From owner-proteins@net.bio.net Sun May 01 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!pipex!sunic!trane.uninett.no!eunet.no!nuug!EU.net!Austria.EU.net!newsfeed.ACO.net!info.univie.ac.at!lab8486.abc.univie.ac.at!ma From: ma@ABC.univie.ac.at (Manuel Simon) Newsgroups: bionet.molbio.proteins Subject: Re: DSSP program wanted !! Date: Mon, 2 May 1994 10:27:35 Organization: Inst. Biochemistry and Molecular Cell Biology Lines: 209 Distribution: bionet Message-ID: References: NNTP-Posting-Host: lab8486.abc.univie.ac.at X-Newsreader: Trumpet for Windows [Version 1.0 Rev A] In article chaisiri@KKU1.KKU.AC.TH (Chaisiri Wongkham) writes: >From: chaisiri@KKU1.KKU.AC.TH (Chaisiri Wongkham) >Subject: Re: DSSP program wanted !! >Date: 30 Apr 1994 02:11:51 -0700 >--1380020962-1416198300-767688255:#26970 >Content-Type: TEXT/PLAIN; charset=US-ASCII >Hope the attached file will help you. >Bye, >-------------------------------------------------------------------------- >Chaisiri Wongkham Internet: chaisiri@kku1.kku.ac.th >Department of Biochemistry FAX: 66 43 243064 >Faculty of Medicine Telephone:66 43 242343-6 Ext. 3840 >Khon Kaen University >Khon Kaen 40002, THAILAND. >-------------------------------------------------------------------------- >On Fri, 29 Apr 1994, Hemant Varma wrote: >> geetha (geetha@ABSALPHA.DCRT.NIH.GOV) wrote: >> : Hello Netters >> : Can anybody help me find DSSP program ? Is there any anon. FTP site or is >> : it commercially available? >> : * DSSP -- Dictionary of Sec. Str. Prediction -- Kabsch and Sander. >> : Thanks for your help. >> Please let me know that too! I have spent months trying to >> find it!! >> Hemant >> : --Geetha >--1380020962-1416198300-767688255:#26970 >Content-Type: TEXT/PLAIN; charset=US-ASCII; name="dssp.txt" >Content-Transfer-Encoding: BASE64 >Content-ID: >Content-Description: >RnJvbSBhcmNoaWUtZXJyb3JzQGNjc3VuMS5zb2dhbmcuYWMua3IgU2F0IEFw >ciAzMCAxMzozOTo0MSAxOTk0CkRhdGU6IFNhdCwgMzAgQXByIDk0IDY6Mzgg >R01UCkZyb206IGFyY2hpZS1lcnJvcnNAY2NzdW4xLnNvZ2FuZy5hYy5rcgpU >bzogY2hhaXNpcmlAa2t1MS5ra3UuYWMudGgKU3ViamVjdDogYXJjaGllIFtw >cm9nIERTU1BdIHBhcnQgMSBvZiAxCgpIb3N0IHNvbG9tb24udGVjaG5ldC5z >ZyAgICAoMTkyLjE2OS4zMy4zKQpMYXN0IHVwZGF0ZWQgMTg6NDAgMzEgTWFy >IDE5OTQKCiAgICBMb2NhdGlvbjogL3B1Yi9OVVMvejgvaGVpZGVsYmVyZy9z >b2Z0d2FyZS91bml4CiAgICAgIERJUkVDVE9SWSAgICBkcnd4ci14ci14ICAg >ICA1MTIgYnl0ZXMgIDA0OjIxICA5IE1hciAxOTk0ICBkc3NwCgogICAgTG9j >YXRpb246IC9wdWIvTlVTL3o4L2hlaWRlbGJlcmcvZGF0YWJhc2VzL3Byb3Rl >aW5fZXh0cmFzCiAgICAgIERJUkVDVE9SWSAgICBkcnd4ci14ci14ICAgICA1 >MTIgYnl0ZXMgIDE1OjQ0ICA4IE1hciAxOTk0ICBkc3NwCgoKSG9zdCBmdHAu >ZW1ibC1oZWlkZWxiZXJnLmRlICAgICgxOTIuNTQuNDEuMzMpCkxhc3QgdXBk >YXRlZCAxNjowMSAyMyBBcHIgMTk5NAoKICAgIExvY2F0aW9uOiAvcHViL2Rh >dGFiYXNlcy9wcm90ZWluX2V4dHJhcwogICAgICBESVJFQ1RPUlkgICAgZHJ3 >eHIteHIteCAgIDE2ODk2IGJ5dGVzICAxODo0OSAgMiBEZWMgMTk5MyAgZHNz >cAoKICAgIExvY2F0aW9uOiAvcHViL3NvZnR3YXJlL3VuaXgKICAgICAgRElS >RUNUT1JZICAgIGRyd3hyLXhyLXggICAgIDUxMiBieXRlcyAgMDA6MDAgIDcg >T2N0IDE5OTMgIGRzc3AKCiAgICBMb2NhdGlvbjogL3B1Yi9kYXRhYmFzZXMv >cHJvdGVpbl9leHRyYXMvZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0g >ICAzNjQ5OSBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDEyY2EuZHNzcAog >ICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICAyMDg5OSBieXRlcyAgMDA6MDAg >MTIgRmViIDE5OTMgIDE1NWMuZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1y >LS0gICAxODE4MSBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFhYXAuZHNz >cAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICA0MzA4NyBieXRlcyAgMDA6 >MDAgMTIgRmViIDE5OTMgIDFhYnAuZHNzcAogICAgICBGSUxFICAgIC1ydy1y >LS1yLS0gICA3MTU4NyBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFhY2Uu >ZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0gIDEyMTYzOSBieXRlcyAg >MDA6MDAgMTIgRmViIDE5OTMgIDFhY20uZHNzcAogICAgICBGSUxFICAgIC1y >dy1yLS1yLS0gICAxNzQxNiBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFh >Y3guZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICA1ODk0NSBieXRl >cyAgMDA6MDAgMTIgRmViIDE5OTMgIDFhazMuZHNzcAogICAgICBGSUxFICAg >IC1ydy1yLS1yLS0gICAgNTE1MiBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMg >IDFhbDEuZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICAxOTM0MiBi >eXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFhbGMuZHNzcAogICAgICBGSUxF >ICAgIC1ydy1yLS1yLS0gICA1MDQzMSBieXRlcyAgMDA6MDAgMTIgRmViIDE5 >OTMgIDFhbGQuZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICAxMDQ1 >MCBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFhbXQuZHNzcAogICAgICBG >SUxFICAgIC1ydy1yLS1yLS0gICA0Mjk0OSBieXRlcyAgMDA6MDAgMTIgRmVi >IDE5OTMgIDFhcGIuZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0gIDEy >MTYzOSBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFhdDEuZHNzcAogICAg >ICBGSUxFICAgIC1ydy1yLS1yLS0gICAgODM3NyBieXRlcyAgMDA6MDAgMTIg >RmViIDE5OTMgIDFhdGYuZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0g >ICA4NTEzMiBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFhdG4uZHNzcAog >ICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICAgIDc2NSBieXRlcyAgMDA6MDAg >MTIgRmViIDE5OTMgIDFhdHguZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1y >LS0gICAxOTYwOSBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFhenUuZHNz >cAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICA0Mjk0OSBieXRlcyAgMDA6 >MDAgMTIgRmViIDE5OTMgIDFiYXAuZHNzcAogICAgICBGSUxFICAgIC1ydy1y >LS1yLS0gICA5MzI1OSBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFiYnAu >ZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICAgOTE1MSBieXRlcyAg >MDA6MDAgMTIgRmViIDE5OTMgIDFiZHMuZHNzcAogICAgICBGSUxFICAgIC1y >dy1yLS1yLS0gICA1OTU5MCBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFi >amwuZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICA3NTg0NCBieXRl >cyAgMDA6MDAgMTIgRmViIDE5OTMgIDFibXYuZHNzcAogICAgICBGSUxFICAg >IC1ydy1yLS1yLS0gICAxOTQ4MCBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMg >IDFicDIuZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICAyNjMwOCBi >eXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFicmQuZHNzcAogICAgICBGSUxF >ICAgIC1ydy1yLS1yLS0gICAzMzY2MSBieXRlcyAgMDA6MDAgMTIgRmViIDE5 >OTMgIDFjMnIuZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICAzNjYy >OCBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFjYTIuZHNzcAogICAgICBG >SUxFICAgIC1ydy1yLS1yLS0gICAzNjQ5OSBieXRlcyAgMDA6MDAgMTIgRmVi >IDE5OTMgIDFjYTMuZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICAg >ODI0OCBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFjYmguZHNzcAogICAg >ICBGSUxFICAgIC1ydy1yLS1yLS0gICAxNDMyMCBieXRlcyAgMDA6MDAgMTIg >RmViIDE5OTMgIDFjYzUuZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0g >ICA0MTQwMSBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFjY3AuZHNzcAog >ICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICAxNzkzMiBieXRlcyAgMDA6MDAg >MTIgRmViIDE5OTMgIDFjY3IuZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1y >LS0gICAyNTkyMSBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFjZDQuZHNz >cAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICAxNzUzNiBieXRlcyAgMDA6 >MDAgMTIgRmViIDE5OTMgIDFjZHAuZHNzcAogICAgICBGSUxFICAgIC1ydy1y >LS1yLS0gICAxOTIxMyBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFjZHQu >ZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICAzMzAyNSBieXRlcyAg >MDA6MDAgMTIgRmViIDE5OTMgIDFjaGcuZHNzcAogICAgICBGSUxFICAgIC1y >dy1yLS1yLS0gICA0MTUzOSBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFj >aG8uZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICAzMTA4MSBieXRl >cyAgMDA6MDAgMTIgRmViIDE5OTMgIDFjbGEuZHNzcAogICAgICBGSUxFICAg >IC1ydy1yLS1yLS0gICA0NTI3MSBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMg >IDFjbXMuZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICA2NDg4OCBi >eXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFjbjEuZHNzcAogICAgICBGSUxF >ICAgIC1ydy1yLS1yLS0gICA3ODAzNyBieXRlcyAgMDA6MDAgMTIgRmViIDE5 >OTMgIDFjb2guZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICA1NDU1 >OSBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFjb2wuZHNzcAogICAgICBG >SUxFICAgIC1ydy1yLS1yLS0gICA2ODM2MiBieXRlcyAgMDA6MDAgMTIgRmVi >IDE5OTMgIDFjb3guZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICA0 >OTY1NyBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFjcGsuZHNzcAogICAg >ICBGSUxFICAgIC1ydy1yLS1yLS0gICAgOTU0NyBieXRlcyAgMDA6MDAgMTIg >RmViIDE5OTMgIDFjcm4uZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0g >ICA1OTIwMyBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFjc2MuZHNzcAog >ICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICA0NzIwNiBieXRlcyAgMDA6MDAg >MTIgRmViIDE5OTMgIDFjc2UuZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1y >LS0gICAxMjM4NSBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFjdGYuZHNz >cAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICAgNzM0NSBieXRlcyAgMDA6 >MDAgMTIgRmViIDE5OTMgIDFjdGkuZHNzcAogICAgICBGSUxFICAgIC1ydy1y >LS1yLS0gICA1OTk4NiBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFjdHMu >ZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICAxMjc3MiBieXRlcyAg >MDA6MDAgMTIgRmViIDE5OTMgIDFjdHguZHNzcAogICAgICBGSUxFICAgIC1y >dy1yLS1yLS0gICAxODgzNSBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFj >eTMuZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICAxNjkwMCBieXRl >cyAgMDA6MDAgMTIgRmViIDE5OTMgIDFjeWMuZHNzcAogICAgICBGSUxFICAg >IC1ydy1yLS1yLS0gICAxMTQ3MyBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMg >IDFkZm4uZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICA1MDY4OSBi >eXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFkaGYuZHNzcAogICAgICBGSUxF >ICAgIC1ydy1yLS1yLS0gICAyNzU5OCBieXRlcyAgMDA6MDAgMTIgRmViIDE5 >OTMgIDFkcmYuZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICAxMTIx >NSBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFkdHguZHNzcAogICAgICBG >SUxFICAgIC1ydy1yLS1yLS0gICAyMTE1NyBieXRlcyAgMDA6MDAgMTIgRmVi >IDE5OTMgIDFlY2EuZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICAy >MTE1NyBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFlY2QuZHNzcAogICAg >ICBGSUxFICAgIC1ydy1yLS1yLS0gICAyMTE1NyBieXRlcyAgMDA6MDAgMTIg >RmViIDE5OTMgIDFlY24uZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0g >ICAyMTE1NyBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFlY28uZHNzcAog >ICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICA0NzMzNSBieXRlcyAgMDA6MDAg >MTIgRmViIDE5OTMgIDFlcjguZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1y >LS0gICAzNDU3MyBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFlc3QuZHNz >cAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICAyNjU3NSBieXRlcyAgMDA6 >MDAgMTIgRmViIDE5OTMgIDFldHUuZHNzcAogICAgICBGSUxFICAgIC1ydy1y >LS1yLS0gICA1OTg0OCBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFmMTku >ZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICA1OTg0OCBieXRlcyAg >MDA6MDAgMTIgRmViIDE5OTMgIDFmYWkuZHNzcAogICAgICBGSUxFICAgIC1y >dy1yLS1yLS0gICA4NTUxOSBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFm >YnAuZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICA1Njg4MSBieXRl >cyAgMDA6MDAgMTIgRmViIDE5OTMgIDFmYzEuZHNzcAogICAgICBGSUxFICAg >IC1ydy1yLS1yLS0gICAzNTg1NCBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMg >IDFmYzIuZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0gIDExOTE4OCBi >eXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFmY2IuZHNzcAogICAgICBGSUxF >ICAgIC1ydy1yLS1yLS0gICAxNzI3OCBieXRlcyAgMDA6MDAgMTIgRmViIDE5 >OTMgIDFmZDIuZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICA0MDc2 >NSBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFmZGguZHNzcAogICAgICBG >SUxFICAgIC1ydy1yLS1yLS0gICA3NjIzMSBieXRlcyAgMDA6MDAgMTIgRmVi >IDE5OTMgIDFmZGwuZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICAx >MDU3OSBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFmZHguZHNzcAogICAg >ICBGSUxFICAgIC1ydy1yLS1yLS0gICAyNTUzNCBieXRlcyAgMDA6MDAgMTIg >RmViIDE5OTMgIDFmaGEuZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0g >ICAxNzQwNyBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFma2YuZHNzcAog >ICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICA0MTc4OCBieXRlcyAgMDA6MDAg >MTIgRmViIDE5OTMgIDFmbnIuZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1y >LS0gICAyMjU3NiBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFmeDEuZHNz >cAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICAyOTAxNyBieXRlcyAgMDA6 >MDAgMTIgRmViIDE5OTMgIDFmeGEuZHNzcAogICAgICBGSUxFICAgIC1ydy1y >LS1yLS0gICA1MzUyNyBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFmeGku >ZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICAgNzM1NCBieXRlcyAg >MDA6MDAgMTIgRmViIDE5OTMgIDFnY24uZHNzcAogICAgICBGSUxFICAgIC1y >dy1yLS1yLS0gICAyNjA1MCBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFn >Y3IuZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICAzNDk1MSBieXRl >cyAgMDA6MDAgMTIgRmViIDE5OTMgIDFnY3QuZHNzcAogICAgICBGSUxFICAg >IC1ydy1yLS1yLS0gIDE3NjMzOSBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMg >IDFnZDEuZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICAgNzYwMyBi >eXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFnbWEuZHNzcAogICAgICBGSUxF >ICAgIC1ydy1yLS1yLS0gICA0ODg4MyBieXRlcyAgMDA6MDAgMTIgRmViIDE5 >OTMgIDFnb3guZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICA1MTIx >NCBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFncDEuZHNzcAogICAgICBG >SUxFICAgIC1ydy1yLS1yLS0gIDE5Njk3NSBieXRlcyAgMDA6MDAgMTIgRmVi >IDE5OTMgIDFncGEuZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0gIDEw >OTc3MSBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFncGIuZHNzcAogICAg >ICBGSUxFICAgIC1ydy1yLS1yLS0gICA4OTY0NyBieXRlcyAgMDA6MDAgMTIg >RmViIDE5OTMgIDFncGQuZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0g >ICAyMjU2NyBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFoYmcuZHNzcAog >ICAgICBGSUxFICAgIC1ydy1yLS1yLS0gIDE1MjYwOCBieXRlcyAgMDA6MDAg >MTIgRmViIDE5OTMgIDFoYnMuZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1y >LS0gICAzNjQ5OSBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFoY2EuZHNz >cAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICAxMTIxNSBieXRlcyAgMDA6 >MDAgMTIgRmViIDE5OTMgIDFoY2MuZHNzcAogICAgICBGSUxFICAgIC1ydy1y >LS1yLS0gICA0MDc2NSBieXRlcyAgMDA6MDAgMTIgRmViIDE5OTMgIDFoY28u >ZHNzcAogICAgICBGSUxFICAgIC1ydy1yLS1yLS0gICAgIDc2NSBieXRlcyAg >MDA6MDAgMzAgTm92IDE5OTIgIDFidXMuZHNzcAoK >--1380020962-1416198300-767688255:#26970-- Right, this was also my feeling! proceed this way, Manuel From owner-proteins@net.bio.net Sun May 01 23:00:00 1994 Path: biosci!bcm!cs.utexas.edu!swrinde!gatech!newsxfer.itd.umich.edu!news.cic.net!magnus.acs.ohio-state.edu!aarman From: aarman@magnus.acs.ohio-state.edu (Ahmet Arman) Newsgroups: bionet.cellbiol.,bionet.molbio.proteins, Subject: Help Date: 3 May 1994 00:59:23 GMT Organization: The Ohio State University Lines: 12 Message-ID: <2q47lb$2d0@charm.magnus.acs.ohio-state.edu> NNTP-Posting-Host: beauty.magnus.acs.ohio-state.edu I have one abstract in my hand which was published in Herbsttagung der gesellschaft fur Biologische Chemie. I researched all journals whether it is published as article but i did not find it. How can I learn whether or not this abstract is published as article a journal. Authors: C.Nieb,A.Niehaus and W.Wintermeyer Title:Functional Isolated G Domain of Elongation Factor G Thank you for your cooperation A.ARMAN From owner-proteins@net.bio.net Sun May 01 23:00:00 1994 Path: biosci!bcm!cs.utexas.edu!swrinde!ihnp4.ucsd.edu!library.ucla.edu!psgrain!nntp.cs.ubc.ca!unixg.ubc.ca!drwilson From: drwilson@unixg.ubc.ca (Dan R. Wilson) Newsgroups: bionet.molbio.proteins Subject: Re: DSSP program wanted !! Date: 