From owner-proteins@net.bio.net Sun Aug 01 23:00:00 1993 Path: biosci!daresbury!doc.ic.ac.uk!agate!library.ucla.edu!ddsw1!uunet!pipex!sunic!ebc.ee!kask!aabroi From: aabroi@ebc.ee (Aare Abroi) Newsgroups: bionet.molbio.proteins Subject: list of different structures ??? Message-ID: <1993Aug2.204205.160@ebc.ee> Date: 2 Aug 93 17:42:04 GMT Lines: 6 Nntp-Posting-Host: kask.ebc.ee X-Newsreader: TIN [version 1.2 PL0]Lines: 6 -- Aare Abroi Estonian Biocenter aabroi@ebc.ee Tartu, Estonia From owner-proteins@net.bio.net Sun Aug 01 23:00:00 1993 Path: biosci!uwm.edu!linac!convex!constellation!rex!kunapuli From: kunapuli@rex.uokhsc.edu (Kunapuli T. Madhusudhan) Newsgroups: bionet.molbio.proteins Subject: Nonendothelial Angiotensin Converting Enzyme Message-ID: Date: 2 Aug 93 15:10:51 GMT Organization: University of Oklahoma Health Sciences Center, OKC Lines: 5 Does any body have information on the non-endothelail angiotensin-I converting enzyme(ace) ?. If so, please send e-mail to me. Thank you in advance. -madhu From owner-proteins@net.bio.net Sun Aug 01 23:00:00 1993 Path: biosci!daresbury!doc.ic.ac.uk!agate!spool.mu.edu!umn.edu!snowman.med.umn.edu!kay From: kay@snowman.med.umn.edu (Kay Faaberg (Plagemann)) Newsgroups: bionet.molbio.methds-reagnts,bionet.general,bionet.molbio.proteins,bionet.virology Subject: Tricine gel drying Message-ID: Date: 2 Aug 93 21:00:19 GMT Sender: news@news2.cis.umn.edu (Usenet News Administration) Organization: University of Minnesota, Twin Cities Lines: 7 Xref: biosci bionet.molbio.methds-reagnts:6775 bionet.general:5637 bionet.molbio.proteins:778 bionet.virology:169 Nntp-Posting-Host: snowman.med.umn.edu X-Newsreader: TIN [version 1.2 PL1] I can't figure out a way to dry a 16.5%T, 3%C no urea tricine gel without cracking into a thousand pieces. Right now I have limited success with 30min fixing, 30 min destaining, 20 min with Amplify, and drying for at least 4 hrs at 60 degrees C. I am wondering, since the gel dryer is on house vacuum, that the vacuum is too strong or not strong enough or too variable. Help is needed. From owner-proteins@net.bio.net Sun Aug 01 23:00:00 1993 Path: biosci!daresbury!doc.ic.ac.uk!agate!library.ucla.edu!ddsw1!uunet!pipex!sunic!ebc.ee!kask!aabroi From: aabroi@ebc.ee (Aare Abroi) Newsgroups: bionet.molbio.proteins Subject: list of different structures ??? Message-ID: <1993Aug2.204007.159@ebc.ee> Date: 2 Aug 93 17:40:07 GMT Lines: 6 Nntp-Posting-Host: kask.ebc.ee X-Newsreader: TIN [version 1.2 PL0]Lines: 6 -- Aare Abroi Estonian Biocenter aabroi@ebc.ee Tartu, Estonia From owner-proteins@net.bio.net Sun Aug 01 23:00:00 1993 Path: biosci!CALSHP.CALS.WISC.EDU!hu From: hu@CALSHP.CALS.WISC.EDU (Hu ZhiLiang) Newsgroups: bionet.molbio.proteins Subject: Re: Native gel recipe Message-ID: <9308021359.AA24005@calshp.cals.wisc.edu> Date: 2 Aug 93 13:59:13 GMT References: <9308020555.AA23202@net.bio.net> Sender: daemon@net.bio.net Distribution: bionet Lines: 25 >I am looking for PAGE native gel recipe which can separate low molecular weight >complexes (less than 100KD). References would help also. Any help >appreciated. > >Thanks, Bill A 25-30% acylamind gel may do that: 40% acrylamind 6.0 ml 1.5 M tris 2.5 ml D.D. Water 0.7 ml TEMED 12 microliters 30% Ammonium sulfate 12 microliters Electrode buffer: use boric acid + tris + EDTA + sodium azide and run in cold room or under refrigeration. (sorry for not being specific since I don't have my handbook handy :-) There are very good references in "Methods in Enzymology" volume 128 or 129. Good luck! -- Yours faithfully Zhiliang[7m /-//_/_[m From owner-proteins@net.bio.net Mon Aug 02 23:00:00 1993 Path: biosci!daresbury!daresbury!not-for-mail From: mbrgw@s-crim1.dl.ac.uk (R.G. Walters) Newsgroups: bionet.molbio.methds-reagnts,bionet.general,bionet.molbio.proteins,bionet.virology Subject: Re: Tricine gel drying Message-ID: <23ld04INNavp@s-crim1.dl.ac.uk> Date: 3 Aug 93 10:00:36 GMT References: Distribution: bionet Organization: Daresbury Lab., Warrington, U.K. Lines: 23 Xref: biosci bionet.molbio.methds-reagnts:6783 bionet.general:5648 bionet.molbio.proteins:780 bionet.virology:175 NNTP-Posting-Host: s-crim1.dl.ac.uk In article kay@snowman.med.umn.edu (Kay Faaberg (Plagemann)) writes: > I can't figure out a way to dry a 16.5%T, 3%C no urea tricine gel >without cracking into a thousand pieces. Right now I have limited >success with 30min fixing, 30 min destaining, 20 min with Amplify, and >drying for at least 4 hrs at 60 degrees C. I am wondering, since the >gel dryer is on house vacuum, that the vacuum is too strong or not >strong enough or too variable. Help is needed. I think this should be in a FAQ. I asked about this a while ago, and the answer was "lower the %C". But obviously that's not possible if you're trying separate small fragments (I assume that's why you're using this gel system). One possibility I've never tried is to dry down onto cellulose rather than 3MM. I forget the exact method, but you wet two cellulose sheets with MeOH/acetic acid and make a gel sandwich. The cellulose adheres to the gel, and so supports it while the gel dries, reducing the likelihood of cracking. I'm told :-) Robin Walters. Robert Hill Institute, Sheffield UK. I got bored with my old .sig So here's a new one From owner-proteins@net.bio.net Mon Aug 02 23:00:00 1993 Path: biosci!agate!library.ucla.edu!ddsw1!uunet!pipex!sunic!ebc.ee!kask!aabroi From: aabroi@ebc.ee (Aare Abroi) Newsgroups: bionet.molbio.proteins Subject: list of different folds Message-ID: <1993Aug3.170955.163@ebc.ee> Date: 3 Aug 93 14:09:54 GMT Lines: 14 Nntp-Posting-Host: kask.ebc.ee X-Newsreader: TIN [version 1.2 PL0]Lines: 14 There are identified about 100 different structures or folds of proteins. Does anyone know is somewhere available a represantative list (or something like that) of different structures or differrent folds of proteins ? I would be grateful for any kind of help ! -- Aare Abroi Estonian Biocenter aabroi@ebc.ee Tartu, Estonia From owner-proteins@net.bio.net Tue Aug 03 23:00:00 1993 Path: biosci!agate!usenet.ins.cwru.edu!magnus.acs.ohio-state.edu!math.ohio-state.edu!uwm.edu!msuinfo!netnews.upenn.edu!duong From: duong@chestnut.chem.upenn.edu (Duc Duong) Newsgroups: bionet.molbio.proteins,bionet.software,bionet.xtallography Subject: [HELP] Software calculte the angle between 2 planes? Message-ID: <139423@netnews.upenn.edu> Date: 4 Aug 93 17:57:19 GMT Sender: news@netnews.upenn.edu Followup-To: bionet.molbio.proteins Organization: NMR Biochemistry Graduate Research Lab Lines: 11 Xref: biosci bionet.molbio.proteins:786 bionet.software:5587 bionet.xtallography:391 Nntp-Posting-Host: chestnut.chem.upenn.edu hi.. I have 5 coordinates points that define 2 planes intersect each other. I'd like calculate the angle between them.. The problem is simple.. so is there any software would do this kind of calculation?? I don't want to re-invent the wheel here.. so can InsightII, Quanta?? etc.. do these kind of stuff.. The five angles have the x,y,z coordinates.. duc From owner-proteins@net.bio.net Tue Aug 03 23:00:00 1993 Path: biosci!daresbury!zeta.bmc.uu.se!corax.udac.uu.se!sunic!uunet!europa.eng.gtefsd.com!darwin.sura.net!newt.welch.jhu.edu!welchdev.welch.jhu.edu!danj From: danj@welchdev.welch.jhu.edu (Dan Jacobson) Newsgroups: bionet.molbio.proteins Subject: Re: dUTPase information anyone? Keywords: dUTPase Message-ID: <1993Aug4.155510.29075@newt.welch.jhu.edu> Date: 4 Aug 93 15:55:10 GMT References: <7412@krafla.rhi.hi.is> Sender: news@newt.welch.jhu.edu Organization: Johns Hopkins University Genome Data Base (GDB) Lines: 46 Nntp-Posting-Host: welchdev.welch.jhu.edu In article <7412@krafla.rhi.hi.is> hbriem@rhi.hi.is (Helgi Briem Magnusson) writes: >Does anyone out there have any information on dUTPases, particularly >in viruses? > >Especially: > ..... > 3) Which dUTPases have been sequenced? We have already > found the EBV, Ecoli and Human sequences. Are there > others? > A quick gopher search of genbank for dUTPase yeilds the following: --> 1. gb:ECDUT E. coli dut gene for dUTPase (EC 3.6.1.23) (deoxyuridine. 2. gb:ECDUTPYR Escherichia coli dut-pyrE gene region. 3. gb:ECODCDA E.coli deoxycytidine triphosphate deaminase (dcd) gene,... 4. gb:S40549 deoxyuridine triphosphatase [tomatoes, Tiny Tim cultivar... 5. gb:HUMUTPNH Homo sapiens dUTP nucleotidohydrolase mRNA, 5' end.. 6. gb:EH4BG Equine herpesvirus B1, B3, B5 genes for DNA replication, ... 7. gb:HEVZVXX Varicella-Zoster virus complete genome. 8. gb:HS4GP340B Epstein-Barr virus glycoprotein 340 (BLLF1), BLLF2, a... 9. gb:HS5DUT Murine cytomegalovirus (clone HindIII D) transmembrane p... 10. gb:HSECOMGEN Equine herpesvirus 1 complete genome.. 11. gb:HSV3PRGEN Herpesvirus saimiri the most three prime end of the g... 12. gb:HV6IDDNA Human herpesvirus-6 genes BHLF1, BHLF2, BHLF3, BHRF1 a... 13. gb:IH1CG Ictalurid herpesvirus 1 (channel catfish virus [CCV]), st... a second search for deoxyuridine and triphosphatase yields two more unique entries: --> 3. gb:EIAPOLC Equine infectious anemia virus proviral polymerase gene... 4. gb:EIAPOLDT Equine infectious anemia virus proviral polymerase gen... If you've never heard of gopher write me a note and I'll send you information to help get you started. Best of luck, Dan Jacobson danj@welchgate.welch.jhu.edu From owner-proteins@net.bio.net Tue Aug 03 23:00:00 1993 Path: biosci!daresbury!zeta.bmc.uu.se!corax.udac.uu.se!sunic!uunet!psinntp!alsys1!David From: David S. Gottfried Newsgroups: bionet.molbio.proteins Subject: Re: list of different folds Message-ID: <2031@alsys1.aecom.yu.edu> Date: 4 Aug 93 13:00:30 GMT References: <1993Aug3.170955.163@ebc.ee> Sender: news@alsys1.aecom.yu.edu Organization: Albert Einstein College of Medicine Lines: 20 Nntp-Posting-Host: marcus.aecom.yu.edu In article <1993Aug3.170955.163@ebc.ee> aabroi@ebc.ee (Aare Abroi) writes: > > > There are identified about 100 different structures or folds >of proteins. Does anyone know is somewhere available a represantative >list (or something like that) of different structures or differrent >folds of proteins ? > The classic paper on this subject is Levitt and Chothia, Nature, 261, 552-558 (1976) "Structural Patterns in Globular Proteins". You might also want to check out some more recent texts like Branden and Tooze, "Introduction to Protein Structure", Garland Publishing, New York, 1991. =============================== David S. Gottfried Albert Einstein College of Medicine Dept. of Physiology and Biophysics gottfrie@aecom.yu.edu =============================== From owner-proteins@net.bio.net Tue Aug 03 23:00:00 1993 Path: biosci!daresbury!doc.ic.ac.uk!uknet!pipex!uunet!decwrl!decwrl!waikato!waikato.ac.nz!kuysy From: kuysy@waikato.ac.nz Newsgroups: bionet.molbio.proteins Subject: Message-ID: <1993Aug4.143825.18740@waikato.ac.nz> Date: 4 Aug 93 02:38:24 GMT Organization: University of Waikato, Hamilton, New Zealand Lines: 5 Can anyone tell me what effect BSA has on a Gel Retardation Assay (Mobility Shift Assay) and therefore why it is sometimes used in these assays and sometimes not? Comments would be very helpful. Yvonne Kuys email kuysy@ruakura.cri.nz From owner-proteins@net.bio.net Tue Aug 03 23:00:00 1993 Path: biosci!daresbury!zeta.bmc.uu.se!corax.udac.uu.se!sunic!isgate!krafla!hbriem From: hbriem@rhi.hi.is (Helgi Briem Magnusson) Newsgroups: bionet.molbio.proteins Subject: dUTPase information anyone? Keywords: dUTPase Message-ID: <7412@krafla.rhi.hi.is> Date: 4 Aug 93 14:38:23 GMT Sender: usenet@rhi.hi.is Lines: 11 Nntp-Posting-Host: hengill.rhi.hi.is Does anyone out there have any information on dUTPases, particularly in viruses? Especially: 1) Is there a published review of it or related enzymes? 2) What metabolic pathways does it affect? 