionet.molbio.proteins Subject: Surface Prediction Message-ID: <9110191925.AA13696@genbank.bio.net> Date: 19 Oct 91 19:24:00 GMT Sender: daemon@genbank.bio.net Distribution: bionet Lines: 18 I am seeking a surface prediction program that will run on VMS or PC or MAC. preferably the latter. I am aiming to correlate surface predictions with conservation across taxa. Any one know of a workable program that will do surface predictions? (from aa seuqnce of course). Thanks in advance. Win Hide Laborator of molecular systematics Smithsonian Istitution Washington D.C. 301 238 3444 hidew@simsc (bitnet) From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!ICNUCEVM.CNUCE.CNR.IT!COOKE%FRPERP51 From: COOKE%FRPERP51@ICNUCEVM.CNUCE.CNR.IT Newsgroups: bionet.molbio.proteins Subject: HCA analysis Message-ID: <9106210650.AA23156@genbank.bio.net> Date: 21 Jun 91 07:54:23 GMT Sender: daemon@genbank.bio.net Distribution: bionet Lines: 11 Greetings, Does anybody know of a hydrophobic cluster analysis programme (preferably, but not necessarily, pd and preferably, but not necessarily, Mac) available by server or other ftp. We'd be very grateful! Monique Raynal Replies to COOKE@FRPERP51.BITNET From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!RULGL.LEIDENUNIV.NL!BMGHOEK From: BMGHOEK@RULGL.LEIDENUNIV.NL Newsgroups: bionet.molbio.proteins Subject: ACTH structure wanted Message-ID: <9105061846.AA16594@genbank.bio.net> Date: 6 May 91 14:53:00 GMT Sender: daemon@genbank.bio.net Lines: 15 I'am looking for crystallographic data for the human ACTH. At present I have been unable to locate any data in the well-known data- banks. Is there anyone who can help me ? I am looking for the structure of the entire 39-aa hormone ! Thanx, peter van Veelen, Gorlaeus Labs, Leiden University, Dept. of Analytical Chemistry PO Box 9502 NL-2300 RA Leiden, Neth. Phone +31-71-274321 E-mail via bmgsluis@rulgl.LeidenUniv.nl From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!apple!decwrl!mcnc!borg!hatteras!wright From: wright@hatteras.cs.unc.edu (Bill Wright) Newsgroups: bionet.molbio.proteins,bionet.general,sci.bio.technology,sci.bio Subject: Molecular Graphics Society Conference Message-ID: <3666@borg.cs.unc.edu> Date: 3 May 91 20:44:14 GMT Sender: news@cs.unc.edu Followup-To: poster Lines: 348 Xref: bionet bionet.molbio.proteins:108 bionet.general:1092 sci.bio.technology:98 sci.bio:2640 MOLECULAR GRAPHICS SOCIETY INTERNATIONAL MEETING May 13-17, 1991 GENERAL INFORMATION PURPOSE The Molecular Graphics Society sponsors an annual conference that provides a platform for disseminating the latest developments in computer-aided molecular study and design. THE AUDIENCE The presentations and discussions among participants should be of interest to all those involved in the investigation of molecular structure, function. The meeting will offer a forum for detailed appraisal of the techniques and technologies of computer graphics as applied to the field of molecular modeling. OVERVIEW The conference technical program will consist of invited speakers, contributed papers, and posters. There will be technical exhibits by commercial vendors of molecular graphics hardware and software. The remainder of the program includes continental breakfast each morning, refreshment breaks and lunch each day, an evening reception to open the conference on Monday evening, a barbecue on Tuesday evening and a conference dinner on Thursday evening. A sightseeing program for participants' guests is planned. There is a reservation form for sightseeing. There will be an additional charge for this program. LOCATION The conference will take in Chapel Hill, North Carolina, on the campus of The University of North Carolina. Chapel Hill is a small community of about 40,000. In May the weather is usually very pleasant with daytime temperatures in the upper 70s and nighttime lows in the 60s; however, you should be prepared for a shower. The University of North Carolina is one vertex of North Carolina's Research Triangle (Raleigh, Durham, Chapel Hill) in the center of which is the Research Triangle Park and the Raleigh-Durham Airport. The conference will open with a reception on Monday evening, May 13. All technical sessions will be held in Hanes Art Center Auditorium on the University campus. Meals will be served at the Carolina Inn. CONFERENCE REGISTRATION The registration fee for members of the Molecular Graphics Society is $275. For non-members, the registration fee is $300. The registration fee includes conference registration, reception, refreshment breaks, lunches, the barbecue and the conference dinner. .Full time students need not pay a registration fee; however.if students wish to purchase tickets to lunches, the barbecue, and the conference dinner, these may be purchased separately (see registration form). Students who have already paid a registration fee will have the amount of the fee refunded. We will make every effort to work with our caterers to honor any special dietary needs expressed on your registration form. Although we would prefer to receive your registration in advance either by mail, email or fax, on-site registration is possible. ACCOMMODATIONS Hotel arrangements are to be handled by the individual directly with the conference hotels. Blocks of rooms have been reserved at two nearby hotels and at a student dormitory. One block of rooms is at the Carolina Inn, located about a block away from Hanes Auditorium, site of the conference. Another block of rooms has been reserved at the Omni Europa several miles away. Transportation will be provided from the Omni Europa to the conference site. A third block of rooms has been reserved at Granville Towers dormitory two blocks from Hanes Auditorium. Room reservation forms giving all pertinent details are included in this conference announcement TRANSPORTATION The local airport is Raleigh-Durham International (RDU). American Airlines is the official carrier for the Molecular Graphics Society International Conference, offering special fares to North American conferees: 5% saving off published excursion fare with the US, or 40% (Canada 35%) off the full coach fare with a 7-day advance purchase valid from May 12- 19, 1991. Call 1-800-433-1790 and refer to STAR FILE S/151GC to obtain the discount. For transportation to the Carolina Inn, contact LTD Services. LTD operates by reservation. In order to be picked up, call LTD (1-800-432-8008 or 919-840-1829) at least one day in advance and give the time, flight number and airline you will arrive on. You may call after you arrive but you may have a substantial wait. When you arrive at the airport, go to the Customer Service Booth and obtain a voucher. The cost with voucher is $10.00 per person. The Omni Europa provides complimentary transportation from the airport for all hotel guests. These arrangements should be made directly with their reservations office. Taxis, which you can take to any location in Chapel Hill for about $25.00, are generally waiting outside the airport terminals. INVITED SPEAKERS Jurgen Brickmann, Technische Hochschule-Darmstadt, "Interactive Manipulation of Solid Molecular Models" Bruce Bush, Merck "Visualizing the Role of Dielectric Solvation in Ligand-protein Binding" Andrew Dearing, Shell UK Research Laboratory "The State of Computer-Assisted Molecular Design in the Early 90s" Robert Langridge, University of California-San Francisco, "Molecular Image Representations and their Uses" Rod Hubbard, York University, "How Far Can You Go?" James Milner-White, University of Glasgow, "Employing Hydrogen Bond Information to Provide More Informative Displays of Whole Proteins" Edward Tufte, Yale University "Envisioning Information" Hideaki Umeyama, Kitasato University-Tokyo "Predictive Contribution of Protein Engineering and Computer Graphics for Drug Design" CONTRIBUTED PAPERS "A New Approach to the Rapid Determination of Protein Side- chain Conformations: Implications for the Analysis of Side- Chains Connectivity" P. Tuffery & S. Hazout, Universit de Paris & C. Etchebast & R. Lavery, Institut de Biologie Physico-Chemique "Automated Site-Directed Drug Design Using Molecular Lattices," Richard Lewis, Imperial Cancer Research Fund & Diana Roe & Irwin Kuntz, University of California-San Francisco "HINT: Graphical Visualization of Molecular Hydrophobicity and Hydrophobic Interactions in Proteins and Small Molecules," Glenn Kellogg, Medical College of Virginia "Sculpt: Interactive Manipulation of Proteins while Modeling Atomic Forces," Mark Surles, University of North Carolina at Chapel Hill "Interactive Computation and Display of Molecular Surfaces,"T.J. O'Donnell, O'Donnell Associates "Computer Animation of Photosynthesis," Nelson Max, Lawrence Livermore National Lab. "A Visual Protein Crystallographic Software System for Xview," Duncan McRee, Scripps Clinic "A Language for Molecular Visualization," Thomas Palmer, Cray Research, Inc. "FLIMMSY-A Flexible Visualization Tool for Use on UNIX Workstations," Nigel Richards & Stephen Chamberlin, University of Florida "Shape Analysis of Protein Surfaces," Bruce Duncan & Arthur Olson, Scripps Clinic Cavity Search: An Algorithm for the Isolation and Display of Cavity-Like Binding Regions,"Chris Ho & Garland Marshall, Washington University "Exhaustive Search for Optimal Shape Complementarity of Molecular Surface Sections," Anne Badel & Serge Hazout, INSERM & Jean Paul Mornon, CNRS "The Conformational Analysis of Flexible Molecules Within Macromolecular Receptor Sites," Andrew Leach, Robert Langridge & Irwin Kuntz, University of California-San Francisco "Computer Simulation of Substrate Docking and Diffusion," David Goodsell & Arthur Olson, Scripps Clinic "Prediction of Antibody-Antigen Docking by a Parallel Global Search,"P.H. Walls & M.J.E. Sternberg, Imperial Cancer Research Fund "Probing Active Site Surfaces: A 'Groping' Experience," Vivian Cody, Medical Foundation of Buffalo PROGRAM COMMITTEE Chairman Mike Pique, Scripps Clinic Committee Russ Athay, Biosym Technologies Mike Carson, University of Alabama-Birmingham Michael Connolly, New York University Tom Ferrin, University of California-San Francisco Mike Hann, Glaxo Akiko Itai, University of Tokyo John McAllister, Tripos Associates Jean Paul Mornon, Universites de Paris VI et VII Haruki Nakamura, Protein Engineering Research Institute Jane Richardson, Duke University Hikeaki Umeyama, Kitasato Universtiy Jacques Weber,University of Geneva Shoshana Wodak, Universit Libre de Bruxelles Conference Chairman Frederick P. Brooks, Jr., University of North Carolina-Chapel Hill HOTEL RESERVATIONS Please make reservations directly with the hotel and refer to the Molecular Graphics Conference CAROLINA INN PO Box 1100, Chapel Hill, NC 27514 Group 1402 919-933-2001 or 1-800-962-8519 fax to 919-962-3400 Circle desired accommodation: single $42-65 double $52-80 Guest Name____________________________________ Address_______________________________________ _______________________________Phone__________ Arrival________________Departure______________ Share with____________________________________ Reservations will be held until 6:00 pm on arrival date unless a one night deposit is received or is guaranteed with American Express, Visa, or Mastercard.. Card name ______________________Exp. date ______ Card number ____________________________________ Signature ______________________________________ OMNI EUROPA 1 Europa Drive, Chapel Hill 27514 919-968-4900 or 800-334-4280 In making your reservations, please refer to the Molecular