2 May 1994 21:59:11 GMT Organization: University of British Columbia, Vancouver, B.C., Canada Lines: 18 Distribution: bionet Message-ID: <2q3t3f$5r@nnrp.ucs.ubc.ca> References: <9404291441.AA07036@absalpha.dcrt.nih.gov> NNTP-Posting-Host: unixg.ubc.ca In article <9404291441.AA07036@absalpha.dcrt.nih.gov>, geetha wrote: > >Hello Netters > >Can anybody help me find DSSP program ? Is there any anon. FTP site or is >it commercially available ? Gopher to "felix.embl-heidelberg.de" on port 70, traverse the menus to a directory called "software/unix/dssp" and you'll find a LICENSE form. Fill it out, send it by snail mail to the EMBL address indicated, and (apparently) DSSP source code will be sent to you by e-mail. I've looked for some time myself for DSSP, and was pleased to find the LICENSE form _recently_ added to the EMBL gopher menu. It's free to academic users, but you must pay some $$$ for commercial use. Happy DSSPing B-|. Dan Wilson (drwilson@unixg.ubc.ca). From owner-proteins@net.bio.net Sun May 01 23:00:00 1994 Path: biosci!NBRF.GEORGETOWN.EDU!POSTMASTER From: POSTMASTER@NBRF.GEORGETOWN.EDU Newsgroups: bionet.molbio.proteins Subject: Release 40.00 of PIR-International Protein Sequence Database Date: 2 May 1994 10:47:17 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 250 Sender: daemon@net.bio.net Distribution: bionet Message-ID: <01HBV4F61K7M8WWV3A@NBRF.Georgetown.Edu> NNTP-Posting-Host: net.bio.net Announcements of the Protein Information Resource 2 May 1994 Contents 1. PIR-International Protein Sequence Database Release 40.00 2. Summary of Database Developments in Release 40.00 3. The March 1994 ATLAS of Protein and Genomic Sequences CD-ROM 4. The Complex Carbohydrate Structure Database and CarbBank Announcements 1. PIR-International Protein Sequence Database Release 40.00 Release 40.00 of the PIR-International database, Release 14.00 of the NRL_3D Database (corresponding to Brookhaven Protein Data Bank Release 65), and Release 5.1 of the PIR ALN Database of Protein Sequence Alignments are now available through the PIR On-line System and the PIR Network Request Server. The PIR1, PIR2, PIR3, and NRL_3D databases are distributed on tape, and those databases plus the ALN Database are distributed on CD-ROM. Database Release Sequences Residues PIR1 40.00 12,227 4,454,283 Classified and Annotated Entries PIR2 40.00 34,147 9,362,019 Annotated Entries PIR3 40.00 21,049 5,930,994 Unverified Entries NRL_3D 14.00 2,722 484,598 Protein Sequences in Brookhaven PDB ALN 5.1 1,133 Entries Protein Sequence Alignments The NRL_3D Database contains protein sequences extracted from the Brookhaven Protein Data Bank (PDB) coordinate data files. Introduced by the PIR in 1990 as an interface between the Protein Sequence Database and the PDB, it was the first sequence database providing access to the PDB data via computerized sequence searching and comparison methods. The ALN Database contains multiple sequence alignments of selected protein sequences from the PIR-International Protein Sequence Database. Growth of the PIR databases is documented in the file DBGROWTH.LIS available through the PIR Network Request Server. The following files are also available through the Server: PADD.LIS PIR1 and PIR2 entries added since Release 39.00 PREV.LIS PIR1 and PIR2 entries with revised sequences since Release 39.00 SPECIES.LIS species recorded in PIR1 and PIR2 SUPERFAM.LIS superfamiles recorded in PIR1 and PIR2 KEYWORDS.LIS keywords employed in PIR1 and PIR2 FEATURES.LIS features catalogued in PIR1 and PIR2 JOURNALS.LIS recognized journal abbreviations ALNBASE.LIS a description of the ALN Database ALNTITLE.LIS titles in the ALN Database NRLTITLE.LIS titles in the NRL_3D Database To obtain these and other files from the PIR Network Request Server, requests should be sent to: FILESERV@GUNBRF.BITNET or FILESERV@NBRF.Georgetown.Edu 2. Summary of Database Developments in Release 40.00 The enhanced NBRF format was introduced with release 39.00. These format enhancements were undertaken in order to (1) improve the coverage, accuracy, and completeness of the PIR-International Protein Sequence Database, (2) provide additional data fields and define them more precisely so that conversions to other formats or database systems (RDBMS or OODBMS) can be accomplished more easily, (3) make the overall presentation more uniform for human readability and more computer parsable to facilitate automatic checking for correct format, syntax, and vocabulary within the database, and (4) make the two flat file distribution formats of the PIR-International, the NBRF format and the CODATA format, more completely interconvertible without any degradation of information. Because we realized that planned changes could cause software problems if our users were not given advance notice, we set up a developers mailing list and began issuing the PIR Technical Development Bulletin. The fourth Bulletin documented the changes that would be introduced with the enhanced NBRF Format in Release 39.00. It is available in the file PIRTECH.LIS, which can be sent by the PIR Network Request Server or picked up by anonymous FTP from the UH Gene-Server, ftp.bchs.uh.edu, IP address 129.7.2.43. This electronic bulletin provides detailed specifications of the database format and serves as an "early warning system" for software developers and others who are concerned about changes in the format and standards for the PIR databases. If you are interested in the technical aspects of these database changes and would like to be placed on the mailing list for the Technical Bulletin, send a brief electronic mail note to POSTMAST@GUNBRF.BITNET or POSTMASTER@NBRF.Georgetown.Edu. Descriptions of the CODATA Exchange Format and of PIR feature annotations can be obtained from the PIR Network Request Server in the files CXFSD.LIS and FEATDOC.LIS respectively. 3. The March 1994 ATLAS of Protein and Genomic Sequences CD-ROM The new release of the ATLAS of Protein and Genomic Sequences CD-ROM is now available for distribution. The ATLAS Information Retrieval program provides direct and simultaneous retrieval from the databases included on the CD-ROM or on mounted secondary CD-ROMs. In this release of the ATLAS CD-ROM, versions of the ATLAS program are provided for these operating systems: PC-DOS, VAX/VMS, OpenVMS Alpha AXP, DEC OSF/1 Alpha AXP, DEC ULTRIX (RISC), SunOS, SGI/IRIX, and Macintosh The ATLAS program provides a user-friendly environment where entries from selected databases can be linked dynamically for simultaneous retrieval on biological annotations and bibliographic information, such as protein names, superfamily names, homology domains, organism names, gene names, keywords, feature descriptions, author's names, etc. The ATLAS program also enables selected sets of sequences to be searched directly both for exact subsequences or for patterns. A complete and comprehensive Installation and User's Guide is provided on the CD-ROM and the ATLAS program itself contains an integrated help facility. The ATLAS CD-ROM contains specially configured versions of the FASTA programs that allow the protein sequence databases on the CD-ROM to be searched by sequence directly. These programs will execute on PC-DOS, VAX/VMS, and DEC ULTRIX systems. The ATLAS CD-ROM includes: - PIR1, PIR2, PIR3, NRL_3D, and ALN data sets - release 39.06 of the MIPS PATCHX data set - release 2.1 of the JIPID ECOLI (Escherichia coli) Nucleic Acid Sequence Database - release 81.0 of the NCBI-GenBank Genetic Sequence Databank GBNEW data set - indexes for release 81.0 of the NCBI-GenBank Genetic Sequence Databank - release 8 of Complex Carbohydrate Structure Database The MIPS PATCHX data set has been assembled from a collection of other public domain protein sequence databases. When used in conjunction with the MIPS PATCHX data set, the Protein Sequence Database provides the most complete collection of protein sequence data currently available in the public domain. The ECOLI Nucleic Acid Sequence Database compiled by scientists at JIPID and NBRF is a comprehensive, nonredundant, fully merged (all recognized contigs are assembled into single sequence segments), and annotated database containing sequence information from the GenBank, EMBL, and NBRF nucleic acid sequence databases, plus information entered directly from published reports. Protein coding regions are annotated in the feature tables, as are additional features such as promoter regions, Shine-Dalgarno sequences, and transcription termination sequences. The protein coding regions are directly cross-referenced to the PIR-International Protein Sequence Database and features are formatted to allow direct translation by computer. Overlapping sequences are merged and ordered by map position. When their orientation is known, sequence segments are represented in the same direction (the plus strand). Genetic map positions are directly correlated with the Kohara physical map using an algorithm developed by Kunisawa and coworkers that compares restriction fragment lengths, directly incorporating information on restriction site distances while avoiding site inversion problems. Because of its size it is no longer possible to include all of the GenBank Sequence Databank on the ATLAS CD-ROM. All of the GBNEW dataset is provided and the LOCUS and TITLE information is available for the 14 other datasets. However, index files for the NCBI-GenBank Genetic Sequence Databank release 81.0 are provided so that for VAX/VMS and MS-DOS systems with multiple CD-ROM drives the ATLAS program can access the NCBI-GenBank Sequence Databank mounted on a secondary CD-ROM drive. Through the cooperation of CarbBank, the Complex Carbohydrate Structure Database (CCSD) and its associated CarbBank software are now included on the Atlas of Protein and Genomic Sequences CD-ROM. The ATLAS CD-ROM includes documentation and an Installation Manual and Tutorial for CarbBank. The ATLAS program cannot access the CCSD. The CCSD and CarbBank are discussed in more detail in the next section. Orders for the ATLAS CD-ROM are accepted, WITHOUT PREPAYMENT, on institutional purchase orders, by FAX or E-mail. For further information in the US and the Americas, please contact: Kathryn Sidman, Technical Services Coordinator Protein Information Resource (PIR) National Biomedical Research Foundation (NBRF) 3900 Reservoir Rd., NW Washington DC 20007 FAX: (202) 687-1662 phone: (202) 687-2121 E-mail: PIRMAIL@nbrf.georgetown.edu PIRMAIL@gunbrf.bitnet In Europe contact: Martinsried Institute for Protein Sequences (MIPS) Max-Planck-Institute for Biochemistry 8033 Martinsried, Germany FAX: 49 89 8578 2655 phone: 49 89 8578 2657 E-mail: mewes@ehpmic.mips.biochem.mpg.de In Asia and Oceania contact: Japan International Protein Information Database (JIPID) Science University of Tokyo 2669 Yamazaki, Noda 278 Japan FAX: 81 47 122 1544 phone: 81 48 124 1501 E-mail: Tsugita@JPNSUT31.BITNET 4. The Complex Carbohydrate Structure Database and CarbBank This release of the ATLAS CD-ROM includes the Complex Carbohydrate Structure Database (CCSD) release 8 and CarbBank version 2.5. The CCSD is a database that contains complex carbohydrate structures and associated text information derived from scientific publications. The database has a flat file format. Structural abbreviations and nomenclature are similar to those found in the journal Carbohydrate Research. CarbBank is the computer management system for CCSD database files. CarbBank runs on PC- or MS-DOS, IBM-compatible microcomputers, and has a menu-driven user interface. CarbBank has an Editor that allows you to create or modify database records and a Searcher that will let you find records based on Search Criteria that you supply. A Report generation facility allows the user to create a variety of reports on the contents of databases, and an Interchange module allows CarbBank to view reports and to exchange records among ASCII text files, a CarbBank-specific version of the CCSD, and an ASN.1 version of the CCSD. The CarbBank program cannot operate from a floppy diskette, from a CD-ROM, or from a write-protected disk. There are other minimum system and hardware requirements. Please consult the CarbBank documentation or CarbBank before attempting to install this software on your PC. For information about CarbBank contact: Dana Smith CarbBank/CCSD Manager 114 W. Magnolia St. Suite 305 Bellingham, WA 98225, USA Phone: (206) 733-7183 FAX: (206) 733-7283 EMail: Internet: 76424.1122@Compuserve.Com ------------------------------------------------------------------------ Inquiries about how to obtain the PIR-International Protein Sequence Database: Ms. Katie Sidman PIR Technical Services Coordinator National Biomedical Research Foundation 3900 Reservoir Road NW Washington DC 20007 Phone: (202) 687-2121 FAX: (202) 687-1662 EMail: PIRMAIL@nbrf.georgetown.edu ------------------------------------------------------------------------ Dr. Winona C. Barker, Director Protein Information Resource National Biomedical Research Foundation Washington DC 20007 BARKER@nbrf.georgetown.edu From owner-proteins@net.bio.net Sun May 01 23:00:00 1994 Newsgroups: bionet.molbio.proteins Path: biosci!agate!howland.reston.ans.net!EU.net!sunic!news.lth.se!news.lu.se!heimdall!bryan From: bryan@fkem2.lth.se (Bryan Finn) Subject: Re: Protein Folding Message-ID: <1994May2.121340.20687@nomina.lu.se> Sender: news@nomina.lu.se (USENET News System) Nntp-Posting-Host: heimdall.fkem2.lth.se Reply-To: bryan@fkem2.lth.se Organization: Physical Chemistry 2, Lund University, Sweden References: <74975.ewright@fox.nstn.ns.ca> Date: Mon, 2 May 1994 12:13:40 GMT Lines: 34 In article ewright@fox.nstn.ns.ca, ewright@FOX.NSTN.NS.CA ("Edwin Wright") writes: > Does anyone know the foremost research center in protein folding? Also, > what is the latest, most comprehensive reference or review on this topic? > One could argue for many places being foremost in the protein folding field, however, the field is generally well dispersed over a number of labs, each with their own particular slant on the problem. Baldwin at Stanford is one the "biggies" and his review articles are among the most cited (esp Ann. Review Bioch.