3) Which dUTPases have been sequenced? We have already found the EBV, Ecoli and Human sequences. Are there others? Thanks - Helgi Briem and Gupmundur Pitursson From owner-proteins@net.bio.net Tue Aug 03 23:00:00 1993 Path: biosci!NBRF.GEORGETOWN.EDU!POSTMASTER From: POSTMASTER@NBRF.GEORGETOWN.EDU Newsgroups: bionet.molbio.proteins Subject: Re: list of different folds Message-ID: <01H1COTQP672ADBU5O@NBRF.Georgetown.Edu> Date: 4 Aug 93 19:32:35 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 31 In message <9308031427.AA26989@net.bio.net> Aare Abroi (aabroi@ebc.ee) asked, > Does anyone know is somewhere available a represantative > list (or something like that) of different structures or differrent > folds of proteins ? The latest and most comprehensive list would undoubtedly be the library being developed by Janet Thornton and her group. She reported on this project at the Protein Society 7th Annual Symposium at San Diego, 24-28 July. In the abstract of her presentation she cites the following. @article{ThorntonFold1, author = "Christine A. Orengo and Janet M. Thornton and others", journal = "Current Biology", volume = "3", year = 1993, pages = "131-139"} @article{ThorntonFold2, author = "Christine A. Orengo and Janet M. Thornton and others", journal = "Protein Engineering", year = 1993, comment = "in press"} ------------------------------------------------------------------------ Dr. John S. Garavelli Database Coordinator Protein Information Resource National Biomedical Research Foundation Washington, DC 20007 POSTMAST@GUNBRF.BITNET POSTMASTER@NBRF.GEORGETOWN.EDU From owner-proteins@net.bio.net Tue Aug 03 23:00:00 1993 Path: biosci!daresbury!zeta.bmc.uu.se!corax.udac.uu.se!sunic!uunet!europa.eng.gtefsd.com!darwin.sura.net!haven.umd.edu!purdue!mentor.cc.purdue.edu!mace.cc.purdue.edu!b35 From: b35@mace.cc.purdue.edu (Vic Ilag) Newsgroups: bionet.molbio.proteins,bionet.molbio.methds-reagnts Subject: high molecular weight protein complex from Hela Cells Message-ID: Date: 4 Aug 93 19:08:02 GMT Sender: news@mentor.cc.purdue.edu (USENET News) Organization: Purdue University Lines: 5 Xref: biosci bionet.molbio.proteins:788 bionet.molbio.methds-reagnts:6821 Does anyone know of any high molecular weight protein complex from Hela cells or stress-induced cells that can be pelleted at 100,000 xg for 2 hours? Please email me if you know of any. THanks in advance. vic From owner-proteins@net.bio.net Wed Aug 04 23:00:00 1993 Path: biosci!daresbury!zeta.bmc.uu.se!corax.udac.uu.se!sunic!uunet!usc!math.ohio-state.edu!magnus.acs.ohio-state.edu!usenet.ins.cwru.edu!ukma!eng.ufl.edu!usenet.ufl.edu!mailer.cc.fsu.edu!iris3.chem.fsu.edu!rrk From: rrk@iris3.chem.fsu.edu (Randal R. Ketchem) Newsgroups: bionet.molbio.proteins Subject: Re: [HELP] Software calculte the angle between 2 planes? Message-ID: Date: 5 Aug 93 03:22:29 GMT References: <139423@netnews.upenn.edu> Sender: usenet@mailer.cc.fsu.edu Organization: Florida State University -- Structural Biology Program Lines: 33 In article <139423@netnews.upenn.edu> duong@chestnut.chem.upenn.edu (Duc Duong) writes: >hi.. > >I have 5 coordinates points that define 2 planes intersect each other. >I'd like calculate the angle between them.. The problem is simple.. so >is there any software would do this kind of calculation?? I don't want >to re-invent the wheel here.. so can InsightII, Quanta?? etc.. do >these kind of stuff.. > >The five angles have the x,y,z coordinates.. > >duc Why not re-invent the wheel? Let's say 4 points are {a, b, c, d}. Let's also say that {a, b, c} defines one plane and that {b, c, d} defines the other. Note that {b, c} is on both planes, thus defining the intersection. The normal to the vectors ab and ac shall be called Nabc. The normal to the vectors bc and bd shall be called Nbcd. The angle between Nabc and Nbcd is the magnitude of the angle between the planes. To determine the sign of the angle, take the normal of Nabc and Nbcd and call the new vector Nnorm. If the angle between the vector bc and Nnorm is negative, then the sign of the angle between the planes is negative. Otherwise, the sign of the angle between the planes is positive. Of course, this only applies if you are using the right hand rule and the points are connected as vectors a-b-c-d, such as in a torsion angle calculation. Randal R. Ketchem Institute of Molecular Biophysics 904.644.7798 (voice) Florida State University 904.644.8281 (FAX) Tallahassee, FL 32306-3015 rrk@sb.fsu.edu (email) From owner-proteins@net.bio.net Wed Aug 04 23:00:00 1993 Path: biosci!daresbury!zeta.bmc.uu.se!corax.udac.uu.se!sunic!uunet!haven.umd.edu!purdue!lerc.nasa.gov!magnus.acs.ohio-state.edu!math.ohio-state.edu!sdd.hp.com!nigel.msen.com!yale.edu!yale!zip.eecs.umich.edu!umn.edu!molbio.cbs.umn.edu!paul-b From: paul-b@molbio.cbs.umn.edu (Paul Bucciaglia) Newsgroups: bionet.molbio.methds-reagnts,bionet.molbio.proteins Subject: protein expression systems Message-ID: Date: 5 Aug 93 16:09:15 GMT Sender: news@news2.cis.umn.edu (Usenet News Administration) Organization: College of Biological Sciences, U of MN Lines: 29 Xref: biosci bionet.molbio.methds-reagnts:6847 bionet.molbio.proteins:791 Nntp-Posting-Host: molbio.cbs.umn.edu Hello folks, I have been trying for months to overexpress a plant protein in e. coli. After three vectors, several media and growth conditions and more hosts than i can count on my fingers and toes, i am beginning to wonder if there ain't a better way. Results from pulse labelling experimets in aT7 expression system show that protein is being synthesized (and is soluble) but it does not accumulate to detectable levels on Coomassie stained gels. Similarly, only very low levlels of total protein (again about half soluble) were produced with pFLAG vectors as detected by monoclonal antibodies to the flag epitope. I beleive the protein is unstable in e. coli; alternatively the protein might be toxic to e. coli however no lysis of induced cultures appears and they grow almost as well as induced controls (vector only). *****I would love to hear from those who have tried other expression systems, expecially yeast and baculovirus. Any suggestions as to vectors, hosts and growth conditions would be appreciated. ****** I am particularly interested in yeast vectors which express epitopes such as the flag (yeasts contain similar enzymes as the plant enzyme i wish to oeverproduce) to aid in purification; this would save me the step of having to create my own vector/epitope/cDNA construct. Thanks in advance! Paul Bucciaglia paul-b@molbio.cbs.umn.edu From owner-proteins@net.bio.net Wed Aug 04 23:00:00 1993 Path: biosci!daresbury!zeta.bmc.uu.se!corax.udac.uu.se!sunic!pipex!uunet!haven.umd.edu!umd5.umd.edu!usenet From: jbyrd@math1.smcm.edu (Jeffery Byrd) Newsgroups: bionet.molbio.proteins Subject: Stability of beta-galactosidase Message-ID: <23r0gr$fc2@umd5.umd.edu> Date: 5 Aug 93 13:04:27 GMT Organization: University of Maryland, College Park Lines: 6 NNTP-Posting-Host: math1.smcm.edu Would anyone be able to tell me how long a molecule of beta-galactosidase is stable in E. coli before it is degraded? Thanks Jeffrey Byrd St. Mary's College of Maryland JByrd@oyster.smcm.edu From owner-proteins@net.bio.net Thu Aug 05 23:00:00 1993 Path: biosci!agate!spool.mu.edu!uwm.edu!post.its.mcw.edu!zazen!psl.wisc.edu!news From: roca@macc.wisc.edu (Alberto I Roca) Newsgroups: bionet.molbio.methds-reagnts,bionet.molbio.proteins Subject: Re: protein expression systems Message-ID: <1993Aug6.010046.23005@pslu1.psl.wisc.edu> Date: 6 Aug 93 01:00:46 GMT References: Sender: news@pslu1.psl.wisc.edu (USENET News System) Organization: Biochemistry, UW-Madison Lines: 20 Xref: biosci bionet.molbio.methds-reagnts:6862 bionet.molbio.proteins:792 X-Xxdate: Thu, 5 Aug 93 20:07:16 GMT X-Useragent: Nuntius v1.1.1d17 paul, regarding your possibly unstable protein in e.coli, have you tried any protease deficient strains? i know of a couple: BL21 from Novagen. lon(minus) and ompT(minus) CAG626 lon(minus) CAG597 rpoH(minus) CAG629 lon(minus) rpoH(minus) for the CAG strains see Baker PNAS 81(21):6779(84) for a description. unfortunately they haven't worked for my particular protein, but i thought i would pass on the information. alberto :| ================================================================= Alberto I. Roca Internet: roca@macc.wisc.edu Biochemistry Bitnet: roca@wiscmacc 420 Henry Mall University of Wisconsin-Madison Madison, Wisconsin 53706 USA From owner-proteins@net.bio.net Sun Aug 08 23:00:00 1993 Path: biosci!parc!decwrl!ames!elroy.jpl.nasa.gov!usc!sol.ctr.columbia.edu!xlink.net!math.fu-berlin.de!tertius.in-berlin.de!mpimg-berlin-dahlem.mpg.de!wegloehner From: wegloehner@mpimg-berlin-dahlem.mpg.de (Wolfgang Wegloehner) Newsgroups: bionet.molbio.methds-reagnts,bionet.molbio.proteins Subject: Re: protein expression systems Message-ID: <1993Aug8.124307.1@mpimg-berlin-dahlem.mpg.de> Date: 8 Aug 93 11:43:07 GMT References: Organization: MPI fuer Molekulare Genetik, Berlin Lines: 51 Xref: biosci bionet.molbio.methds-reagnts:6884 bionet.molbio.proteins:793 Nntp-Posting-Host: pluto Nntp-Posting-User: wegloehner In article , paul-b@molbio.cbs.umn.edu (Paul Bucciaglia) writes: > Hello folks, > > I have been trying for months to overexpress a plant protein in e. coli. After > three vectors, several media and growth conditions and more hosts than i can > count on my fingers and toes, i am beginning to wonder if there ain't a better > way. Results from pulse labelling experimets in aT7 expression system show that > protein is being synthesized (and is soluble) but it does not accumulate to > detectable levels on Coomassie stained gels. Similarly, only very low levlels > of total protein (again about half soluble) were produced with pFLAG vectors as > detected by monoclonal antibodies to the flag epitope. I beleive the protein is > unstable in e. coli; alternatively the protein might be toxic to e. coli however > no lysis of induced cultures appears and they grow almost as well as induced > controls (vector only). > > *****I would love to hear from those who have tried other expression systems, > expecially yeast and baculovirus. Any suggestions as to vectors, hosts and > growth conditions would be appreciated. ****** > > I am particularly interested in yeast vectors which express epitopes such as > the flag (yeasts contain similar enzymes as the plant enzyme i wish to > oeverproduce) to aid in purification; this would save me the step of having to > create my own vector/epitope/cDNA construct. > > Thanks in advance! > > Paul Bucciaglia > > paul-b@molbio.cbs.umn.edu > > Dear Paul, I've got exactly the same problem. I've tried to overexpress an nuclear encoded chloroplast ribosomal protein in E.coli with lots of different expression systems (lambda, trc, tac, and the pET-vectors) with absolutely no visible expression on coomassie (but the protein was detectable by western blot analysis). Because I had no time to establish the yeast or baculovirus system I gave E.coli a last chance. I used an pET derived vector who secretes your protein into the periplasm. It works wonderful. I can see a very faint new band occuring on total cell extract SDS-PAGE, but if I analyze the periplasmic fraction I have only two main components: beta-lactamase and my protein. In addition I used the BL21(DE3) strain witch is deficient in outer membrane protease (can see no degadation at all). By a simple two step-purificatin (IEC and HPLC) I can get now about 10 mg of protein from one liter. The only problem is that with this system it is rather difficult to handle large culture volumes (have a look in Current Protocols [16.6.7]). I would give coli another chance. Hope this helps Wolf From owner-proteins@net.bio.net Mon Aug 09 23:00:00 1993 Path: biosci!BIOMED.MED.YALE.EDU!SUNHW From: SUNHW@BIOMED.MED.YALE.EDU Newsgroups: bionet.molbio.proteins Subject: unknown yeast gene cloned but... Message-ID: <01H1L2XS9XUW004C6X@BIOMED.MED.YALE.EDU> Date: 10 Aug 93 19:31:16 GMT Sender: daemon@net.bio.net Lines: 9 Dear friends: Through some genetic tricks, I have cloned an unknown gene from yeast. The open reading frame predicts a 45kd protein. A Prosite search hit a match with the heme-binding motif of the cytochrome protein family (very good match). Since this gene was cloned based on functional relationship with histones, how can such a motif have anything to do with histones? My wildest guess is that this protein is a demethylase, because histones are methylated on some lysines. Any help? Your comments will be greatly appreciated! (I'm not sure how the demethylation reaction goes.) Sun from Yale From owner-proteins@net.bio.net Mon Aug 09 23:00:00 1993 Path: biosci!uwm.edu!math.ohio-state.edu!magnus.acs.ohio-state.edu!gchacko From: gchacko@magnus.acs.ohio-state.edu (George W Chacko) Newsgroups: bionet.immunology,bionet.molbio.methds-reagnts,bionet.molbio.proteins Subject: Help: epitope mapping Keywords: antibodies, epitope, Geysen Message-ID: <248f2e$276@charm.magnus.acs.ohio-state.edu> Date: 10 Aug 93 15:32:30 GMT Organization: The Ohio State University Lines: 19 Xref: biosci bionet.immunology:468 bionet.molbio.methds-reagnts:6916 bionet.molbio.proteins:794 NNTP-Posting-Host: bottom.magnus.acs.ohio-state.edu Posted for a friend. Please reply to vkapur@path.bcm.tmc.edu. --------------------------------------------------------------------------- I am looking for information on commercial suppliers of epitope mapping kits based on the technique of Geysen and coworkers (PNAS 81:3998, 1984; J. Immunol. Methods 102:259, 1987). Any information about the companies that supply these kits will be much appreciated. Many thanks. -vivek Vivek Kapur Section of Molecular Pathobiology Department of Pathology Baylor College of Medicine Houston, TX 77030 vkapur@bcm.tmc.edu vkapur@path.bcm.tmc.edu From owner-proteins@net.bio.net Mon Aug 09 23:00:00 1993 Path: biosci!BIOMED.MED.YALE.EDU!SUNHW From: SUNHW@BIOMED.MED.YALE.EDU Newsgroups: bionet.molbio.proteins Subject: nuknown yeast gene cloned but... Message-ID: <01H1LFQIVC54004C45@BIOMED.MED.YALE.EDU> Date: 11 Aug 93 01:38:02 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 9 Dear friends: Through some genetic tricks, I have cloned an unknown gene from yeast. The open reading frame predicts a 45kd protein. A Prosite search hit a match with the heme-binding motif of the cytochrome protein family (very good match). Since this gene was cloned based on functional relationship with histones, how can such a motif have anything to do with histones? My wildest guess is that this protein is a demethylase, because histones are methylated on some lysines. Any help? Your comments will be greatly appreciated! (I'm not sure how the demethylation reaction goes.) Sun from Yale From owner-proteins@net.bio.net Mon Aug 09 23:00:00 1993 Path: biosci!daresbury!doc.ic.ac.uk!agate!usenet.ins.cwru.edu!magnus.acs.ohio-state.edu!gchacko From: gchacko@magnus.acs.ohio-state.edu (George W Chacko) Newsgroups: bionet.immunology,bionet.molbio.methds-reagnts,bionet.molbio.proteins Subject: Re: Help: epitope mapping Keywords: antibodies, epitope, Geysen Message-ID: <2496nt$2rh@charm.magnus.acs.ohio-state.edu> Date: 10 Aug 93 22:16:29 GMT References: <248f2e$276@charm.magnus.acs.ohio-state.edu> Organization: The Ohio State University Lines: 4 Xref: biosci bionet.immunology:473 bionet.molbio.methds-reagnts:6924 bionet.molbio.proteins:796 