Graphics Conference. Circle desired accommodation: single $65 double $70 Guest Name____________________________________ Address_______________________________________ _______________________________Phone__________ Arrival________________Departure______________ Share with ___________________________________ Reservations will be held until 6:00 pm on arrival date unless a one night deposit is received or is guaranteed with a credit card. Card name ______________________Exp. date ______ Card number ____________________________________ Signature ______________________________________ GRANVILLE TOWERS DORMITORY University Square Chapel Hill, NC 27514 919-929-7143 In making your reservations, please refer to the Molecular Graphics Conference. Rooms have 2 twin beds with bath shared with others in adjoining room. The rate is $36.72 per room per day. Complete payment is required in advance. Check type of accommodation: ___Double-2 people in twin room ___Single-1 person in twin room ___Male ___Female Guest Name____________________________________ Address_______________________________________ _______________________________Phone__________ Arrival________________Departure______________ Share with ___________________________________ SIGHTSEEING TOURS REGISTRATION The region around Chapel Hill offers excellent opportunities to study the history of the region, to sample regional crafts, and to shop. We have outlined three tours for any family members or guests who would like to enjoy our countryside. The cost listed is for the tour only and does not include the cost of lunch. Please check the tours you are registering for in the space provided. These tours are designed for guests accompanying meeting participants and take place during the technical sessions. Group Tours Date Description Cost __ Tues., May 14 Tour of Hillsborough 10:00 am-3:00 pm Historic District $ 4.00 Lunch at Colonial Inn or Regulator Cafe Tour of Duke Gardens and campus __ Wed., May 15 Tour of Old Salem $15.00 8:30 am-5:00 pm Lunch at Salem Tavern Tour of Museum of Southern Decorative Arts __ Thurs., May 16 Alamance Battleground no cost 10:00 am-3:00 pm and colonial farmhouse Fearrington Village (shops and pottery) Drive through countryside TOTAL COST OF TOURS $______ (transfer total to registration form) Guest's name ___________________________________ (for name badge) (please print) Individual Tours You may prefer to rent a car and sightsee on your own. We will have brochures available to describe some of the options. Below are several suggestions: *Shopping at the Burlington Outlets (name brand merchandise at a discounted price) *North Carolina Art Museum in Raleigh *Seagrove and Jugtown potteries (about 40 different potters) *Shopping malls MGS conference participants' guests are also invited to attend the barbecue on Tuesday, May 14, from 6:00-9:00 pm at an additional cost of $15.00 and the conference dinner on Thursday, May 16, from 7:00-9:00 pm at an additional cost of $30.00. Please register for these on the conference registration form. CONFERENCE REGISTRATION Please print or type the following information: Name (for badge) _______________________________ Affiliation (for badge) ________________________ Address ________________________________________ ________________________________________________ Phone _________________ Email __________________ MGS member? Yes __________ No_______________ Total Member $275 $ ______ Non-member $300 $ ______ Student $0 $_______ Additional lunch tickets Tues.-Fri _____x $50 = $_______ Additional barbecue tickets _____x $15.= $________ Additional conference dinner tickets ____ x $30 = $ _______ Sightseeing tour(s) cost $ _______ Total amount due $________ Please make check or money order payable (in US currency) to Molecular Graphics Conference. We cannot accept credit cards. Return to: Mary Ducker Molecular Graphics Conference CB #3175, Sitterson Hall University of North Carolina Chapel Hill, NC 27599-3175 USA 919-962-1869 FAX: 919-062-1799 email ducker@cs.unc.edu No refunds can be given after May 6, 1991. From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!THEORY.BCHS.UH.EDU!dbd From: dbd@THEORY.BCHS.UH.EDU (Dan Davison) Newsgroups: bionet.molbio.proteins Subject: Thanks and followup on di-tri gly-ser reference Message-ID: <9104182244.AA00305@theory.BCHS.UH.EDU> Date: 18 Apr 91 22:44:52 GMT Sender: daemon@genbank.bio.net Lines: 22 I'd like to thank all that responded to my request for a reference on alternating gly-ser runs in proteins. It appears that the protein I was remembering is the Drosophila _per_ gene product, and the motif has something to do with peptidoglycan proteins. The gly-ser protein in question if from "da worm" as it's know around here, Caenorhabitis (sp?) elegans. Especial thanks to: BI599023@brownvm.brown.edu cleaves@njmsa.umdnj.edu Keith.A.Johnson@mac.dartmouth.edu BAIROCH%cmu.unige.ch@pucc.PRINCETON.EDU JCJB@biology.cambridge.ac.uk When the researcher who asked the question is ready to reveal more, I will post to this group. Again, my thanks for the prompt replies! dan From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!uwm.edu!spool.mu.edu!sol.ctr.columbia.edu!bronze!cricket.bio.indiana.edu!gilbertd From: gilbertd@cricket.bio.indiana.edu (Don Gilbert) Newsgroups: bionet.molbio.proteins Subject: Re: rat codon frequency tables Message-ID: <1991Mar20.221406.26446@bronze.ucs.indiana.edu> Date: 20 Mar 91 22:14:06 GMT References: <9103202154.AA20653@gcg.com> Sender: news@bronze.ucs.indiana.edu (USENET News System) Organization: Biology, Indiana University - Bloomington Lines: 22 Posted: Wed Mar 20 16:14:06 1991 In article <9103202154.AA20653@gcg.com> dkatz@GCG.COM (Don Katz - Genetics Computer Group) writes: >> There is a tabulation in Nucleic Acids Research 14:r151-r197, 1986, which >> includes quite a number of species. I am not aware of any update on that >> tabulation. > >Most recent tabulation is Wada et al., Codon usage tabulated from the >GenBank genetic sequence data. NAR 18(suppl):2367-2411, 1990 To refresh our network memory, Mike Cherry has a more recent set of codon tables for 50 species available in useable, electronic form. Try anonymous ftp to: frodo.mgh.harvard.edu Codon usage tables for all major species 132.183.190.10 (GCG format) ( [.codon] ) Contact: Mike Cherry*, cherry@frodo.mgh.harvard.edu -- don -- Don Gilbert gilbert@bio.indiana.edu biocomputing office, biology dept., indiana univ., bloomington, in 47405 From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!news.cs.indiana.edu!samsung!rex!wupost!m.cs.uiuc.edu!ux1.cso.uiuc.edu!uxa.cso.uiuc.edu!klw11037 From: klw11037@uxa.cso.uiuc.edu (Kyle Leon Webb) Newsgroups: bionet.molbio.proteins Subject: Kabsch and Sander algorithm Message-ID: <1991Jul31.224225.12484@ux1.cso.uiuc.edu> Date: 31 Jul 91 22:42:25 GMT Sender: usenet@ux1.cso.uiuc.edu (News) Organization: University of Illinois at Urbana Lines: 9 I am looking for an computer program done by Kabsch and Sander, that is used to recognize protein secondary structure features ( alpha helices, beta sheets) given the xray coordinates of the residues. Is this available via ftp anywhere. I apologize if the above description is somewhat mangled, as I am not terribly well versed in protein crystalography. Kyle Webb Dept of Chemistry, University of Illinois (217) 333-8710 From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!gunbrf.bitnet!POSTMAST From: POSTMAST@gunbrf.bitnet Newsgroups: bionet.molbio.proteins Subject: Reposting of PIR FILESERVER Announcement Message-ID: <9103301745.AA06644@genbank.bio.net> Date: 30 Mar 91 16:43:00 GMT Sender: daemon@genbank.bio.net Lines: 210 Announcement of the Protein Identification Resource BITNET Network Request Service The National Biomedical Research Foundation Protein Identification Resource has a full-function network fileserver and database query system. This automatic network server, operating since August 1990, is capable of handling database queries, sequence searches and sequence submissions, in addition to fileserver requests. To use this server, request commands should be directed to FILESERV@GUNBRF on BITNET. The FILESERVer recognizes the following commands sent either in a mail message, or (if the sender is on BITNET) in command messages or in a file: Command Action ------- ----------------------------------------------- ACCESSION list entry codes and titles by accession number AUTHOR list entry codes and titles by author BASES list accessible databases DEPOSIT deposit entry for database submission END DEPOSIT terminate deposit entry GET return entry by entry code HELP return HELP instructions INDEX list SENDable files JOURNAL list entry codes and titles by journal citation KEYWORD list entry codes and titles by keyword RETURN change return address for gateway mail SEARCH search for sequence by FASTA procedure END SEARCH terminate sequence for searching SEND send file SPECIES list entry codes and titles by species SUGGEST leave suggestion for PIR staff END SUGGEST terminate suggestion text TITLE list entry codes and titles by title Multiple commands can be sent with one command on each line of a mail message or file. Commands should NOT be sent on the Subject line of a mail message. Receipt of command messages and files will be acknowledged immediately. Mail messages will be acknowledged by return mail. For help in using any of the commands, send a request of the form HELP topic for example HELP SEARCH In addition to the commands, help instructions are also available on the following topics: Gateway_Access IBM-VM_BITNET On-Line_Access VAX-VMS_BITNET Because of inter-network gateway communication protocols, there are limitations on requests sent through gateways. Users not on BITNET or INTERNET who will be accessing BITNET through local or inter-network gateways should read and carefully follow these instructions before sending requests. Only mail message requests (not command messages or files) can be sent through gateways. Because the addresses posted on gateway mail do not always work for the return, before you send requests through inter-network gateways it is strongly recommended that you first contact Dr. John S. Garavelli at POSTMASTER@GUNBRF on BITNET. We will confirm a return address for you and may instruct you to use the RETURN command to insure that your request output will reach you. It is not usually necessary to do this if you are on BITNET or INTERNET, unless your system employs a local remailer or your mail program applies a non-standard return address (for example a personal name on the FROM: line). The BITNET network and the inter-network gateways impose strict file size limits. Poorly posed database queries may result in output so extensive that it could not be returned by network mail. Therefore, an output limit of 1000 lines for each command and 3000 lines total for each request is imposed by the PIR FILESERVer. The DEPOSIT command must, and the SEARCH and SUGGEST commands may, be followed by their respective END commands when text appears on intervening lines. The DEPOSIT command requires, and the SEARCH command optionally uses, parameters that appear on the same line as the command. Because of the complexity of these commands, users should obtain and carefully read the help instructions on these commands before attempting to use them. Here is a brief synopsis of each server command. ACCESSION number This command will return a list of entry codes and titles for entries with accession numbers matching the left portion