(ARB)(1982) v. 51, p. 459 and ARB (1990) v. 59, p. 631). These are written with Peter Kim, now at the Whitehead Inst., Boston, who has a strong folding group himself. A.R. Fersht at Cambridge, although he joined the field later has done much to make up for lost time and has quite a bit published in folding. And there are many others doing good work. Creighton's books are a good place to start before delving into the literature. Matthews (C.R.) also had a very readable review in ARB (1993)v.62, p.653 (although I'm maybe a little biased). The journal Current Opinion in Structural Biology is filled with mini-reviews of various aspects in the field as well. --- ___________________________________________________________________ | | | Dr. Bryan Finn | | Department of Physical Chemistry 2 Tel: +46-46-108254 | | Chemical Center Fax: +46-46-104543 | | University of Lund | | POB 124 | | S-221 00 Lund Sweden e-mail: bryan@freja.fkem2.lth.se | |_________________________________________________________________| | | | "It is unworthy of excellent men to lose hours like slaves in | | the labor of calculation." -- Leibniz | |_________________________________________________________________| From owner-proteins@net.bio.net Sun May 01 23:00:00 1994 Path: biosci!agate!msuinfo!harbinger.cc.monash.edu.au!ctl-g10-23.cc.monash.edu.au!mhocw From: mhocw@ccs1.cc.monash.edu.au (MR CW HO [GEN]) Newsgroups: bionet.molbio.proteins Subject: preconcentration of protein prior to SDS PAGE Date: Tue, 3 May 1994 06:27:50 GMT Organization: Monash University Lines: 9 Message-ID: NNTP-Posting-Host: ctl-g10-23.cc.monash.edu.au Keywords: SDS PAGE Hello... i am working on plant proteins at the moment. I have trouble trying to extract the protein in appropriate amounts to view them in SDS PAGE. I am using 0.07% Mercaptoethanol in 10% TCA in acetone. THis should work appropriately. After running on multilane gels I would proceed to put them through a column of Mono S resins. I need suggestions of any kind. thank you Add.: Mhocw@ccs1.cc.monash.edu.au From owner-proteins@net.bio.net Sun May 01 23:00:00 1994 Path: biosci!agate!msuinfo!harbinger.cc.monash.edu.au!vcp1.vcp.monash.edu.au!MichaelJ.McLeish From: MichaelJ.McLeish@vcp1.vcp.monash.edu.au (Michael J. McLeish) Newsgroups: bionet.molbio.proteins Subject: Sequence alignment programs Date: Tue, 3 May 1994 15:15:56 Organization: Victorian College of Pharmacy Lines: 13 Message-ID: NNTP-Posting-Host: mm.vcp.monash.edu.au Dear Netters I am interested in obtaining a program (or programs), preferably public domain, for the alignment of DNA and amino acid sequences. I would appreciate any advice on the choice of programs available. Thanks in advance. Mike Michael J. McLeish Ph.D. Victorian College of Pharmacy E-mail: Michael_m@vcp.monash.edu.au From owner-proteins@net.bio.net Sun May 01 23:00:00 1994 Newsgroups: bionet.molbio.proteins Path: biosci!agate!howland.reston.ans.net!pipex!sunic!EU.net!ub4b!reks.uia.ac.be!news From: przemko@reks.uia.ac.be (Przemko) Subject: Vaccinia expression Message-ID: <1994May2.104744.19745@reks.uia.ac.be> Sender: news@reks.uia.ac.be (USENET News System) Organization: University of Antwerp X-Newsreader: Date: Mon, 2 May 1994 10:47:44 GMT Lines: 10 Hi! It appears that I will have to do some antibodies against my, cloned protein. After looking around, it appears that, in my case, vaccinia system would be the best. We have access to appropiate facilities where the work can be done but... Is anyone selling the system? I could not find it in catalogues, it also appears that there some patent restrictions etc... Could someone enlighten me, please, as to how to get a vaccinia vectors? Przemko From owner-proteins@net.bio.net Mon May 02 23:00:00 1994 Path: biosci!daresbury!trane.uninett.no!sunic!EU.net!uknet!warwick!bham!bcm39.bham.ac.uk!j.d.brinck From: j.d.brinck@bham.ac.uk (Jason Brinck) Newsgroups: bionet.molbio.proteins Subject: Fermentation newsgroup? Date: Tue, 3 May 1994 16:19:24 Organization: The University of Birmingham Lines: 8 Message-ID: NNTP-Posting-Host: bcm39.bham.ac.uk X-Newsreader: Trumpet for Windows [Version 1.0 Rev A] Sorry about the previous, truncated posting!! All I wanted to know is: Is there a fermentation newsgroup out there? I'm interested in anything from lab-scale to industrial plants. Cheers, Jason From owner-proteins@net.bio.net Mon May 02 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!EU.net!uknet!daresbury!not-for-mail From: wgreenha@crc.ac.uk (Dr. W. Greenhale) Newsgroups: bionet.molbio.proteins Subject: fuzzy bands on SDS gels Date: 3 May 1994 12:45:09 +0100 Lines: 18 Sender: daemon@mserv1.dl.ac.uk Distribution: bionet Message-ID: <2q5dg5$pr6@mserv1.dl.ac.uk> Original-To: proteins@dl.ac.uk Hello Netters, I'm afraid I'm not much of a protein person but even I have to run the occasional SDS-PAGE gel. Most of the time this gives no problem but just lately the lower molecular weight bands are very fuzzy. I'm running 10 to 20% gels PAGE gels. My hunch is this is a salt problem but why is it only appearing now? I'm using Sigma Trizma base, is this O.K.? Speaking of which is there any difference between Trizma base and Tris? Bill Greenhalf Biotechnology Group, MRIC, NEWI Deeside, Connah's Quay, Clwyd, UK E-mail Greenhalfw@Newi.ac.uk From owner-proteins@net.bio.net Mon May 02 23:00:00 1994 Path: biosci!agate!library.ucla.edu!news.mic.ucla.edu!unixg.ubc.ca!not-for-mail From: davideb@unixg.ubc.ca (David Edward Bradshaw) Newsgroups: bionet.molbio.proteins,bionet.general Subject: Serine protease inhibitors, esp of Subtilisins Date: 3 May 1994 23:20:05 -0700 Organization: University of British Columbia Lines: 34 Sender: davideb@unixg.ubc.ca Message-ID: <2q7eql$op4@netinfo.ubc.ca> NNTP-Posting-Host: netinfo.ubc.ca Summary: Need sugg. re serine protease inhibitors. Keywords: subtilisins, serine, inhibitors, protease, proteinase Xref: biosci bionet.molbio.proteins:1866 bionet.general:8878 Dear Netters; I am curently researching specific inhibition of the subtilisin-like serine protease secreted by the fungus _O.piscea_. Does anyone have any ideas on specific inhibitors of the proteinase? Ideally, I wish to interfere with the digestion and uptake of wood proteins by the fungus, disrupting the nitrogen utilization pathway and leaving the fungi viable, still able to utilize inorganic N-sources (for culture in semi-artificial media). Possible inhibitors currently under consideration are EDTA, PMSF, Pefabloc, SDS, DDAC, Boric acids, PQ8, Copper compounds, pigment inhibitors, carbodiimide, alpha-2-macroglobulin, beta-mercaptoethanol, APMSF, TLCK, and alpha-antitrypsin. The direct utility of these inhibitors is use in wood preservation (ie: protection from staining fungi, esp O.p.), so ideally they must be water-soluble, with low rates of spontaneous breakdown at approximately neutral pH, non-hramful to the wood, relatively non-toxic, and cheap enough to use commercially (although this is not such an issue now, as this is only being done on a small scale at present). Any thoughts on this matter would be greatly appreciated. A second thought is that there may be a way to block release of the enzyme from the fungi. The proteinase is the major secreted protein product, and blocking of exocytosis may serve my needs, if there is an inhibitor for this purpose available. My background is in biochemistry, so I have much research to do! Anyhow, any thoughts will be of great help. Please reply by email ifpossible, to save the bandwidth. Thanks in advance for your help! Dave. ------------------------------------------------------------------| |Dave Bradshaw davideb@unixg.ubc.ca or 73063.1630@compuserve.com | |-----------------------------------------------------------------| | "When I die, I hope I die like my Grandfather did, quietly in | | my sleep, not screaming like the passengers in his car." | |_________________________________________________________________| From owner-proteins@net.bio.net Mon May 02 23:00:00 1994 Path: biosci!daresbury!trane.uninett.no!sunic!EU.net!uknet!warwick!bham!bcm39.bham.ac.uk!j.d.brinck From: j.d.brinck@bham.ac.uk (Jason Brinck) Newsgroups: bionet.molbio.proteins Subject: Fermentation newsgroup? Date: Tue, 3 May 1994 16:15:32 Organization: The University of Birmingham Lines: 1 Message-ID: NNTP-Posting-Host: bcm39.bham.ac.uk X-Newsreader: Trumpet for Windows [Version 1.0 Rev A] From owner-proteins@net.bio.net Mon May 02 23:00:00 1994 Newsgroups: bionet.molbio.proteins Path: biosci!daresbury!trane.uninett.no!sunic!EU.net!howland.reston.ans.net!cs.utexas.edu!convex!news.duke.edu!news-feed-1.peachnet.edu!umn.edu!lenti.med.umn.edu!kay From: kay@lenti.med.umn.edu (Kay Faaberg (Plagemann)) Subject: Tricine gel drying Message-ID: Sender: news@news.cis.umn.edu (Usenet News Administration) Nntp-Posting-Host: lenti.med.umn.edu Organization: University of Minnesota, Twin Cities X-Newsreader: TIN [version 1.2 PL2] Date: Tue, 3 May 1994 19:01:16 GMT Lines: 1 From owner-proteins@net.bio.net Mon May 02 23:00:00 1994 Path: biosci!BCRSSU.AGR.CA!RAMPITSCH From: RAMPITSCH@BCRSSU.AGR.CA Newsgroups: bionet.molbio.proteins Subject: sds page bands; reply Date: 3 May 1994 11:03:55 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 35 Sender: daemon@net.bio.net Distribution: bionet Message-ID: <01HBWLER5VJ6000BPB@GW.AGR.CA> NNTP-Posting-Host: net.bio.net In reply to: >I'm afraid I'm not much of a protein person but even I have to run the >occasional SDS-PAGE gel. Most of the time this gives no problem but just >lately the lower molecular weight bands are very fuzzy. I'm running 10 to >20% gels PAGE gels. My hunch is this is a salt problem but why is it only >appearing now? I'm using Sigma Trizma base, is this O.K.? Speaking of which >is there any difference between Trizma base and Tris? >Bill Greenhalf >Biotechnology Group, >E-mail Greenhalfw@Newi.ac.uk Hi Bill: Yes, Trizma is the same as tris, as far as I know. Your problem of recent fuzzy bands may be caused by your acrylamide stock going off as it does over time. Is it polymerizing as rapidly as it used to? or does it take forever? Try a fresh stock and add anion exchange beads to the stock (they absorb acrylic acid formed over time). Also, are your buffer stocks still OK? Are you using a Laemmli system? You've probably thought of most of this, but it's a start. cheers, chris. (PS, BTW you *are* a protein person :-) ------------------------------------------------------------------------------ Chris Rampitsch | RAMPITSCH@BCRSSU.AGR.CA Dept. Plant Science, Univ. of BC | Phone (604) 494-7711 Vancouver, British Columbia | Fax (604) 494-0755 Canada V6T 2A2 _/\_ ---------------------------------- __\ /__ ---------------------------------- \__ __/ ______________________________________||______________________________________ From owner-proteins@net.bio.net Mon May 02 23:00:00 1994 Path: biosci!daresbury!trane.uninett.no!sunic!EU.net!howland.reston.ans.net!usc!sdd.hp.com!col.hp.com!csn!tali.hsc.colorado.edu!brbmt4.hsc.colorado.edu!Hovland_P From: Peter Hovland Newsgroups: bionet.molbio.proteins Subject: Re: test Date: 4 May 1994 00:23:25 GMT Organization: University of Colorado Health Sciences Center Lines: 7 Distribution: world Message-ID: <2q6ptt$8cm@tali.hsc.colorado.edu> References: <1994Apr27.123927.1@ccvax.sinica.edu.tw> NNTP-Posting-Host: brbmt4.hsc.colorado.edu X-UserAgent: Nuntius v1.1.1d24 X-XXMessage-ID: X-XXDate: Tue, 3 May 94 18:23:06 GMT Subject: test From: mbmst Date: 27 Apr 94 12:39:27 +0000 In article <1994Apr27.123927.1@ccvax.sinica.edu.tw> , mbmst@ccvax.sinica.edu.tw writes: >test this, too is a test. From owner-proteins@net.bio.net Mon May 02 23:00:00 1994 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!vixen.cso.uiuc.edu!newsrelay.iastate.edu!news.iastate.edu!bipin From: bipin@iastate.edu (Bipin K Dalmia) Newsgroups: bionet.molbio.proteins Subject: pI=9.5 protein will not bind to cation exchanger at pH 6.5 Date: 3 May 1994 22:38:03 GMT Organization: Iowa State University, Ames, Iowa (USA) Lines: 15 Distribution: world Message-ID: <2q6job$21t@news.iastate.edu> NNTP-Posting-Host: class1.iastate.edu i'm trying to purify a protein expressed in e. coli. there is tons of it in the soluble extract. the pI is about 9.5. so naturally i tried using a cation exchanger at pH 6.5 but my protein flows right thru it. i've checked the ionic strengths etc. and they look good. the resin was properly equilibrated too. i'm using bio-rad's biorex-70 resin in the sodium form and eluting with a gradient of NaCl. any clues? bip -- bipin k. dalmia the other night i was lying on my bed, looking bipin@iastate.edu up at the beautiful stars, and i said to myself, n2.bkd@isumvs.iastate.edu 'where the F*CK is my ROOF !!' -- From owner-proteins@net.bio.net Mon May 02 23:00:00 1994 Path: biosci!SPEEDY.COACADE.UV.MX!evargas From: evargas@SPEEDY.COACADE.UV.MX (Enrique Vargas) Newsgroups: bionet.molbio.proteins Subject: India Congress quest Date: 3 May 1994 14:30:27 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 21 Sender: daemon@net.bio.net Distribution: bionet Message-ID: <9405032138.AA11677@speedy.speedy.coacade.uv.mx> NNTP-Posting-Host: net.bio.net Dear colleagues: I'm interested in the XVI International Congress of Biochemistry & Molecular Biology. I recived two e-addresses: root@nii.ernet.in and postmaster@nii.ernet.in; but I can't contact them. Could you help me? With best regards E. Vargas. ******************************************************************************* * Enrique Vargas-Madrazo * evargas@speedy.coacade.uv.mx * * * optional: salazar@redvax1.dgsca.unam.mx * ******************************************************************************* * Laboratorio de Biologia Molecular * Phone number: (28)125757 * * e Inmunologia Teorica. * FAX number: (28)125757 * ******************************************************************************* * Instituto de Investigaciones Biologicas * Universidad Veracruzana * * * Xalapa, Veracruz; Mexico. * ******************************************************************************* * POSTAL ADRESS: * * Juan de la Barrera 54, * * Col. Electricistas, C.P. 91000 * * Xalapa, Veracruz; Mexico. * *************************************** From owner-proteins@net.bio.net Mon May 02 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!pipex!lyra.csx.cam.ac.uk!warwick!bham!med242.bham.ac.uk!user From: p.s.lecane@bham.ac.uk (Philip Lecane) Newsgroups: bionet.molbio.proteins Subject: Attention p53 Groupies Followup-To: bionet.molbio.proteins Date: 3 May 1994 11:39:16 GMT Organization: University of Birmingham Lines: 14 Distribution: world Message-ID: NNTP-Posting-Host: med242.bham.ac.uk Hello there, This is my first time posting to this group. I am coming to the end of my Ph.D in Cancer research here in Birmingham and I was wondering if any other tumour biologists read this group. I have been studing the effects of Adenovirus 5 and 12 on p53 and other cellular proteins in Human and rat cells and I would like to know what other people are doing in the vast p53 field (doesn't need to include Adenovirus). I would also like to discuss various oncogene/tumour-suppressor proteins and other related topics. So if you have something to talk about, let me know. If you have any problems relating to this area of research perhaps I can help. Looking forward to hearing some responses Philip From owner-proteins@net.bio.net Mon May 02 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!vixen.cso.uiuc.edu!sdd.hp.com!col.hp.com!csn!tali.hsc.colorado.edu!brbmt4.hsc.colorado.edu!Hovland_P From: Peter Hovland Newsgroups: bionet.molbio.proteins Subject: Re: Sequence alignment programs Date: 4 May 1994 00:35:41 GMT Organization: University of Colorado Health Sciences Center Lines: 24 Distribution: world Message-ID: <2q6qkt$8fv@tali.hsc.colorado.edu> References: NNTP-Posting-Host: brbmt4.hsc.colorado.edu X-UserAgent: Nuntius v1.1.1d24 X-XXMessage-ID: X-XXDate: Tue, 3 May 94 18:35:16 GMT Subject: Sequence alignment programs From: Michael J. McLeish, MichaelJ.McLeish@vcp1.vcp.monash.edu.au Date: Tue, 3 May 1994 15:15:56 In article Michael J. McLeish, MichaelJ.McLeish@vcp1.vcp.monash.edu.au writes: >Dear Netters > >I am interested in obtaining a program (or programs), preferably public >domain, for the alignment of DNA and amino acid sequences. I would >appreciate any advice on the choice of programs available. > >Thanks in advance. > >Mike > >Michael J. McLeish Ph.D. >Victorian