NNTP-Posting-Host: bottom.magnus.acs.ohio-state.edu Condie Carmack! Thanks for your reply but there's a problem with your mailer. I can't get mail to you. George Chacko From owner-proteins@net.bio.net Tue Aug 10 23:00:00 1993 Path: biosci!daresbury!doc.ic.ac.uk!uknet!pavo.csi.cam.ac.uk!camcus!bjd12 From: bjd12@cus.cam.ac.uk (Ben Davis) Newsgroups: bionet.molbio.methds-reagnts,bionet.molbio.proteins Subject: Re: Zn/Co substitution Keywords: metalloproteinase, inhibitor Message-ID: <1993Aug11.081829.19718@infodev.cam.ac.uk> Date: 11 Aug 93 08:18:29 GMT Sender: news@infodev.cam.ac.uk (USENET news) Organization: U of Cambridge, England Lines: 9 Xref: biosci bionet.molbio.methds-reagnts:6935 bionet.molbio.proteins:798 Nntp-Posting-Host: bootes.cus.cam.ac.uk Could anybody give me some advice about replacing the Zn in a metalloproteinase with Co, and looking at inhibitor binding with UV. I've heard its a good technique, but can't find any suitable references. Thanks a lot, Ben Davis, MRC Unit for Protein Function and Design, Cambridge, UK From owner-proteins@net.bio.net Tue Aug 10 23:00:00 1993 Path: biosci!parc!decwrl!ames!elroy.jpl.nasa.gov!usc!wupost!bigboy.sbc.com!news.mtholyoke.edu!eddie.mit.edu!news.intercon.com!panix!not-for-mail From: jfehr@panix.com (James Fehr) Newsgroups: bionet.molbio.proteins Subject: Mammalian Expression Systems Message-ID: <24c9hr$63c@panix.com> Date: 12 Aug 93 02:22:51 GMT Sender: jfehr@panix.com Distribution: na Organization: PANIX Public Access Internet and Unix, NYC Lines: 9 NNTP-Posting-Host: panix.com I am trying to find the names of institutions or labs which have mammalian expression systems which do not use commerciallly available or patented systems who might be interested in licensing their systems or working with a start-up company. -- James Fehr Made with 100% recycled electrons From owner-proteins@net.bio.net Tue Aug 10 23:00:00 1993 Path: biosci!daresbury!doc.ic.ac.uk!agate!howland.reston.ans.net!usc!elroy.jpl.nasa.gov!nntp-server.caltech.edu!rickert From: rickert@cco.caltech.edu (Keith Warren Rickert) Newsgroups: sci.chem,bionet.molbio.proteins Subject: Address for company (PolyLC) Message-ID: <24bsrmINN8hr@gap.caltech.edu> Date: 11 Aug 93 22:46:14 GMT Organization: California Institute of Technology, Pasadena Lines: 11 Xref: biosci sci.chem:6319 bionet.molbio.proteins:799 NNTP-Posting-Host: sandman.caltech.edu Does anyone have an address or better yet, a phone number for a company known as PolyLC? They sell supplies for HPLC of proteins and peptide fragments, among other things. Any information would be appreciated. Keith -- Keith Rickert | Mallory the Shedding fuzzball : rickert@cco.caltech.edu | "MC" B G 5 Y L C-- I++ T+++ A- E H S V+++ F keith@imppig.caltech.edu From owner-proteins@net.bio.net Wed Aug 11 23:00:00 1993 Path: biosci!daresbury!doc.ic.ac.uk!uknet!pipex!uunet!europa.eng.gtefsd.com!emory!emoryu1!rttimme From: rttimme@emory.edu (Dr. Richard Timmer) Newsgroups: bionet.molbio.methds-reagnts,bionet.molbio.proteins Subject: Re: Zn/Co substitution Message-ID: <4278@emoryu1.cc.emory.edu> Date: 12 Aug 93 01:57:32 GMT References: <1993Aug11.081829.19718@infodev.cam.ac.uk> Followup-To: bionet.molbio.methds-reagnts Organization: Emory University, Atlanta, GA Lines: 11 Xref: biosci bionet.molbio.methds-reagnts:6969 bionet.molbio.proteins:801 X-Newsreader: Tin 1.1 PL3 Please post any responses that you get by e-mail or a summary of some sort. Thanks. **************************************************************************** | Richard Timmer | | Dept. of Physiology | | Emory Univ. School of Medicine voice: 404-727-7411 | | 1648 Pierce Drive fax: 404-727-2648 | | Atlanta, GA 30322 e-mail: rttimme@emoryu1.cc.emory.edu | **************************************************************************** From owner-proteins@net.bio.net Wed Aug 11 23:00:00 1993 Path: biosci!daresbury!doc.ic.ac.uk!agate!howland.reston.ans.net!noc.near.net!saturn.caps.maine.edu!dartvax!grafton.dartmouth.edu!knight From: knight@grafton.dartmouth.edu (John Boswell) Newsgroups: bionet.molbio.proteins Subject: Help with Phenyl Sepharose chrom. Message-ID: Date: 11 Aug 93 19:59:09 GMT Sender: news@dartvax.dartmouth.edu (The News Manager) Organization: Dartmouth College, Hanover, NH Lines: 45 Hi, First, thanks to everyone who helped with my Ponceau-S query. I'll post a summary of responses soon... Currently I'm trying to purify a protein via Phenyl sepharose chromato- graphy. I was able to get decent separation when I applied a crude protein concentrate to a 1x9cm column: Loaded with 20 mM TES, 1mM Benzamidine, 1M NaCl; eluted with: Buffer A: 20 mM TES, 1 mM benzamidine pH 7.4 Buffer B: Buffer A + 20% Ethylene glycol gradient 0-100% B over 2 hours (at 20 mL/hr), then Buffer B for another hour. This gave me two peaks; one right at the start of the gradient, which tailed off, then another *sharp* peak shortly after 100% buffer B. Western blot analysis showed that my protein came off starting with the downside of the first peak, and kept trickling off until the second peak, which had a lot of my protein of interest. I pooled all fractions that had my protein, concentrated them to about 1 mL, and washed with loading buffer. I then applied this to a NEW column of phenyl sepharose (1x9 cm), and did a step elution: 50 mM TES, 1 mM benzamidine for about 20 mL, then 50 mM TES, 1mM benzamidine, 20% ehtylene glycol for about 20 mL. What I got was two *little* "peaks" (more like blips), and that's it. My thought in doing this second column was to try to tweak the elution so that I could wash off loosely bound protein with the low salt, then elute my protein of interest with the 20% ethylene glycol. But it seems that my protein has stuck irreversibly to the column. My boss suggested that the crude extract chromatography worked so well because the "crud" in the extract stuck to the irreversible sites. The second column was loaded with a purified protein, and the *protein* stuck to the column irreversibly. *sigh* Any suggestions on how to get this protein off? I really don't want to use harsh organics to elute, since 1.) they may start attacking the matrix leading to more junk in my sample and 2.) I need to keep the protein in an environment that will keep it active. I'm new to this hydrophobic interaction chromatography, and thus *wide* open to suggestions. Thanks a bunch for reading this (too long?) notea :):) -John Boswell -- **************************************************************************** Dr. John Boswell knight@grafton.dartmouth.edu Dept. of Chemistry, Biochemistry and Molecular Biology Oregon Graduate Institute, Portland, OR 503-690-1086 From owner-proteins@net.bio.net Wed Aug 11 23:00:00 1993 Path: biosci!daresbury!doc.ic.ac.uk!agate!howland.reston.ans.net!europa.eng.gtefsd.com!uunet!sangam!vikram!imtech!mrigank From: mrigank@imtech.ernet.in (Dr. Mrigank) Newsgroups: bionet.molbio.proteins Subject: Problem with recombinant streptokinase. Message-ID: <6181@imtech.ernet.in> Date: 6 Aug 93 09:44:30 GMT Organization: Inst. of Microbial Technology, Chandigarh, India Lines: 13 Want patent information and process development of recombinant streptokinase. Facing problem in isolating a single entity streptokinase. Final purification displays two bands on the protein gel-major & minor; both active.What is the reason for the cleavage? Could the signal sequence attached be creating this effect? -- Dr. Mrigank Phone: +91 172 45004 x216 Institute of Microbial Technology Email: mrigank@imtech.ernet.in P O Box 1304, Sector 39A UUCP: Chandigarh 160 014 India. ...!uunet!sangam!vikram!imtech!mrigank ==+==+==+==+==+==+==+==+==+==+==+==+==+==+==+==+==+==+==+==+==+==+==+==+==+==+ -- When I feed the poor, they call me saint. When I ask why the poors do not have food, they call me communist - Archbishop Camaran From owner-proteins@net.bio.net Thu Aug 12 23:00:00 1993 Path: biosci!agate!howland.reston.ans.net!darwin.sura.net!cs.utk.edu!ornl!fnnews.fnal.gov!lakesis.fapesp.br!ime.usp.br!news From: fdcreina@quim.iq.usp.br Newsgroups: bionet.molbio.proteins Subject: Re: Protein expression Keywords: protein Message-ID: <24gmbj$jth@mafalda.ime.usp.br> Date: 13 Aug 93 18:25:55 GMT Organization: University of sao Paulo Lines: 2 NNTP-Posting-Host: reina1.iq.usp.br Did you check the presence of rare codons in the first 25 aa of your codong sequence? In Protein Science 2:1053-1056 we discuss a case similar to yours where the solution was to change the rare codons. From owner-proteins@net.bio.net Thu Aug 12 23:00:00 1993 Path: biosci!agate!howland.reston.ans.net!europa.eng.gtefsd.com!uunet!nih-csl!jowens.nci.nih.gov!jow From: jow@helix.nih.gov (Jim Owens) Newsgroups: bionet.molbio.proteins Subject: Information wanted about hemocyanin Message-ID: <1993Aug13.211821.28831@alw.nih.gov> Date: 13 Aug 93 21:18:21 GMT Sender: postman@alw.nih.gov (AMDS Postmaster) Organization: NIH, Lab of Genetics Lines: 26 X-Xxmessage-Id: X-Xxdate: Fri, 13 Aug 93 17: 18:19 GMT Giant keyhole limpet hemocyanin (KLH) is a popular carrier protein for immunization. Our collaborators have coupled peptides derived from the sequence of protein kinase C isoforms to KLH. My boss was embarassed by his ignorance of KLH at a seminar he gave this week. Now he is trying to learn about KLH. In the early 70's I worked for an old fashioned immunologist and did a lot of derivitizing of KLH. From an old paper (1977) we quoted a molecular weight of 50800 for the KLH monomer. Looking back at the source for that number (in Biochemistry vol5) I did not find anything about KLH, but lots about other hemocyanins. There is no entry for KLH in any of the protein or nucleic acid databases. Medline entries for hemocyanin are plentiful, but KLH is impossible to find. Does anybody out there know the amino acid composition of KLH, or know where or who we can ask about KLH? I confess to being thouroughly ignorant of the biology of the giant keyhole limpet (Megathura crenulata). As far as I can tell, the people who seem to have references in the 1960s seem to be mostly Italians. Could it be that this mollusk lives in the Mediteranean? If so, how did its blood protein become so popular with immunologists? Any help would be greatly appreciated. Thanks in advance, Jim Owens From owner-proteins@net.bio.net Thu Aug 12 23:00:00 1993 Path: biosci!agate!howland.reston.ans.net!darwin.sura.net!news.Vanderbilt.Edu!news From: PLANCHAJ@ctrvax.Vanderbilt.Edu (Tony Planchart) Newsgroups: bionet.molbio.proteins Subject: Hydroxylapatite chromatography and 8M urea Message-ID: <1993Aug13.183151.14449@news.vanderbilt.edu> Date: 13 Aug 93 18:31:51 GMT Sender: news@news.vanderbilt.edu Organization: Vanderbilt University Lines: 36 Nntp-Posting-Host: ctrvax.vanderbilt.edu X-News-Reader: VMS NEWS 1.24 I would appreciate any advice on the following problem: I am attempting to purify a cytoskeletal protein (Type III IF) using a urea extraction protocol that calls for selective separation on hydroxylapatite. The loading/elution buffer is 6M urea buffered with NaP (pH 7.2). The urea does not crytallize at 4 degrees C (this has been tested and determined to be true) and the run takes place at four degrees. The results are sporadic at best... sometimes I can purify the protein to near homegeneity with little loss to non-adsorption, sometimes I can purify it with significant loss to non-adsorption (ie most of ite comes out in the flow through) and sometimes I loose everything in the flow through (absolutely no separation). My questions are: 1. If the hydroxylapatite does not appear to be *dirty*, ie a quick baseline is achieved with column buffer prior to loading the column, does it still have to be "regenerated prior to a second use? 2. If the urea does not crystallize at 4 degrees C, does that mean that when going through the column it doesn't crystallize either... or could it be that it is crystallizing in the column? 3. Is it possible that the NaP is crystallizing (we're talking 8 to 35 mM NaP gradients here... it's difficult for me to imagine that these concentrations would reach supersaturation at four degrees C!)? 