of the accession number provided. AUTHOR name This command will return a list of entry codes and titles for entries with an author matching the portion of the author name provided. BASES This command will return a list of the accessible databases and the number of entries each contains. Currently, this selection of databases cannot be changed during network access. The databases available and their abbreviations for code specification are as follows: Abbreviation Database Update Schedule PIR1 PIR Annotated and Classified Entries quarterly PIR2 PIR Preliminary Entries approximately bimonthly PIR3 PIR Unverified Entries weekly N NBRF Nucleic GB GenBank(TM) as received EMBL EMBL as received Access to these and additional databases can be provided to on-line users. DEPOSIT FORM or DEPOSIT AUTHORIN submission text END DEPOSIT This command will allow the submission of protein sequence entries prepared in a standard format. The PIR accepts submissions in the electronic version of the GenBank/EMBL/PIR Data Submission Form, or in the Transaction Protocol Format of the GenBank AUTHORIN program. This command MUST be followed on the same line by either FORM or AUTHORIN to indicate the type of deposit, and by the END DEPOSIT command at the end of the text of the entry. Only one DEPOSIT command should be sent with each request. A separate form must be submitted for each sequence. Forms with more than one sequence and requests with more than one DEPOSIT command cannot be accepted. It is important that nucleotide sequences including authors' protein sequence translations be submitted to only to GenBank or EMBL, as appropiate, and not to the PIR FILESERVer. GenBank and EMBL forward protein sequences to the PIR International with no further effort required on the part of the author. GET code This command will return the full text of an entry with the code matching the code provided. These codes are found in the lists returned by one of the search commands (ACCESSION, AUTHOR, JOURNAL, KEYWORD, SPECIES, or TITLE). The format of the code is a database abbreviation, a colon, and four to ten alphanumeric characters. INDEX This command will return a list of the files that can currently be sent by the PIR FILESERVER using the SEND command. JOURNAL citation This command will return a list of entry codes and titles for entries with a journal citation matching the portion of the citation provided. KEYWORD words This command will return a list of entry codes and titles for entries with any keyword, or portion of a keyword, matching the words provided. You may provide any number of groups of three or more alphanumeric characters expected in a single keyword entry. RETURN address If you are sending mail from a non-BITNET network through a gateway, you may need to provide a return address different from the one posted on the message in order for your output to be sent to you correctly. The RETURN command will allow you to correct your return address. SEARCH parameters sequence or SEARCH parameters sequence text END SEARCH This command will allow a sequence to be compared in a FASTA search (see W.R.Pearson & D.J. Lipman PNAS (1988) 85:2444-2448) with the PIR databases. You may send either protein or nucleotide sequences in the IUPAC standard single letter code; however,only the PIR protein sequence databases will be searched. Nucleotide sequences will be translated in six reading frames according to a selectable genetic code, and those translated protein sequences will be compared against the PIR protein sequence databases. The SEARCH command may be used in two forms, either on a single line with parameters and sequence, or on multiple lines with the parameters on the line with the SEARCH command, followed by lines with the sequence and an END SEARCH command on the line following the end of the sequence. There are two optional parameters for the SEARCH command, KTUP and NUC. The KTUP parameter sets the ktup value for the FASTA program. The NUC parameter specifies that the sequence is a nucleotide sequence, and can select the genetic code to be used for the translation of that sequence. SEND filename This command will instruct the FILESERVer to send, by separate electronic transmission, the specified file. A list of the currently available files can be obtained by using the INDEX command. SPECIES name This command will return a list of entry codes and titles for entries with the species matching the portion of a species name provided. The species name may be the Latin genus and/or species name, or a common name. Because the names of some viruses contain the common name of the host species, entry codes and titles for entries with the species of viruses infecting a species may also be listed. Please note: this is not an efficient command for performing a general query of the PIR databases especially with extensively studied species. For well-studied species, the TITLE command will be more efficient. SUGGEST text or SUGGEST text END SUGGEST This command will submit the text of your message to an NBRF staff member. You may use it to suggest modifications or improvements to our FILESERVER and PIR database services. You may either place the text on the same line with the SUGGEST command, or you may use any number of lines for the text followed by the END SUGGEST command on the line after the last line of the text. TITLE title This command will return a list of entry codes and titles for entries with any portion of a title matching the word provided. You may provide any number of groups of three or more alphanumeric characters expected in a single title. PIR titles include protein names, species names and Enzyme Commission numbers, consequently this command is generally the most efficient way to perform a general query of the PIR databases. ------------------------------------------------------------------------ Dr. John S. Garavelli Database Coordinator Protein Identification Resource National Biomedical Research Foundation Washington, DC 20007 POSTMASTER@GUNBRF.BITNET From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!PB3.CHM.BNL.GOV!ABOLA From: ABOLA@PB3.CHM.BNL.GOV Newsgroups: bionet.molbio.proteins Subject: BITNET connection to Georgetown University - PIR Message-ID: <910417143353.483@PB3.CHM.BNL.GOV> Date: 17 Apr 91 18:33:53 GMT Sender: daemon@genbank.bio.net Lines: 11 John Garavelli has requested that the following notice be circulated. __________________________________________________________________ The BITNET connection to Georgetown University - PIR has been down since April 4, 1991 due to problems in the University communications systems. The connection may be down for several days more From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!uwm.edu!caen!dali.cs.montana.edu!Msu2.oscs.montana.edu!uchkhmr From: uchkhmr@Msu2.oscs.montana.edu Newsgroups: bionet.molbio.proteins Subject: Consensus signal sequences Message-ID: <00949ABB.D7F9A0C0@Msu2.oscs.montana.edu> Date: 5 Jun 91 16:46:52 GMT Sender: usenet@dali.cs.montana.edu Reply-To: uchkhmr@Msu2.oscs.montana.edu Organization: Montana State University Lines: 6 I would appreciate any information, preferably the latest references, on signal peptide consensus sequences (i.e. specificity of signal peptidases). I am in the process of identifying a protein sequence based on cDNA structure. Please respond to BITNET "UCHKHMR@MTSUNIX1". Thanks! From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!WFEB2.BITNET!MACRIDES From: MACRIDES@WFEB2.BITNET (Foteos Macrides) Newsgroups: bionet.molbio.proteins Subject: Re: software to locate given amino acid composition in sequence Message-ID: <9110301632.AA04859@genbank.bio.net> Date: 30 Oct 91 17:31:00 GMT Sender: daemon@genbank.bio.net Distribution: bionet Lines: 22 >In article lfk@eastman1.mit.edu (Lee F. >Kolakowski) writes: >>Is this just VMS software ported to Unix, or does the new GCG do things >>in a more Unix style like using pipes, standard-in and out? >> > >GCG programs and command/menu syntax is the same on both systems (with >a few exceptions like "-" versus "/" command-line switches). File >handling syntax on Unix is Unix (e.g., case sensitive). >-- >Don Gilbert gilbert@bio.indiana.edu >biocomputing office, biology dept., indiana univ., bloomington, in 47405 What about on-line help (GENHELP & GENMANUAL)? Is it MAN-like or VMS_HELP-like? Fote ========================================================================= Foteos Macrides Worcester Foundation for Experimental Biology MACRIDES@WFEB2.BITNET 222 Maple Avenue, Shrewsbury, MA 01545 ========================================================================= From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!gunbrf.bitnet!POSTMAST From: POSTMAST@gunbrf.bitnet Newsgroups: bionet.molbio.proteins Subject: PIR Network Server Announcement Message-ID: <9108010710.AA01734@genbank.bio.net> Date: 1 Aug 91 07:07:00 GMT Sender: news@genbank.bio.net Distribution: bionet Lines: 261 Announcement of the Protein Identification Resource BITNET Network Request Service Five commands and access to two new sequence databases have been added to the network request service. The new commands are FEATURE, HOST, QUIT, SUPERFAMILY and TAXONOMY. They are described below in more detail. The two new databases are NRL_3D which contains the sequence information extracted from the Brookhaven Protein Data Bank, and GBNEW which contains the weekly update sequences from GenBank (TM). These databases are automatically available through all the commands that can use them. The National Biomedical Research Foundation Protein Identification Resource has a full-function network fileserver and database query system. This automatic network server, operating since August 1990, is capable of handling database queries, sequence searches and sequence submissions, in addition to fileserver requests. To use this server, request commands should be directed to FILESERV@GUNBRF on BITNET. The FILESERVer recognizes the following commands sent either in a mail message, or (if the sender is on BITNET) in command messages or in a file: Command Action ------- ----------------------------------------------- ACCESSION list entry codes and titles by accession number AUTHOR list entry codes and titles by author BASES list accessible databases DEPOSIT deposit entry for database submission END DEPOSIT terminate deposit entry FEATURE list entry codes and titles by feature table entry GET return entry by entry code HELP return HELP instructions HOST list entry codes and titles by host species INDEX list SENDable files JOURNAL list entry codes and titles by journal citation KEYWORD list entry codes and titles by keyword QUIT ignore the remaining text (E-mail signature blocks) RETURN change return address for gateway mail SEARCH search for sequence by FASTA procedure END SEARCH terminate sequence for searching SEND send file SPECIES list entry codes and titles by species SUGGEST leave suggestion or correction for PIR staff END SUGGEST terminate suggestion text SUPERFAMILY list entry codes and titles by superfamily name TAXONOMY report taxonomy for scientific or common name TITLE list entry codes and titles by title Multiple commands can be sent with one command on each line of a mail message or file. Commands should NOT be sent on the Subject line of a mail message. Receipt of command messages and files will be acknowledged immediately. Mail messages will be acknowledged by return mail. For help in using any of the commands, send a request of the form HELP topic for example