College of Pharmacy >E-mail: Michael_m@vcp.monash.edu.au The Indiana University gopher offers a software called SEQAPP which can be used with another program called CLUSTAL for multiple sequence alignment. I've never actually used it, but I've seen others do it. It was free last year. From owner-proteins@net.bio.net Mon May 02 23:00:00 1994 Path: biosci!daresbury!trane.uninett.no!eunet.no!nuug!EU.net!howland.reston.ans.net!europa.eng.gtefsd.com!news.umbc.edu!haven.umd.edu!purdue!lerc.nasa.gov!magnus.acs.ohio-state.edu!rsaldanh From: rsaldanh@magnus.acs.ohio-state.edu (Roland J Saldanha) Newsgroups: bionet.molbio.proteins Subject: Re: pI=9.5 protein will not bind to cation exchanger at pH 6.5 Date: 4 May 1994 00:35:31 GMT Organization: The Ohio State University Lines: 29 Distribution: world Message-ID: <2q6qkj$7er@charm.magnus.acs.ohio-state.edu> References: <2q6job$21t@news.iastate.edu> NNTP-Posting-Host: bottom.magnus.acs.ohio-state.edu In article <2q6job$21t@news.iastate.edu>, Bipin K Dalmia wrote: >i'm trying to purify a protein expressed in e. coli. there is tons of it >in the soluble extract. the pI is about 9.5. so naturally i tried using >a cation exchanger at pH 6.5 but my protein flows right thru it. i've >checked the ionic strengths etc. and they look good. the resin was >properly equilibrated too. i'm using bio-rad's biorex-70 resin in the >sodium form and eluting with a gradient of NaCl. > >any clues? > >bip >-- >bipin k. dalmia the other night i was lying on my bed, looking >bipin@iastate.edu up at the beautiful stars, and i said to myself, >n2.bkd@isumvs.iastate.edu 'where the F*CK is my ROOF !!' >-- Frequently this is due to nucleic acids contaminating a prep. Basic proteins stay tightly bound and their charge is thus masked and the protein flows through. If you have not already treated your extract to remove nucleic acids you might consider: PEI precipitation in high salt (0.5M) to remove nucleic acids followed by ammonium sulphate precipitation of the protein to get rid of the PEI. or nuclease treatment or gel filtration in high salt (if your protein is small enough to seprerate from bulk nucleic acids). PEI is by far the most widely used. From owner-proteins@net.bio.net Mon May 02 23:00:00 1994 Path: biosci!LSM.NRL.NAVY.MIL!miller From: miller@LSM.NRL.NAVY.MIL Newsgroups: bionet.molbio.proteins Subject: preferred codon usage in E. coli Date: 3 May 1994 14:19:37 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 11 Sender: daemon@net.bio.net Distribution: bionet Message-ID: <0097DE31.958FC4A0.28681@lsm.nrl.navy.mil> NNTP-Posting-Host: net.bio.net Hello everyone, I am currently trying to overexpress a eukaryotic protein using a T7 RNA polymerase promotor system, but am only getting about 1 mg/liter culture of expressed protein. I am looking for ways to optimize this expresAny can determine which codons are most frequently used in E. coli. Any other suggestions would be greatly appreciated. Charles Miller, PhD From owner-proteins@net.bio.net Mon May 02 23:00:00 1994 Newsgroups: bionet.molbio.proteins Path: biosci!daresbury!trane.uninett.no!sunic!EU.net!howland.reston.ans.net!cs.utexas.edu!convex!news.duke.edu!news-feed-1.peachnet.edu!umn.edu!lenti.med.umn.edu!kay From: kay@lenti.med.umn.edu (Kay Faaberg (Plagemann)) Subject: signal sequence cleavage predictions Message-ID: Summary: Is there a program to do this? I heard that there was a program called something like Sender: news@news.cis.umn.edu (Usenet News Administration) Nntp-Posting-Host: lenti.med.umn.edu Organization: University of Minnesota, Twin Cities Date: Tue, 3 May 1994 19:11:46 GMT Lines: 5 : write to kay@lenti.umn.edu Keywords: From owner-proteins@net.bio.net Tue May 03 23:00:00 1994 Newsgroups: bionet.molbio.proteins Path: biosci!agate!howland.reston.ans.net!darwin.sura.net!fconvx.ncifcrf.gov!mack From: mack@ncifcrf.gov (Joe Mack) Subject: Re: preferred codon usage in E. coli Message-ID: Organization: Frederick Cancer Research and Development Center References: <0097DE31.958FC4A0.28681@lsm.nrl.navy.mil> Distribution: bionet Date: Wed, 4 May 1994 13:16:21 GMT Lines: 22 In article <0097DE31.958FC4A0.28681@lsm.nrl.navy.mil> miller@LSM.NRL.NAVY.MIL writes: >Hello everyone, > >I am currently trying to overexpress a eukaryotic protein using a T7 RNA >polymerase promotor system, but am only getting about 1 mg/liter culture of >expressed protein. I am looking for ways to optimize this expresAny > >can determine which codons are most frequently used in E. coli. Any other >suggestions would be greatly appreciated. For a table of codons look in the Novagen Catalogue, 1994, p68 (Ref Gribskov et al NAR 1984, 12, 539-49). For an example of increasing expression of a gene see Holler et al, Gene 1993, 136, 323-8. Joe Mack, BSc mack@ncifcrf.gov > >Charles Miller, PhD > From owner-proteins@net.bio.net Tue May 03 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!EU.net!chsun!elna.ethz.ch!bourne33.ethz.ch!schuppenhauer From: Michael R. Schuppenhauer Newsgroups: bionet.immunology,fr.bio.general,fj.sci.bio,sci.bio,sci.bio.technology,bionet.cellbiol,bionet.molbio.methds-reagnts,bionet.molbio.proteins Subject: Searching MAb's against hCG (a,b) Date: 4 May 1994 13:49:03 GMT Organization: ETH Zurich - ChemEng Lines: 26 Distribution: world Message-ID: <2q894f$guo@elna.ethz.ch> NNTP-Posting-Host: bourne33.ethz.ch X-UserAgent: Version 1.1.3 X-XXMessage-ID: X-XXDate: Wed, 4 May 94 14:56:29 GMT Xref: biosci bionet.immunology:1312 sci.bio:8489 sci.bio.technology:1095 bionet.cellbiol:498 bionet.molbio.methds-reagnts:13923 bionet.molbio.proteins:1869 Hi everybody out there, We are working on human Chorionic Gonadotropin (hCG). The idea is to detect the alpha and the beta chain as well as the complete molecule in a (Western) Blot with visible light. Therefore we are looking for MAb's for the alpha chain and the beta chain. Both should also be detecting the complete molecule, therefore they must not bind at the connection of alpha and beta. To make it more complex we want to detect each subchain in the Blot at visible giving different color. Therefore one antibody should be IgG the other different for instance IgM or IgA. Therefore we are looking for protocols (if any) MAb's or references to accomplish it. Like does anyone have an idea were to find a Mouse MAb IgM against the alpha or the beta chain of hCG that is ideally conjugated to Flourescine, Rhodamine or Biotin (Streptavidin Red)? Thanks very much for any thoughts, hints or comments. Michael R. Schuppenhauer ETH Zurich, Switzerland michaelrs@ezzeus.vmsmail.ethz.ch schuppenhauer@tech.chem.ethz.ch From owner-proteins@net.bio.net Tue May 03 23:00:00 1994 Newsgroups: bionet.molbio.proteins Path: biosci!agate!howland.reston.ans.net!europa.eng.gtefsd.com!darwin.sura.net!fconvx.ncifcrf.gov!mack From: mack@ncifcrf.gov (Joe Mack) Subject: Re: pI=9.5 protein will not bind to cation exchanger at pH 6.5 Message-ID: Organization: Frederick Cancer Research and Development Center References: <2q6job$21t@news.iastate.edu> Date: Wed, 4 May 1994 13:21:11 GMT Lines: 25 In article <2q6job$21t@news.iastate.edu> bipin@iastate.edu (Bipin K Dalmia) writes: >i'm trying to purify a protein expressed in e. coli. there is tons of it >in the soluble extract. the pI is about 9.5. so naturally i tried using >a cation exchanger at pH 6.5 but my protein flows right thru it. i've >checked the ionic strengths etc. and they look good. the resin was >properly equilibrated too. i'm using bio-rad's biorex-70 resin in the >sodium form and eluting with a gradient of NaCl. I wouldn't worry about it just yet, proteins don't have to bind just because they have the opposite charge to the column, the charged might be in a hollow or spread evenly over the surface. Go finf something that it will bind to. Joe Mack mack@ncifcrf.gov > >any clues? > >bip >-- >bipin k. dalmia the other night i was lying on my bed, looking >bipin@iastate.edu up at the beautiful stars, and i said to myself, >n2.bkd@isumvs.iastate.edu 'where the F*CK is my ROOF !!' >-- From owner-proteins@net.bio.net Tue May 03 23:00:00 1994 Path: biosci!daresbury!trane.uninett.no!sunic!EU.net!howland.reston.ans.net!vixen.cso.uiuc.edu!newsrelay.iastate.edu!news.iastate.edu!yqhuang From: yqhuang@iastate.edu () Newsgroups: bionet.immunology,bionet.molbio.proteins Subject: immunoaffinity purification Date: 4 May 1994 19:49:29 GMT Organization: Iowa State University, Ames, IA Lines: 24 Distribution: world Message-ID: <2q8u89$skp@news.iastate.edu> NNTP-Posting-Host: vincent1.iastate.edu Xref: biosci bionet.immunology:1315 bionet.molbio.proteins:1871 Dear netters, I have been trying to purify a cell surface glycoprotein by immunoaffinty chromatography.I tried protein G-sepharose for both purification and covalent coupling of the monoconal antibody.That worked just fine.I solubilized the membrane proteins in detergent,without first purifying the membrane.The problems were:1)elution:I tried high pH,low pH,high salt(4 M MgCl2),NaSCN,urea,and even guanidine.HCl,no one satisfied me for recovery. 2)purity.I used proteinG-sepharose precolumn,but still could not get rid of the contaminants.Lentil lectin column did not help either. Thank you for your advice in advance. Yueqiao Huang 3178 Molecular Biology Bldg Iowa State University Ames,IA 50011 fax:515-294-0345 email:yqhaung@iastate.edu -- From owner-proteins@net.bio.net Tue May 03 23:00:00 1994 Path: biosci!bcm!news.tamu.edu!MEDBIOCHEM2.TAMU.EDU!erich From: erich@bioch.tamu.edu (Eric J Hebert) Newsgroups: bionet.molbio.proteins Subject: Re: preferred codon usage in E. coli Date: Wed, 4 May 1994 16:14:32 Organization: Texas A&M University Lines: 32 Distribution: bionet Message-ID: References: <0097DE31.958FC4A0.28681@lsm.nrl.navy.mil> NNTP-Posting-Host: medbiochem2.tamu.edu X-Newsreader: Trumpet for Windows [Version 1.0 Rev A] In article mack@ncifcrf.gov (Joe Mack) writes: >For a table of codons look in the Novagen Catalogue, 1994, p68 (Ref Gribskov >et al NAR 1984, 12, 539-49). For an example of increasing expression of a >gene see Holler et al, Gene 1993, 136, 323-8. >Joe Mack, BSc >mack@ncifcrf.gov >> >>Charles Miller, PhD >> In addition to Joe's comments, I believe deBoer, H.A. & Kastelein, R.A. (1986) in Maximizing Gene Expression, eds. Rezinkoff, W & Gold, L. (BUtterworth, Stoneham, MA). pp. 225-285. is an excellent reference. Also Springer and Sligar have used this information in the "High-Level expression of Sperm Whale Myoglobin in E. coli" in PNAS 84:8961-8965 (1987) for an example of its use. Good Luck E Erich@bioch.tamu.edu From owner-proteins@net.bio.net Tue May 03 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!newsserver.jvnc.net!raffles.technet.sg!nuscc.nus.sg!mcbtansh From: mcbtansh@leonis.nus.sg (Tan Shyh Han) Newsgroups: bionet.molbio.proteins Subject: Sequence of Sp1 Transcription Factor Date: 5 May 1994 04:39:03 GMT Organization: National University of Singapore Lines: 5 Message-ID: <2q9t97$90l@nuscc.nus.sg> NNTP-Posting-Host: leonis.nus.sg Keywords: Sp1, Protein/DNA sequence X-Newsreader: TIN [version 1.2 PL0] Does anyone know the full length sequence of the Sp1 sequence? I have searched the databases but the sequence posted by Kadonaga et al only contain about 3/4 of the 3' sequence. From owner-proteins@net.bio.net Tue May 03 23:00:00 1994 Path: biosci!daresbury!trane.uninett.no!sunic!EU.net!howland.reston.ans.net!vixen.cso.uiuc.edu!sdd.hp.com!saimiri.primate.wisc.edu!ames!purdue!lerc.nasa.gov!magnus.acs.ohio-state.edu!csn!tali.hsc.colorado.edu!brbmt4.hsc.colorado.edu!Hovland_P From: Peter Hovland Newsgroups: bionet.molbio.proteins Subject: Re: modeling group Date: 4 May 1994 16:42:47 GMT Organization: University of Colorado Health Sciences Center Lines: 7 Distribution: world Message-ID: <2q8ja7$nt8@tali.hsc.colorado.edu> References: <2pec6b$a4q@senator-bedfellow.MIT.EDU> NNTP-Posting-Host: brbmt4.hsc.colorado.edu X-UserAgent: Nuntius v1.1.1d24 X-XXMessage-ID: X-XXDate: Wed, 4 May 94 10:42:26 GMT In article <2pec6b$a4q@senator-bedfellow.MIT.EDU> Lluis Ribas, lluis@aaRS.mit.edu writes: >Summary: >Expires: >References: <9404212029.AA00523@merlin.ciens.ula.ve> Do it! From owner-proteins@net.bio.net Tue May 03 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!wupost!news.miami.edu!usenet.ufl.edu!maple.circa.ufl.edu!KDLST1 From: kdlst1@maple.circa.ufl.edu Newsgroups: bionet.molbio.proteins Subject: pI of thryoid hormone? Date: 5 May 1994 01:34:06 GMT Organization: University of Florida - CIRCA Lines: 13 Message-ID: <2q9iefINNn3t@no-names.nerdc.ufl.edu> Reply-To: kdlst1@maple.circa.ufl.edu NNTP-Posting-Host: maple.circa.ufl.edu Netters, I am desparately seeking the pI of the parathyroid hormone fragment 1-34 (not the full, intact protein!). If anyone has this information, or knows where I could get it, any help would be greatly appreciated. Thank you. Keith KDLST1@ufcc.ufl.edu From owner-proteins@net.bio.net Tue May 03 23:00:00 1994 Path: biosci!agate!usenet.ins.cwru.edu!lerc.nasa.gov!purdue!news.cs.indiana.edu!nstn.ns.ca!psinntp!psinntp!cmcl2!mcclb0!hill From: hill@mcclb0.med.nyu.edu (John Edward Hill) Newsgroups: bionet.molbio.proteins Subject: GPI consensus sequence(s) Message-ID: <1994May3.091053.7420@mcclb0> Date: 3 May 94 09:10:53 EST Distribution: world Organization: NYU Medical Center, New York, NY 10016, USA Lines: 12 Are there any consensus sequences for GPI-anchor proteins? If no consensus sequences, are there any rules or general observations? Thanks! John ___________________________________________________________________________ John Edward Hill, Ph.D. | Department of Cell Biology Internet: HILL@MCCLB0.MED.NYU.EDU | New York University Medical Center EARN/Bitnet: HILL@NYUMED.BITNET | 550 First Avenue 212-263-7135 FAX: 212-263-8139 | New York, New York 10016-6402 ___________________________________________________________________________ From owner-proteins@net.bio.net Tue May 03 23:00:00 1994 Path: biosci!daresbury!trane.uninett.no!sunic!isgate!news.rhi.hi.is!zjons From: zjons@rhi.hi.is (Zophonias Oddur Jonsson) Newsgroups: bionet.molbio.proteins Subject: Re: Sequence alignment programs Date: 5 May 1994 00:17:30 GMT Organization: University of Iceland Lines: 33 Message-ID: <2q9duq$t4o@eldborg.rhi.hi.is> References: <2q6qkt$8fv@tali.hsc.colorado.edu> NNTP-Posting-Host: hengill.rhi.hi.is In <2q6qkt$8fv@tali.hsc.colorado.edu> Peter Hovland writes: >Subject: Sequence alignment programs >From: Michael J. McLeish, MichaelJ.McLeish@vcp1.vcp.monash.edu.au >Date: Tue, 3 May 1994 15:15:56 >In article Michael >J. McLeish, MichaelJ.McLeish@vcp1.vcp.monash.edu.au writes: >>Dear Netters >> >>I am interested in obtaining a program (or programs), preferably public >>domain, for the alignment of DNA and amino acid sequences. I would >>appreciate any advice on the choice of programs available. >The Indiana University gopher offers a software called SEQAPP which can >be used with another program called CLUSTAL for multiple sequence >alignment. I've never actually used it, but I've seen others do it. It >was free last year. I have been looking around for a program like that for the mac and as far as I know ClustalV is the best one available for free. You can run it without seqapp, but it can be a bit confusing to get it to work for the first time. There is a UNIX version of clustalV and I am pretty sure it has been ported to DOS. Clustalv is in most of the bio software archives but to name one I think it can be downloaded by anonymous ftp at felix.embl-heidelberg.de ClustalV is not a Mac style program but once you get it to work It's a dream Good luck Zophonias O. Jonsson University of Iceland From owner-proteins@net.bio.net Tue May 03 23:00:00 1994 Path: biosci!daresbury!trane.uninett.no!sunic!EU.net!howland.reston.ans.net!europa.eng.gtefsd.com!library.ucla.edu!psgrain!nntp.cs.ubc.ca!unixg.ubc.ca!quartz.ucs.ualberta.ca!max From: max@mycroft.mmid.ualberta.ca (Max Cummings) Newsgroups: bionet.molbio.proteins Subject: Scrutineer Date: 4 May 1994 22:31:36 GMT Organization: Department of Medical Microbiology and Infectious Diseases, University of Alberta Lines: 18 Message-ID: <2q97o8$i3n@quartz.ucs.ualberta.ca> NNTP-Posting-Host: clouseau.mmid.ualberta.ca X-Newsreader: TIN [version 1.2 PL2] I am looking for a unix version (to run on an SGI Indy) of a program called Scrutineer which calculates the amino acid composition of proteins in databases such as PIR and SWISS-PROT. The program was supposed to be (according to Anal. Biochem. 