4. Is there something I'm missing here? Please post or reply via e-mail to tony%mobv01@ctrvax.vanderbilt.edu Thanks, Tony Planchart Dept. of Molecular Biology Vanderbilt University Nashville, TN From owner-proteins@net.bio.net Thu Aug 12 23:00:00 1993 Path: biosci!uwm.edu!vixen.cso.uiuc.edu!howland.reston.ans.net!noc.near.net!news.cs.brandeis.edu!binah.cc.brandeis.edu!DUCA From: duca@binah.cc.brandeis.edu (Karen Duca, a.k.a. Rocky) Newsgroups: bionet.molbio.proteins Subject: ion channel gramicidin A Message-ID: <1993Aug13.192035.27113@news.cs.brandeis.edu> Date: 13 Aug 93 19:20:35 GMT Sender: news@news.cs.brandeis.edu (USENET News System) Reply-To: duca@binah.cc.brandeis.edu Organization: Brandeis University Lines: 13 Is anyone aware of any differences in conduction properties of gramicidin is different membranes? If the membrane can support open channels at all I'm curious to know if there are any differences in selectivity of the channel, channel lifetime, etc. Any help appreciated, as I'm trying to do some theoretical modeling of small peptide channels and I'm not sure hos important this effect might be. Thanx, Karen duca@binah.cc.brandeis.edu P.S. Our mail server will be down on Aug.14-15, so please wait until Monday to reply directly. A summary of answers (assuming I get any) will be posted. From owner-proteins@net.bio.net Sat Aug 14 23:00:00 1993 Path: biosci!daresbury!doc.ic.ac.uk!warwick!qmw-dcs!qmw!demon!genesys.demon.co.uk!Duncan From: Duncan@genesys.demon.co.uk ("Dr. Duncan Clark") Newsgroups: bionet.molbio.proteins Subject: Re: Hydroxylapatite chromatography and 8M urea Message-ID: <745359308snz@genesys.demon.co.uk> Date: 14 Aug 93 20:15:08 GMT References: <1993Aug13.183151.14449@news.vanderbilt.edu> Sender: usenet@demon.co.uk Reply-To: Duncan@genesys.demon.co.uk Organization: GeneSys Ltd. Lines: 41 X-Newsreader: Simple NEWS 1.90 (ka9q DIS 1.21) In article <1993Aug13.183151.14449@news.vanderbilt.edu> PLANCHAJ@ctrvax.Vanderbilt.Edu writes: >I would appreciate any advice on the following problem: I am attempting to >purify a cytoskeletal protein (Type III IF) using a urea extraction protocol >that calls for selective separation on hydroxylapatite. The loading/elution >buffer is 6M urea buffered with NaP (pH 7.2). The urea does not crytallize at >4 degrees C (this has been tested and determined to be true) and the run takes >place at four degrees. The results are sporadic at best... sometimes I can >purify the protein to near homegeneity with little loss to non-adsorption, >sometimes I can purify it with significant loss to non-adsorption (ie >most of ite comes out in the flow through) and sometimes I loose everything in >the flow through (absolutely no separation). > >My questions are: > >1. If the hydroxylapatite does not appear to be *dirty*, ie a quick baseline >is achieved with column buffer prior to loading the column, does it still have >to be "regenerated prior to a second use? > >2. If the urea does not crystallize at 4 degrees C, does that mean that when >going through the column it doesn't crystallize either... or could it be that >it is crystallizing in the column? > >3. Is it possible that the NaP is crystallizing (we're talking 8 to 35 mM NaP >gradients here... it's difficult for me to imagine that these concentrations >would reach supersaturation at four degrees C!)? > >4. Is there something I'm missing here? I use HTP to purify restriction enzymes and a variety of modifying enzymes. The gradients are nearly always 20-400mM Kpi so that isn't your problem. I usually regenerate my columns with 1M Kpi, sometimes with 4M Urea, and don't have any problems with the column. It is possible to autoclave HTP (Biorad's) so that may be a better clean up route. I would alwys play safe and always regenerate your column. -- ----------------------------------------------------------------------------- Duncan Clark | Internet: duncan@genesys.demon.co.uk GeneSys Ltd. | Compuserve: 100015.1406@compuserve.com ----------------------------------------------------------------------------- From owner-proteins@net.bio.net Sun Aug 15 23:00:00 1993 Path: biosci!agate!howland.reston.ans.net!europa.eng.gtefsd.com!uunet!pipex!uknet!warwick!qmw-dcs!qmw!demon!visigoth.demon.co.uk!user From: pettsj@visigoth.demon.co.uk (James Petts) Newsgroups: bionet.molbio.proteins Subject: Laura Walsh's Annotated List Message-ID: Date: 16 Aug 93 23:05:09 GMT Sender: news@demon.co.uk (Usenet Administration) Followup-To: bionet.molbio.proteins Organization: No Affiliation Lines: 12 Nntp-Posting-Host: visigoth.demon.co.uk Can anybody point me in the direction of Laura Walsh's annotated PDB list, please? -- ===> James Petts <=== ========================================================================= pettsj@visigoth.demon.co.uk ..oo000oo.. PGP 2.X key on the servers ========================================================================= I feel that if a person can't communicate, the very least he can do is shut up. -- Tom Lehrer ========================================================================= From owner-proteins@net.bio.net Sun Aug 15 23:00:00 1993 Path: biosci!agate!howland.reston.ans.net!gatech!prism!gt1619a From: gt1619a@prism.gatech.EDU (James D. McIninch) Newsgroups: bionet.general,bionet.software,bionet.molbio.proteins Subject: Updated GenMark Gene Recognition Server Annoncement Message-ID: <108955@hydra.gatech.EDU> Date: 16 Aug 93 14:29:51 GMT Followup-To: bionet.general Organization: Georgia Institute of Technology Lines: 87 Xref: biosci bionet.general:5724 bionet.software:5658 bionet.molbio.proteins:809 --- GenMark Server *** ANOUNCEMENT --- genmark@ford.gatech.edu We are pleased to announce that the GenMark server, software and data, has been updated. A number of new features have been added and many previously available features have been updated. The GenMark server provides an E-Mail based gene finding service using the GenMark algorithm (based on non-stationary Markov chain models) which was developped at the Georgia Institute of Technology (Atlanta, GA) and at the Institute of Molecular Genetics (Moscow). The GenMark server accepts messages containing DNA sequences in a very simple format. The submitter may specify the nature of the algorithm used by species name and specify parameters affecting the complexity of the analysis. In its most simple form, a GenMark query may look like this: % mail genmark@ford.gatech.edu Subject: genmark data acatgcatcgatcatcagcatcagcatatacgatcagctacatcgatcatgaacgttacgtga atctagctcagcatgcatcagtcagtcatgcatgcatgatgcatatgcatactgctatgcatc atcgagctagcatacgatcgctcgccctagctaaagctagcatagcgatcg . EOT Summary of features ------------------------------------------------------------------------------- - List of DNA sequence regions predicted as protein-coding in a certain frame. - Optional detailed report on the GenMark evaulation of the coding poten- tial of the sequence in the form of PostScript graphical output (to print on a laser printer). - NEW OPTION: Immediate sending of DNA sequence regions predicted as pro- tein-coding to a BLAST server for sequence homology searches using the BLAST algorithm (NCBI/NIH). BLAST results are sent directly to the submitter. - NEW OPTION: A new matrix is available permitting the analysis of human sequences (currently not very sophisticted, exons shorter than 60bp may be missed). - NEW OPTION: Search for horizontally transferred genes and intervening sequences in E. Coli as well as assessment of gene expression level. (Using the default settings, the standard E. Coli information predicts the coding potential of 96bp fragments with a 4% false negative rate and a 3% false positive rate). FOR MORE INFORMATION ------------------------------------------------------------------------------- You may retrieve a copy of the new instructions and explanation of features for using GenMark as well as an up to date list of matrices by send- ing an E-Mail message with the word "instructions" in the subject or body of the letter to: genmark@ford.gatech.edu If you would like to contact us personally, you may do so by sending electronic mail to Dr. M. Borodovsky at: mb56@prism.gatech.edu ... or ot J. McIninch at: gt1619a@prism.gatech.edu (Dr. Borodovsky will be unavailable until August 18, 1993) REFERENCES ------------------------------------------------------------------------------- Borodovsky M, McIninch J. (1993) GENMARK: Parallel Gene Recognition for Both DNA strands, Computers & Chemistry, 17, N2, 123-133. Borodovsky M, McIninch J. (1993) Prediction of Gene Locations Using DNA Markov Chain Models. Proceedings of the Seconf International Conference on Super- computing Bioinformatics and Complex Genome Analysis. St. Petersberg, FL, 199, World Scientific, 231-248. Borodovsky, M.Yu., Sprizhitsky, Yu.A., Golovanov, E.I., Alexandrov, A.A.,(1986) Statistical Patterns in the Primary Structure of the Functional Regions of the Escherichia Coli Genome. III. Computer Recognition of Protein Coding Regions. Molecular Biology, 20, 1144-1150. From owner-proteins@net.bio.net Mon Aug 16 23:00:00 1993 Path: biosci!bcm!cs.utexas.edu!uunet!munnari.oz.au!metro!basser.cs.su.oz.au!news.adelaide.edu.au!ajeffrie From: ajeffrie@waite.adelaide.edu.au (Alex Jeffries) Newsgroups: bionet.molbio.proteins Subject: Basic amino acids: how may are significant? Summary: What % of a.a. need to be basic before it is considered a high level? Keywords: basic amino acids SDS-gel electrophoresis Message-ID: <24perh$oaa@huon.itd.adelaide.edu.au> Date: 17 Aug 93 02:13:05 GMT Organization: The University of Adelaide, Waite Campus Lines: 25 NNTP-Posting-Host: schooner.waite.adelaide.edu.au Faculty: Agricultural & Natural Resource Sciences Hi all, I have read that proteins with a high basic amino acid content can have their Mr overestimated when sized using SDS-polyacrylamide gel electrophoresis. The usual reference for this is; Daubert, S. D. abd Bruening, G. (1984). detection of genome-linked proteins of plant and animal viruses. In _Methods in virology._ Maramarosch, K. and Koprowski, H. eds. 347-379. Academic Press, Orlando, Florida. I have read this reference but can not find any mention of what exactly "high" is. Does any one know if, say 12% Arg Asp and/or Lys would be considered high or would 25% be required? Thanks in advance, Alex Jeffries -------------------------------------------------------------------------------- Alex Jeffries Dept. of Plant Sciences ajeffrie@waite.adelaide.edu.au Waite Agricultural Research Institute The University of Adelaide Australia -------------------------------------------------------------------------------- From owner-proteins@net.bio.net Mon Aug 16 23:00:00 1993 Path: biosci!bcm!cs.utexas.edu!wupost!howland.reston.ans.net!xlink.net!scsing.switch.ch!kanin.arnes.si!cathy.ijs.si!kuhelj From: Robert.Kuhelj@ijs.si (Robert Kuhelj, IJS) Newsgroups: bionet.molbio.proteins Subject: Help! Checking corectness of folding Message-ID: <1993Aug17.104044.511@cathy.ijs.si> Date: 17 Aug 93 08:40:43 GMT Organization: J. Stefan Institute, Lj, Slovenia Lines: 21 Hi there, I am trying to refold one of the proteinases, cathepsin B. I have this enzyme(recombinant product!) solubilized in 8 M urea and I'm diluting it into buffers containing various redox pairs. Till now I have been checking the corectness of folding by determining the enzyme activity. Unfortunately, I have to activate this enzyme by cutting of the pro-region (it is an proenzyme) before performing enzyme activity test and this task takes about a few hours. QUESTION: Is there any alternative simple method to check the corectness of folding, i.e. the percentage of molecules correctly folded? What about native PAGE? Is it enough sensitive to distinguish between different conformational states of the same protein? Robert Kuhelj, Dept. of Biochem. & Mol Biol., Jozef Stefan Institute, Ljubljana, Slovenia E-mail address: Robert.Kuhelj@ijs.si From owner-proteins@net.bio.net Mon Aug 16 23:00:00 1993 Path: biosci!daresbury!daresbury!news From: WALLACE@IT.IRBM ("Andrew, Tel. +39-6-91093434") Newsgroups: bionet.molbio.proteins Subject: RE: Help! Checking corectness of folding Message-ID: <1993Aug17.172216.18259@gserv1.dl.ac.uk> Date: 17 Aug 93 17:18:32 GMT Sender: list-admin@daresbury.ac.uk Distribution: bionet Lines: 23 Precedence: first-class Original-To: Robert.Kuhelj@si.ijs Original-Cc: proteins@uk.ac.daresbury, WALLACE@IRBM.IT >Is there any alternative simple method to check the corectness of folding, i.e. >the percentage of molecules correctly folded? What about native PAGE? Is it >enough sensitive to distinguish between different conformational states of >the same protein? >Robert Kuhelj, Dept. of Biochem. & Mol Biol., Jozef Stefan Institute, >Ljubljana, Slovenia Native PAGE should do the job for you and although it will only give a rough idea of what's going on, it should be simple and quick enough to meet your needs. A good guide to getting started is David Goldenberg's chapter on protein conformation analysis by gel electrophoresis in the volume "Protein Structure: A Practical Approach" in the IRL Press Practical Approach book series (ISBN 0 19 963001), I recommended you get hold of a copy. If you need more precise information about the folded state of your protein, you'll probably have to turn to CD or tryptophan fluorescence methods. Laser-light scattering might be another possibility but I don't have much relevant information on it. Hope this helps, Andrew Wallace Department of Biochemistry, IRBM P. Angeletti, Pomezia, Italy From owner-proteins@net.bio.net Mon Aug 16 23:00:00 1993 Path: biosci!daresbury!doc.ic.ac.uk!pipex!uunet!psinntp!alsys1!David From: David S. Gottfried Newsgroups: bionet.molbio.proteins Subject: Re: Help! Checking corectness of folding Message-ID: <2057@alsys1.aecom.yu.edu> Date: 17 Aug 93 12:38:34 GMT References: <1993Aug17.104044.511@cathy.ijs.si> Sender: news@alsys1.aecom.yu.edu Organization: Albert Einstein College of Medicine Lines: 21 Nntp-Posting-Host: marcus.aecom.yu.edu In article <1993Aug17.104044.511@cathy.ijs.si> Robert.Kuhelj@ijs.si (Robert Kuhelj, IJS) writes: : > >Is there any alternative simple method to check the corectness of folding, i.e. >the percentage of molecules correctly folded? What about native PAGE? Is it >enough sensitive to distinguish between different conformational states of >the same protein? > one possibility is to check if the same amount of helix and sheet structure is there using circular dichroism (CD) spectrsocopy. alternatively, and complimentarily, using protein fluorescence (if any Trp present) can give you a qualitative picture of correct tertiary structure. =============================== David S. Gottfried Albert Einstein College of Medicine Dept. of Physiology and Biophysics gottfrie@aecom.yu.edu =============================== From owner-proteins@net.bio.net Mon Aug 16 23:00:00 1993 Path: biosci!parc!decwrl!decwrl!usenet.coe.montana.edu!netnews.nwnet.net!serval!owl.csrv.uidaho.edu!crow.csrv.uidaho.edu!raman913 From: raman913@crow.csrv.uidaho.edu (Raman Ramanujam) Newsgroups: bionet.molbio.proteins Subject: Re: What are these? Message-ID: <24r4qfINNrrh@owl.csrv.uidaho.edu> Date: 17 Aug 93 17:34:07 GMT References: <24phe1$k87@cyberspace.com> Organization: University of Idaho, Moscow, Idaho Lines: 15 NNTP-Posting-Host: crow.csrv.uidaho.edu X-Newsreader: TIN [version 1.1 PL8] Warren Victorian (warren@cyberspace.com) wrote: : I found these wierd international phone sex lines in a magazine the : otherday and I was just wondering how these people can offer a service : like this for free. It makes no sence to me. Anyways it is pretty hardcore : and anyone into that type of stuff should give it a shout. : 011-239-129-2618 : or : 011-239-129-2620 Hey , I don't think you have the right newsgroup for your question. Please look into the full groupo list and post this in the appropriate one Do not post inappropriate ones on this group or follow it up. Thanks in advance. From owner-proteins@net.bio.net Mon Aug 16 23:00:00 1993 Path: biosci!uwm.edu!vixen.cso.uiuc.edu!howland.reston.ans.net!noc.near.net!das-news.harvard.edu!husc-news.harvard.edu!husc8.harvard.edu!fujita1 From: fujita1@husc8.harvard.edu (Kenji Fujita) Newsgroups: bionet.molbio.proteins Subject: Re: Help! Checking corectness of folding Message-ID: <1993Aug17.161932.27347@husc14.harvard.edu> Date: 17 Aug 93 20:19:32 GMT References: <1993Aug17.104044.511@cathy.ijs.si> Organization: Harvard University Science Center Lines: 31 Nntp-Posting-Host: husc8.harvard.edu In article <1993Aug17.104044.511@cathy.ijs.si> Robert.Kuhelj@ijs.si (Robert Kuhelj, IJS) writes: >Hi there, > > >I am trying to refold one of the proteinases, cathepsin B. I have this >enzyme(recombinant product!) solubilized in 8 M urea and I'm diluting it into >buffers containing various redox pairs. Till now I have been checking the >corectness of folding by determining the enzyme activity. Unfortunately, I have >to activate this enzyme by cutting of the pro-region (it is an proenzyme) >before performing enzyme activity test and this task takes about a few hours. > >QUESTION: > >Is there any alternative simple method to check the corectness of folding, i.e. >the percentage of molecules correctly folded? What about native PAGE? Is it >enough sensitive to distinguish between different conformational states of >the same protein? > >Robert Kuhelj, Dept. of Biochem. & Mol Biol., Jozef Stefan Institute, >Ljubljana, Slovenia > >E-mail address: Robert.Kuhelj@ijs.si If you have the equipment, you might want to try circular dichroism. This will give you some idea if you have correct secondary structure, at least. -- ******************************************************************************* *** Kenji Fujita *** *** fujita1@husc.harvard.edu (617) 864-1634 *** ******************************************************************************* From owner-proteins@net.bio.net Mon Aug 16 23:00:00 1993 Path: biosci!agate!howland.reston.ans.net!gatech!rutgers!princeton!tcp9kip60.princeton.edu!user From: SHANEY@WATSON.PRINCETON.EDU (Steven A. Haney) Newsgroups: bionet.molbio.proteins Subject: Re: Hydroxylapatite chromatography and 8M urea Message-ID: Date: 17 Aug 93 21:37:03 GMT References: <1993Aug13.183151.14449@news.vanderbilt.edu> <745359308snz@genesys.demon.co.uk> Sender: news@Princeton.EDU (USENET News System) Followup-To: bionet.molbio.proteins Organization: Dept. of Mol. Biol. Princeton Univ. Lines: 59 Originator: news@nimaster Nntp-Posting-Host: tcp9kip60.princeton.edu In article <745359308snz@genesys.demon.co.uk>, Duncan@genesys.demon.co.uk ("Dr. Duncan Clark") wrote: > > In article <1993Aug13.183151.14449@news.vanderbilt.edu> PLANCHAJ@ctrvax.Vanderbilt.Edu writes: > > >I would appreciate any advice on the following problem: I am attempting to > >purify a cytoskeletal protein (Type III IF) using a urea extraction protocol > >that calls for selective separation on hydroxylapatite. The loading/elution > >buffer is 6M urea buffered with NaP (pH 7.2). The urea does not crytallize at > >4 degrees C (this has been tested and determined to be true) and the run takes > >place at four degrees. The results are sporadic at best... sometimes I can > >purify the protein to near homegeneity with little loss to non-adsorption, > >sometimes I can purify it with significant loss to non-adsorption (ie > >most of ite comes out in the flow through) and sometimes I loose everything in > >the flow through (absolutely no separation). > > > >My questions are: > > > >1. If the hydroxylapatite does not appear to be *dirty*, ie a quick baseline > >is achieved with column buffer prior to loading the column, does it still have > >to be "regenerated prior to a second use? > > > >2. If the urea does not crystallize at 4 degrees C, does that mean that when > >going through the column it doesn't crystallize either... or could it be that > >it is crystallizing in the column? > > > >3. Is it possible that the NaP is crystallizing (we're talking 8 to 35 mM NaP > >gradients here... it's difficult for me to imagine that these concentrations > >would reach supersaturation at four degrees C!)? > > > >4. Is there something I'm missing here? > > I use HTP to purify restriction enzymes and a variety of modifying enzymes. > The gradients are nearly always 20-400mM Kpi so that isn't your problem. I > usually regenerate my columns with 1M Kpi, sometimes with 4M Urea, and don't > have any problems with the column. It is possible to autoclave HTP (Biorad's) > so that may be a better clean up route. I would alwys play safe and always > regenerate your column. > > -- > ----------------------------------------------------------------------------- > Duncan Clark | Internet: duncan@genesys.demon.co.uk > GeneSys Ltd. | Compuserve: 100015.1406@compuserve.com > ----------------------------------------------------------------------------- It is important to payattention to the fact that NaPi is much less soluble at 4oC than KPi. I have had some problems with sodium phosphate in the past (although 35 mM does not seem like it would be a problem). Unless you require that sodium be present, it might be safer to use potassium phosphate buffered solutions. Good Luck, Steve. From owner-proteins@net.bio.net Tue Aug 17 23:00:00 1993 Path: biosci!daresbury!s-crim1!lhb From: lhb@s-crim1.dl.ac.uk (L.H. Bell) Newsgroups: bionet.molbio.proteins Subject: Re: What are these? Message-ID: <24su6f$gl3@mserv1.dl.ac.uk> Date: 18 Aug 93 09:53:19 GMT References: <24phe1$k87@cyberspace.com> <24r4qfINNrrh@owl.csrv.uidaho.edu> Sender: lhb@s-crim1 (L.H. Bell) Organization: SERC Daresbury Lab, Warrington, U.K. Lines: 23 NNTP-Posting-Host: s-crim1.dl.ac.uk In article <24r4qfINNrrh@owl.csrv.uidaho.edu>, raman913@crow.csrv.uidaho.edu (Raman Ramanujam) writes: |> Warren Victorian (warren@cyberspace.com) wrote: |> : I found these wierd international phone sex lines in a magazine the |> : otherday and I was just wondering how these people can offer a service |> : like this for free. It makes no sence to me. Anyways it is pretty hardcore |> : and anyone into that type of stuff should give it a shout. |> |> : (numbers deleted) |> |> Hey , I don't think you have the right newsgroup for your question. |> Please look into the full group list and post this in the appropriate one |> Do not post inappropriate ones on this group or follow it up. |> |> Thanks in advance. This phone line message was posted to every newsgroup. It is also not the first time that this message has been posted. Anyone who objects should send mail to roor@cyberspace.com or support@cyberspace.com and ask them to expel Warren Victorian. Lachlan Bell lhb@s-crim1.dl.ac.uk From owner-proteins@net.bio.net Tue Aug 17 23:00:00 1993 Path: biosci!agate!howland.reston.ans.net!europa.eng.gtefsd.com!uunet!news!demon!visigoth.demon.co.uk!user From: pettsj@visigoth.demon.co.uk (James Petts) Newsgroups: bionet.molbio.proteins Subject: Sequence Search of PDB Message-ID: Date: 18 Aug 93 00:45:19 GMT Sender: news@demon.co.uk (Usenet Administration) Followup-To: bionet.molbio.proteins Organization: No Affiliation Lines: 15 Nntp-Posting-Host: visigoth.demon.co.uk Hi. Does anybody know of any software which is equivalent to the old SEARCHDB program distributed by Brookhaven which runs on Macs or Un*x? We need something local (not net-based) which will take a sequence and report then filename if it is found in a PDB file. -- ===> James Petts <=== ========================================================================= pettsj@visigoth.demon.co.uk ..oo000oo.. PGP 2.X key on the servers ========================================================================= I feel that if a person can't communicate, the very least he can do is shut up. -- Tom Lehrer ========================================================================= From owner-proteins@net.bio.net Tue Aug 17 23:00:00 1993 Path: biosci!parc!decwrl!decwrl!spool.mu.edu!umn.edu!limerick.cbs.umn.edu!hiroki From: hiroki@limerick.cbs.umn.edu (Hiroki Morizono) Newsgroups: bionet.molbio.proteins Subject: Re: Help! Checking corectness of folding Message-ID: Date: 18 Aug 93 09:11:10 GMT References: <1993Aug17.172216.18259@gserv1.dl.ac.uk> Sender: news@news2.cis.umn.edu (Usenet News Administration) Reply-To: hiroki@limerick.cbs.umn.edu Distribution: bionet Organization: University of Minnesota, Twin Cities Lines: 56 Nntp-Posting-Host: limerick.cbs.umn.edu X-Newsreader: Tin 1.1 PL5 Andrew, Tel. +39-6-91093434 (WALLACE@IT.IRBM) wrote: : >Is there any alternative simple method to check the corectness of folding, i.e. : >the percentage of molecules correctly folded? What about native PAGE? Is it : >enough sensitive to distinguish between different conformational states of : >the same protein? : : >Robert Kuhelj, Dept. of Biochem. & Mol Biol., Jozef Stefan Institute, : >Ljubljana, Slovenia : : Native PAGE should do the job for you and although it will only give a rough : idea of what's going on, it should be simple and quick enough to meet your : needs. A good guide to getting started is David Goldenberg's chapter on : protein conformation analysis by gel electrophoresis in the volume : "Protein Structure: A Practical Approach" in the IRL Press Practical Approach : book series (ISBN 0 19 963001), I recommended you get hold of a copy. : If you need more precise information about the folded state of your protein, : you'll probably have to turn to CD or tryptophan fluorescence methods. : Laser-light scattering might be another possibility but I don't have much : relevant information on it. : : Hope this helps, : : Andrew Wallace : Department of Biochemistry, IRBM P. Angeletti, Pomezia, Italy If you are able to see changes in light scattering, then a simple native PAGE should do the trick, and won't require special instruments. It really depends on what your definition of "properly folded" or "alternate conformational states" is. Some people quibble over minute differences, Other people consider a range between near unfolded and fully folded to be a conformational difference. Another possibility not suggested is difference UV. If you have a batch of pre-protein which can be activated properly, then compare its spectra with your fresh batch. Measuring fluorescence across a range of wavelengths will also give some indication of changes in residue interactions that get peturbed if you have different states. If you are going to do CD, you may as well do the experiment of comparing changes in CD spectra between the pre-protein and the protein while you are at it, that's probably worth a figure or two in a paper. To determine percentage of correctly folded stuff, you have to take into account that most of these conformations probably are going to interconvert or aggregate, and that by perturbing the equilibrium distribution of these species by some type of separation method, you will get fairly meaningless information unless the interconversion rate is significantly slower than your separation rate. If you just want to get an idea of "Is this batch going to be any good or not?" then it won't really matter. Hiroki From owner-proteins@net.bio.net Tue Aug 17 23:00:00 1993 Path: biosci!daresbury!doc.ic.ac.uk!agate!spool.mu.edu!sdd.hp.com!network.ucsd.edu!riscsm!manuel From: manuel@scripps.edu (Manuel Baca) Newsgroups: bionet.molbio.proteins Subject: Re: Basic amino acids: how may are significant? Keywords: basic amino acids SDS-gel electrophoresis Message-ID: <1993Aug18.171206.12464@riscsm.scripps.edu> Date: 18 Aug 93 17:12:06 GMT References: <24perh$oaa@huon.itd.adelaide.edu.au> Sender: manuel@scripps.edu Organization: The Scripps Research Institute, La Jolla, California, USA Lines: 33 In article <24perh$oaa@huon.itd.adelaide.edu.au> ajeffrie@waite.adelaide.edu.au (Alex Jeffries) writes: > Hi all, > > I have read that proteins with a high basic amino acid content can have >their Mr overestimated when sized using SDS-polyacrylamide gel electrophoresis. >The usual reference for this is; > > Daubert, S. D. abd Bruening, G. (1984). detection of genome-linked >proteins of plant and animal viruses. In _Methods in virology._ Maramarosch, K. >and Koprowski, H. eds. 347-379. Academic Press, Orlando, Florida. > > I have read this reference but can not find any mention of what exactly >"high" is. Does any one know if, say 12% Arg Asp and/or Lys would be considered >high or would 25% be required? > > Thanks in advance, > > Alex Jeffries Think not in terms of the percentage of basic residues (Lys, Arg, His but *not* Asp), but rather on the pI of the protein, as if there are 20% basic residues, but 25% acidic (Asp, Glu), then the protein will actually be acidic. Any protein with a pI above 9 can be considered sufficiently basic that it will probably migrate abnormally on SDS PAGE. The more basic, the more abnormally it will probably migrate. If your protein is glycosylated, this too can cause reduced electrophoretic mobility. -- Manuel Baca Scripps Research Institute From owner-proteins@net.bio.net Wed Aug 18 23:00:00 1993 Path: biosci!uwm.edu!cs.utexas.edu!uunet!spool.mu.edu!torn!nott!emr1!weathere From: weathere@emr1.emr.ca (Carl Weatherell) Newsgroups: bionet.molbio.proteins Subject: Residue Molecular Weights Message-ID: <1993Aug19.211342.5842@emr1.emr.ca> Date: 19 Aug 93 21:13:42 GMT Organization: Dept. of Energy, Mines, and Resources, Ottawa Lines: 15 X-Newsreader: TIN [version 1.1 PL8] I would like to know the molecular weights of the individual chains of the following proteins; thyroglobulin (bovine) gamma-globulin alcohol dehydrogenase (yeast) beta-amylase (bovine) apoferritin (bovine) Can someone email the values or at least point me to where I may find them. I am using them for SEC in SDS to analyze an industrial product which is not amenable to non-denaturing SEC. Thanks in advance. Carl Weatherell email weathere@emr1.emr.ca From owner-proteins@net.bio.net Wed Aug 18 23:00:00 1993 Path: biosci!MSU.EDU!21337MGR From: 21337MGR@MSU.EDU ("Jonathan.Walton") Newsgroups: bionet.molbio.proteins Subject: basic amino acids and PAGE Message-ID: <9308191435.AA04020@net.bio.net> Date: 19 Aug 93 14:34:00 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 15 In regards to recent messages re: basic amino acids causing abnormal migration on SDS-PAGE, I have a related query. Fungal xylanase has a very high pI with lots of basic amino acids. But it runs normally on SDS-PAGE, i.e. its apparent size matches with predicted size based on DNA sequence. But by gel filtration it runs much smaller (22 kD vs. 8-10 kD). We used a silica-based HPLC (TSK brand) column; others with other related fungal xylanases found the same discrepancy between SDSPAGE and GF using GF matrices of other types (Sephadex, etc.). Can anyone explain why such a protein would act this way? If one assumes its shape is not globular (reasonable, considering how small it is) but elongated (sausage-shaped) then by my understanding it should appear larger than it really is by GF. Can anyone enlighten me? Jon Walton 21337mgr@msu.edu From owner-proteins@net.bio.net Wed Aug 18 23:00:00 1993 Path: biosci!uwm.edu!vixen.cso.uiuc.edu!howland.reston.ans.net!spool.mu.edu!bloom-beacon.mit.edu!mcrcim.mcgill.edu!sifon!athena.ulaval.ca!NewsWatcher!user From: NLANDRY@campus.ulaval.ca (Nathalie Landry) Newsgroups: bionet.molbio.proteins Subject: recombinant interleukin 2 Message-ID: Date: 19 Aug 93 17:48:34 GMT Sender: news@athena.ulaval.ca Followup-To: bionet.molbio.proteins Organization: Universite Laval Lines: 3 Nntp-Posting-Host: 132.203.6.32 Has anyone got a good method for the renaturation of r h IL-2 from inclusion bodies ?Il-2 is now in guanidine . Michel Page E-mail at mpage@campus.ulaval.ca From owner-proteins@net.bio.net Wed Aug 18 23:00:00 1993 Path: biosci!agate!howland.reston.ans.net!europa.eng.gtefsd.com!uunet!psinntp!newsserver.pixel.kodak.com!kodaki.kodak.com!amm From: amm@kodaki.kodak.com (Alan Mathiowetz) Newsgroups: bionet.molbio.proteins Subject: Re: Checking Predicted Protein Folding Message-ID: Date: 19 Aug 93 16:59:23 GMT References: <01H1XBRPCUR6001IMU@nic.the.net> Sender: usenet@newsserver.pixel.kodak.com Distribution: bionet Organization: Eastman Kodak Research Labs Lines: 22 In article <01H1XBRPCUR6001IMU@nic.the.net> SHAUN%JASON.DECNET@relay.the.net ("Shaun D. Black") writes: >Colleagues, > In a similar vein to the current discussion about checking the folding >of a polypeptide, I wonder if anyone knows of software that will check the >predicted tertiary structure of a polypeptide to see if there are any >problems in the structure. Certainly the minimized energy of the structure >relative to model structures is a good place to start. But, I'm interested >in software that might check local packing, deviances from ideal bonding >angles, or calculate the density of the structure. Any and all thoughts >are appreciated. Cheers, Shaun The 3-D Profile method of David Eisenberg and colleagues can check a protein model. It doesn't specifically do what you ask; rather, features such as solvent-accessible surface, % hydrophobicity, and secondary structure are used to assign an environment type to each residue in the protein. Then, the model is scored according to how likely it is that each residue would be in the type of environment you have put it in. You can plot the score vs. residue to get an idea of what regions of your model are good and which are bad. The program is commercially available from Biosym as an add-on to Insight. We have tried a demo of the program and it is quite easy to use and gives valuable output. From owner-proteins@net.bio.net Wed Aug 18 23:00:00 1993 Path: biosci!daresbury!s-crim1!lhb From: lhb@s-crim1.dl.ac.uk (L.H. Bell) Newsgroups: bionet.molbio.proteins Subject: Re: Checking Predicted Protein Folding Message-ID: <250dc6$anp@mserv1.dl.ac.uk> Date: 19 Aug 93 17:30:46 GMT References: <01H1XBRPCUR6001IMU@nic.the.net> Sender: lhb@s-crim1 (L.H. Bell) Distribution: bionet Organization: SERC Daresbury Lab, Warrington, U.K. Lines: 41 NNTP-Posting-Host: s-crim1.dl.ac.uk There is a package of programs called procheck (Laskowski et al., 1993), which may do what you are looking for. Quoting from the programs docs; "The aim of PROCHECK is to assess both the overall stereochemical quality of a given protein structure, as compared with well-refined structures at the same resolution, and to give an indication of its local,residue-by-residue reliability. To assess a structure, the program makes use of a number of parameters that have been found to be good indicators of stereochemical quality, described in detail in Morris et al. (1992). These parameters, which are for the most part not included in standard refinement procedures (and so are less likely to be biased by them), are listed in Table 1 of Appendix A. The checks also make use of ``ideal'' bond lengths and bond angles, as derived from a recent and comprehensive analysis (Engh & Huber, 1991) of small molecule structures in the Cambridge Structural Database, CSD - now numbering over 80,000 structures. Engh R A & Huber R (1991). Accurate bond and angle parameters for X-ray protein structure refinement. Acta Cryst., A47, 392-400. Laskowski R A, MacArthur M W, Moss D S & Thornton J M (1993). PROCHECK: a program to check the stereochemical quality of protein structures. J. Appl. Cryst., 26, 283-291. Morris A L, MacArthur M W, Hutchinson E G & Thornton J M (1992). Stereochemical quality of protein structure coordinates. Proteins, 12, 345-364." If there is anybody interested in this program who is a member of the UK's academic community, then you can try out the program on the SERC's SEQNET facility (seqnet.daresbury.ac.uk) Otherwise, the person to e-mail about this program is roman@uk.ac.ucl.bioc.bsm Hope this is was helpful, Lachlan Bell From owner-proteins@net.bio.net Wed Aug 18 23:00:00 1993 Path: biosci!uwm.edu!cs.utexas.edu!uunet!pipex!sunic!corax.udac.uu.se!zeta.bmc.uu.se!daresbury!daresbury!news From: WALLACE@IT.IRBM ("Andrew, Tel. +39-6-91093434") Newsgroups: bionet.molbio.proteins Subject: RE: basic amino acids and PAGE Message-ID: <1993Aug19.161400.24923@gserv1.dl.ac.uk> Date: 19 Aug 93 16:11:04 GMT Sender: list-admin@daresbury.ac.uk Distribution: bionet Lines: 21 Precedence: first-class Original-To: 21337MGR@MSU.EDU Original-Cc: proteins@uk.ac.daresbury, WALLACE@IRBM.IT In message bionet.molbio.proteins Msg # 479 Jon Walton writes: >In regards to recent messages re: basic amino acids causing abnormal migration >on SDS-PAGE, I have a related query. Fungal xylanase has a very high pI with >lots of basic amino acids. But it runs normally on SDS-PAGE, i.e. its >apparent size matches with predicted size based on DNA sequence. But by gel >filtration it runs much smaller (22 kD vs. 8-10 kD). We used a silica-based >HPLC (TSK brand) column; others with other related fungal xylanases found the >same discrepancy between SDSPAGE and GF using GF matrices of other types >(Sephadex, etc.). Could it be that the protein is interacting with the column matrix, thus being slightly retarded in its elution volume and thus appearing smaller than it really is? You might expect an effect like this with a highly basic protein and silica- or dextran-based matrices, which have a slight acidic character. Maybe you could try increasing the salt concentration of the column buffer to, say, 400 mM or so, which might help to prevent such non-specific interactions. Just a suggestion... Andrew From owner-proteins@net.bio.net Wed Aug 18 23:00:00 1993 Path: biosci!relay.the.net!SHAUN%JASON.DECNET From: SHAUN%JASON.DECNET@relay.the.net ("Shaun D. Black") Newsgroups: bionet.molbio.proteins Subject: Checking Predicted Protein Folding Message-ID: <01H1XBRPCUR6001IMU@nic.the.net> Date: 19 Aug 93 15:58:04 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 13 Colleagues, In a similar vein to the current discussion about checking the folding of a polypeptide, I wonder if anyone knows of software that will check the predicted tertiary structure of a polypeptide to see if there are any problems in the structure. Certainly the minimized energy of the structure relative to model structures is a good place to start. But, I'm interested in software that might check local packing, deviances from ideal bonding angles, or calculate the density of the structure. Any and all thoughts are appreciated. Cheers, Shaun =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-= = Shaun D. Black, PhD | Internet: shaun%jason.decnet@relay.the.net = = Dept. of Biochemistry | University of Texas Health Center, at Tyler = =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-= From owner-proteins@net.bio.net Thu Aug 19 23:00:00 1993 Path: biosci!daresbury!doc.ic.ac.uk!uknet!mcsun!sun4nl!sci.kun.nl!caos.kun.nl!jackl From: jackl@caos.kun.nl (Jack Leunissen) Newsgroups: bionet.molbio.proteins Subject: Re: Sequence Search of PDB Message-ID: <1993Aug20.091107.12848@caos.kun.nl> Date: 20 Aug 93 09:11:07 GMT References: Organization: CAOS/CAMM Lines: 29 pettsj@visigoth.demon.co.uk (James Petts) writes: >Hi. Does anybody know of any software which is equivalent to the old >SEARCHDB program distributed by Brookhaven which runs on Macs or Un*x? >We need something local (not net-based) which will take a sequence and >report then filename if it is found in a PDB file. >-- > ===> James Petts <=== You might try the ATLAS program, distributed on CDROM by the NBRF (for infor- mation: PIRMAIL@GUNBRF.BITNET). It contains (a.o.) the NRL_3D database, which has the sequences, and documentation, in it from the current PDB. You can search for sequences, allowing for mismatches, very rapidly. You can also search for references, authors, features, etc. The program run on VAX/VMS, ULTRIX (RISC), PC/DOS, and Macintosh (I'm not certain about the last). Hope this is what you're looking for... Jack -- +----------------------------+-----------------------------------+ Jack A.M. Leunissen, Ph.D. | CAOS/CAMM Center Email: jackl@caos.kun.nl | University of Nijmegen Tel. : +31 80 65 22 48 | Toernooiveld 1 Fax : +31 80 65 29 77 | 6525 ED Nijmegen, The Netherlands +-------- CAOS/CAMM is the Dutch National Node in EMBnet --------+ From owner-proteins@net.bio.net Thu Aug 19 23:00:00 1993 Path: biosci!agate!spool.mu.edu!uwm.edu!linac!uchinews!cs.umd.edu!lhc!quartz!harris From: harris@quartz.nlm.nih.gov (Nomi Harris) Newsgroups: bionet.software,bionet.molbio.proteins Subject: Protein secondary structure prediction available via mail server Keywords: protein secondary structure, neural network Message-ID: <1993Aug20.183751.2018@nlm.nih.gov> Date: 20 Aug 93 18:37:51 GMT Sender: nomi@cgl.ucsf.edu Organization: University of California, San Francisco Lines: 50 Xref: biosci bionet.software:5698 bionet.molbio.proteins:831 nnpredict is a program that predicts the secondary structure type for each residue in an input amino acid sequence. The basis of the prediction is a two-layer, feed-forward neural network. nnpredict can take into account the tertiary class of the protein (either none, all- alpha, all-beta, or alpha/beta) when predicting secondary structure. We are making nnpredict available via a mail server. You can mail in an amino acid squence, and nnpredict will predict secondary structure for your sequence and mail the prediction to you. For instructions on using the nnpredict server, send mail to: nnpredict@celeste.ucsf.edu Other correspondence, bug reports, etc. can be sent to nnpredict-request@celeste.ucsf.edu The mail server was written by Nomi Harris Copyright (C) 1993 Regents of the University of California (Note: don't bother asking Nomi about the details of the nnpredict algorithm, because she didn't write nnpredict.) nnpredict was written by Donald Kneller Copyright (C) 1991 Regents of the University of California References: (1) J. L. McClelland and D. E. Rumelhart. (1988) "Explorations in Parallel Distributed Processing" vol 3. pp 318-362. MIT Press, Cambridge MA. (2) D. G. Kneller, F. E. Cohen and R. Langridge (1990) "Improvements in Protein Secondary Structure Prediction by an Enhanced Neural Network" J. Mol. Biol. (214) 171-182. Abstract for (2): Computational neural networks have recently been used to predict the mapping between protein sequence and secondary structure. They have proven adequate for determining the first-order dependence between these two sets, but have, until now, been unable to garner higher-order information that helps determine secondary structure. By adding neural network units that detect periodicities in the input sequence, we have modestly increased the secondary structure prediction accuracy. The use of tertiary structural class causes a marked increase in accuracy. The best case prediction was 79% for the class of all-alpha proteins. A scheme for employing neural networks to validate and refine structural hypotheses is proposed. The operational difficulties of applying a learning algorithm to a dataset where sequence heterogeneity is under-represented and where local and global effects are inadequately partitioned are discussed. From owner-proteins@net.bio.net Fri Aug 20 23:00:00 1993 Path: biosci!agate!spool.mu.edu!wupost!waikato!comp.vuw.ac.nz!canterbury.ac.nz!otago.ac.nz!sanger.otago.ac.nz!craigm From: craigm@sanger.otago.ac.nz (Craig Marshall) Newsgroups: bionet.molbio.proteins Subject: Re: Basic amino acids: how may are significant? Message-ID: Date: 21 Aug 93 12:22:21 GMT References: <1993Aug18.171206.12464@riscsm.scripps.edu> Sender: usenet@news.otago.ac.nz (News stuff) Organization: University of Otago Lines: 60 Nntp-Posting-Host: sanger.otago.ac.nz X-Newsreader: TIN [version 1.1 PL8] Manuel Baca (manuel@scripps.edu) wrote: > In article <24perh$oaa@huon.itd.adelaide.edu.au> ajeffrie@waite.adelaide.edu.au (Alex Jeffries) writes: Hi all, > > I have read that proteins with a high basic amino acid content > >can have their Mr overestimated when sized using SDS-polyacrylamide > >gel electrophoresis. The usual reference for this is; > > > > Daubert, S. D. abd Bruening, G. (1984). detection of > >genome-linked proteins of plant and animal viruses. In _Methods in > >virology._ Maramarosch, K. and Koprowski, H. eds. 347-379. Academic > >Press, Orlando, Florida. > > > > I have read this reference but can not find any mention of > >what exactly "high" is. Does any one know if, say 12% Arg Asp and/or > >Lys would be considered high or would 25% be required? > > > > Thanks in advance, > > > > Alex Jeffries > > > Think not in terms of the percentage of basic residues (Lys, Arg, His > but *not* Asp), but rather on the pI of the protein, as if there are > 20% basic residues, but 25% acidic (Asp, Glu), then the protein will > actually be acidic. Any protein with a pI above 9 can be considered > sufficiently basic that it will probably migrate abnormally on SDS > PAGE. The more basic, the more abnormally it will probably migrate. If > your protein is glycosylated, this too can cause reduced > electrophoretic mobility. > > > > -- > Manuel Baca > Scripps Research Institute I not sure that I agree that it is just a question of pI. Determination of molecular weight in SDS-PAGE assumes that there is a uniform mass-to-charge ratio conferred by the approximately even coating of the protein by SDS. Any variations in the sequence that perturb the eveness of the coating may result in abnormal mobility in the gel. A patch of negatively charged residues could result in an absence of SDS in a region whereas a similar patch of positively charged residues may result in extra SDS binding. Either if these events would be likely to result in non-ideal mobility. This is a rather hand-waving explanation which doesn't really answer the original question. I shall cheat and say that the answer is defined empirically, but it would be interesting to see if proteins that do migrate abnormally on SDS-PAGE do have the charged regions suggested above. -- Craig Marshall craigm@sanger.otago.ac.nz or Biochemistry Department bioc07@otago.ac.nz University of Otago Phone 64 3 479 7849 P.O. Box 56 Fax 64 3 479 7866 Dunedin, New Zealand From owner-proteins@net.bio.net Sun Aug 22 23:00:00 1993 Path: biosci!rutgers!gatech!howland.reston.ans.net!xlink.net!math.fu-berlin.de!zib-berlin.de!news.dfn.de!scsing.switch.ch!epflnews!igcmac5.epfl.ch!user From: membrez@sicsoft.epfl.ch (James 007) Newsgroups: bionet.molbio.proteins Subject: HSA structure. Message-ID: Date: 23 Aug 93 08:18:13 GMT Followup-To: bionet.molbio.proteins Organization: Swiss Fed. Inst. of Technol. Lines: 10 NNTP-Posting-Host: igcmac5.epfl.ch Can somebody send me some references about the structure and chemical composition of human serum albumin ? Jacques Membrez Swiss Federal Institut of Technology Chemical Engineering Department 1015 Lausanne (Switzerland, french speeking part of) Email : membrez@sicsoft.epfl.ch From owner-proteins@net.bio.net Sun Aug 22 23:00:00 1993 Path: biosci!NBRF.GEORGETOWN.EDU!POSTMASTER From: POSTMASTER@NBRF.GEORGETOWN.EDU Newsgroups: bionet.molbio.proteins Subject: Interruption of Network Access to PIR Message-ID: <01H23BTQBEPUAEKSQE@NBRF.Georgetown.Edu> Date: 23 Aug 93 21:01:03 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 19 Announcement of Temporary Interruption of Access to The Protein Identification Resource The National Biomedical Research Foundation will be attempting to repair a hardware problem on Tuesday 24 August. From 16:00 EDT Tuesday 24 August through about 16:00 EDT Wednesday 25 August it will not be possible for users to access the Protein Identification Resource Network Server, the On-line System, or contact the PIR staff by electronic mail. We regret any inconvenience this temporary loss of service will cause. ------------------------------------------------------------------------ Dr. John S. Garavelli Database Coordinator Protein Information Resource National Biomedical Research Foundation Washington, DC 20007 POSTMAST@GUNBRF.BITNET POSTMASTER@NBRF.GEORGETOWN.EDU From owner-proteins@net.bio.net Sun Aug 22 23:00:00 1993 Path: biosci!rutgers!concert!news-feed-1.peachnet.edu!gatech!usenet.ins.cwru.edu!agate!doc.ic.ac.uk!uknet!mcsun!sun4nl!sci.kun.nl!caos.kun.nl!jackl From: jackl@caos.kun.nl (Jack Leunissen) Newsgroups: bionet.molbio.proteins Subject: Re: Sequence Search of PDB Message-ID: <1993Aug23.074836.16432@caos.kun.nl> Date: 23 Aug 93 07:48:36 GMT References: Organization: CAOS/CAMM Lines: 27 pettsj@visigoth.demon.co.uk (James Petts) writes: >Hi. Does anybody know of any software which is equivalent to the old >SEARCHDB program distributed by Brookhaven which runs on Macs or Un*x? >We need something local (not net-based) which will take a sequence and >report then filename if it is found in a PDB file. You might try the ATLAS program, distributed on CDROM by the NBRF (for infor- mation: PIRMAIL@GUNBRF.BITNET). It contains (a.o.) the NRL_3D database, which has the sequences, and documentation, in it from the current PDB. You can search for sequences, allowing for mismatches, very rapidly. You can also search for references, authors, features, etc. The program run on VAX/VMS, ULTRIX (RISC), PC/DOS, and Macintosh (I'm not certain about the last). Hope this is what you're looking for... Jack -- +----------------------------+-----------------------------------+ Jack A.M. Leunissen, Ph.D. | CAOS/CAMM Center Email: jackl@caos.kun.nl | University of Nijmegen Tel. : +31 80 65 22 48 | Toernooiveld 1 Fax : +31 80 65 29 77 | 6525 ED Nijmegen, The Netherlands +-------- CAOS/CAMM is the Dutch National Node in EMBnet --------+ From owner-proteins@net.bio.net Mon Aug 23 23:00:00 1993 Path: biosci!NET.BIO.NET!kristoff From: kristoff@NET.BIO.NET (David Kristofferson) Newsgroups: bionet.molbio.proteins Subject: IMPORTANT BIOSCI INFORMATION Message-ID: <9308240900.AA10151@net.bio.net> Date: 24 Aug 93 09:00:04 GMT Sender: kristoff@net.bio.net Distribution: bionet Lines: 243 Three important items follow: BIOSCI archive searching by e-mail, the BIOSCI FAQ, and the BIOSCI User Address Directory form. If you have not yet listed yourself in our e-mail address directory, please take a few minutes to complete and return the form below. If your address information has changed since you listed yourself, please send us an updated form. Sincerely, Dave Kristofferson BIOSCI/bionet Manager kristoff@net.bio.net **** SEARCHING BIOSCI ARCHIVES WITH WAISMAIL **** E-mail users can search the BIOSCI archives by using our waismail e-mail server. For instructions send the message help to waismail@net.bio.net. Leave the Subject: line blank. Other methods of searching the archives via WAIS and gopher are described in the BIOSCI FAQ. **** BIOSCI FREQUENTLY ASKED QUESTIONS (FAQ) SHEET **** New users of BIOSCI/bionet may want to read the "Frequently Asked Questions" or "FAQ" sheet for BIOSCI. The FAQ provides details on how to participate in these forums and is available for anonymous FTP from net.bio.net [134.172.2.69] in pub/BIOSCI/biosci.FAQ. It may also be requested by sending e-mail to biosci@net.bio.net (use plain English for your request). The FAQ is also posted on the first of each month to the newsgroup BIONEWS/bionet.announce immediately following the posting of the BIOSCI information sheet. **** BIOSCI USER ADDRESS DIRECTORY **** Please take this opportunity to add your name and address information to the BIOSCI User Address Database if you have not already done so. Below is the address form that we would like each reader of the BIOSCI/bionet newsgroups to complete and return if you would like to be listed in our database. The database serves as a directory that enables biologists, who are currently using (or even just reading) the BIOSCI newsgroups, to look up e-mail addresses and other information about our users. The address database is reindexed nightly for WAIS and waismail access (waismail is our WAIS e-mail server, more below) and will also be available for access via other gopher sites if they wish to permit it. The raw unindexed data is available for FTP from net.bio.net and is atomized sufficiently to allow import into your local RDBMS should you so desire. Please carefully follow the instructions for completing the form below and return it to either of the following two addresses (whichever is more convenient for you). Thanks in advance for taking the time to complete and return the form. Addresses for returning forms Location Network ----------------------------- -------- ------- biovote@net.bio.net U.S.A. Internet/BITNET biovote@daresbury.ac.uk U.K. JANET MAKING SURE THAT YOUR INFORMATION IS CURRENT This notice will be mailed bimonthly to each newsgroup. You should check our WAIS source or waismail e-mail server from time-to-time to see if your address information is still up-to-date. Send the message help to waismail@net.bio.net for instructions on using waismail. Leave the Subject: line in your message blank. Using Gopher to complete the form --------------------------------- If you don't want to use a text editor, you can also use Dan Jacobson's gopher site to fill out the address database form as follows. Otherwise skip this section on gopher and proceed to the instructions for filling out the form below. > To add yourself to the database just point your > gopher client at merlot.welch.jhu.edu and select the following: > > --> 15. Searching For Biologists/ > > --> 9. E-mail Addresses of Biosci-Bionet Users/ > > --> 1. Add (or Correct) Your Address to the BIOSCI User Address > Data.. > > > And fill out the form. or Rob Harper's gopher site in Europe as follows: > Europeans can point their gopher client at gopher.csc.fi and add their > information to the database. All entries will be mailed directly to > Dave for incorporation in a wais source. > > The path to the questionare is as follows. > > ---> 10. Finnish EMBnet BioBox/ > > ---> 8. FAQ Files/ > > FAQ Files > > 1. EMBnet: Information. > 2. EMBnet: Internet resources guide. > 3. A Biologist's Guide to Internet Resources/ > 4. All FAQs (Frequently Asked Questions) Searches and Archives/ > --->5. Bionauts Address Database (questionaire) IMPORTANT INSTRUCTIONS - PLEASE READ CAREFULLY Please enter all responses after the : on each line, leaving one (1) blank space after the : (i.e., before the start of your text). Please do NOT extend your responses past the end of each line (80 characters) or alter any of the field identifiers such as "first name: ". Several lines are provided at the end of the form for comments, but, please adhere to the line length restriction. On the date: line, please enter the date in the DD-MM-YY format, e.g., 05-05-93 for 5 May 1993. This line will tell others when the information was last updated. Please be sure to include the 0's for single digit days or months, e.g., 05-05-93, not 5-5-93. Note that the "e-mail network: " line below is for specifying, e.g., "Internet," "BITNET," "EARN," "JANET," or whatever other network that your computer may be on. If you are uncertain about any field, please feel free to leave it blank, but please DO NOT DELETE the field identifier from the form! In the first field below, "New information or Update ...", please enter "N" if this is the first time that you have registered in the directory or "U" if you are correcting a listing that you sent to us previously. The comment: lines may be used for anything that you like but PLEASE DO NOT DELETE THEM FROM THE FORM OR ALTER THEM. One suggested use is to list the names of the newsgroups in which you participate. Please use the MAILING LIST name (see below - the latest version of the list can be requested from biosci@net.bio.net) instead of the USENET name even if you don't participate by e-mail. WAIS might get confused by the periods in the USENET names. This allows one to retrieve via WAIS or waismail the list of participants in a particular group. For example: comment: ARABIDOPSIS PLANT-BIOLOGY BIONEWS On the comment: lines use these names below ---- NOT the USENET names below MAILING LIST NAME USENET Newsgroup Name ----------------- --------------------- ACEDB-SOFT bionet.software.acedb AGEING bionet.molbio.ageing AGROFORESTRY bionet.agroforestry ARABIDOPSIS bionet.genome.arabidopsis BIOFORUM bionet.general BIO-INFORMATION-THEORY bionet.info-theory BIONAUTS bionet.users.addresses BIONEWS bionet.announce BIO-JOURNALS bionet.journals.contents BIO-MATRIX bionet.molbio.bio-matrix BIO-SOFTWARE bionet.software CHROMOSOMES bionet.genome.chromosomes COMPUTATIONAL-BIOLOGY bionet.biology.computational DROSOPHILA bionet.drosophila EMBL-DATABANK bionet.molbio.embldatabank EMPLOYMENT bionet.jobs GDB bionet.molbio.gdb GENBANK-BB bionet.molbio.genbank GENETIC-LINKAGE bionet.molbio.gene-linkage HIV-MOLECULAR-BIOLOGY bionet.molbio.hiv HUMAN-GENOME-PROGRAM bionet.molbio.genome-program IMMUNOLOGY bionet.immunology INFO-GCG bionet.software.gcg JOURNAL-NOTES bionet.journals.note METHODS-AND-REAGENTS bionet.molbio.methds-reagnts MOLECULAR-EVOLUTION bionet.molbio.evolution NEUROSCIENCE bionet.neuroscience N2-FIXATION bionet.biology.n2-fixation PHOTOSYNTHESIS bionet.photosynthesis PLANT-BIOLOGY bionet.plants POPULATION-BIOLOGY bionet.population-bio PROTEIN-ANALYSIS bionet.molbio.proteins PROTEIN-CRYSTALLOGRAPHY bionet.xtallography RAPD bionet.molbio.rapd SCIENCE-RESOURCES bionet.sci-resources TROPICAL-BIOLOGY bionet.biology.tropical VIROLOGY bionet.virology WOMEN-IN-BIOLOGY bionet.women-in-bio YEAST bionet.molbio.yeast Listing newsgroups on the comment: line is optional, of course. Thanks again for your cooperation! --------------- please cut here and return portion below --------------- New information or Update to old record (enter N or U): date (DD-MM-YY): first name: middle initial: family name: job title: e-mail address: e-mail network: phone number: FAX number: institution: address1: address2: address3: city: state/province: country: postal code: research interest: research interest: comment: comment: comment: comment: comment: From owner-proteins@net.bio.net Mon Aug 23 23:00:00 1993 Path: biosci!agate!howland.reston.ans.net!europa.eng.gtefsd.com!emory!emoryu1!emoryu1.cc.emory.edu From: clarsen@emoryu1.cc.emory.edu (Chris Larsen) Newsgroups: bionet.molbio.proteins Subject: Re: basic amino acids and PAGE Message-ID: <4498@emoryu1.cc.emory.edu> Date: 24 Aug 93 15:49:36 GMT References: <9308191435.AA04020@net.bio.net> Sender: news@emory.edu Reply-To: clarsen@emoryu1.cc.emory.edu Organization: Emory University (BIMCORE) Lines: 5 Nntp-Posting-Host: emoryu1.cc.emory.edu Would it be possible for the effect to be not one of STOKES RADIUS (you're correct) but of charge? I understand that some proteins do in fact bind the (-) charges of sephadex They could be repeled by the matrices... We have 8 and 14 kDa globulars in our lab. Size is irrelevant. From owner-proteins@net.bio.net Thu Aug 26 23:00:00 1993 Path: biosci!daresbury!daresbury!news From: PARSONS_A@uk.co.pcr.snd01 Newsgroups: bionet.molbio.proteins Subject: Software for Clustering Databases by Sequence Similarity Message-ID: <1993Aug27.142820.4303@gserv1.dl.ac.uk> Date: 27 Aug 93 15:22:22 GMT Sender: list-admin@daresbury.ac.uk Distribution: bionet Lines: 23 Precedence: first-class Original-To: PROTEINS Greetings NetFolk, Just a quickie. Does anyone know if there is any software available for clustering databases by sequence similarity (in the way the Entrez sequences are clustered). I dont mean in the way that GenBank is clustered by taxonomy but by actual sequence similarity. ADVthanksANCE, Tony Parsons +----------------------------------------------------------------------------+ | Dr.Tony Parsons, VOX : + 44 304 616871 | | Information Technology, FAX : + 44 304 616670 | | Pfizer Central Research, | | Ramsgate Road, +---------------------- e-mail ------------------------+ | Sandwich, |JANET : parsons_a@uk.co.pcr.snd01 | | KENT |Internet : parsons_a@snd01.pcr.co.uk | | CT13 9NJ UK |Compuserve : 100064,765 PSImail:234216700127.parsons_a | +-----------------+----------------------------------------------------------+ From owner-proteins@net.bio.net Fri Aug 27 23:00:00 1993 Path: biosci!NBRF.GEORGETOWN.EDU!POSTMASTER From: POSTMASTER@NBRF.GEORGETOWN.EDU Newsgroups: bionet.molbio.proteins Subject: Announcement of Interruption of Access to PIR Message-ID: <01H29YPK8G0YAH2PMB@NBRF.Georgetown.Edu> Date: 28 Aug 93 15:00:28 GMT Sender: daemon@net.bio.net Distribution: bionet Lines: 19 Announcement of Temporary Interruption of Access to The Protein Identification Resource The National Biomedical Research Foundation will be attempting to repair a hardware problem again on Monday 30 August. From 16:00 EDT Monday 30 August through about 10:00 EDT Tuesday 31 August it will not be possible for users to access the Protein Identification Resource Network Server, the On-line System, or contact the PIR staff by electronic mail. We regret any inconvenience this temporary loss of service will cause. ------------------------------------------------------------------------ Dr. John S. Garavelli Database Coordinator Protein Information Resource National Biomedical Research Foundation Washington, DC 20007 POSTMAST@GUNBRF.BITNET POSTMASTER@NBRF.GEORGETOWN.EDU From owner-proteins@net.bio.net Sun Aug 29 23:00:00 1993 Path: biosci!daresbury!doc.ic.ac.uk!pipex!sunic!news.funet.fi!luotsi.uku.fi!messi.uku.fi!saarela From: saarela@messi.uku.fi (Janne Saarela) Newsgroups: bionet.molbio.proteins,sci.bio.technology Subject: Lysozyme enzyme mutants activities? Message-ID: Date: 29 Aug 93 11:13:33 GMT Sender: news@luotsi.uku.fi Organization: University of Kuopio, Finland Lines: 8 Xref: biosci bionet.molbio.proteins:840 sci.bio.technology:583 I need information about activity of hen egg white lysozyme (chicken lysozyme) mutants S24A (Ser -> Ala) and N37E (Asn -> Glu). Activities (% of wild type enzyme) against M. luteus in O.05 M phosphate buffer at pH 7.0 and 30 degrees C or against glycol chitin in 0.1 M acetate buffer at pH 5.5 and 40 degrees C are preferred, but I am interested in every piece of information about those mutants. Please, mail your information to saarela@messi.uku.fi From owner-proteins@net.bio.net Mon Aug 30 23:00:00 1993 Path: biosci!agate!usenet.ins.cwru.edu!gatech!usenet.ufl.edu!mailer.cc.fsu.edu!iris3.chem.fsu.edu!rrk From: rrk@iris3.chem.fsu.edu (Randal R. Ketchem) Newsgroups: bionet.molbio.proteins Subject: Re: Phi/Psi/Chi1 Angles from PDB Files Message-ID: Date: 31 Aug 93 21:07:50 GMT References: <1993Aug31.202618.16045@emba.uvm.edu> Sender: usenet@mailer.cc.fsu.edu Organization: Florida State University -- Structural Biology Program Lines: 30 In article <1993Aug31.202618.16045@emba.uvm.edu> mannlab@med.uvm.edu (Lab of Dr. Ken Mann) writes: > > I am looking for software (Irix/VAX/MSDOS) which will find > Phi/Psi/Chi angles using PDB files. > > I really dread the thought of using a program (Alchemy/HyperChem/ > InsightII) which would require me to make these measurements > "by hand" -- that is, interactively. > > Code which automatically delivers the desired angles to standard > output would be great! > > Thanks in advance. > > ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::: > D. Gaffney > Dept. of Biochemistry > College of Medicine > University of Vermont > ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::: > InsightII will do this without requiring you to select each atom. In Biopolymer, select Protein->List->Dihedrals. It will display a table of all torsion angles. Randal R. Ketchem Institute of Molecular Biophysics 904.644.7798 (voice) Florida State University 904.644.8281 (FAX) Tallahassee, FL 32306-3015 rrk@sb.fsu.edu (email) From owner-proteins@net.bio.net Mon Aug 30 23:00:00 1993 Path: biosci!uwm.edu!spool.mu.edu!howland.reston.ans.net!europa.eng.gtefsd.com!uunet!emba-news.uvm.edu!mannlab From: mannlab@med.uvm.edu (Lab of Dr. Ken Mann) Newsgroups: bionet.molbio.proteins Subject: Phi/Psi/Chi1 Angles from PDB Files Message-ID: <1993Aug31.202618.16045@emba.uvm.edu> Date: 31 Aug 93 20:26:18 GMT Sender: news@emba.uvm.edu Organization: University of Vermont -- Division of EMBA Computer Facility Lines: 19 X-Newsreader: TIN [version 1.2 PL1] I am looking for software (Irix/VAX/MSDOS) which will find Phi/Psi/Chi angles using PDB files. I really dread the thought of using a program (Alchemy/HyperChem/ InsightII) which would require me to make these measurements "by hand" -- that is, interactively. Code which automatically delivers the desired angles to standard output would be great! Thanks in advance. ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::: D. Gaffney Dept. of Biochemistry College of Medicine University of Vermont ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::: From owner-proteins@net.bio.net Tue Aug 31 23:00:00 1993 Path: biosci!parc!decwrl!ames!agate!doc.ic.ac.uk!uknet!pavo.csi.cam.ac.uk!mbfs.bio.cam.ac.uk!seb1005 From: seb1005@mbfs.bio.cam.ac.uk (Steven Brenner) Newsgroups: bionet.molbio.proteins Subject: Re: Phi/Psi/Chi1 Angles from PDB Files Message-ID: <1993Sep1.094950.11688@infodev.cam.ac.uk> Date: 1 Sep 93 09:49:50 GMT References: <1993Aug31.202618.16045@emba.uvm.edu> Sender: news@infodev.cam.ac.uk (USENET news) Organization: U of Cambridge, England Lines: 25 Nntp-Posting-Host: mbfs.bio.cam.ac.uk rrk@iris3.chem.fsu.edu (Randal R. Ketchem) writes: >In article <1993Aug31.202618.16045@emba.uvm.edu> mannlab@med.uvm.edu (Lab of Dr. Ken Mann) writes: >> >> I am looking for software (Irix/VAX/MSDOS) which will find >> Phi/Psi/Chi angles using PDB files. You should probably have a look at dssp by Kabsch & Sander. It is really designed for identifying secondary structure elements from pdb files, but computes the angles you request along the way. Executable versions of the program are on ftp.embl-heidelberg.de in the directory pub/databases/protein_extras/dssp. A reference to it is: W. Kabsch, C. Sander, "Dictionary Of Protein Secondary Structure - Pattern-Recognition Of Hydrogen-Bonded And Geometrical Features." _Biopolymers_ 22:12 2577-2637 (1983). -- Steven E. Brenner | Department of Biochemistry seb1005@mbfs.bio.cam.ac.uk | University of Cambridge Lab +44 223 333671 | Tennis Court Road Fax +44 223 333345 | Cambridge CB2 1QW, UK From owner-proteins@net.bio.net Tue Aug 31 23:00:00 1993 Path: biosci!daresbury!zeta.bmc.uu.se!corax.udac.uu.se!sunic!trane.uninett.no!nntp.uio.no!usenet From: haraldo@karius.uio.no (Harald Osmundsen) Newsgroups: bionet.molbio.proteins Subject: Beta-actin replacement? Message-ID: <261o0e$kg4@hermod.uio.no> Date: 1 Sep 93 08:54:38 GMT Organization: Universitet i Oslo Lines: 5 NNTP-Posting-Host: pcodont01.uio.no X-Newsreader: WinVN version 0.80 We have used a beta-actin -probe as reference for studing mRNA-levels in rat liver. I am not, however, convinced that the beta-actin-signal is constant in every situation . Can somebody suggest a better alternative probe? Harald Osmundsen From owner-proteins@net.bio.net Tue Aug 31 23:00:00 1993 Path: biosci!uwm.edu!spool.mu.edu!howland.reston.ans.net!noc.near.net!news.cs.brandeis.edu!binah.cc.brandeis.edu!DUCA From: duca@binah.cc.brandeis.edu (Karen Duca, a.k.a. Rocky) Newsgroups: bionet.molbio.proteins Subject: physical model kits Message-ID: <1993Sep1.143258.27592@news.cs.brandeis.edu> Date: 1 Sep 93 14:32:58 GMT Sender: news@news.cs.brandeis.edu (USENET News System) Reply-To: duca@binah.cc.brandeis.edu Organization: Brandeis University Lines: 11 I'm trying to locate kits for building ball and stick and/or space filling molecular models. Does anybody know of vendors of such products for large scale models? We're interested in building a 1,300 atom structure com- posed of four 20-aa peptides, so the smaller kits won't do. We're willing to sink a little money into this, but naturally would like to keep it as cheap as possible. I'll post a summary of replies if I get any for those who might be interested. Thanx, Karen duca@binah.cc.brandeis.edu From owner-proteins@net.bio.net Tue Aug 31 23:00:00 1993 Path: biosci!agate!doc.ic.ac.uk!uknet!mcsun!sun4nl!eur.nl!cs.few.eur.nl!andre From: andre@cs.few.eur.nl (Andre van der Hoek) Newsgroups: bionet.molbio.proteins Subject: Potential Energy Function Evaluation in Internal Coordinates HELP Message-ID: <1993Sep1.163726.11694@cs.few.eur.nl> Date: 1 Sep 93 16:37:26 GMT Sender: news@cs.few.eur.nl Organization: Erasmus Universiteit Rotterdam Lines: 35 Hello, in our research project we are trying to optimize polymer structures by applying a large scale global optimization algorithm on the potential energy function of a polymer structure. At the moment, we do have a potential energy function in Cartesian coordinates, but we would like to do some experiments using an evaluation function in internal coordinates (bond anlges, dihedral angles). Just to avoid doing the work others did before (and cause writing the code is pretty hard) we would like to know the following: * Is there anybody out there using an evaluation function in internal coordinates? * Would this person be willing to share his source code with us? If so, please contact us by E-mailing to: Andre van der Hoek andre@cs.colorado.edu or andre@cs.few.eur.nl Thanks for your attention, === Andre === -- ==================================================================== = Andre van der Hoek. E-mail: andre@cs.few.eur.nl = = Somebody has to be brilliant, but it ain't me, although I hoped so.= ====================================================================