HELP SEARCH In addition to the commands, help instructions are also available on the following topics: Gateway_Access IBM-VM_BITNET On-Line_Access VAX-VMS_BITNET Because of inter-network gateway communication protocols, there are limitations on requests sent through gateways. Users not on BITNET or INTERNET who will be accessing BITNET through local or inter-network gateways should read and carefully follow these instructions before sending requests. Only mail message requests (not command messages or files) can be sent through gateways. Because the addresses posted on gateway mail do not always work for the return, before you send requests through inter-network gateways it is strongly recommended that you first contact Dr. John S. Garavelli at POSTMASTER@GUNBRF on BITNET. We will confirm a return address for you and may instruct you to use the RETURN command to insure that your request output will reach you. It is not usually necessary to do this if you are on BITNET or INTERNET, unless your system employs a local remailer or your mail program applies a non-standard return address (for example a personal name on the FROM: line). The BITNET network and the inter-network gateways impose strict file size limits. Poorly posed database queries may result in output so extensive that it could not be returned by network mail. Therefore, an output limit of 1000 lines for each command and 3000 lines total for each request is imposed by the PIR FILESERVer. The DEPOSIT command must, and the SEARCH and SUGGEST commands may, be followed by their respective END commands when text appears on intervening lines. The DEPOSIT command requires, and the SEARCH command optionally uses, parameters that appear on the same line as the command. Because of the complexity of these commands, users should obtain and carefully read the help instructions on these commands before attempting to use them. Here is a brief synopsis of each server command. ACCESSION number This command will return a list of entry codes and titles for entries with accession numbers matching the left portion of the accession number provided. AUTHOR name This command will return a list of entry codes and titles for entries with an author matching the portion of the author name provided. BASES This command will return a list of the accessible databases and the number of entries each contains. Currently, this selection of databases cannot be changed during network access. The databases available and their abbreviations for code specification are as follows: Abbreviation Database Update Schedule PIR1 PIR Annotated and Classified Entries quarterly PIR2 PIR Preliminary Entries approximately bimonthly PIR3 PIR Unverified Entries weekly NRL_3D Brookhaven Data Bank Sequences quarterly N NBRF Nucleic GB GenBank (TM) as received GBNEW GenBank (TM) New Entries weekly EMBL EMBL as received Access to these and additional databases can be provided to on-line users. DEPOSIT FORM or DEPOSIT AUTHORIN submission text END DEPOSIT This command will allow the submission of protein sequence entries prepared in a standard format. The PIR accepts submissions in the electronic version of the GenBank/EMBL/PIR Data Submission Form, or in the Transaction Protocol Format of the GenBank AUTHORIN program. This command MUST be followed on the same line by either FORM or AUTHORIN to indicate the type of deposit, and by the END DEPOSIT command at the end of the text of the entry. Only one DEPOSIT command should be sent with each request. A separate form must be submitted for each sequence. Forms with more than one sequence and requests with more than one DEPOSIT command cannot be accepted. It is important that nucleotide sequences including authors' protein sequence translations be submitted to only to GenBank or EMBL, as appropiate, and not to the PIR FILESERVer. GenBank and EMBL forward protein sequences to the PIR International with no further effort required on the part of the author. FEATURE feature-name This command will return a list of entry codes and titles for entries in the PIR databases only with an entry in the feature table matching the portion of the feature name provided. A list of the features currently in the database can be obtained by the command SEND FEATURES. GET code This command will return the full text of an entry with the code matching the code provided. These codes are found in the lists returned by one of the search commands (ACCESSION, AUTHOR, JOURNAL, FEATURE, HOST, KEYWORD, SPECIES, SUPERFAMILY or TITLE). The format of the code is a database abbreviation, a colon, and four to ten alphanumeric characters. HOST host-name This command will return a list of entry codes and titles for entries in the PIR databases only with a host name matching the portion of the host name provided. INDEX This command will return a list of the files that can currently be sent by the PIR FILESERVER using the SEND command. JOURNAL citation This command will return a list of entry codes and titles for entries with a journal citation matching the portion of the citation provided. KEYWORD words This command will return a list of entry codes and titles for entries with any keyword, or portion of a keyword, matching the words provided. You may provide any number of groups of three or more alphanumeric characters expected in a single keyword entry. QUIT If you use a mail program which automatically attaches a signature block to every message, use this command to inform the server that all the following lines should be ignored. RETURN address If you are sending mail from a non-BITNET network through a gateway, you may need to provide a return address different from the one posted on the message in order for your output to be sent to you correctly. The RETURN command will allow you to correct your return address. SEARCH parameters sequence or SEARCH parameters sequence text END SEARCH This command will allow a sequence to be compared in a FASTA search (see W.R.Pearson & D.J. Lipman PNAS (1988) 85:2444-2448) with the PIR databases. You may send either protein or nucleotide sequences in the IUPAC standard single letter code; however,only the PIR protein sequence databases will be searched. Nucleotide sequences will be translated in six reading frames according to a selectable genetic code, and those translated protein sequences will be compared against the PIR protein sequence databases. The SEARCH command may be used in two forms, either on a single line with parameters and sequence, or on multiple lines with the parameters on the line with the SEARCH command, followed by lines with the sequence and an END SEARCH command on the line following the end of the sequence. There are two optional parameters for the SEARCH command, KTUP and NUC. The KTUP parameter sets the ktup value for the FASTA program. The NUC parameter specifies that the sequence is a nucleotide sequence, and can select the genetic code to be used for the translation of that sequence. SEND filename This command will instruct the FILESERVer to send, by separate electronic transmission, the specified file. A list of the currently available files can be obtained by using the INDEX command. SPECIES name This command will return a list of entry codes and titles for entries with the species matching the portion of a species name provided. The species name may be the Latin genus and/or species name, or a common name. Because the names of some viruses contain the common name of the host species, entry codes and titles for entries with the species of viruses infecting a species may also be listed. Please note: this is not an efficient command for performing a general query of the PIR databases especially with extensively studied species. For well- studied species, the TITLE command will be more efficient. SUGGEST text or SUGGEST text END SUGGEST This command will submit the text of your message to an NBRF staff member. You may use it to suggest modifications or improvements to our FILESERVER or corrections to the PIR database. You may either place the text on the same line with the SUGGEST command, or you may use any number of lines for the text followed by the END SUGGEST command on the line after the last line of the text. SUPERFAMILY superfamily-name This command will return a list of entry codes and titles for entries in the PIR databases only which belong to that superfamily. Since the domains of some multidomain proteins are not completely classified, the SUPERFAMILY command will not necessarily produce a complete list of all entries in a specific superfamily. A list of the superfamilies currently in the database can be obtained by the command SEND SUPERFAM. TAXONOMY taxonomic-name or TAXONOMY common-name This command will report taxonomies for entries in the taxonomic database currently being used by the PIR and shared with GenBank (TM) and EMBL. This database is maintained by Dr. Andrzej Elzanowski at the Max-Planck- Institut fur Biochemie. You should provide a fully or partially specified name of 1 to 8 words with a minimum length of 3 letters each. Names at all taxonomic levels containing those words will be reported. The organelles containing genetic material of some higher organisms also have entries in this database. TITLE title This command will return a list of entry codes and titles for entries with any portion of a title matching the word provided. You may provide any number of groups of three or more alphanumeric characters expected in a single title. PIR titles include protein names, species names and Enzyme Commission numbers, consequently this command is generally the most efficient way to perform a general query of the PIR databases. ------------------------------------------------------------------------ Dr. John S. Garavelli Database Coordinator Protein Identification Resource National Biomedical Research Foundation Washington, DC 20007 POSTMASTER@GUNBRF.BITNET From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!uwm.edu!ux1.cso.uiuc.edu!director.beckman.uiuc.edu!goldman From: goldman@director.beckman.uiuc.edu (Goldman) Newsgroups: bionet.molbio.proteins Subject: scuba diving Summary: write for diving info Keywords: scuba Message-ID: <1991May19.031301.17124@ux1.cso.uiuc.edu> Date: 19 May 91 03:13:01 GMT Sender: usenet@ux1.cso.uiuc.edu (News) Organization: University of Illinois at Urbana Lines: 3 anyone interested in diving info/groups e-mail and i will follow up. --rgg From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!grimbb.bitnet!WARREN From: WARREN@grimbb.bitnet Newsgroups: bionet.molbio.proteins Subject: Info about E coli VisC Message-ID: <9109161804.AA03361@genbank.bio.net> Date: 16 Sep 91 19:00:00 GMT Sender: daemon@genbank.bio.net Distribution: bionet Lines: 24 Dear Netters, In a recent homology search I pulled out of the PIR database the sequence for the E coli VisC gene. Unfortunately the entry (JQ0845) gives no information on the gene function, and although it lists the authors names (Nakahigashi, K., Miyamoto, K., Nishimura, K., and Inokuchi, H.) it does not give a journal reference nor the authors address. So I was wondering if anyone out there might know: 1) Anything about the E. coli VisC gene product OR 2) An address (electronic or snail) for any of the authors ************************************************************************ Bill Warren Tel -30-81-21-2647 IMBB Insect Group FAX -30-81-23-1308 PO Box 1527 Heraklion, 711 10 E-Mail WARREN@NEFELH.CC.UCH.GR Crete, GREECE ************************************************************************ From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!lhc!nih-csl!helix.nih.gov!donnel From: donnel@helix.nih.gov (Donald A. Lehn) Newsgroups: bionet.molbio.proteins Subject: NIH Database Message-ID: <1168@nih-csl.nih.gov> Date: 3 Apr 91 20:27:41 GMT Sender: news@nih-csl.nih.gov Distribution: bionet.molbio.proteins bionet.molbio.swiss-prot bionet.molbio.yeast Organization: National Institutes of Health, Bethesda Lines: 37 To all networked researchers: I am in the process of putting together an NIH research proposal for a grant to establish a national net accessible NIH database. This database would be accessible by anonymous FTP by anyone on this network. The data base would contain amung other things: 1. Detailed experimental protocols. 