198:330(1991)) at EMBL-Heidelberg.de under unix software but I could only see a vax version. Anybody know where this beast is? Thanks, -- Max Cummings, MMID, 1-41 Medical Sciences Bldg., University of Alberta, Edmonton, Alberta, CANADA, T6G 2H7 Tel: 403-492-7581 or 4696; FAX: 403-492-7521 max@clouseau.mmid.ualberta.ca From owner-proteins@net.bio.net Tue May 03 23:00:00 1994 Newsgroups: bionet.molbio.proteins Path: biosci!ysics.physics.sunysb.edu!adam.cc.sunysb.edu!psinntp!psinntp!cmcl2!yale.edu!cs.yale.edu!loglady.ninds.nih.gov!johnk From: johnk@loglady.ninds.nih.gov (John Kuszewski) Subject: Re: Attention p53 Groupies Message-ID: <1994May3.203600.11531@cs.yale.edu> Sender: news@cs.yale.edu (Usenet News) Nntp-Posting-Host: spasm.niddk.nih.gov Reply-To: johnk@loglady.ninds.nih.gov (John Kuszewski) Organization: National Inst. of Health, NINDS, LMCN References: Date: Tue, 3 May 1994 20:36:00 GMT Lines: 16 Speaking of p53, does anyone know if there's a good expression system for it (or just its DNA-binding domain) in ecoli? -- _____________ | ___/_ | |/ / -- /\ // /-- || || / /|| || || / / || || ||/ / || John Kuszewski || |/ /| || johnk@spasm.niddk.nih.gov || / /|| || \/ / / || \/ that's MISTER protein G to you! |/__/| | /_________| From owner-proteins@net.bio.net Wed May 04 23:00:00 1994 Path: biosci!agate!overload.lbl.gov!dog.ee.lbl.gov!ihnp4.ucsd.edu!swrinde!cs.utexas.edu!howland.reston.ans.net!EU.net!uknet!lyra.csx.cam.ac.uk!mole.bio.cam.ac.uk!smb18 From: smb18@mole.bio.cam.ac.uk (Simon Brocklehurst (Bioc)) Newsgroups: bionet.molbio.proteins Subject: Re: Recombinant protein folding Date: 5 May 1994 18:04:58 GMT Organization: University of Cambridge, England Lines: 50 Message-ID: <2qbcga$bqe@lyra.csx.cam.ac.uk> References: NNTP-Posting-Host: mole.bio.cam.ac.uk j.d.brinck@bham.ac.uk (Jason Brinck) writes: >Can anyone give me some info? >I am at the moment purifying the recombant and wild type forms of an enzyme >and want to analyse the differences in protein folding, if any, as the >recombinant form is less active than the wild type. What type of analyses are >there for studying protein folding and how much/how pure does the protein have >to be. Circular dichroism has been suggested to me. The problem with over-expressing proteins is that some systems seem to express the protein too quickly for it to fold _properly_. Maybe a limiting situation would be getting inclusion bodies etc. But it doesn't have to be that drastic. So you can get "in between" situations where the protein is expressed and soluble and purifiable, but in some way not quite correctly folded. i.e the CD and 1-D NMR suggest that the protein is unfolded. Don't ignore 'old-fashioned', non-sexy ignore of this - i.e. those that don't require fancy machinery to look at the problem. A very nice and acutally quite subtle probe of the amount of time that a protein spends folded properly vs folded not properly is limited proteolysis. So you would compare the behaviours of your recombinant vs wilt-type You could do a time-course (perhaps 5 minutes, 10 minutes, 1 hour, 3 hours) with ,say, trypsin added to your protein. Run the samples out on a gel etc. Obviously try to pick a protease that your wild-type isn't too susceptable to! The way proteases probably work on _proteins_ (check out the paper from Janet Thornton's group, in the next/current issue of Protein Science) is that 5-10 residues usually need to change conformation to fit into the active site etc i.e. these regions are flexible. So if your recombinant protein is more susceptable to proteolysis (the bands will disappear on the gel!!) - then it is more flexible than the wild-type, thus spends less time in the "native" conformation etc etc. If it works, this technique it's much less hassle than CD, or 1-D NMR! Simon !----------------------------------------------------------------------- Simon M. Brocklehurst Cambridge Centre for Molecular Recognition Department of Biochemistry University of Cambridge Cambridge UK E-mail: s.m.brocklehurst@bioc.cam.ac.uk From owner-proteins@net.bio.net Wed May 04 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!pipex!warwick!bham!bcm39.bham.ac.uk!j.d.brinck From: j.d.brinck@bham.ac.uk (Jason Brinck) Newsgroups: bionet.molbio.proteins Subject: Recombinant protein folding Date: Thu, 5 May 1994 16:43:48 Organization: The University of Birmingham Lines: 11 Message-ID: NNTP-Posting-Host: bcm39.bham.ac.uk X-Newsreader: Trumpet for Windows [Version 1.0 Rev A] Can anyone give me some info? I am at the moment purifying the recombant and wild type forms of an enzyme and want to analyse the differences in protein folding, if any, as the recombinant form is less active than the wild type. What type of analyses are there for studying protein folding and how much/how pure does the protein have to be. Circular dichroism has been suggested to me. Thanks, Jason Brinck From owner-proteins@net.bio.net Wed May 04 23:00:00 1994 Newsgroups: bionet.molbio.proteins Path: biosci!agate!howland.reston.ans.net!EU.net!sunic!ki.se!kidec.cmb.ki.se!cib From: cib@kidec.cmb.ki.se (Carlos Ibanez) Subject: ESR of proteins Message-ID: Organization: CMB, Karolinska Institutet Date: Thu, 5 May 1994 14:14:21 GMT Lines: 9 What is the biggest protein that could be analyzed using ESR? What problems are usually addressed by ESR and what are its major limitations If you could references to get me started, I'd appreciate it very much. Thank you very much. pol From owner-proteins@net.bio.net Wed May 04 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!EU.net!chsun!elna.ethz.ch!usenet From: mkertesz@micro.biol.ethz.ch (Michael Kertesz) Newsgroups: bionet.molbio.proteins Subject: Re: pI=9.5 protein will not bind to cation exchanger at pH 6.5 Date: 5 May 1994 13:22:47 GMT Organization: Microbiology ETHZ Lines: 15 Message-ID: <2qarv7$dj8@elna.ethz.ch> References: <2q6job$21t@news.iastate.edu> NNTP-Posting-Host: b22-pro486-1.ethz.ch X-Newsreader: WinVN 0.83.2 In article <2q6job$21t@news.iastate.edu>, bipin@iastate.edu (Bipin K Dalmia) says: > >i'm trying to purify a protein expressed in e. coli. there is tons of it >in the soluble extract. the pI is about 9.5. so naturally i tried using >a cation exchanger at pH 6.5 but my protein flows right thru it. i've > How did you determine the pI? From the nucleic acid sequence? The isoelectric point in the native protein can differ by up to three or four pH units from this!! Check the pI on a native ief gel (if its important - otherwise just use a different system that does separate the protein. There are lots of possibilities!) Michael Kertesz ETH - Institute of Microbiology Zuerich. From owner-proteins@net.bio.net Wed May 04 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!pipex!lyra.csx.cam.ac.uk!bjd12 From: bjd12@cus.cam.ac.uk (Ben Davis) Newsgroups: bionet.general,bionet.molbio.embldatabank,bionet.molbio.proteins,bionet.software Subject: databases search - protein size Date: 5 May 1994 11:36:17 GMT Organization: U of Cambridge, England Lines: 18 Message-ID: <2qalnh$36h@lyra.csx.cam.ac.uk> NNTP-Posting-Host: grus.cus.cam.ac.uk X-Newsreader: TIN [version 1.2 PL2] Xref: biosci bionet.general:8904 bionet.molbio.embldatabank:318 bionet.molbio.proteins:1879 bionet.software:8099 Hi I'm trying to find a way of searching databases for proteins (ideally from E.Coli) with a mass in a given range (say between 10 and 18 kDa). Anyone got any suggestions ? Ben -- ______________________________________________________________________________ Ben Davis, MRC Protein Function and Design, Cambridge, UK ______________________________________________________________________________ "They can make me do it, but they can't make me do it with dignity." From owner-proteins@net.bio.net Wed May 04 23:00:00 1994 Path: biosci!daresbury!trane.uninett.no!sunic!EU.net!howland.reston.ans.net!vixen.cso.uiuc.edu!koniskyj3.life.uiuc.edu!user From: berk@uxa.cso.uiuc.edu (Holger Berk) Newsgroups: bionet.molbio.proteins Subject: Agarose gels for protein purification? Followup-To: bionet.molbio.proteins Date: Thu, 05 May 1994 15:49:34 -0600 Organization: UIUC Lines: 14 Message-ID: NNTP-Posting-Host: koniskyj3.life.uiuc.edu Hello! My question THIS time is about using agarose gel electrophoresis for the purification of proteins. Has anyone out there had any experience with this procedure? Is it possible to detect the proteins in the agarose gel by coomassie blue staining, or do you have to transfer the protiens to a membrane first? Also, is contamination with proteins present in the agarose itself a problem? Any references anyone could send me about this procedure would be very greatly appreciated! Thank you, Ed Beaty Ed_Beaty@qms1.life.uiuc.edu From owner-proteins@net.bio.net Wed May 04 23:00:00 1994 Newsgroups: bionet.molbio.proteins Path: biosci!daresbury!trane.uninett.no!sunic!EU.net!uunet!uunet.ca!uunet.ca!uunet.ca!rose!usenet From: jason.yew@rose.com (jason yew) Subject: Protein folding software Date: Fri, 6 May 1994 03:14:10 GMT Message-ID: <1994May06.021415.8232@rose.com> Distribution: bionet Sender: usenet@rose.com (Usenet Gateway) X-Gated-By: Usenet <==> RoseMail Gateway (v1.70) Organization: Rose Media Inc, Toronto, Ontario. Lines: 23 My friend wishes to ask a question.. Recently a few programs have been written that tackle the problem of protein folding: by analyzing amino acid environments or long-range contacts, they check whether a primary sequence can adopt a known protein fold. I'm aware that Skolnick's Matchmaker is available from TRIPOS associates, and that Thornton is trying to get a server version of her program running, but I haven't been able to find out where I can obtain any of the many other programs which have been written. Would anybody out there know how I can get the programs from Eisenberg (UCLA), Sippl (University of Salzburg), Bryant (nih), Crippen, Wolynes, or Schneider? Thanks for your help, Ulug Unligil and Michael Kobor (ulu@lec.med.utoronto.ca) Department of Molecular and Medical Genetics University of Toronto Toronto, Ontario * --- RoseReader 2.50 P001279 Entered at [ROSE] RoseMail 2.50 : RoseNet<=>Usenet Gateway : Rose Media 416-733-2285 From owner-proteins@net.bio.net Wed May 04 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!pipex!lyra.csx.cam.ac.uk!bjd12 From: bjd12@cus.cam.ac.uk (Ben Davis) Newsgroups: bionet.molbio.proteins Subject: Re: Recombinant protein folding Date: 5 May 1994 16:14:22 GMT Organization: U of Cambridge, England Lines: 41 Message-ID: <2qb60u$9dj@lyra.csx.cam.ac.uk> References: NNTP-Posting-Host: grus.cus.cam.ac.uk X-Newsreader: TIN [version 1.2 PL2] Jason Brinck (j.d.brinck@bham.ac.uk) wrote: : Can anyone give me some info? : I am at the moment purifying the recombant and wild type forms of an enzyme : and want to analyse the differences in protein folding, if any, as the : recombinant form is less active than the wild type. What type of analyses are : there for studying protein folding and how much/how pure does the protein have : to be. Circular dichroism has been suggested to me. CD is good. You need mL's of uM protein soln, and it needs to be fairly pure (as in > 95% ideally). I've heard FTIR is good for judging folded states (as in 2nd structure content) but have never used it.I understand its heavy on protein. I'd recommend fluorescence, espc doing a fluoresence monitored denaturation - compare wt and recombinant denaturations. Or you could just look at the full emmision spectrum, but I think a denaturation would be easy and probably be more convincing that it was folding ok. Or, there's always NMR, if you've got access to one - just compare the fingerprint regions of the wt and recombinant - don't even need them assigned, judst overlay them (or even just 1D's). This has got to be the most thorough, but its heavy on protein and time, and probably not what you want to do first. : Thanks, : Jason Brinck No problem. Ben -- ______________________________________________________________________________ Ben Davis, MRC Protein Function and Design, Cambridge, UK ______________________________________________________________________________ "They can make me do it, but they can't make me do it with dignity." From owner-proteins@net.bio.net Wed May 04 23:00:00 1994 Path: biosci!headwall.Stanford.EDU!b439-macquadra-i.stanford.edu!user From: doig@cmgm.stanford.edu (Andrew Doig) Newsgroups: bionet.molbio.proteins Subject: Circular Dichroism in Manchester Followup-To: bionet.molbio.proteins Date: 5 May 1994 23:33:59 GMT Organization: Stanford University Lines: 4 Distribution: world Message-ID: NNTP-Posting-Host: b439-macquadra-i.stanford.edu Does anyone know of a CD machine I might possibly get some time on near Manchester, England? Andrew Doig From owner-proteins@net.bio.net Wed May 04 23:00:00 1994 Newsgroups: bionet.immunology,bionet.molbio.proteins Path: biosci!daresbury!trane.uninett.no!sunic!EU.net!uunet!nih-csl!dtwin103.niaid.nih.gov!SSechi From: SSechi@helix.nih.gov (Salvatore Sechi) Subject: Re: immunoaffinity purification Message-ID: Lines: 45 Sender: postman@alw.nih.gov (AMDS Postmaster) Organization: NIAID X-Newsreader: Trumpet for Windows [Version 1.0 Rev A] References: <2q8u89$skp@news.iastate.edu> Date: Fri, 6 May 1994 00:44:36 GMT Xref: biosci bionet.immunology:1321 bionet.molbio.proteins:1887 In article <2q8u89$skp@news.iastate.edu> yqhuang@iastate.edu () writes: >From: yqhuang@iastate.edu () >Subject: immunoaffinity purification >Date: 4 May 1994 19:49:29 GMT >Dear netters, >I have been trying to purify a cell surface glycoprotein by immunoaffinty >chromatography.I tried protein G-sepharose for both purification and >covalent coupling of the monoconal antibody.That worked just fine.I >solubilized the membrane proteins in detergent,without first purifying the >membrane.The problems were:1)elution:I tried high pH,low pH,high salt(4 M >MgCl2),NaSCN,urea,and even guanidine.HCl,no one satisfied me for recovery. >2)purity.I used proteinG-sepharose precolumn,but still could not get rid of >the contaminants.Lentil lectin column did not help either. >Thank you for your advice in advance. >Yueqiao Huang >3178 Molecular Biology Bldg >Iowa State