2. Listings of sources of reagents, vectors, and any other materials, both commercial and from individuals, that may be needed by NIH researchers. 3. Information on grants. What grants are avaliable. Help files. And a listing of the current grants and contracts. 4. A job bank. 5. Software developed by NIH researchers who wish to have others share in it use. If you are interested in seeing such a database established please send me an E-mail message indicating such. Also please state what other types of data you would like to see included in such a database. Since I plan on using these replies in my grant application, please be sure to include your full name, position, affiliation and phone number in your response. Thanking you in advance, Donald A. Lehn National Cancer Institute National Institutes of Health Bethesda, MD 20892 Pnone: (301) 496-2885 FAX: (301) 468-8419 E-mail: donnel@helix.nih.gov From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!rutgers!cs.utexas.edu!sdd.hp.com!zaphod.mps.ohio-state.edu!casbah.acns.nwu.edu!ucsd!scripps!riscsm!bashford From: bashford@scripps.edu (Don &) Newsgroups: bionet.molbio.proteins Subject: Re: Surface Prediction Message-ID: Date: 23 Oct 91 18:33:47 GMT References: <9110191925.AA13696@genbank.bio.net> Sender: news@Scripps.EDU Distribution: bionet Organization: Scripps Research Institute, La Jolla, CA, USA Lines: 35 In-reply-to: HIDEW@SIMSC.BITNET's message of 19 Oct 91 19:24:00 GMT >>>>> On 19 Oct 91 19:24:00 GMT, HIDEW@SIMSC.BITNET said: HIDEW> I am seeking a surface prediction program that will run on VMS or PC or MAC. HIDEW> preferably the latter. I am aiming to correlate surface predictions with HIDEW> conservation across taxa. HIDEW> Any one know of a workable program that will do surface predictions? HIDEW> (from aa seuqnce of course). I'm not sure what you mean by "surface predictions", but you may be interested in a paper by myself, Cyrus Chothia and Arthur Lesk, J. Mol. Biol. vol. 196, pp 199-216 (1987). It describes a sequence template characterizing the globin family which includes some unexpected conservation rules at surface sites. I can make the computer program and templates available to you. They are written in C and, in older versions, ran on a VAX, but now run on Unix. They could probably be re-ported to the VAX without too much trouble, although I understand the VAX C compiler is buggy. HIDEW> Win Hide HIDEW> Laborator of molecular systematics HIDEW> Smithsonian Istitution HIDEW> Washington D.C. HIDEW> 301 238 3444 HIDEW> hidew@simsc (bitnet) Donald Bashford Department of Molecular Biology The Scripps Research Institute 10666 North Torrey Pines Road La Jolla, CA 92037 USA From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!news.miami.edu!ncar!asuvax!cs.utexas.edu!wupost!micro-heart-of-gold.mit.edu!uw-beaver!ubc-cs!unixg.ubc.ca!kakwa.ucs.ualberta.ca!sherlock.mmid.ualberta.ca!lnds From: userisra@mts.ucs.ualberta.ca (Mark Israel) Newsgroups: sci.chem,comp.graphics.visualization,bionet.software,bionet.molbio.proteins Subject: Molecular dynamics for interpolation? Message-ID: <1991Nov27.221748.936@kakwa.ucs.ualberta.ca> Date: 27 Nov 91 22:17:48 GMT Sender: userisra@mts.ucs.ualberta.ca Organization: University of Alberta, Edmonton, Canada Lines: 21 Xref: bionet sci.chem:4836 comp.graphics.visualization:1243 bionet.software:1559 bionet.molbio.proteins:201 Originator: lnds@sherlock.mmid.ualberta.ca Nntp-Posting-Host: sherlock.mmid.ualberta.ca I am trying to make a video of a protein unfolding. What I have to work from is "snapshot" coordinate sets ("artist's conceptions") of the protein in various stages of unfolding. I would like to interpolate between these snapshots in a biochemically realistic fashion. (Previously I tried interpolating "naively" with splines, but the motion was not convincing.) Therefore I have been doing molecular dynamics with Axel Br"unger's X-PLOR package. I can get from one snapshot to the next all right, but I can't get there in a smooth fashion. The RMS shift between one output frame and the next varies wildly; it depends generally on the harmonic term, but it's too erratic for me to control it. Can anyone point me to alternative software -- a molecular dynamics package with which I *could* restrain the RMS shift? Any suggestions would be appreciated. Mark Israel I have heard the Wobble! userisra@mts.ucs.ualberta.ca From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!news.cs.indiana.edu!spool.mu.edu!agate!ames!lll-winken!aunro!alberta!kakwa.ucs.ualberta.ca!news From: Chris_Upton@darwin.biochem.ualberta.ca Newsgroups: bionet.molbio.proteins Subject: Protein Structure Display Message-ID: <1991Nov29.004339.752@kakwa.ucs.ualberta.ca> Date: 29 Nov 91 00:43:39 GMT Sender: news@kakwa.ucs.ualberta.ca Organization: University of Alberta Lines: 17 Nntp-Posting-Host: mac8.biochem.ualberta.ca Hi, I looking for a program that will display protein structures on a Sparc2. I don't need to do anything fancy just look at the structures and twirl them around! I tried the demo version of Mac-Mimic, worked great but was very slow (unusable) for a 300 aa protein when using a Mac IIcx. I guess it was meant for the new fast-macs! Thanks, Chris Upton Chris_Upton@darwin.biochem.ualberta.ca Biochemistry University of Alberta Edmonton Alberta From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!biochemistry.oxford.ac.uk!rbr From: rbr@biochemistry.oxford.ac.uk (Rob Russell) Newsgroups: bionet.molbio.proteins Subject: Protein Structure Display Message-ID: <13071.9111291432@biochemistry.oxford.ac.uk> Date: 29 Nov 91 14:32:46 GMT Sender: daemon@genbank.bio.net Distribution: bionet Lines: 18 Chris Upton (Chris_Upton@ca.ualberta.biochem.darwin) writes: > I looking for a program that will display protein structures on a Sparc2. >I don't need to do anything fancy just look at the structures and twirl them >around! We obtained a program called `nseqtool' from the EMBL file server (just send a message saying `help' to netserv@de.embl-heidleberg). The program allows you to twirl 3D structures in stereo on a sparcstation, in addition to all sorts of fancy things with sequence alignments (ie. in conjunction with the structure). Robert Russell Laboratory of Molecular Biophysics Oxford, U.K. rbr@uk.ac.ox.bioch From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!PUCC.PRINCETON.EDU!SCHWA003%DUKEMC From: SCHWA003%DUKEMC@PUCC.PRINCETON.EDU Newsgroups: bionet.molbio.proteins Subject: subscription Message-ID: <9104052010.AA18818@genbank.bio.net> Date: 5 Apr 91 18:58:00 GMT Sender: daemon@genbank.bio.net Lines: 13 Received: and processed by DEMPO version 4.6 To: DEMPO!BITNET::"PROTEINS@IRLEARN" From: SCHWA003 "SCHWARTZBACH, CARYL J PH.D. " Received by DEMPO: Fri Apr 5 14:57:05 1991 From: CANCTR::CJS 5-APR-1991 14:56:36.20 To: DEMPO!BITNET::"proteins@irlearn" CC: Subj: subscription ----------------------------------------------------------------- SUB PROTEINS Caryl J. Schwartzbach From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!GCG.COM!dkatz From: dkatz@GCG.COM (Don Katz - Genetics Computer Group) Newsgroups: bionet.molbio.proteins Subject: Re: rat codon frequency tables Message-ID: <9103202154.AA20653@gcg.com> Date: 20 Mar 91 21:54:03 GMT Sender: daemon@genbank.bio.net Lines: 6 > There is a tabulation in Nucleic Acids Research 14:r151-r197, 1986, which > includes quite a number of species. I am not aware of any update on that > tabulation. Most recent tabulation is Wada et al., Codon usage tabulated from the GenBank genetic sequence data. NAR 18(suppl):2367-2411, 1990 From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!hyatt!prasher From: prasher@hyatt (Doug Prasher) Newsgroups: bionet.molbio.proteins Subject: Test of mail Message-ID: <9109041751.AA00160@hyatt.WHOI.EDU> Date: 4 Sep 91 17:51:46 GMT Sender: daemon@genbank.bio.net Distribution: bionet Lines: 1 From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!uwm.edu!wupost!micro-heart-of-gold.mit.edu!bloom-beacon!bloom-picayune.mit.edu!18.70.0.226!lfk From: lfk@eastman1.mit.edu (Lee F. Kolakowski) Newsgroups: bionet.molbio.proteins Subject: Re: software to locate given amino acid composition in sequence Message-ID: Date: 30 Oct 91 13:42:50 GMT References: <2C2D25732020D1AB@HELIX.MGH.HARVARD.EDU> <1991Oct27.081326.7041@mcclb0.med.nyu.edu> <1991Oct29.173156.27356@bronze.ucs.indiana.edu> Sender: news@athena.mit.edu (News system) Distribution: bionet,world Organization: Mass. Inst. of Tech., Dept. of Chemistry Lines: 32 In-Reply-To: gilbertd@sunflower.bio.indiana.edu's message of 29 Oct 91 17: 31:56 GMT Nntp-Posting-Host: eastman1.mit.edu On 29 Oct 91 17:31:56 GMT, gilbertd@sunflower.bio.indiana.edu (Don Gilbert) said: > My copy of GCG for Unix just arrived in a big box a couple hours > back. We've been using the Beta test release of this for a few > months -- it is every bit as good as the VMS version, only much > faster. Is this just VMS software ported to Unix, or does the new GCG do things in a more Unix style like using pipes, standard-in and out? Not to say that the VMS-model is bad, just that it does not work like the rest of Unix. -- Frank Kolakowski ======================================================================= | Email: lfk@eastman1.mit.edu or kolakowski@helix.mgh.harvard.edu or | | lfk@athena.mit.edu or kolakowski@wccf.mit.edu | | US Mail: | | Lee F. Kolakowski | | Endocrine Unit Massachusetts General Hospital | | Wellman 5 Boston, MA 02114 | | Phone AT&T: 1-617-726-3966 #include | ======================================================================= From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!agate!linus!think.com!rpi!dali.cs.montana.edu!caen!sdd.hp.com!wuarchive!uunet!mixcom!mmvvmm From: mmvvmm@mixcom.COM (Daniel Offutt) Newsgroups: bionet.molbio.proteins Subject: Protein folding by a combination of methods Summary: Query about synthesis of molecular dynamics with neural net methods. Keywords: protein folding, molecular dynamics, neural networks Message-ID: <721@mixcom.COM> Date: 9 May 91 17:04:34 GMT Organization: Milwaukee Information eXchange (Public access Usenet, Email) Lines: 10 Has there been any work on combining molecular dynamics simulation approaches to protein folding with neural network methods? I do not mean by this a staged approach where, for example, a neural network predicts secondary structure, and then a folding simulation program finishes the task. I mean a folding simulation program that has been parameterized with "weights" and then trained to fold proteins better using a protein structure database for training data. If you understand what I have in mind here, and can lead me to some relevant papers, I would much appreciate it. Daniel Offutt From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!agate!linus!think.com!zaphod.mps.ohio-state.edu!swrinde!mips!sdd.hp.com!wuarchive!uunet!mixcom!mmvvmm From: mmvvmm@mixcom.COM (Daniel Offutt) Newsgroups: bionet.molbio.proteins Subject: protein design using computational methods Summary: Query about the state of the art in protein design by computer. Keywords: protein folding, computational methods, molecular dynamics Message-ID: <719@mixcom.COM> Date: 9 May 91 16:59:46 GMT Organization: Milwaukee Information eXchange (Public access Usenet, Email) Lines: 12 I have found descriptions in the literature of various applications of computational methods to protein *folding*. But I have yet to discover an article concerning the application of computational methods to protein *design*. Perhaps this should not be surprising, since a solution to the folding problem appears to be a prerequisite to a solution to the general protein design problem, and the folding problem appears to be computationally intractable today. Is this an accurate summary of the state of the art in computational protein design? If not, can anyone point out some articles on computational protein design worth reading? I would be interested even in experiments with designing much-simplified "model" proteins. Daniel Offutt From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!agate!linus!think.com!zaphod.mps.ohio-state.edu!swrinde!mips!sdd.hp.com!wuarchive!uunet!mixcom!mmvvmm From: mmvvmm@mixcom.COM (Daniel Offutt) Newsgroups: bionet.molbio.proteins Subject: Tertiary structure from neural network Summary: Query about using neural nets to predict tertiary protein structure. Keywords: neural networks, tertiary protein structure prediction Message-ID: <720@mixcom.COM> Date: 9 May 91 17:02:34 GMT Organization: Milwaukee Information eXchange (Public access Usenet, Email) Lines: 12 I recently read a nontechnical article describing a neural network that had been trained to predict tertiary protein structure from the primary sequence. As I recall, there was little information about the extent to which this network was able to make correct predictions given primary sequences it had never "seen" before. So I wonder: Has anyone followed up on this research? Has anyone replicated the result? Does the method show any promise for predicting tertiary structure correctly, given an arbitrary primary sequence? If so, it would seem to be an important result, since neural networks run far more quickly than molecular dynamics simulations of protein folding. Daniel Offutt From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!news.cs.indiana.edu!mips!zaphod.mps.ohio-state.edu!ub!csn!boulder!boulder!eesnyder From: eesnyder@boulder.Colorado.EDU (Eric E. Snyder) Newsgroups: sci.bio,bionet.molbio.proteins Subject: post translational modification: DOPA? Keywords: DOPA Message-ID: Date: 2 May 91 15:08:30 GMT Sender: news@colorado.edu (The Daily Planet) Organization: University of Colorado, Boulder Lines: 21 Xref: bionet sci.bio:2627 bionet.molbio.proteins:106 Nntp-Posting-Host: beagle.colorado.edu I heard an interesting talk last night... just in passing, the speaker mentioned an invertebrate protein containing 17% dihydroxyphenylalanine (aka DOPA)! I couldn't believe this... Have I been living under a rock for the last 25 yrs? How common is this protein modification? Is it post-translational? Does it occur in vertebrates? --------------------------------------------------------------------------- TTGATTGCTAAACACTGGGCGGCGAATCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG Eric E. Snyder Department of MCD Biology ...making feet for childrens' shoes. University of Colorado, Boulder Boulder, Colorado 80309-0347 LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu --------------------------------------------------------------------------- From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!s.u-tokyo!ccut!sun-barr!cs.utexas.edu!swrinde!zaphod.mps.ohio-state.edu!sol.ctr.columbia.edu!bronze!sunflower.bio.indiana.edu!gilbertd From: gilbertd@sunflower.bio.indiana.edu (Don Gilbert) Newsgroups: bionet.molbio.proteins Subject: Re: software to locate given amino acid composition in sequence Message-ID: <1991Oct30.144009.12106@bronze.ucs.indiana.edu> Date: 30 Oct 91 14:40:09 GMT References: <1991Oct29.173156.27356@bronze.ucs.indiana.edu> Sender: news@bronze.ucs.indiana.edu (USENET News System) Distribution: bionet,world Organization: Biology, Indiana University - Bloomington Lines: 11 Nntp-Posting-Host: sunflower.bio.indiana.edu In article lfk@eastman1.mit.edu (Lee F. Kolakowski) writes: >Is this just VMS software ported to Unix, or does the new GCG do things >in a more Unix style like using pipes, standard-in and out? > GCG programs and command/menu syntax is the same on both systems (with a few exceptions like "-" versus "/" command-line switches). File handling syntax on Unix is Unix (e.g., case sensitive). -- Don Gilbert gilbert@bio.indiana.edu biocomputing office, biology dept., indiana univ., bloomington, in 47405 From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!ig!ames!haven.umd.edu!uvaarpa!mcnc!beguine!joan From: joan@med.unc.edu (Joan Shields) Newsgroups: bionet.molbio.proteins Subject: GTP-binding Proteins Message-ID: <4580@beguine.UUCP> Date: 17 Jul 91 17:00:35 GMT Sender: usenet@beguine.UUCP Organization: UNC-CH School of Medicine Lines: 10 Originator: joan@ocean Is anyone or does anyone know of someone working with: GTP-binding proteins, especially Gi(1-3) and/or Go and/or the antibodies to these proteins. Thanks, Joan Shields Dept. of Anesthesiology UNC-CH From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!uwm.edu!rutgers!orstcs! From: kramer@bionette.cgrb.orst.edu (Jack Kramer - Biophysics) Newsgroups: bionet.molbio.proteins,bionet.molbio.general Subject: recent flames Message-ID: <1991Jun04.144206.16835@lynx.CS.ORST.EDU> Date: 4 Jun 91 14:42:06 GMT Sender: @lynx.CS.ORST.EDU Organization: Oregon State University, Corvallis Lines: 11 Xref: bionet bionet.molbio.proteins:132 Nntp-Posting-Host: bionette.cgrb.orst.edu I do not wish to waste further time or space replying to the recent flames against my postings concerning the PIR. For those who have expressed interest in the alleged "false" or "misleading" statements, I have placed a copy of the correspondence between myself and NBRF in the pub/messages.pir file available via anonymous ftp on molbio.med.miami.edu [129.171.84.3]. While there you may wish to examine the lists of network accessable resources maintained for the molecular biologist. jack kramer From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!BBRI.ERI.HARVARD.EDU!KRAKOWER From: KRAKOWER@BBRI.ERI.HARVARD.EDU Newsgroups: bionet.molbio.proteins Subject: list of human cell surface proteins? Message-ID: <4F5C74196020C93C@HELIX.MGH.HARVARD.EDU> Date: 16 Oct 91 19:44:00 GMT Sender: daemon@genbank.bio.net Distribution: bionet Lines: 5 Does anyone know of a list or reference of proteins found on human cell surfaces? We have an unidentified protein of approximately 80 kDa and would like to narrow down what it is. Thank you very much. Terri Krakower krakower@bbri.eri.harvard.edu From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!STOLAF.EDU!prion-request From: prion-request@STOLAF.EDU (Chris Swanson -- Prion Digest Moderator) Newsgroups: bionet.molbio.proteins Subject: The Prion Digest Message-ID: <9103120215.AA26428@stolaf.edu> Date: 11 Mar 91 20:58:03 GMT Sender: daemon@genbank.bio.net Lines: 70 Hello, due to requests, the Prion mailing list has arrived and will be in weekly digest form. The first issue is planned to be mailed this comming Sat. Everyone is welcome, subscription information is below in the header for the first digest. Every issue of the digest will also be posted to bionet.molbio.protein at the same time it is mailed out to the list. I hope people will find this digest a useful tool. If you have mistakenly gotten on this list, please mail me (prion-request) a note and I will fix the problem ASAP -Chris Chris Swanson, Chem/CS/Pre-med Undergrad, St. Olaf College, Northfield,MN 55057 DDN: (CDS6) INTERNET: swansonc@acc.stolaf.edu UUCP: swansonc@stolaf AT&T: Work: (507)-645-6845 Home: (507)-663-6424 I would deny this reality, but that wouldn't pay the bills... --- The "Prion Digest" is a Usenet distributed e-mail list, compiled from postings to it, and distributed weekly (current plan is for early Sat. A.M.) While the main goal of the digest is to provide a resource for researchers working with prions and interested bystanders, all are welcome. All articles posted will be included in the next digest. If a poster feels that his posting is of an urgent nature, it may be distributed sooner than the regular digest. If you want to post an "urgent" message send it to the prion-request address, not the prion one. All requests regarding administrivia (subscriptions, cancellations, comments, etc.) should be mailed to the moderator . All postings to the digest should be directed to . There are archives of all back issues available via anonymous ftp from beowulf@acc.stolaf.edu (130.71.192.20) in the pub/prion directory. If you do not have ftp access, please write and back issues will be mailed to you. -- Chris Swanson (Prion Digest Moderator) From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!lhc!ncifcrf!fcs260c2!toms From: toms@fcs260c2.ncifcrf.gov (Tom Schneider) Newsgroups: bionet.molbio.proteins Subject: Re: Books on Heme-protein Message-ID: <2242@fcs280s.ncifcrf.gov> Date: 24 Jun 91 18:37:09 GMT References: <9106201350.AA26670@genbank.bio.net> Sender: news@ncifcrf.gov Distribution: bionet Organization: NCI Supercomputer Facility, Frederick, MD Lines: 26 In article <9106201350.AA26670@genbank.bio.net> TAB1KAC%JPNTOHOK@ICNUCEVM.CNUCE.CNR.IT (WAZAWA TETSUICHI) writes: >Please tell me some books on ... >heme-protein, like hemoglobin, myoglobin, This might be fun for starters: @book{Dickerson1983, author = "R. E. Dickerson and I Geis", title = "Hemoglobin: Structure, Function, Evolution, and Pathology", year = "1983", publisher = "The Benjamin/Cummings Publishing Co., Inc.", address = "Menlo Park, California", isbn = "0-8053-2411-9"} >Tetsuichi Wazawa >Faculty of Science, Tohoku Universiry >Sendai, Japan Tom Schneider National Cancer Institute Laboratory of Mathematical Biology Frederick, Maryland 21702-1201 toms@ncifcrf.gov From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!lhc!ncifcrf!fcs260c2!toms From: toms@fcs260c2.ncifcrf.gov (Tom Schneider) Newsgroups: bionet.molbio.proteins Subject: Re: protein design using computational methods Keywords: protein folding, computational methods, molecular dynamics Message-ID: <2158@fcs280s.ncifcrf.gov> Date: 14 May 91 14:13:09 GMT References: <719@mixcom.COM> Sender: news@ncifcrf.gov Organization: NCI Supercomputer Facility, Frederick, MD Lines: 68 In article <719@mixcom.COM> mmvvmm@mixcom.COM (Daniel Offutt) writes: > ... I have yet to discover an article concerning the application of > computational methods to protein *design*. @article{Blundell1985, author = "T. Blundell and M. J. E. Sternberg", title = "Computer-aided design in protein engineering", journal = "Trends in Biotechnology", volume = "3", pages = "228-235", year = "1985"} @article{Wetzel1986, author = "R. Wetzel", title = "What is protein engineering?", journal = "Protein Engineering", volume = "1", pages = "3-5", year = "1986"} @article{Pabo1983, author = "C. Pabo", title = "Molecular Technology: Designing proteins and peptides", journal = "Nature", volume = "301", pages = "200", year = "1983"} There must be more recent papers than these, perhaps you can use them as the basis of a search. > Perhaps this should not be surprising, since a solution to the > folding problem appears to be a prerequisite to a solution to the general > protein design problem, and the folding problem appears to be computationally > intractable today. Is this an accurate summary of the state of the art in > computational protein design? No, there have been several attempts reported in the literature, even a case of a the construction of a catalytic protein. Sorry, I don't have that reference, but I think there was a paper in nature within the last year. Dickerson, I believe, has been working on constructing bundles of alpha helices and beta sheets. Also, the the emerging field of nanotechnology, it is recognized that it well may be easier to design proteins from scratch than to figure out how they evolved in nature. Look at the sci.nanotech news group for discussions. @article{Drexler1981, author = "K. E. Drexler", title = "Molecular engineering: An approach to the development of general capabilities for molecular manipulation", journal = "Proc. Natl. Acad. Sci. USA", volume = "78", pages = "5275-5278", year = "1981"} @book{Drexler1986, author = "K. E. Drexler", title = "Engines of Creation", publisher = "Anchor Press", address = "Garden City, New York", year = "1986"} Tom Schneider National Cancer Institute Laboratory of Mathematical Biology Frederick, Maryland 21702-1201 toms@ncifcrf.gov From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!uwm.edu!rpi!zaphod.mps.ohio-state.edu!ub!uhura.cc.rochester.edu!crocus.medicine.rochester.edu!ajp2o From: ajp2o@crocus.medicine.rochester.edu (Anthony J. Persechini) Newsgroups: bionet.software,bionet.molbio.proteins Subject: Circular Dichroism Keywords: CD, circular dichroism Message-ID: <1991Jun4.100618@crocus.medicine.rochester.edu> Date: 4 Jun 91 14:06:18 GMT Sender: news@uhura.cc.rochester.edu Reply-To: ajp2o@crocus.medicine.rochester.edu Organization: University of Rochester Lines: 15 Xref: bionet bionet.software:980 bionet.molbio.proteins:131 I am planning to begin using CD measurements to characterize mutant versions of a protein with a known 3D structure. I am looking for advice on state-of-the-art methodology, particularly with regard to data analysis. Unfortunately, I am currently limited to an old JASCO J41A, which cannot go much below 200 nm. Information on the latest freely distributable software for analysis of CD spectra would be appreciated. -- Anthony Persechini Dept. of Physiology, Box 642 Assistant Professor School of Medicine >>>>>>>>>>>>>>>>>>> University of Rochester ajp2o@crocus.medicine.rochester.edu Rochester, NY 14642 From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!daresbury!news From: karabinos@exmed1.dnet.gwdg.de ("EXMED1::KARABINOS") Newsgroups: bionet.molbio.proteins Subject: bionet-news Message-ID: <1992Sep24.211711.10357@gserv1.dl.ac.uk> Date: 24 Sep 92 21:18:59 GMT Sender: list-admin@daresbury.ac.uk Distribution: bionet Lines: 1 Original-To: proteins@uk.ac.daresbury sub bionet-news.bionet.molbio.proteins From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!daresbury!news From: karabinos@exmed1.dnet.gwdg.de ("EXMED1::KARABINOS") Newsgroups: bionet.molbio.proteins Subject: list Message-ID: <1992Sep26.105408.19442@gserv1.dl.ac.uk> Date: 26 Sep 92 10:56:25 GMT Sender: list-admin@daresbury.ac.uk Distribution: bionet Lines: 1 Original-To: proteins@uk.ac.daresbury list bionet.molbio.proteins From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!UH.EDU!Davison From: Davison@UH.EDU (Dan Davison) Newsgroups: bionet.molbio.proteins Subject: Re: How to access Brookhaven database? Message-ID: <199209281347.AA11724@Menudo.UH.EDU> Date: 28 Sep 92 13:47:28 GMT References: <9209281314.AA00251@genbank.bio.net> Sender: daemon@genbank.bio.net Distribution: bionet Lines: 29 Li, Dong 312-996-0509 said: > I will be grateful if you tell me how to access Brookhave Database (a > protein database) or how to retrieve the files in it. As announced about a month ago, the Protein Data Bank, the international collection of protein crystallographic coordinates, is available for anonymous FTP from ftp.bchs.uh.edu in pub/gene-server/pdb/.... Files are kept compressed, so use binary mode when FTP'ing. This service is temporary until the Protein Data Bank gets their own FTP site arranged. NOTE: you must know which files you want -- only the coordinate files are available. No guide to the coordinate files is here. See the file README for important redistribution information. dan gene-server manager -- dr. dan davison/dept. of biochemical and biophysical sciences/univ. of Houston/4800 Calhoun/Houston,TX 77204-5934/davison@uh.edu/DAVISON@UHOU -----RIP Isaac Asimov 1920-1992 I'll miss him -------------------- Disclaimer: As always, I speak only for myself, and, usually, only to myself. From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!daresbury!news From: karabinos@exmed1.dnet.gwdg.de ("EXMED1::KARABINOS") Newsgroups: bionet.molbio.proteins Subject: send-list Message-ID: <1992Sep28.095010.19352@gserv1.dl.ac.uk> Date: 28 Sep 92 09:46:40 GMT Sender: list-admin@daresbury.ac.uk Distribution: bionet Lines: 1 Original-To: proteins@uk.ac.daresbury send-list From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!daresbury!news From: karabinos@exmed1.dnet.gwdg.de ("EXMED1::KARABINOS") Newsgroups: bionet.molbio.proteins Subject: send-list Message-ID: <1992Sep28.093129.18168@gserv1.dl.ac.uk> Date: 28 Sep 92 09:33:17 GMT Sender: list-admin@daresbury.ac.uk Distribution: bionet Lines: 1 Original-To: proteins@uk.ac.daresbury send-list From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!news.cs.indiana.edu!sdd.hp.com!spool.mu.edu!darwin.sura.net!zaphod.mps.ohio-state.edu!news.acns.nwu.edu!uicvm.uic.edu!u53077 From: U53077@uicvm.uic.edu (Li, Dong 312-996-0509) Newsgroups: bionet.molbio.proteins Subject: How to access Brookhave database? Message-ID: <92271.210135U53077@uicvm.uic.edu> Date: 28 Sep 92 02:01:35 GMT Organization: University of Illinois at Chicago Lines: 10 Dear netters, I will be grateful if you tell me how to access Brookhave Database (a protein database) or how to retrieve the files in it. Thank you for your attention. Dong LI ************************************************************************* With malice toward none, with charity for all.......... Abraham Lincoln From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!agate!ucbvax!MANGO.MEF.KI.SE!arne From: arne@MANGO.MEF.KI.SE (Arne Elofsson) Newsgroups: bionet.molbio.proteins Subject: RE: Secondary Structure Software? Message-ID: <9209180950.AA21704@mango.mef.ki.se> Date: 18 Sep 92 09:50:07 GMT Sender: daemon@ucbvax.BERKELEY.EDU Lines: 7 I think you can find most what you want from EMBL (European Molecular Biology labartorium) E- mail a line HELP to : netserv@embl-Heidelberg.de The software is also in the Gopher space at several points. Arne Elofsson From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!BROWNVM.BROWN.EDU!ST402943 From: ST402943@BROWNVM.BROWN.EDU (Steve Bogusz) Newsgroups: bionet.molbio.proteins Subject: Asp & Glu pK Message-ID: <9209171856.AA16042@genbank.bio.net> Date: 17 Sep 92 18:47:28 GMT Sender: daemon@genbank.bio.net Distribution: bionet Lines: 11 I am currently doing research on the selectivity of voltage gated ion channels, which may include a ring of Asp residues and/or a ring of Glu residues arranged in a 4-fold symmetry in the interior of an 8-stranded beta barrel. My question is does anyone know of any work in the field that would allow me to predict how many of the these four nearby residues would be charged? One would assume that since they are in such close contact that not all of the group would be charged. The effect of an ion binding at the site might also effect the protonation of the residues. Any help would be greatly appreciated. Steve Bogusz From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!daresbury!news From: karabinos@exmed1.dnet.gwdg.de ("EXMED1::KARABINOS") Newsgroups: bionet.molbio.proteins Subject: anu-news Message-ID: <1992Sep24.075649.4084@gserv1.dl.ac.uk> Date: 24 Sep 92 07:57:34 GMT Sender: list-admin@daresbury.ac.uk Distribution: bionet Lines: 1 Original-To: proteins@uk.ac.daresbury anu-news From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!daresbury!embnet.se!corax.udac.uu.se!sunic!mcsun!uunet!olivea!spool.mu.edu!sdd.hp.com!wupost!morpheus!tkerwin From: tkerwin@morpheus.wustl.edu (Tim Kerwin) Newsgroups: bionet.molbio.proteins Subject: Secondary Structure Software? Message-ID: Date: 17 Sep 92 22:00:38 GMT Distribution: bionet Organization: Washington University in Saint Louis, MO USA Lines: 13 NNTP-Posting-Host: morpheus.wustl.edu I'm looking for software which implements one of the algorithms which predict secondary structure from the amino acid sequence, such as the Chou-Fasman method. Any help will be appreciated, since this is all new to me, and I'll have to write it myself if someone else hasn't done it already. Thanks in advance! -- Tim Kerwin Anesthesiology Research Washington University Medical School From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!QMS1.LIFE.UIUC.EDU!Dan_Szymanski From: Dan_Szymanski@QMS1.LIFE.UIUC.EDU ("Dan Szymanski") Newsgroups: bionet.molbio.proteins Subject: affinity limits Message-ID: <199209210112.AA01372@ux1.cso.uiuc.edu> Date: 21 Sep 92 02:05:00 GMT Sender: news@genbank.bio.net Distribution: bionet Lines: 11 Subject: Time:7:50 PM OFFICE MEMO affinity limits Date:9/20/92 does anyone out there know anything about limits/predictions of affinity given a number of starting conditions in the binding interaction, for example ionic strength, electrostatic maps of ligand and binding site, h-bond configs.etc. Could one, for example, define an upper limit of affinity of a protein for DNA given the above information, or what other info. is required? Is it just a matter of adding up the number of kcal each binding interaction is worth? From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!uwm.edu!wupost!darwin.sura.net!jvnc.net!netnews.upenn.edu!duong From: duong@chestnut.chem.upenn.edu (Duc Duong) Newsgroups: bionet.software,bionet.molbio.proteins Subject: Software computation for structural protein.. Message-ID: <89106@netnews.upenn.edu> Date: 16 Sep 92 01:19:53 GMT Sender: news@netnews.upenn.edu Followup-To: bionet.software Organization: University of Pennsylvania Lines: 11 Xref: bionet bionet.software:3273 bionet.molbio.proteins:383 Nntp-Posting-Host: chestnut.chem.upenn.edu Hi.. I am looking for the software that read in the NOE Distances (Nuclear Overhouses Effect) then it calculates the structure of the protein (linear, helix, double hexlix,..etc). The distance is less than 5Angstroms. The data is collected by using solution NMR method. I am sure that I read about the software before but I don't recall right now. Any help or suggestion will greatly appreciated. E-mail please. Thank you. duc From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!GUNBRF.NBRFNET.GEORGETOWN.EDU!POSTMASTER From: POSTMASTER@GUNBRF.NBRFNET.GEORGETOWN.EDU Newsgroups: bionet.molbio.proteins Subject: Correction of Nameserver Error Message-ID: <01GOKTPQTN6Q8WW5L2@NBRF.Georgetown.Edu> Date: 9 Sep 92 15:10:01 GMT Sender: daemon@genbank.bio.net Distribution: bionet Lines: 23 Yesterday in the announcement of restoration of access to the Protein Identification Resource, the BITNET and Internet addresses in the text were correct. However, the mailer for Bionet queried a nameserver with an incorrect entry for our Internet address. As a result the mail header for the announcement contained an incorrect, non-working Internet address. That nameserver at Georgetown University has been chastised and the correct Internet address should appear in the mail header above. To repeat the correct addresses, requests for the Protein Identification Resource Network Server should be be sent to FILESERV@GUNBRF on BITNET or to FILESERV@NBRF.Georgetown.Edu on Internet. ------------------------------------------------------------------------ Dr. John S. Garavelli Database Coordinator Protein Identification Resource National Biomedical Research Foundation Washington, DC 20007 POSTMASTER@GUNBRF.BITNET POSTMASTER@NBRF.GEORGETOWN.EDU From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!BIOTECHNET.COM!THOMSTEVENS From: THOMSTEVENS@BIOTECHNET.COM Newsgroups: bionet.molbio.proteins Subject: reviewers for manuscript Message-ID: <01GOS2I3MDL28Y55EY@delphi.com> Date: 14 Sep 92 19:23:17 GMT Sender: daemon@genbank.bio.net Distribution: bionet Lines: 14 TO: ALL FROM: Thomas J. Stevens, Assistant Editor, BioTechniques RE: Use of a programmable calculator for storing cloning library data If you have used a programmable calculator, preferably the Hewlett-Packard HP48SX, for storing DNA and peptide sequencing information, I would be interested in asking you to review a short manuscript for BioTechniques. Thomas J. Stevens, Assistant Editor BioTechniques Eaton Publishing 154 East Central Street Natick, MA 01760 USA phone (508) 655-8282 fax (508) 655-9910 From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!uwm.edu!spool.mu.edu!caen!uakari.primate.wisc.edu!zazen!news From: nmrdb@vms.macc.wisc.edu (BEVERLY SEAVEY) Newsgroups: bionet.molbio.proteins Subject: Classification/nomenclature schemes for receptors,DNA-binding proteins? Message-ID: <1992Sep14.195010.16550@macc.wisc.edu> Date: 14 Sep 92 21:46:50 GMT Sender: news@macc.wisc.edu (USENET News System) Organization: University of Wisconsin Academic Computing Center Lines: 8 I am looking for attempts at nomenclature and classification for receptors, nucleic acid binding proteins , and other non-enzymatic proteins. I know there should be one at least for receptors - at the 1990 CODATA meeting at the ad hoc meeting on nomenclature, someone mentioned that he was on a commission that would soon be coming up with recommendations. I don't work directly with receptors, so I wouldn't necessarily see any such results when they came out. From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!agate!ames!haven.umd.edu!uunet!utcsri!torn!newshost.uwo.ca!uwovax.uwo.ca!michael From: michael@uwovax.uwo.ca Newsgroups: bionet.molbio.proteins Subject: Thiol proteases Message-ID: <1992Sep7.205545.1@uwovax.uwo.ca> Date: 8 Sep 92 00:55:45 GMT Sender: news@julian.uwo.ca (USENET News System) Organization: University of Western Ont, London Lines: 7 Nntp-Posting-Host: hydra.uwo.ca Would anyone have or know of someone who has mutagenized a thiol protease at an essential residue to eliminate enzyme activity while at the same time, as far as determined or desired, retained overall structure? I would be very grateful for details. Many thanks, Michael Clarke michael@uwovax.uwo.ca From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!GUNBRF.BITNET!POSTMAST From: POSTMAST@GUNBRF.BITNET Newsgroups: bionet.molbio.proteins Subject: Announcement of PIR Network Request Server Downtime Message-ID: <9209031805.AA15203@genbank.bio.net> Date: 3 Sep 92 17:47:30 GMT Sender: daemon@genbank.bio.net Distribution: bionet Lines: 20 Announcement of Temporary Interruption of Access to The Protein Identification Resource The National Biomedical Research Foundation will be attempting to upgrade software beginning on Monday 7 September. From 9:00 EDT Monday 7 September through about 12:00 EDT Tuesday 8 September it will not be possible for users to access the Protein Identification Resource Network Server. In addition there may be a short interruption of the On-line System during that period. Please, do not send requests to FILESERV@GUNBRF from 7 September through 8 September. We regret any inconvenience this temporary loss of service will cause. ------------------------------------------------------------------------ Dr. John S. Garavelli Database Coordinator Protein Identification Resource National Biomedical Research Foundation Washington, DC 20007 POSTMASTER@GUNBRF.BITNET From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!agate!ames!haven.umd.edu!uunet!usc!sdd.hp.com!ux1.cso.uiuc.edu!news.cso.uiuc.edu!uxa.cso.uiuc.edu!kgg6519 From: kgg6519@uxa.cso.uiuc.edu (Kamalakar Gulukota) Newsgroups: bionet.molbio.proteins Subject: Aggregation of proteins on refolding Message-ID: Date: 31 Aug 92 14:42:36 GMT Sender: usenet@news.cso.uiuc.edu (Net Noise owner) Organization: University of Illinois at Urbana Lines: 26 Here is a question on Protein refolding experiments. Can someone please answer it. Many proteins on refolding give only partial activity because the rest of the protein has aggregated. It is supposed that it is really some partially folded intermediates on the folding pathway that form interactions with other molecules rather than have intramolecular interactions to form the native structure. How much of the protein (what %) aggregates depends upon the nature of the protein as well as, in some cases, on the method of refolding (or, perhaps more to the point, the method in which the protein was denatured in the first place). Now, the question is this: Does it make sense to talk about a single number as the percentage of the protein that aggregates? i.e. is there a limit that aggregation reaches? If I found 30% aggregation at 2 hours, would I find 35% at 3 hours and so on? If I waited long enough, would aggregation in any protein refolding process reach 100%? Undoubtedly, the RATE of aggregation decreases with time. But does it ever get close enough to zero that we can say that the aggregation at that time is the limit and that at time = infinity, the % aggregation would still be about the same? Thanks very much in advance Gulu From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!NBRF.NBRFNET.GEORGETOWN.EDU!POSTMASTER From: POSTMASTER@NBRF.NBRFNET.GEORGETOWN.EDU Newsgroups: bionet.molbio.proteins Subject: Restoration of Access to Network Request Server Message-ID: <01GOJMCSXBLE8WVZ12@NBRF.Georgetown.Edu> Date: 8 Sep 92 19:15:24 GMT Sender: daemon@genbank.bio.net Distribution: bionet Lines: 21 Announcement of Restoration of Access to The Protein Identification Resource The National Biomedical Research Foundation has restored access to the Protein Identification Resource Network Server. Requests may again be sent to FILESERV@GUNBRF on BITNET or to FILESERV@NBRF.Georgetown.Edu on Internet. We regret any inconvenience this temporary loss of service may have caused. ------------------------------------------------------------------------ Dr. John S. Garavelli Database Coordinator Protein Identification Resource National Biomedical Research Foundation Washington, DC 20007 POSTMASTER@GUNBRF.BITNET POSTMASTER@NBRF.Georgetown.Edu From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!daresbury!news From: LIUNI@MVX36.CSATA.IT Newsgroups: bionet.molbio.proteins Subject: Information on FUSION PROTEIN Message-ID: <1992Sep11.162426.5583@gserv1.dl.ac.uk> Date: 11 Sep 92 16:16:00 GMT Sender: list-admin@daresbury.ac.uk Distribution: bionet Lines: 27 X-Envelope-To: proteins@daresbury.ac.uk X-Vms-Cc: LIUNI Original-To: proteins@UK.AC.DARESBURY X-Vms-To: IN%"proteins@daresbury.ac.uk" Hi, can anyone help me with this problem. I am working on Fusion Protein whose function is to link togheter two membranes (e.g. viral membrane and cellular membrane). I have a protein sequence and my problem is to search in Eukaryotic proteins, definited regions for this function. Can anyone help me on how solve this problem. Thank you in advange. ________________________________________________________________________ Dr. Sabino Liuni Research Area of CNR -Italy E_mail: LIUNI@MVX36.CSATA.IT LIUNI@IBAMARTE.BITNET ------------------------------------------------------------------------ From owner-proteins@net.bio.net Sun Sep 27 23:00:00 1992 Path: bionet!GUNBRF.BITNET!POSTMAST From: POSTMAST@GUNBRF.BITNET Newsgroups: bionet.molbio.proteins Subject: RE: Duplicate use of entry codes Message-ID: <9208282155.AA04757@genbank.bio.net> Date: 28 Aug 92 21:52:01 GMT Sender: daemon@genbank.bio.net Distribution: bionet Lines: 128 In message <9208271604.AA10206@genbank.bio.net> ODONNELL@ARCB.AFRC.AC.UK (Cary O'Donnell) expressed concern about an apparent "duplicated use of the sequence ID for two very similar (almost identical!!) sequences." Several people brought to our attention a problem concerning duplicated entry identification codes and accession numbers among the data sections PIR1, PIR2, and PIR3 in the PIR-International Protein Sequence Database. We apologize for this difficulty and have modified our procedures to ensure that this does not recur in future releases. We thank those who brought this problem to our attention and will greatly appreciate any further comments, corrections, or recommendations concerning the database. We will to take this opportunity to restate the policy concerning entry identification codes and accession numbers in order to clarify (we hope) the situation. The entry identification code (on the `header-line' in NBRF-format; on the `ENTRY' record in CODATA format) is a unique code assigned to every entry in PIR1, PIR2, and PIR3. The code should be unique across all three data sections. The code is not a permanent identifier, however; it is subject to change from release to release. The duplication of entry identification codes reported in version 33 was a mistake and has been corrected. An accession number as it appears within the reference section of an entry refers uniquely to the sequence as reported by the authors in the corresponding publication, manuscript, or submission. These sequences are being compiled into an archival data set. The accession number is the entry identification code of the archival sequence entry. fThese accession numbers are permanent identifiers of the `reported' sequences and will remain associated with the reported sequences as long as they remains in the database. When the data are processed by PIR-International staff and entered in the PIR1 and PIR2 data sections, the accession numbers are placed in the accession field of the appropriate reference. In NBRF format, they occur on `A;Accession:' lines following the corresponding reference. In CODATA format they occur within the `REFERENCE #accession' fields. Please refer to the document CXFSD available from FILESERV@GUNBRF.BITNET (SEND CXFSD) for specifics concerning the CODATA format. Note that the reference-specific accession numbers are distinct from those that occur on the `C;Accession:' line (NBRF format) or on the ACCESSION record (CODATA format). This field contains a list of all the accession numbers that were ever associated with the entry; some of these do not correspond to specific reported sequences because our original policy was to associate them with the entire `merged' PIR entry. The PIR3 section of the database consists of all entries in the archival data set that have not been entered into PIR1 and PIR2. These entries have not been `merged' and the entry identification code and the accession number are i