University >Ames,IA 50011 >fax:515-294-0345 >email:yqhaung@iastate.edu >-- > Recovery in Affinity Chromatography: I don't understend if the low recovery is in the coupling or in the elution? Probably You should be able to answer to this question. For my experience if the cupling is poor you still have many things that can be tried, Pierce or Biorad sell many different reagents and/or kits for this porpose. There is no rule for deciding what is the best coupling method. For the elution may be necessary 8M urea. Have you tried? The best precolumn for getting resd of aspecific binding is the same column coupled with an other antibody ( one no very expensive) of the same isotype. I hope the above suggestion will be helpfull. Good Luck. Salvatore Sechi Laboratory of Molecular Allergy and Immunology NIH, NIAID email: ssechi.helix.nih.gov From owner-proteins@net.bio.net Thu May 05 23:00:00 1994 Path: biosci!agate!ames!purdue!news.bu.edu!med-pharm5.bu.edu!user From: leach@mbcrr.harvard.edu (Martin Leach) Newsgroups: bioinet.journals.contents,bioinet.molbio.embldatabank,bionet.molbio.gdb,bionet.molbio.genbank,bionet.molbio.news,bionet.molbio.proteins,bionet.neuroscience,bionet.molbio.methds-reagnts Subject: **URGENT MEDICAL EMERGENCY PLEASE READ*** Date: Fri, 06 May 1994 12:46:06 +0000 Organization: Boston University Dept. of Pharmacology Lines: 35 Distribution: world Message-ID: NNTP-Posting-Host: med-pharm5.bu.edu Xref: biosci bionet.molbio.gdb:197 bionet.molbio.genbank:1620 bionet.molbio.news:4 bionet.molbio.proteins:1891 bionet.neuroscience:3251 bionet.molbio.methds-reagnts:14012 Dear netters, Received this email for help.... please forward any info to the email address in the letter and not to me. U could, and i will forward anything **************************************************************************** I need your help from you or other people that you know. We need to know the effects of the ingestion of acrylamide (20 ml. sol.) in the body. There is a 26 years old boy in intensive care, in his body has been found acrylamide and methanol, that he didn't mentioned before, we want to know if it is possible that the methanol is a metabolic product due to the acrylamide. Which reaction can have these substances in the body? Pleaes answer soon is very important and send this message to other people that you think can help. Thank you very much Candida: +44-61-955 8231 mjfcvn@mh1.mcc.ac.uk ***************************************************************************** thanx in advance Martin Leach -- ..... Martin Leach Email:leach@mbcrr.harvard.edu _|____ Dept. of Pharmacology Phone: (617) 638-5323 / o / Boston Univ. School of Med. Fax: (617) 638-4329 _/ |-/__==/ 80 E. Concord St. (L603) (BULLDOZER) \_ Boston MA 02118 "Not the old underpants on your USA head.....WIBBLE" -BLACKADDER From owner-proteins@net.bio.net Thu May 05 23:00:00 1994 Path: biosci!CMU.CHIANGMAI.AC.TH!mdbci001 From: mdbci001@CMU.CHIANGMAI.AC.TH (Prachya Kongtawelert) Newsgroups: bionet.molbio.proteins Subject: protamine sulphate! Date: 6 May 1994 16:23:32 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 9 Sender: daemon@net.bio.net Distribution: bionet Message-ID: NNTP-Posting-Host: net.bio.net Hello netters, Could anyone please tell me about the structure of protamine sulphate and how it interact with heparin and heparin liked substances? Any suggestions would be very much appreciate. Prachya From owner-proteins@net.bio.net Thu May 05 23:00:00 1994 Path: biosci!daresbury!bioftp.unibas.ch!rc1.vub.ac.be!is3e!philstas From: philstas@vub.ac.be (Stas Philippe) Newsgroups: bionet.molbio.proteins Subject: ANTIBODY MODELLING PROGRAM? Date: 5 May 1994 14:20:59 GMT Organization: Brussels Free Universities (VUB/ULB), Belgium Lines: 16 Message-ID: <2qavcb$m8b@rc1.vub.ac.be> NNTP-Posting-Host: is3e.vub.ac.be X-Newsreader: TIN [version 1.2 PL2] Hello, Anyone knows where I can find the Antibody Modelling program Ads? Prices, what harware required? Thanks _____________________________________________________________ _ Philippe Stas philstas@vub.ac.be _ _ Dept. of Cellular Immunology _ _ Free University of Brussels tel: 32-2-359.03.58 _ _ Paardenstraat 65 Fax: 32-2-359.03.59 _ _ B1640 St.Genesius Rode _ _ _ _____________________________________________________________ From owner-proteins@net.bio.net Thu May 05 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!pipex!lyra.csx.cam.ac.uk!warwick!bham!med242.bham.ac.uk!user From: p.s.lecane@bham.ac.uk (Philip Lecane) Newsgroups: bionet.molbio.proteins Subject: Re: Fermentation newsgroup? Followup-To: bionet.molbio.proteins Date: 6 May 1994 14:15:54 GMT Organization: Institute of Cancer Studies Lines: 17 Distribution: world Message-ID: References: NNTP-Posting-Host: med242.bham.ac.uk In article , j.d.brinck@bham.ac.uk (Jason Brinck) wrote: > All I wanted to know is: Is there a fermentation newsgroup out there? I'm > interested in anything from lab-scale to industrial plants. > > Cheers, > > Jason Is there a alcohol-fermentation newsgroup around? Are there any free samples available? Sorry for "bugging" you guys! Phil aka "Legend in his own Lunchtime". From owner-proteins@net.bio.net Thu May 05 23:00:00 1994 Newsgroups: bionet.molbio.proteins Path: biosci!agate!howland.reston.ans.net!EU.net!sunic!ki.se!kidec.cmb.ki.se!cib From: cib@kidec.cmb.ki.se (Carlos Ibanez) Subject: e-mail address Message-ID: Organization: CMB, Karolinska Institutet Date: Fri, 6 May 1994 12:31:21 GMT Lines: 5 Could anyone out there please give me the e-mail address of Dr. P. Poulsen at the Carlsberg Institute? Thank you very much POL From owner-proteins@net.bio.net Thu May 05 23:00:00 1994 Newsgroups: bionet.molbio.proteins Path: biosci!agate!howland.reston.ans.net!darwin.sura.net!hearst.acc.Virginia.EDU!murdoch!dayhoff.med.Virginia.EDU!wrp From: wrp@dayhoff.med.Virginia.EDU (William R. Pearson) Subject: Re: Sequence alignment programs Message-ID: Sender: usenet@murdoch.acc.Virginia.EDU Organization: University of Virginia References: Date: Tue, 3 May 1994 23:31:01 GMT Lines: 17 Michael J. McLeish wrote: >Dear Netters > >I am interested in obtaining a program (or programs), preferably public >domain, for the alignment of DNA and amino acid sequences. I would >appreciate any advice on the choice of programs available. > The FASTA package is a comprehensive set of programs for sequence alignment, including local and global alignments and heuristic database searches. It is available from virginia.EDU in "pub/fasta/fasta17.shar(.Z)". This package is not in the public domain and should not be redistributed without permission, but it is freely available. Bill Pearson From owner-proteins@net.bio.net Thu May 05 23:00:00 1994 Path: biosci!daresbury!bioftp.unibas.ch!embl-heidelberg.de!hobohm From: hobohm@embl-heidelberg.de (Uwe Hobohm) Newsgroups: bionet.molbio.proteins Subject: Re: DSSP program wanted !! Message-ID: <1994May2.102729.171079@eros.embl-heidelberg.de> Date: 2 May 94 10:27:28 +0100 References: <9404291441.AA07036@absalpha.dcrt.nih.gov> Distribution: bionet Organization: European Molecular Biology Laboratory Lines: 114 In article <9404291441.AA07036@absalpha.dcrt.nih.gov>, geetha@ABSALPHA.DCRT.NIH.GOV (geetha) writes: > > Hello Netters > > Can anybody help me find DSSP program ? Is there any anon. FTP site or is > it commercially available ?r? > > * DSSP -- Dictionary of Sec. Str. Prediction -- Kabsch and Sander. > > Thanks for your help. > > --Geetha DSSP license agreement ______________________ Please fill the DSSP license agreement form, sign, keep a copy, and return by paper mail to Uwe Hobohm EMBL D-69012 Heidelberg Germany of fax it: FAX: +49-6221-387 517 PLEASE INDICATE YOUR INTERNET EMAIL ADRESS CLEARLY ! The distribution of the DSSP source code (C version) to academic users is performed using a shell script that automatically prepares the code and sends it via email. This is done because we want to keep the distribution effort short besides our scientific work. cut here _______________________________________________________________________________ ACADEMIC LICENSE AGREEMENT FOR THE PROGRAM DSSP BY WOLFGANG KABSCH AND CHRIS SANDER An academic license agreement for the DSSP program (c) W. Kabsch, C. Sander,and MPI-MF, 1983, 1988 is granted to .................................... in exchange for the following commitments: I hereby certify that (1) I am an academic user at an academic research institution. In using the software, We will respect the interests of the authors and their institutions. (2) I will not use the software in commercial activities without a written commercial license agreement; commercial activities include, in particular, work under contract from a commercial company. (3) I will not redistribute the software to others outside of my immediate research group. I will suggest to other interested research groups to contact the authors directly. When I leave my current institution, I will either delete the software or reapply for a new license. (4) I will not alter or suppress the run-time copyright message. (5) I will acknowledge the program authors on any publication of scientific results based in part on use of the program and cite the article in which the program was described. (6) I will report evidence of program bugs to the authors. (7) I will send the source code of any bug corrections and program extensions, major or minor, to the original authors, for free academic use. If I have made major extensions which are incor- porated by the authors, I reserve the right to be appropriately included in any future commercial license agreement. (8) I will not extract part of the software, e.g. modules or sub- routines, for use in other contexts without permission by the authors. (9) I will not use the program in the context of classified research. Purpose of research: Full name and institutional address: Internet email adress: Date: Signature: From owner-proteins@net.bio.net Thu May 05 23:00:00 1994 Newsgroups: bionet.molbio.proteins,bionet.software,sci.comp-aided Path: biosci!agate!ihnp4.ucsd.edu!galaxy.ucr.edu!library.ucla.edu!news.ucdavis.edu!lilac!varma From: varma@lilac.cs.ucdavis.edu (Hemant Varma) Subject: Programs needed: Dali, Comp3D, Suppos Message-ID: Sender: usenet@ucdavis.edu (News Guru) Organization: University of California, Davis X-Newsreader: TIN [version 1.2 PL1] Date: Fri, 6 May 1994 18:33:28 GMT Lines: 18 Xref: biosci bionet.molbio.proteins:1892 bionet.software:8127 sci.comp-aided:344 Hello friends, I once again need your help. I am trying to get a copy of the following programs written by Sander and co-workers at the EMBL at Heidelberg. If any one has any information on how to get them I would really appreciate it. 1) Suppos: Fragment pair cluster algorithm 2) Comp3D : Trailing trace superposition algorithm 3) Dali: Distance matrix alignment algorithm These programs were referenced in a paper by Lisa Holm et al (1992) Protein Science, Vol.1 1691-1698. Thank You Hemant Varma From owner-proteins@net.bio.net Fri May 06 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!gatech!newsxfer.itd.umich.edu!zip.eecs.umich.edu!panix!ddsw1!news.cic.net!magnus.acs.ohio-state.edu!aarman From: aarman@magnus.acs.ohio-state.edu (Ahmet Arman) Newsgroups: bionet.molbio.methds-reagnts,bionet.molbio.proteins Subject: Crystallization of Elongation factor EF-G Date: 7 May 1994 21:45:40 GMT Organization: The Ohio State University Lines: 6 Message-ID: <2qh264$p6f@charm.magnus.acs.ohio-state.edu> NNTP-Posting-Host: bottom.magnus.acs.ohio-state.edu Xref: biosci bionet.molbio.methds-reagnts:14044 bionet.molbio.proteins:1897 Hi netters Do you know anybody which crystallized any elongation factor G. Thank you for your cooperation A.ARMAN From owner-proteins@net.bio.net Fri May 06 23:00:00 1994 Path: biosci!agate!ihnp4.ucsd.edu!usc!nic-nac.CSU.net!ctp.org!not-for-mail From: jng@eis.calstate.edu (Joseph S. Ng) Newsgroups: bionet.molbio.proteins Subject: Call for U of Florida email address!! Date: 7 May 1994 22:22:46 -0700 Organization: California Technology Project of The Calif State Univ Lines: 16 Message-ID: <2qhsv6$6ao@eis.calstate.edu> NNTP-Posting-Host: eis.calstate.edu Can anyone out there be of any assistance in my efforts to contact DR. Howard M. Johnson at the dept of microbiology and cell science? Any assistance rendered will be greatly appreciated. -- --- Hougang is an address...Aukang is home...Hougang JoE .ang is an address...Aukang is home...Hougang i Ng, that is... .g********************************************si (Y I OSO DONO) .u* For the love of Christ constraineth us...* s +Lymphocyte .o********************************************a +At .H..((2 Cor 5:14))...emoh si gnakuA...sserdda na +Large .sserdda si gnaguoH...emoh si gnakuA...sserdda n Joseph S. Ng jng@eis.calstate.edu From owner-proteins@net.bio.net Fri May 06 23:00:00 1994 Path: biosci!agate!library.ucla.edu!ihnp4.ucsd.edu!swrinde!gatech!newsxfer.itd.umich.edu!news.cic.net!magnus.acs.ohio-state.edu!aarman From: aarman@magnus.acs.ohio-state.edu (Ahmet Arman) Newsgroups: bionet.molbio.methds-reagnts,bionet.molbio.proteins Subject: Charecterization of fusisdic acid mutattions Date: 7 May 1994 21:58:44 GMT Organization: The Ohio State University Lines: 7 Message-ID: <2qh2uk$p71@charm.magnus.acs.ohio-state.edu> NNTP-Posting-Host: bottom.magnus.acs.ohio-state.edu Xref: biosci bionet.molbio.methds-reagnts:14045 bionet.molbio.proteins:1898 I saw two fusidic acid resistant mutant strain in one article which did not mention where fusidic acid mutants aare located on elongation factor G. Is there anybody who charecterized fusidic acid mutants? How do you test whether or not fusidic acid and cold sensitive mutations are caused by single mutation or multiple mutations. Thank you for your attention to my request From owner-proteins@net.bio.net Sat May 07 23:00:00 1994 Newsgroups: bionet.molbio.embldatabank,bionet.molbio.genbank,bionet.molbio.proteins Path: biosci!daresbury!bioftp.unibas.ch!doelz From: doelz@comp.bioz.unibas.ch (Reinhard Doelz) Subject: Different entry is same sequence (Re: same sequence is different in EMBL and GENBANK) Message-ID: <1994May8.084902.4583@comp.bioz.unibas.ch> Organization: EMBnet Switzerland [Basel] X-Newsreader: TIN [version 1.2 PL2] References: <2q8h6o$av8@mserv1.dl.ac.uk> <2qcts8$a2i@manuel.anu.edu.au> Distribution: bionet Date: Sun, 8 May 1994 08:49:02 GMT Lines: 194 Xref: biosci bionet.molbio.embldatabank:325 bionet.molbio.genbank:1622 bionet.molbio.proteins:1900 My apologies... this is a bit long but try to read it carefully. Ingrid Jakobsen (ingrid@helios.anu.edu.au) wrote: : In article <2q8h6o$av8@mserv1.dl.ac.uk>, Massimo Delledonne writes: : (Sad story deleted about EMBL and GenBank entries being diffent : for the same Accession Number) ... and some other remarks deleted ... : I have also seen duplicate entries eliminated from GenBank, but kept : on EMBL, and sequences withdrawn because corrections showed them to be : identical to previous sequences, but retained on EMBL. : So my solution in general is to stick to GenBank, and not use EMBL. I know : this is a sad thing to say, but as Massimo has also found out, it just : doesn't seem as up-to-date. I don't know which side of the Atlantic the : problem is on: GenBank not sending information on, or EMBL not using it. Just as a matter of fairness, blaming anyone on examples won't help, and deducing that EMBL is bad is presumably a valued view in the states but if I claim GENBANK is bad the US wouldn't tolerate it either :-) It is that the both talk to each other on computer basis. Computer parsing programs are a mess, in particular as both databases don't agree entirely on their formats; i.e. parsing extends to mapping and voila - there are problems. The following example is an annecdote I just came accross where both databases have a duplicate. The entry GGCOL8 in EMBL (15 April 1994, updated 20-April 1994) is LOCUS CHKC1A206 (1-Jun-1984) in GENBANK. However, Entry GGCOL8 (9-Jun 1982, updated 6-Jul 1989) with LOCUS GGCOL8 (6-Jul 89) is only with one Accession number more; J00827 being the first and V00400 being the additional one. Both entries refer to a journal Cell 22, 887-892 (1980) - i.e., EMBL seems to take 14 years before they do a mistake, whereas GENBANK takes only 5 years. The sequences are entirely identical. I use the GENBANK format here to show differences: < AUTHORS Yamada,Y., Avvedimento,E.V., Mudryj,M., Ohkubo,H., Vogeli,G., > AUTHORS Yamada,Y., Avvedimento,E., Mudryj,M., Ohkubo,H., Vogeli,G., < amplification of a dna segment containing an exon of 54 bp > amplification of a DNA segment containing an exon of 54 bp I guess (or at least hope) that these are not the reason for the duplication. The problem comes in the feature table! For the sake of completion I use EMBL format here, in truncated form: FT intron <1. .8 | FT source 1. .70 FT /note="collagen | FT /organism="Gallu FT prim_transcript <1. .>70 | FT CDS 9. .62 FT /note="collagen | FT /note="exon 6" FT exon 9. .62 | FT /number=42 | FT /note="collagen | FT exon 9. .62 | FT /note="collagen | FT putative" | FT intron 63. .>70 | FT /note="collagen | FT source 1. .70 | FT /organism="Gallu | One entry says /note="collagen helipeptide, exon 42 (AA 37 to 54); and the other says /note="exon 6" --- from the SAME reference. In one entry, it tells CDS, in the other, there is no CDS. Why? Simply because in one entry there is CDS from 9 to 62, and mat_peptide in the other entry: (GENBANK format again) < mat_peptide 9..62 < /partial < /codon_start=1 < /note="collagen helipeptide, 2 (AA 37 to 54)" > CDS 9..62 > /note="exon 6; NCBI gi: 63306." > /codon_start=1 > /translation="GPQGPRGPPGPPGKAGED" So what is the difference between a mat_peptide and a CDS? The gbrel.txt from release 82 tells us CDS Sequence coding for amino acids in protein (includes stop codon) mat_peptide Mature peptide coding region (does not include stop codon) and ftable.doc from EMBL CDS Sequence coding for amino acids in protein exon Region that codes for part of spliced mRNA OK, so far the documentation; but GENBANK's precise definition is contra- dictory here as once it is _with_ and once _without_ stop codon. Well; it ist't quite so as the last three nucleotides are coding D as stated in the translation: /translation="GPQGPRGPPGPPGKAGED" I haven't analyzed this systematically but I am afraid that inconsistencies like this make database provider's life difficult. As human intervention is extremely expensive (manpower) and we (customers) don't want to pay the prediction that it will become worse in the future is a safe guess. You rely on BLAST searching? Fine. I used the peptide as described above and seqrched the 'nr' dataset which we do in-house on all protein databases available. The entry scoring Score = 108 (49.3 bits), Expect = 1.1e-08, P = 1.1e-08 Identities = 18/18 (100%), Positives = 18/18 (100%) if looked up in the result, is located at position 8 (as the only entirely matching entry - other irrelevant matches lead the score) and does NOT occur in either SWISSPROT nore PIR database, but only in PATCHX (Pfeiffer, MIPS Martinsried). Entry: patchx:M25963 ; There, we read: LOCUS CHKCOLA07 DEFINITION Chicken alpha-2 collagen gene type I gene, exons 13-15 ACCESSION M25963 SOURCE ORGANISM Gallus gallus REFERENCE 1 AUTHORS Boedtker,H., Finer,M. and Aho,S. TITLE The structure of the chicken alpha-2 collagen gene JOURNAL Ann. N. Y. Acad. Sci. 460, 85-116 (1985) FEATURES CDS join(M25956:1548. .1617,M25956:3513. .3523, M25956:4131. .4148,M25956:4783. .4818,M25959:182. .265, M25961:205. .261,M25962:609. .653,M25962:755. .808, M25962:1118. .1171,M25962:1539. .1592,M25962:2078. .2131, M25962:2345. .2398,6. .50,287. .340,439. .483) /partial /note="alpha-collagen type I;; NCBI gi: 211605." /codon_start=1 Note that there's now talking on entry M25963, with both EMBL and GENBANK versions, and this is exon 13-15, whereas the original source talked about exon 42, and exon 6, respectively. A DNA comparison reveals. Ggcol8 x M25963 May 8, 1994 10:23 .. . . . 15 CAAGGTCCTCGTGGTCCCCCTGGTCCTCCAGGAA 48 || ||| |||| |||| ||||||| ||||| 284 CAGGGTGCTCGCGGTCTCCCTGGTGAGAGAGGAA 317 Oh well, interesting... Why don't you try a BLAST at home and see ? ... on DNA? CONCLUSION ========== I think we all agree that databases are non-optimal. On the other hand, if you see those guys working, they don't feel lazy, nor do they enjoy being reminded that they do produce low-quality data. (I won't talk on proteins here but the situation there is even worse). The data need better MAINTENANCE! We could spend another XX M$ on both sides of the atlantic to have a staff of workers clean up the past, and cope with the flood of the future. But still, this wouldn't help. I think that there's something severely wrong with responsibilities. The researchers don't do what they should, namely take care of their own entries or areas, and correct the entries as appropriate. And, for the future, the genome projects should adopt slightly more responsibility for what they produce. Just dumping thousands of low-quality data entries to the databases, generated by robots, and complain afterwards doesn't help. The funding agencies must understand that a genome project is USELESS (read: wasted money) if the data are not integrated well into the data sets. The coordinators of the projects must refer from cooking their own little databases as they comlain the loudest on the unability of the general database providers. We certainly don't need hundreds of small databases but rather one set which is complete, and high quality. ?We ? Who are 'We' that we tolerate these duplications without doing something ourselves? A change in culture is needed. Regards Reinhard Doelz EMBnet Switzerland -- +---------------------------+-------------------------------------------+ | Dr. Reinhard Doelz | Tel. x41 61 2672247 Fax x41 61 2672078 | | Biocomputing | electronic Mail doelz@urz.unibas.ch | |Biozentrum der Universitaet+-------------------------------------------+ From owner-proteins@net.bio.net Sat May 07 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!pipex!uknet!daresbury!not-for-mail From: JAB5@VAX.YORK.AC.UK Newsgroups: bionet.molbio.proteins Subject: ser-lys dyad Date: 8 May 1994 19:39:23 +0100 Lines: 6 Sender: daemon@mserv1.dl.ac.uk Distribution: bionet Message-ID: <2qjbkr$r9m@mserv1.dl.ac.uk> Original-To: PROTEINS@dl.AC.UK Please help my fading memory. I recall a Ser-Lys dyad in a protein active site but can't remember which protein family! Anyone out there know? Thanks Jim Brannigan chemistry dept University of york, uk. From owner-proteins@net.bio.net Sat May 07 23:00:00 1994 Path: biosci!agate!doc.ic.ac.uk!uknet!daresbury!not-for-mail From: JAB5@VAX.YORK.AC.UK Newsgroups: bionet.molbio.proteins Subject: active site arg Date: 8 May 1994 19:37:13 +0100 Lines: 6 Sender: daemon@mserv1.dl.ac.uk Distribution: bionet Message-ID: <2qjbgp$r2a@mserv1.dl.ac.uk> Original-To: PROTEINS@dl.AC.UK Dear colleagues, How best to collate all proteins with arg in active site? Any tips/pointers appreciated Jim brannigan chemistry dept university of york, uk From owner-proteins@net.bio.net Sat May 07 23:00:00 1994 Path: biosci!agate!library.ucla.edu!psgrain!nntp.cs.ubc.ca!unixg.ubc.ca!pasqual From: pasqual@unixg.ubc.ca (Bryce Pasqualotto) Newsgroups: bionet.neuroscience,bionet.molbio.proteins Subject: looking for CaMKII inhibitor Date: 9 May 1994 04:34:06 GMT Organization: University of British Columbia, Vancouver, B.C., Canada Lines: 8 Message-ID: <2qkefu$gj7@nnrp.ucs.ubc.ca> NNTP-Posting-Host: unixg.ubc.ca Xref: biosci bionet.neuroscience:3270 bionet.molbio.proteins:1903 I am looking for a membrane-permeable activator of Ca2+-calmodulin dependent protein kinase II. Does such a creature exist? Thanks in advance, please post replies to me directly (pasqual@unixg.ubc.ca) as I don't tune in often. BAP From owner-proteins@net.bio.net Sun May 08 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!pipex!sunic!EU.net!uunet!newstf01.cr1.aol.com!search01.news.aol.com!not-for-mail From: kurtb3@aol.com (KurtB3) Newsgroups: bionet.molbio.proteins Subject: Re: immunoaffinity purification Date: 10 May 1994 01:23:02 -0400 Organization: America Online, Inc. (1-800-827-6364) Lines: 13 Sender: news@search01.news.aol.com Message-ID: <2qn5nm$2q7@search01.news.aol.com> References: <2q8u89$skp@news.iastate.edu> NNTP-Posting-Host: search01.news.aol.com In article <2q8u89$skp@news.iastate.edu>, yqhuang@iastate.edu () writes: Have tried deionized water or 10-20% ethylene glycol for elution? It is also sometimes helpful to allow the column to "steep" in the elution buffer for awhile. Other than that, you might need to use a lower affinity Ab. Regarding purity, without knowing more details about your procedure its hard to say. Some matrices have problems with nonspecific binding that can be resolved by washing the column with relatively mild elution conditions (ex: high then low salt) prior to elution of the protein of interest. Another possibility is your protein G, which is known to bind things other than IgG. You might try directly coupling your antibody to a preactivated matrix (NHS usually works well); I've had good luck with sepharose-NHS. Pharmacia has a variety of chemistries available. From owner-proteins@net.bio.net Sun May 08 23:00:00 1994 Path: biosci!agate!spool.mu.edu!torn!nott!uotcsi2!mgcheo.med.uottawa.ca!sbaird From: sbaird@mgcheo.med.uottawa.ca (Stephen Baird) Newsgroups: bionet.molbio.embldatabank,bionet.molbio.genbank,bionet.molbio.proteins Subject: Re: Different entry is same sequence (Re: same sequence is different in EMBL and GENBANK) Followup-To: bionet.molbio.embldatabank,bionet.molbio.genbank,bionet.molbio.proteins Date: 10 May 1994 04:11:51 GMT Organization: Department of Computer Science, University of Ottawa Lines: 34 Distribution: bionet Message-ID: <2qn1i7$l92@csi0.csi.uottawa.ca> References: <1994May8.084902.4583@comp.bioz.unibas.ch> NNTP-Posting-Host: mgcheo.med.uottawa.ca X-Newsreader: TIN [version 1.1 PL8] Xref: biosci bionet.molbio.embldatabank:331 bionet.molbio.genbank:1624 bionet.molbio.proteins:1912 Reinhard Doelz (doelz@comp.bioz.unibas.ch) wrote (with a lot deleted): : We could spend another XX M$ on both sides of the atlantic to have a : staff of workers clean up the past, and cope with the flood of the future. : But still, this wouldn't help. I think that there's something severely : wrong with responsibilities. The researchers don't do what they should, namely : take care of their own entries or areas, and correct the entries as appropriate. : And, for the future, the genome projects should adopt slightly more : responsibility for what they produce. Just dumping thousands of low-quality : data entries to the databases, generated by robots, and complain afterwards : doesn't help. : Regards : Reinhard Doelz I like the idea that researchers should be responsible for their entries in the databases (unfortunately not all of us have organized/clean/up-to-date lab benches or offices and database entries might reflect that). I was wondering what one should do when a competitor duplicates your entry or a complete cDNA is sequenced for which there is a EST database entry. How can the best sequences prevail. |--------------------------------------------------------------------| | Stephen Baird sbaird@mgcheo.med.uottawa.ca | | Molecular Genetics tel: 613-738-3925 | | Children's Hospital of Eastern Ontario fax: 613-738-4833 | | 415 Smyth Rd. | | Ottawa, Ontario | | Canada | | K1H 8M8 | |--------------------------------------------------------------------| From owner-proteins@net.bio.net Sun May 08 23:00:00 1994 Newsgroups: bionet.molbio.embldatabank,bionet.molbio.genbank,bionet.molbio.proteins Path: biosci!agate!library.ucla.edu!europa.eng.gtefsd.com!darwin.sura.net!fconvx.ncifcrf.gov!fcsparc6!toms From: toms@fcsparc6.ncifcrf.gov (Tom Schneider) Subject: Re: Different entry is same sequence (Re: same sequence is different in EMBL and GENBANK) Message-ID: Sender: usenet@ncifcrf.gov (C News) Nntp-Posting-Host: fcsparc6.ncifcrf.gov Organization: Frederick Cancer Research and Development Center References: <2q8h6o$av8@mserv1.dl.ac.uk> <2qcts8$a2i@manuel.anu.edu.au> <1994May8.084902.4583@comp.bioz.unibas.ch> Distribution: bionet Date: Mon, 9 May 1994 17:00:50 GMT Lines: 57 Xref: biosci bionet.molbio.embldatabank:330 bionet.molbio.genbank:1623 bionet.molbio.proteins:1906 In article <1994May8.084902.4583@comp.bioz.unibas.ch> doelz@comp.bioz.unibas.ch (Reinhard Doelz) writes: | I haven't analyzed this systematically but I am afraid that inconsistencies | like this make database provider's life difficult. It makes the database user's life extremely difficult. | As human intervention | is extremely expensive (manpower) and we (customers) don't want to pay the | prediction that it will become worse in the future is a safe guess. Yes, unless action is taken soon eventually there will be a crisis. | I think we all agree that databases are non-optimal. On the other hand, | if you see those guys working, they don't feel lazy, nor do they enjoy | being reminded that they do produce low-quality data. (I won't talk | on proteins here but the situation there is even worse). The data need | better MAINTENANCE! Yes | We could spend another XX M$ on both sides of the atlantic to have a | staff of workers clean up the past, and cope with the flood of the future. | But still, this wouldn't help. I think that there's something severely | wrong with responsibilities. The researchers don't do what they should, namely | take care of their own entries or areas, and correct the entries as appropriate. BINGO! | And, for the future, the genome projects should adopt slightly more | responsibility for what they produce. Just dumping thousands of low-quality | data entries to the databases, generated by robots, and complain afterwards | doesn't help. The funding agencies must understand that a genome project | is USELESS (read: wasted money) if the data are not integrated well into the | data sets. The coordinators of the projects must refer from cooking their | own little databases as they comlain the loudest on the unability of the | general database providers. We certainly don't need hundreds of small databases | but rather one set which is complete, and high quality. | ?We ? BINGO! | Who are 'We' that we tolerate these duplications without doing something | ourselves? A change in culture is needed. Duplication should not be tolerated, that's why it is the first principle in my database philosophy paper. (anonymous ftp from ftp.ncifcrf.gov/pub/delila/philgen* but in revision at the moment. If you would like me to tell you when the next revision is out, please send me a note.) Tom Schneider National Cancer Institute Laboratory of Mathematical Biology Frederick, Maryland 21702-1201 toms@ncifcrf.gov From owner-proteins@net.bio.net Sun May 08 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!pipex!doc.ic.ac.uk!bay.cc.kcl.ac.uk!bay.cc.kcl.ac.uk!udbl119 Newsgroups: bionet.molbio.proteins Subject: Immunoaffinity Purification Using An IgM Message-ID: From: udbl119@bay.cc.kcl.ac.uk (Mandy Johnstone) Date: Mon, 9 May 1994 14:10:01 Organization: King's College London Nntp-Posting-Host: pgw2.rai.kcl.ac.uk X-Newsreader: Trumpet for Windows [Version 1.0 Rev A] Lines: 18 Hi Folks, I have a monoclonal antibody which is an IgM and I would like to use it to purify the protein that it recognises. I think the best way to do this is by doing an immunoaffinity isolation, linking my antibody to a solid support column but I do not know how effective it will be with an IgM antibody as apposed to an IgG. I was wondering if anyone out there has had any experience linking IgM abs to a column and the best way to go about this. Also is there a commercially available kit that I can buy that you would recommend. I have an abundant supply of the monoclonal. Many thanks in advance. Mandy. _______________ Mandy Johnstone (M.Johnstone@bay.cc.kcl.ac.uk) King's College, London. From owner-proteins@net.bio.net Sun May 08 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!pipex!doc.ic.ac.uk!daresbury!bioftp.unibas.ch!rc1.vub.ac.be!is3e!philstas From: philstas@vub.ac.be (Stas Philippe) Newsgroups: bionet.molbio.proteins,bionet.xtallography,bionet.immunology Subject: C1q reviews? Date: 9 May 1994 09:15:34 GMT Organization: Brussels Free Universities (VUB/ULB), Belgium Lines: 18 Message-ID: <2qkuvm$8lj@rc1.vub.ac.be> NNTP-Posting-Host: is3e.vub.ac.be X-Newsreader: TIN [version 1.2 PL2] Xref: biosci bionet.molbio.proteins:1904 bionet.xtallography:909 bionet.immunology:1334 Hello, Does someone know of review articles on the structure and function of the Complement one C1 qnd C1q molecules? Also a good review article on the Complement dependant Cell lysis would be nice. Johor _____________________________________________________________ _ Philippe Stas philstas@vub.ac.be _ _ Dept. of Cellular Immunology _ _ Free University of Brussels tel: 32-2-359.03.58 _ _ Paardenstraat 65 Fax: 32-2-359.03.59 _ _ B1640 St.Genesius Rode _ _ _ _____________________________________________________________ From owner-proteins@net.bio.net Sun May 08 23:00:00 1994 Path: biosci!CS.Arizona.EDU!organpipe.uug.arizona.edu!joplin.biosci.arizona.edu!droberts From: droberts@joplin.biosci.arizona.edu (Doug Roberts) Newsgroups: bionet.molbio.proteins Subject: Re: Immunoaffinity Purification Using An IgM Date: 9 May 1994 23:50:01 GMT Organization: University of Arizona, Biotechnology, Tucson Lines: 46 Sender: droberts@joplin.biosci.arizona.edu (Doug Roberts) Message-ID: <2qmi79$cdb@organpipe.uug.arizona.edu> References: NNTP-Posting-Host: joplin.biosci.arizona.edu Keywords: Affinity Column, Activation In article udbl119@bay.cc.kcl.ac.uk (Mandy Johnstone) writes: >Hi Folks, >I have a monoclonal antibody which is an IgM and I would like to use it to >purify the protein that it recognises. I think the best way to do >this is by doing an immunoaffinity isolation, linking my antibody to a solid >support column but I do not know how effective it will be with an IgM antibody >as apposed to an IgG. I was wondering if anyone out there has had any >experience linking IgM abs to a column and the best way to go about this. >Also is there a commercially available kit that I can buy that you would >recommend. I have an abundant supply of the monoclonal. Many thanks in >advance. > >Mandy. >Mandy Johnstone >(M.Johnstone@bay.cc.kcl.ac.uk) > >King's College, London. Well, there are several ways to go about it, most of which that I'm aware of involve hooking up the Antibody to an activated stationary phase via its N-terminus (or a lysine NH3 group.) You can buy many resins that are already activated from Sigma, or you can activate them yourself. I did this several years ago using cyanogen bromide activated agarose and it was somewhat of a pain. It was inefficient in my hands, so you may want to buy it, although I'll bet it will cost you. The purification worked well, but you have to worry about denaturing your protein when you elute it. We used pH 2.3 to elute, and eluted directly into tubes containing some ungodly buffer concentration at pH 7.0. I have a general reference for Affinity purification, and if I remember, there is a section on preparing columns and elution. Methods in Enzymology, Vol. 104, 3-68, 1984. One more thing: If you decide to activate the matrix yourself, using cyanogen bromide, don't let the pH get acidic, as cyanide gas is released. (i.e. do this in the hood). You might consider other activated matrices like tresyl, epoxy, carbonylimidazole, or succinamide. I've heard that they work well, but have never used them. Good luck, Doug R. From owner-proteins@net.bio.net Sun May 08 23:00:00 1994 Path: biosci!FOX.NSTN.NS.CA!ewright From: ewright@FOX.NSTN.NS.CA ("Edwin Wright") Newsgroups: bionet.molbio.proteins Subject: Quantum Chemistry of Protein Conformation Date: 9 May 1994 16:25:24 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 14 Sender: daemon@net.bio.net Distribution: bionet Message-ID: <73559.ewright@fox.nstn.ns.ca> NNTP-Posting-Host: net.bio.net Does anyone know where I can obtain a comprehensive reference on the quantum chemistry of protein conformation? Regards, ------- Edwin Wright 85 Spinnaker Drive, A-602 Halifax, Nova Scotia CANADA B3N 3E3 Telephone: (902) 477-5037 Email: ewright@fox.nstn.ns.ca =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-= From owner-proteins@net.bio.net Sun May 08 23:00:00 1994 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!darwin.sura.net!jhunix.hcf.jhu.edu!NewsWatcher!user From: Hieter@jhuigf.med.jhu.edu (Hieter Lab) Newsgroups: bionet.molbio.proteins Subject: complementing S. cerev. mutants w/ human cDNAs Followup-To: bionet.molbio.proteins Date: Mon, 09 May 1994 15:29:17 -0500 Organization: Johns Hopkins University Lines: 49 Message-ID: NNTP-Posting-Host: 128.220.56.46 I am interested in finding all examples where HUMAN cDNAs can complement yeast (S. cerevisiae) mutations. Below are those that I have found so far. Please write back ASAP with any that you might know of that I missed. Please include references if available. Thanks, Stuart T. YEAST MUTANT Human gene cdc9 DNA ligase I hap2 human hap2 vdac HVDAC1 and 2 rbp1 hFKB12 srm1/prp20 RCC1 (rescues ts, not null) pro3 P5C reductase cdc28 P34CDC2 cdc28 CDK2 cdc28 CDK3 nmt1 NMT (rescues ts or null) cpr1 oxidoreductase cim5 MSS1 pfk? Phosphofructokinase, muscle cki1 choline kinase gst1 GST1-Hs or GSPT1 nop1 fibrillarin rad6 HHR6A, HHR6B arf1 /arf2 ARF5 or ARF6 gal1 galactokinase cdc24 p21rap1A cdc42-1 or cdc24-4 G25K pde1,2 HCP1 ura1 dihydroorotate dehydrogenase abf2 MTTF1 cdc34 HUMCDC34H cks1 CKShs1 or CKShs2 smd1 snRNP D1 ade5, 7, or 8 GART cdc8 dTMP kinase cyc1 cytochrome c glc3 HGBE cln1,2,&3 Cyclin D1/PRAD1/CCND1 From owner-proteins@net.bio.net Mon May 09 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!pipex!warwick!bham!usenet From: J.E.Fox@bham.ac.uk (John E. Fox) Newsgroups: bionet.molbio.proteins Subject: protein sequencing Date: 10 May 1994 12:44:31 GMT Organization: The University of Birmingham, UK Lines: 4 Message-ID: <2qnvjf$ac0@sun4.bham.ac.uk> NNTP-Posting-Host: bcs119.bham.ac.uk X-Newsreader: WinVN version 0.80 Alta Bioscience runs a protein microsequencing service. For details phone John Fox on 021 414 5450 or FAX 021 414 3376 From owner-proteins@net.bio.net Mon May 09 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!pipex!uknet!daresbury!not-for-mail From: dmartin@crc.ac.uk (David Martin x3175) Newsgroups: bionet.molbio.proteins Subject: CE methods for proteins Date: 10 May 1994 11:09:29 +0100 Lines: 14 Sender: daemon@mserv1.dl.ac.uk Distribution: bionet Message-ID: <2qnmgp$6id@mserv1.dl.ac.uk> Original-To: proteins@dl.ac.uk Does anyone out there have any nice methods for commonly available proteins that I can try to run down my Capillary electrophoresis setup? I am trying to get it up and running but the proteins I am interested in don't seem to want to play ball. Any ideas, protocols etc would be more than welcome. Thanks in advance David Martin Haemostasis Research Group dmartin@hgmp.mrc.ac.uk From owner-proteins@net.bio.net Mon May 09 23:00:00 1994 Path: biosci!CUHHCA.HHMI.COLUMBIA.EDU!wpdb From: wpdb@CUHHCA.HHMI.COLUMBIA.EDU (WPDB Account) Newsgroups: bionet.molbio.proteins Subject: WPDB - The Protein Data Bank Through Microsoft Windows - Beta Testers Sought Date: 10 May 1994 12:01:32 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 36 Sender: daemon@net.bio.net Distribution: bionet Message-ID: <9405101849.AA03240@cuhhca.hhmi.columbia.EDU> NNTP-Posting-Host: net.bio.net ------------------------------------------------------ WPDB - The Protein Data Bank through Microsoft Windows Beta Testers Sought ------------------------------------------------------ WPDB is a macromolecular structure query tool which is designed to complement the features found in software like Rasmol, Kinemage and PDBshell. Some of the features are as follows: o 20-fold compression. The latest PDB release (2 CD's - Jan. 1994) minus REMARK records, all but the first member of an NMR ensemble, and only the first alternate atom location can be compressed into approximately 40 MB. o Real-time query based on text string searches of PDB record types, sequence patterns, and secondary structure according to the method of Kabsch and Sander. o Interoperable display objects, currently 3-D renderer, contact maps, and sequence profile analysis (volume, polarity, isoelectric point, hydrophobicity, mean exposure and isotropic temperature factors). Interoperable implies that a selection made in one object will be propagated to other visible display objects. WPDB functions best on an Intel 486/33 processor or above with a color monitor and requires DOS and Windows. If you are interested in testing WPDB please send a mail message to wpdb@cuhhca.hhmi.columbia.edu indicating your mailing address and field of interest. The beta test will include a database of 100 structures and a detailed manual. WPDB was designed, written and produced by Ilya Shindyalov and Phil Bourne. ---------------------------------- From owner-proteins@net.bio.net Mon May 09 23:00:00 1994 Newsgroups: bionet.molbio.proteins Path: biosci!agate!howland.reston.ans.net!pipex!uknet!comlab.ox.ac.uk!gjb From: gjb@bioch.ox.ac.uk (Geoff Barton) Subject: Re: Protein folding software Message-ID: <1994May10.163847.2669@speed.bioch.ox.ac.uk> Originator: gjb@speed.biop Organization: Department of Biochemistry, University of Oxford References: <1994May06.021415.8232@rose.com> Distribution: bionet Date: Tue, 10 May 1994 16:38:47 GMT Lines: 32 > My friend wishes to ask a question.. > Recently a few programs have been written that tackle the problem of > protein folding: by analyzing amino acid environments or long-range > contacts, they check whether a primary sequence can adopt a known > protein fold. I'm aware that Skolnick's Matchmaker is available from > TRIPOS associates, and that Thornton is trying to get a server version > of her program running, but I haven't been able to find out where I > can obtain any of the many other programs which have been written. > Would anybody out there know how I can get the programs from > Eisenberg (UCLA), Sippl (University of Salzburg), Bryant (nih), > Crippen, Wolynes, or Schneider? > Thanks for your help, > Ulug Unligil and Michael Kobor (ulu@lec.med.utoronto.ca) > Department of Molecular and Medical Genetics > University of Toronto > Toronto, Ontario You can get Dr. Steve Bryant's program off the ncbi server (ncbi.nlm.nih.gov). You can get Prof. David Eisenberg's programs from him - email to david@edu.ucla.mbi.uclaue. -- -------------------------------------------------------------------------------- Internet: gjb@bioch.ox.ac.uk (Janet: gjb@uk.ac.ox.bioch) From owner-proteins@net.bio.net Mon May 09 23:00:00 1994 Path: biosci!ROCKVAX.ROCKEFELLER.EDU!cheethj From: cheethj@ROCKVAX.ROCKEFELLER.EDU Newsgroups: bionet.molbio.proteins Subject: pI Calculation Date: 10 May 1994 10:12:00 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 10 Sender: daemon@net.bio.net Distribution: bionet Message-ID: <9405101712.AA12165@rockvax.ROCKEFELLER.EDU> NNTP-Posting-Host: net.bio.net Does anyone know of a program that will allow the calculation of isoelectric points and charges at various pH values for peptides and proteins with modified residues and blocked amino and/or carboxyl termini? Any help with this would be greatly appreciated. Jim Cheetham Laboratory of Molecular and Cellular Neuroscience The Rockefeller University CHEETHJ@Rockvax.Rockefeller.EDU From owner-proteins@net.bio.net Mon May 09 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!pipex!warwick!bham!usenet From: J.E.Fox@bham.ac.uk (John E. Fox) Newsgroups: bionet.molbio.proteins Subject: Re: Peptide Sequencing facilities Date: 10 May 1994 15:27:39 GMT Organization: The University of Birmingham, UK Lines: 25 Message-ID: <2qo95b$iqn@sun4.bham.ac.uk> References: <145303Z21041994@anon.penet.fi> NNTP-Posting-Host: bcs119.bham.ac.uk X-Newsreader: WinVN version 0.80 In article <145303Z21041994@anon.penet.fi>, an15249@anon.penet.fi says: > >Hi. Could anyone give me pointers to places which can >sequence my tryptic peptide for me? Company names and >experience with them (good and bad) would be very >helpful. > >Thanks >------------------------------------------------------------------------- >To find out more about the anon service, send mail to help@anon.penet.fi. >Due to the double-blind, any mail replies to this message will be anonymized, >and an anonymous id will be allocated automatically. You have been warned. >Please report any problems, inappropriate use etc. to admin@anon.penet.fi. I run a sequencing service, would be happy to help. Please contact Dr John Fox School of Biochemistry University of Birmingham Birmingham UK phone 021 414 5450 Fax 021 414 3376 From owner-proteins@net.bio.net Mon May 09 23:00:00 1994 Path: biosci!THORIN.UTHSCSA.EDU!SYLVIA From: SYLVIA@THORIN.UTHSCSA.EDU Newsgroups: bionet.molbio.proteins Subject: Annexin II and V proteins Date: 10 May 1994 21:26:21 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 3 Sender: daemon@net.bio.net Distribution: bionet Message-ID: <940510232501.202182ae@thorin.uthscsa.edu> NNTP-Posting-Host: net.bio.net Does anyone know where I can get a small amount of purified annexins II and/or V ? I got antibodies from Transduction Laboratories, but could really use a bit of purified protein. Thanks in advance. Vic Sylvia sylvia@thorin.uthscsa.edu From owner-proteins@net.bio.net Mon May 09 23:00:00 1994 Path: biosci!FCRFV1.NCIFCRF.GOV!RAO From: RAO@FCRFV1.NCIFCRF.GOV Newsgroups: bionet.molbio.proteins Subject: A Question Date: 10 May 1994 13:44:48 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 6 Sender: daemon@net.bio.net Distribution: bionet Message-ID: <940510164306.20422eb9@FCRFV1.NCIFCRF.GOV> NNTP-Posting-Host: