From owner-proteins@net.bio.net Thu Apr 01 23:00:00 1999 Newsgroups: bionet.molbio.proteins,bionet.general,sci.research.postdoc Path: biosci!agate!newsfeed.berkeley.edu!uchinews2!uchinews!not-for-mail From: jm68@midway.uchicago.edu (Jim Mensch) Subject: Postdocs in biochemistry & molecular biology, U. of Chicago X-Nntp-Posting-Host: howard-nfs.uchicago.edu Message-ID: Sender: news@midway.uchicago.edu (News Administrator) Organization: The University of Chicago Distribution: na Date: Fri, 2 Apr 1999 20:07:27 GMT Lines: 20 Xref: biosci bionet.molbio.proteins:14188 bionet.general:32792 Two postdoctoral research positions will soon be available at the Kennedy Mental Retardation and Connective Tissue Research Center located at the University of Chicago, Chicago IL. These positions will involve research projects in the areas of protein biochemistry/enzymology and molecular biology. To be considered for these appointments, and for further information, please write to: Postdoctoral Search Kennedy Center, MC5058 5841 S. Maryland Ave. Chicago IL 60637 Please include curriculum vitae in your correspondence. No phone calls or email please. The person posting this announcement is not reviewing the applicants; all email responses will be discarded. ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ -- Jim Mensch "His mind is like a steel trap -- full of mice" -- Foghorn Leghorn From owner-proteins@net.bio.net Thu Apr 01 23:00:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!news-feed.inet.tele.dk!bofh.vszbr.cz!newsfeed.gamma.ru!Gamma.RU!demos!news.stack.serpukhov.su!not-for-mail From: "zdf" Newsgroups: bionet.molbio.proteins Subject: Re: Problem expressing a 50-60 kDa mammalian protein in E. coli... tips? Date: Fri, 2 Apr 1999 14:33:17 +0400 Organization: Stack Inc. Lines: 20 Message-ID: <7e26gf$d04$1@news.stack.serpukhov.su> References: <370332E5.7111@hgu.mrc.ac.uk> NNTP-Posting-Host: filimonov.ipr.serpukhov.su X-Newsreader: Microsoft Outlook Express 4.72.3110.1 X-MimeOLE: Produced By Microsoft MimeOLE V4.72.3110.3 >I am trying to express a 1.65 kb cDNA in E. coli using the pET32+ system >with BL21(DE3) bugs. The protein including the trxa/his tag should be >about 50 to 60 kDa. The protocol I used is as follows: first I grow up >a 5 ml culture overnight from a single colony; Pick up single colony in a tube with 3 ml LB and after 3 hrs add IPTG. After 3 h you can see expressing (or cannot). If you do not have production you can to add urea in sample buffer (may be you have your protein in inclusion body). >then in the morning to >inoculate 10 mls of medium with 100 ul of the o/n culture; two hours >later I start induction with 1 mM IPTG and collect samples at 1 h, 2 hr, >4 hrs post-induction and o/n. By coomassie staining I see basically no >induction at all. > From owner-proteins@net.bio.net Fri Apr 02 23:00:00 1999 Path: biosci!agate!newsfeed.berkeley.edu!news.maxwell.syr.edu!nntp.news.xara.net!xara.net!server5.netnews.ja.net!daresbury!not-for-mail From: PKirch1179@aol.com Newsgroups: bionet.molbio.proteins Subject: Fire the Boss & Triple Your Income Date: 3 Apr 1999 12:32:03 +0100 Organization: Daresbury Laboratory, Warrington, U.K. Lines: 37 Message-ID: <7e4u7j$oiu$1@mserv2.dl.ac.uk> Reply-To: PKirch1179@aol.com NNTP-Posting-Host: mserv2.dl.ac.uk Mime-Version: 1.0 Original-To: undisclosed-recipients:;;@dl.ac.uk TRIPLE YOUR $ THIS WEEK FREE Fax System Just For Reading This: Would You Take Out 15 Seconds To Read Something If U Knew You Would Triple Your Money By This Time Next Week? It is happening To Hundreds of People Every Day! Fire the Boss and break the Alarm Clock! - I can truly say it was one of the best decisions of my life!!! - Never commute again! - Make $2000-$5000 or more per week from home with a turn key system! - To find out how our system works: -Ask about our NO WORK Program...Just CASH Checks! Call VM & FOD: 800-607-6006 ex 2668# Leave your name and Phone # Call Me: (602)486-0094 BENEFIT: Stay home with the family! Proven track record of success! You can start out in your spare time Work part time or work up to full time if you want to! It's your business! Call 1-800 607-6006 ex 2668# then press 1 no selling! I made $8,800 my first 21 days!Checks to PROVE IT! Call VM & FOD: 800-607-6006 ex 2668# Call Me: (602)486-0094 . Best Of Luck, Steve Paul From owner-proteins@net.bio.net Fri Apr 02 23:00:00 1999 Path: biosci!AOL.COM!PKirch1179 From: PKirch1179@AOL.COM Newsgroups: bionet.molbio.proteins Subject: Fire the Boss & Triple Your Income Date: 3 Apr 1999 03:37:37 -0800 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 37 Sender: daemon@net.bio.net Distribution: world Message-ID: <79d3d99.243748ac@aol.com> Reply-To: PKirch1179@aol.com NNTP-Posting-Host: net.bio.net TRIPLE YOUR $ THIS WEEK FREE Fax System Just For Reading This: Would You Take Out 15 Seconds To Read Something If U Knew You Would Triple Your Money By This Time Next Week? It is happening To Hundreds of People Every Day! Fire the Boss and break the Alarm Clock! - I can truly say it was one of the best decisions of my life!!! - Never commute again! - Make $2000-$5000 or more per week from home with a turn key system! - To find out how our system works: -Ask about our NO WORK Program...Just CASH Checks! Call VM & FOD: 800-607-6006 ex 2668# Leave your name and Phone # Call Me: (602)486-0094 BENEFIT: Stay home with the family! Proven track record of success! You can start out in your spare time Work part time or work up to full time if you want to! It's your business! Call 1-800 607-6006 ex 2668# then press 1 no selling! I made $8,800 my first 21 days!Checks to PROVE IT! Call VM & FOD: 800-607-6006 ex 2668# Call Me: (602)486-0094 . Best Of Luck, Steve Paul From owner-proteins@net.bio.net Sat Apr 03 23:00:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!nntp.cs.ubc.ca!cyclone.bc.net!newsfeed.telusplanet.net!news0.telusplanet.net.POSTED!not-for-mail From: "Michael, Joanna and Dylan Johns" Newsgroups: bionet.molbio.proteins Subject: labmade IPG strips Lines: 21 X-Priority: 3 X-MSMail-Priority: Normal X-Newsreader: Microsoft Outlook Express 5.00.2014.211 X-MimeOLE: Produced By Microsoft MimeOLE V5.00.2014.211 Message-ID: Date: Sun, 04 Apr 1999 17:41:27 GMT NNTP-Posting-Host: 161.184.18.249 X-Trace: news0.telusplanet.net 923247687 161.184.18.249 (Sun, 04 Apr 1999 11:41:27 MDT) NNTP-Posting-Date: Sun, 04 Apr 1999 11:41:27 MDT Hi all, I have started to make my own immobilized pH gradient strips for the first dimension of 2D electrophoresis. Does anyone have any tips/hints about making the strips? Cutting the strips seems a little tricky. A standard quillotine paper cutter tends to pull the gel inwards at the end of the stroke - this causes the end of the strip to be a little narrower than the beginning. I was wonder how small differences in width would affect the 2D result. -- ---------- __o -------- _`\<,_ ------ (*)/ (*) ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ From owner-proteins@net.bio.net Sat Apr 03 23:00:00 1999 Path: biosci!RNA.BIO.MQ.EDU.AU!anouwens From: anouwens@RNA.BIO.MQ.EDU.AU ("Amanda Nouwens") Newsgroups: bionet.molbio.proteins Subject: Re: labmade IPG strips Date: 4 Apr 1999 18:17:18 -0700 Organization: Dept. of Biological Sciences Lines: 34 Sender: daemon@net.bio.net Distribution: world Message-ID: <199904050112.LAA05809@laurel.ocs.mq.edu.au> References: Reply-To: anouwens@proteome.org.au NNTP-Posting-Host: net.bio.net > > I have started to make my own immobilized pH gradient strips for the first > dimension of 2D electrophoresis. Does anyone have any tips/hints about > making the strips? Cutting the strips seems a little tricky. A standard > quillotine paper cutter tends to pull the gel inwards at the end of the > stroke - this causes the end of the strip to be a little narrower than the > beginning. I was wonder how small differences in width would affect the 2D > result. Guillotines are definitely the best device for cutting IPG sheets - but are you aware that both Amersham-Pharmacia and BioRad are bringing out new pH ranges (including narrow ranges in a variety of lengths) in IPGs. Personally I wouldn't waste my time trying to make them when commercially available, standardised IPGs are on the market, at a fairly reasonable price. The facility where I work use both brands. If you want any more info on them or optimal conditions for use, let me know. Differences in IPG width will make a difference to the total volume which the IPG will rehydrate to - this in turn will affect the total protein capacity of the IPG. Hope that helps, Cheers, Amanda. --------------------------------------------------- Amanda Nouwens Australian Proteome Analysis Facility (APAF) Macquarie University Sydney, NSW 2109 Tel: 02 9850 6209 Fax: 02 9850 6200 Email: anouwens@proteome.org.au From owner-proteins@net.bio.net Mon Apr 05 23:00:00 1999 Path: biosci!newshost.lanl.gov!awabi.library.ucla.edu!128.230.129.106!news.maxwell.syr.edu!dispose.news.demon.net!demon!rill.news.pipex.net!pipex!server1.netnews.ja.net!pegasus.csx.cam.ac.uk!not-for-mail From: Peter Wang Newsgroups: bionet.molbio.proteins Subject: glutathione-paramagnetic beads? Date: Tue, 06 Apr 1999 10:13:45 +0100 Organization: Centre for Protein Engineering Message-ID: <3709D042.BE444B29@mrc-lmb.cam.ac.uk> NNTP-Posting-Host: macx38.mrc-lmb.cam.ac.uk Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii; x-mac-type="54455854"; x-mac-creator="4D4F5353" Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 4.05 (Macintosh; I; PPC) Lines: 25 Dear all: Does anyone know of a supplier of glutathione conjugated to paramagnetic beads (not Sepharose/agarose), for affinity isolation of GST-fusion proteins? I tried asking on Methods & Reagents without success. I'm surprised that such a product seems difficult to come by, given the popularity of GST-fusion pulldown experiments. Cheers, - Peter --------------------------------------------------------- Peter Wang, M.D., Ph.D. MRC Centre for Protein Engineering, Hills Road, Cambridge, CB2 2QH, England Tel (01223) 402104 (international calls +44-1223-402104) Fax (01223) 402140 ( " " +44-1223-402140) CrossTalk Society: http://www.corpus.cam.ac.uk/Activities/pcts/ --------------------------------------------------------- From owner-proteins@net.bio.net Mon Apr 05 23:00:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!news-feed.inet.tele.dk!bofh.vszbr.cz!news.belnet.be!news-ge.switch.ch!news-zh.switch.ch!newsfeed-zh.ip-plus.net!news.ip-plus.net!not-for-mail From: "Defiant" Newsgroups: bionet.molbio.proteins Subject: Branched Chain Amino Acids Date: Tue, 6 Apr 1999 20:34:01 +0200 Organization: Swisscom IP+ (post doesn't reflect views of Swisscom) Lines: 5 Message-ID: <7edk08$ia4$1@pollux.ip-plus.net> NNTP-Posting-Host: w102-194.netwings.ch X-Trace: pollux.ip-plus.net 923423560 18756 194.209.75.194 (6 Apr 1999 18:32:40 GMT) X-Complaints-To: news@ip-plus.net NNTP-Posting-Date: 6 Apr 1999 18:32:40 GMT X-Newsreader: Microsoft Outlook Express 4.72.3110.1 X-Mimeole: Produced By Microsoft MimeOLE V4.72.3110.3 What about BCAA? Is it the money worth? Chris From owner-proteins@net.bio.net Mon Apr 05 23:00:00 1999 Path: biosci!agate!newsfeed.berkeley.edu!news.maxwell.syr.edu!dispose.news.demon.net!demon!rill.news.pipex.net!pipex!server1.netnews.ja.net!pegasus.csx.cam.ac.uk!not-for-mail From: Peter Wang Newsgroups: bionet.molbio.proteins Subject: Re: Influence of his-tag on protein folding Date: Tue, 06 Apr 1999 10:04:31 +0100 Organization: Centre for Protein Engineering Message-ID: <3709CE14.97A2875E@mrc-lmb.cam.ac.uk> References: NNTP-Posting-Host: macx38.mrc-lmb.cam.ac.uk Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii; x-mac-type="54455854"; x-mac-creator="4D4F5353" Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 4.05 (Macintosh; I; PPC) To: Balraj Doray Lines: 32 Dear Balraj: I have heard (and I think there is some publication about it) that proteins with long His tags, e.g. 10 His as in your vector, will multimerize in the presence of Ni, Cu, etc. If dimerization/multimerization is important in the folding of your proteins, perhaps this is happening in vivo? Balraj Doray wrote: > I'm presently using the his-tag sequence from Novogen's pET19b which > has 12 histidines(10 in tandem), 4 aspartates(enterokinase cleavage site), 2 > glycines, 2 serines, a methionine, a lysine and an isoleucine residue in the > sequence upstream of my own protein but I'm not using the pET19b vector but > cloned the fusion sequence into another vector which uses the lac p/o control. > What I'm observing is this tag is making a vast difference to the > folding/assembly characteristics of some of my mutant fusions, namely, the > presence of the tag greatly facilitates assembly of my mutant proteins [snip] --------------------------------------------------------- Peter Wang, M.D., Ph.D. MRC Centre for Protein Engineering, Hills Road, Cambridge, CB2 2QH, England Tel (01223) 402104 (international calls +44-1223-402104) Fax (01223) 402140 ( " " +44-1223-402140) CrossTalk Society: http://www.corpus.cam.ac.uk/Activities/pcts/ --------------------------------------------------------- From owner-proteins@net.bio.net Mon Apr 05 23:00:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!uchinews2!newsswitch.lcs.mit.edu!newspump.monmouth.com!newspeer.monmouth.com!peerfeed.ncal.verio.net!nntp2.cerf.net!nntp3.cerf.net!news.san.rr.com!not-for-mail From: "SomeGuy" Newsgroups: bionet.molbio.proteins Subject: G-PROTEIN SITE Lines: 11 X-Priority: 3 X-MSMail-Priority: Normal X-Newsreader: Microsoft Outlook Express 5.00.2014.211 X-MimeOLE: Produced By Microsoft MimeOLE V5.00.2014.211 Message-ID: Date: Tue, 6 Apr 1999 15:18:28 -0700 NNTP-Posting-Host: 204.210.36.41 X-Trace: news.san.rr.com 923437261 204.210.36.41 (Tue, 06 Apr 1999 15:21:01 PDT) NNTP-Posting-Date: Tue, 06 Apr 1999 15:21:01 PDT Organization: TWC Road Runner, San Diego, CA A site covering the basics of signal transduction and the use of g-proteins in signal cascade. More pages will be added soon. http://gprotein.webjump.com Would appreciate feedback very much (macromol@hotmail.com) Also visit http://macromol.webjump.com for endocrinology, immunology, and physiology. From owner-proteins@net.bio.net Mon Apr 05 23:00:00 1999 Path: biosci!SCITECHRECRUITERS.COM!chris From: chris@SCITECHRECRUITERS.COM ("Christine Morris") Newsgroups: bionet.molbio.proteins Subject: I need a trainer for automated protein sequencers Date: 6 Apr 1999 15:29:20 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 60 Sender: daemon@net.bio.net Distribution: world Message-ID: <006a01be807c$0a9e5040$aebad3cf@christine> NNTP-Posting-Host: net.bio.net This is a multi-part message in MIME format. ------=_NextPart_000_0067_01BE8041.5D5602A0 Content-Type: text/plain; charset="iso-8859-1" Content-Transfer-Encoding: quoted-printable I am searching for someone who is willing to remove themselves from the = bench and train people on automated protein sequencers. Anyone with = detailed technical knowledge of automated protein sequencers or Edman = Degredation who would consider this as a career option... PLEASE email me at chris@scitechrecruiters.com , or call me at = 650-323-3333. The position is located in California. Christine Morris SciTech Recruiters 650-323-3333 phone 650-323-2110 fax chris@scitechrecruiters.com http://www.scitechrecruiters.com "Leaders in the Recruitment of Scientific Professionals" ------=_NextPart_000_0067_01BE8041.5D5602A0 Content-Type: text/html; charset="iso-8859-1" Content-Transfer-Encoding: quoted-printable
I am searching for someone who is = willing to=20 remove themselves from the bench and train people on automated protein=20 sequencers.  Anyone with detailed technical knowledge of automated = protein=20 sequencers or Edman Degredation who would consider this as a career=20 option...
PLEASE email me at chris@scitechrecruiters.com , or=20 call me at 650-323-3333.  The position is located in=20 California.
 
Christine Morris
SciTech=20 Recruiters
650-323-3333  phone
650-323-2110  fax
chris@scitechrecruiters.com
http://www.scitechrecruiters.co= m
"Leaders=20 in the Recruitment of Scientific = Professionals"
------=_NextPart_000_0067_01BE8041.5D5602A0-- From owner-proteins@net.bio.net Mon Apr 05 23:00:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!news-feed.inet.tele.dk!bofh.vszbr.cz!newshub.northeast.verio.net!iad-peer.news.verio.net!peer.news.verio.net!uunet!ffx.uu.net!in5.uu.net!news7-gui.server.ntli.net!news-feed.ntli.net!not-for-mail From: "Keith Hyams" Newsgroups: bionet.molbio.proteins Subject: Yeast Alcohol Dehydrogenase Date: Tue, 6 Apr 1999 19:56:36 +0100 Organization: Virgin News Service Lines: 5 Message-ID: <7edlbo$k2i$1@nclient5-gui.server.virgin.net> NNTP-Posting-Host: 194.168.74.209 X-Newsreader: Microsoft Outlook Express 4.72.3110.1 X-MimeOLE: Produced By Microsoft MimeOLE V4.72.3110.3 I am trying to find an active site map for Alcohol dehydrogenase in Yeast. I have searched the Net and the Brookhaven protein Database but can find nothing specific to yeast. Can anyone help? From owner-proteins@net.bio.net Mon Apr 05 23:00:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!news-feed.inet.tele.dk!bofh.vszbr.cz!newsfeed.nacamar.de!newsfeed.nacamar.de!rz.uni-karlsruhe.de!news.uni-stuttgart.de!fu-berlin.de!we27pc01.ukbf.fu-berlin.DE!not-for-mail From: "Oliver Politz" Newsgroups: bionet.molbio.proteins Subject: membran protein proof needed Date: Wed, 7 Apr 1999 07:18:32 +0200 Organization: Freie Universitaet Berlin Lines: 16 Message-ID: <7eeq2t$sbs$1@fu-berlin.de> NNTP-Posting-Host: we27pc01.ukbf.fu-berlin.de (160.45.184.202) Mime-Version: 1.0 Content-Type: text/plain; charset=iso-8859-1 Content-Transfer-Encoding: 8bit X-Access: 16 17 19 X-Trace: fu-berlin.de 923462557 29052 (none) 160.45.184.202 X-Priority: 3 X-MSMail-Priority: Normal X-Newsreader: Microsoft Outlook Express 5.00.2014.211 X-Mimeole: Produced By Microsoft MimeOLE V5.00.2014.211 Dear all, I have just started a new project on a unkonown protein. We know have the sequence and are trying to analyse the functions. Therefore my question. The data analysis showed a putative transmembrane helix. What is a good method to check if this is a real transmembrane segment of the protein? Thanks in advance -- ______________________________________________ Dr.Oliver Politz UKBF FU-Berlin Dermatology Tel.: (+49)-30-8445 2765; FAX.: (+49)-30-8445 4262 email : politz@gmx.de WWW : http://userpage.ukbf.fu-berlin.de/~droli/index.html From owner-proteins@net.bio.net Mon Apr 05 23:00:00 1999 Path: biosci!AMBER.BIOLOGY.GATECH.EDU!john From: john@AMBER.BIOLOGY.GATECH.EDU (John D. Besemer) Newsgroups: bionet.molbio.proteins Subject: Bioinformatics conference in Atlanta Date: 6 Apr 1999 19:30:03 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 122 Sender: daemon@net.bio.net Distribution: world Message-ID: <9904070218.AA09132@exon.gatech.edu> NNTP-Posting-Host: net.bio.net SECOND GEORGIA TECH INTERNATIONAL CONFERENCE ON BIOINFORMATICS In silico BIOLOGY: SEQUENCE & STRUCTURE & FUNCTION ATLANTA NOVEMBER 11 - 14, 1999 SPONSORS: National Institutes of Health US Department of Energy Alfred P. Sloan Foundation Georgia Tech College of Science Parker H. Petit Institute for Bioengineering & Bioscience SouthEastern Center for Applied Analysis SmithKline Beecham AGENDA: The conference agenda includes keynote lectures, plenary lectures, as well as poster sessions. The list of confirmed speakers is as follows: KEYNOTE SPEAKERS: Russell Doolittle University of California, San Diego, CA Walter Fitch University of California, Irvine, CA PLENARY SPEAKERS: David Baker University of Washington, Seattle, WA Pierre Baldi Net-ID, Pasadena, CA Steven Brenner Stanford University, Stanford, CA Chris Burge MIT, Cambridge, MA Antoine Danchin Institute Pasteur, Paris, France Sean Eddy Washington University School of Medicine, St. Louis, MO Patrick Forterre University Paris-Sud, Paris, France Jeffrey Lawrence University of Pittsburgh, Pittsburgh, PA Steven Henikoff Fred Hutchinson Cancer Research Center, Seattle, WA Christine Orengo University College, London, UK Burkhard Rost Columbia University, New York, NY Andrej Sali Rockefeller University, New-York, NY William Taylor National Institute for Medical Research, London, UK STEERING/PROGRAM COMMITTEE: Pierre Baldi Net-ID Mark Borodovsky, Co-chair Georgia Tech Soren Brunak Technical University of Denmark Chris Burge MIT Jim Fickett SmithKline Beecham Steven Henikoff Fred Hutchinson Cancer Research Center Eugene Koonin, Co-chair NCBI/NIH Andrej Sali Rockefeller University Chris Sander Millennium Pharmaceuticals Gary Stormo University of Colorado DEADLINES: FULL LENGTH MANUSCRIPT SUBMISSION: Special issue of "Bioinformatics" magazine will publish papers submitted by the conference participants presenting either talks or poster papers. Deadline for manuscript submission: June 18, 1999 POSTER SUBMISSION: Deadline for poster abstract submission: September 10, 1999 REGISTRATION: Early registration ends: October 1, 1999 CONFERENCE SCHEDULE: Registration opens at 6:00pm on Thursday, November 11 The program starts 8:00am Friday, November 12 and ends at noon Sunday, November 14. LOCATION: The conference will be held at the Renaissance Atlanta Hotel Downtown located near the center of 1996 Olympic development, close to the Fox Theatre & Georgia Tech. ORGANIZING COMMITTEE: General co-ordination Mark Borodovsky, Georgia Tech mark@amber.gatech.edu "Bioinformatics" magazine publication Chris Burge MIT cburge@mit.edu Poster sessions Scott Sammons Emory University sammons@bimcore.emory.edu Publicity John Besemer Georgia Tech john@amber.gatech.edu Registration and general events Michael Moryc Georgia Tech michael.moryc@conted.gatech.edu MORE INFORMATION To obtain more information on manuscript or poster submission & registration visit the WWW page: http://exon.biology.gatech.edu/conference or contact us by e-mail: register@conted.swann.gatech.edu Phone: (404) 894-2400 Fax: (404) 894-8925 From owner-proteins@net.bio.net Tue Apr 06 23:00:00 1999 Path: biosci!YAHOO.COM!zhang1025 From: zhang1025@YAHOO.COM (yi zhang) Newsgroups: bionet.molbio.proteins Subject: mono Q HR5/5 column system Date: 7 Apr 1999 07:12:35 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 19 Sender: daemon@net.bio.net Distribution: world Message-ID: <19990407140917.20448.rocketmail@web215.mail.yahoo.com> NNTP-Posting-Host: net.bio.net Hi, Does anybody has experience on loading direcely the total protein on the mono Q HR5/5 column without any pre-purification syep? I just simply lysis the mammalial cell with lysis buffer containing PBS and Triton X-100, then centrifuge and filter the lysate to remove the insoluable materials. I plan to use the FPLC SYSTEM to subdivide the protein sample into severals parts and test the biological activity of each part. I wonder if this way is feasible. the lysate definitely contains the lipid component, Does lipid cause the column clog? I appreciate any reply and suggestion. Brady _________________________________________________________ Do You Yahoo!? Get your free @yahoo.com address at http://mail.yahoo.com From owner-proteins@net.bio.net Tue Apr 06 23:00:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!news-feed.inet.tele.dk!bofh.vszbr.cz!newsfeed.nacamar.de!newsfeed.nacamar.de!rz.uni-karlsruhe.de!news.uni-stuttgart.de!news.belwue.de!informatik.tu-muenchen.de!news.ruhr-uni-bochum.de!not-for-mail From: "Thorsten Schmidt" Newsgroups: bionet.molbio.proteins Subject: Protein Extraction from Yeast Date: 7 Apr 1999 20:52:19 GMT Organization: Ruhr-Universitaet Bochum, Rechenzentrum Lines: 20 Message-ID: <01be8138$b5e52e80$df019386@schmidtdw> NNTP-Posting-Host: dialppp-1-223.rz.ruhr-uni-bochum.de X-Trace: sunu789.rz.ruhr-uni-bochum.de 923518339 11428 134.147.1.223 (7 Apr 1999 20:52:19 GMT) NNTP-Posting-Date: 7 Apr 1999 20:52:19 GMT X-Newsreader: Microsoft Internet News 4.70.1155 Dear reader! I would like to make protein extract from a yeast overnight culture to analyse it via western blot. How can I do this? What are the easiest, fastest and satisfactory methods to do this? (The methods in Sambrook et al. are frightening complicated and time-consuming.) Which method do you use? Would you please give me a protocol? Thank you very much in advance!!! Thorsten Schmidt From owner-proteins@net.bio.net Tue Apr 06 23:00:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!newsfeed.berkeley.edu!newsfeed.cwix.com!128.174.5.49!vixen.cso.uiuc.edu!johns From: johns@cs.umr.edu (John Stone) Newsgroups: bionet.molbio.proteins Subject: Announce: VMD 1.3 Release Date: 7 Apr 1999 19:28:15 GMT Organization: Theoretical Biophysics Lines: 33 Message-ID: <7egbkf$am2$1@vixen.cso.uiuc.edu> NNTP-Posting-Host: thor.ks.uiuc.edu VMD "Visual Molecular Dynamics" 1.3 Announcement ------------------------------------------------ The Theoretical Biophysics group at the Beckman Institute For Advanced Science and Technology, the University of Illinois (U-C), is proud to announce the public release of VMD 1.3. VMD is a package for the visualization and analysis of biomolecular systems. This software is distributed free of charge and includes source code, documentation, and precompiled binaries for HP, Linux, Sun, and SGI Unix systems. The documentation includes an installation guide, a users guide, and a programmers guide for interested researchers. VMD also provides on-line help through the use of an external HTML viewer. VMD development is supported by the NIH National Center for Research Resources. A full description of VMD is available via the VMD WWW home page: http://www.ks.uiuc.edu/Research/vmd/ The authors request that any published work which utilizes VMD includes a reference to the VMD web page and/or the following reference: Humphrey, W., Dalke, A. and Schulten, K., "VMD - Visual Molecular Dynamics", J. Molec. Graphics, 1996, vol. 14, pp. 33-38. The Theoretical Biophysics group encourages VMD users to be closely involved in the development process through reporting bugs, contributing fixes, periodical surveys and via other means. We are eager to hear from you, and thank you for using our software! The VMD Developers vmd@ks.uiuc.edu April 5, 1999 From owner-proteins@net.bio.net Tue Apr 06 23:00:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!logbridge.uoregon.edu!newspeer1.nac.net!news.maxwell.syr.edu!newsspool.doit.wisc.edu!news.doit.wisc.edu!default From: klenchin@facstaff.REMOVE_TO_REPLY.wisc.edu (Dima Klenchin) Newsgroups: bionet.molbio.proteins Subject: Re: membran protein proof needed Date: Wed, 07 Apr 1999 20:53:09 GMT Organization: UW-Madison Lines: 12 Message-ID: <7eggin$q00$3@news.doit.wisc.edu> References: <7eeq2t$sbs$1@fu-berlin.de> NNTP-Posting-Host: martinlab.biochem.wisc.edu Mime-Version: 1.0 Content-Type: text/plain; charset=KOI8-R Content-Transfer-Encoding: 8bit X-Newsreader: News Xpress 2.01 X-No-Archive: yes :Dear all, :I have just started a new project on a unkonown protein. We know have the :sequence and are trying to analyse the functions. Therefore my question. The :data analysis showed a putative transmembrane helix. What is a good method :to check if this is a real transmembrane segment of the protein? : Lyse membranes, treat like crazy with proteases (say, pronase), the transmembrane chunk should be protected. - Dima From owner-proteins@net.bio.net Wed Apr 07 23:00:00 1999 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!newsfeed.cwix.com!205.252.116.205!howland.erols.net!news-peer.gip.net!news-dc.gip.net!news.gsl.net!gip.net!brown.telepac.pt!news.telepac.pt!duke.telepac.pt!news.telepac.pt!not-for-mail From: PTSex Newsgroups: bionet.molbio.proteins Subject: ENTER NOW...... GREAT AND 100% FREE LIVE SEX Date: 8 Apr 1999 17:29:37 GMT Lines: 8 Message-ID: <7eip21$j6l$8848@duke.telepac.pt> NNTP-Posting-Host: 194.65.191.176 Looking for sex for the BEST 100% FREE SEX WORLD?? Go to: http://members.theglobe.com/esqueleto/index.htm Will find here the BESTLive Sex Shows...... DO YOU LIKE TO VIEW??? What are you wating for?????? http://members.theglobe.com/esqueleto/index.htm From owner-proteins@net.bio.net Wed Apr 07 23:00:00 1999 Path: biosci!agate!newsfeed.berkeley.edu!news.maxwell.syr.edu!dispose.news.demon.net!demon!baron.netcom.net.uk!netcom.net.uk!server3.netnews.ja.net!news.icnet!NewsWatcher!user From: i.mcfarlane@icrf.icnet.uk (Ian Mc) Newsgroups: bionet.cellbiol,bionet.immunology,bionet.molbio.methds-reagnts,bionet.molbio.proteins Subject: Immunoprecipitation with IgM Date: Thu, 08 Apr 1999 17:22:57 +0100 Organization: Fund Message-ID: NNTP-Posting-Host: 143.65.17.58 Lines: 12 Xref: biosci bionet.cellbiol:11613 bionet.immunology:15967 bionet.molbio.methds-reagnts:75362 bionet.molbio.proteins:14211 Hi, Does anyone have a protocol for immmunoprecipitations with IgM monoclonal Abs. Specifically what do you use to pull down the antigen-antibody complex with? Can I use biotinylated anti-mouse polyvalent Igs (Sigma Cat. No. A9207) and Avidin-agarose (Sigma Cat. No. B2016)? Any help greatly appreciated, Ian Mc Confused? I am. From owner-proteins@net.bio.net Wed Apr 07 23:00:00 1999 Path: biosci!pravda.ucr.edu!awabi.library.ucla.edu!128.32.206.55!newsfeed.berkeley.edu!newsfeed.gamma.ru!Gamma.RU!demos!news.stack.serpukhov.su!not-for-mail From: "Sergey V. Shulga-Morskoy" Newsgroups: bionet.molbio.proteins Subject: Re: protein precipitation Date: Thu, 08 Apr 1999 17:42:16 +0400 Organization: Branch of S&O Institute Lines: 11 Message-ID: <370CB238.AEE304AA@fibkh.serpukhov.su> References: <370C72F8.4C3172B6@fys.unimaas.nl> NNTP-Posting-Host: 195.19.0.100 Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 4.5 [en] (WinNT; I) X-Accept-Language: en I think, you can add simultaouneusly in you extract butanol and may be ammonium sulfate. Danny Hasselbaink wrote: > Can somebody tell me if it is possible to extract lipids (free fatty > acids, triglycerides, phospholipids) and to precipitate proteins in one > single step? > > Thank you. From owner-proteins@net.bio.net Wed Apr 07 23:00:00 1999 Path: biosci!agate!newsfeed.berkeley.edu!newsfeed.gamma.ru!Gamma.RU!demos!news.stack.serpukhov.su!not-for-mail From: "Sergey V. Shulga-Morskoy" Newsgroups: bionet.molbio.proteins Subject: Re: mono Q HR5/5 column system Date: Thu, 08 Apr 1999 17:38:38 +0400 Organization: Branch of S&O Institute Lines: 24 Message-ID: <370CB15E.C0433F04@fibkh.serpukhov.su> References: <19990407140917.20448.rocketmail@web215.mail.yahoo.com> NNTP-Posting-Host: 195.19.0.100 Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 4.5 [en] (WinNT; I) X-Accept-Language: en Hi! In my experience, you can do it. yi zhang wrote: > Hi, > > Does anybody has experience on loading direcely the total protein on > the mono Q HR5/5 column without any pre-purification syep? > > I just simply lysis the mammalial cell with lysis buffer containing PBS > and Triton X-100, then centrifuge and filter the lysate to remove the > insoluable materials. I plan to use the FPLC SYSTEM to subdivide the > protein sample into severals parts and test the biological activity of > each part. I wonder if this way is feasible. the lysate definitely > contains the lipid component, Does lipid cause the column clog? I > appreciate any reply and suggestion. > > Brady > _________________________________________________________ > Do You Yahoo!? > Get your free @yahoo.com address at http://mail.yahoo.com From owner-proteins@net.bio.net Wed Apr 07 23:00:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!news-feed.inet.tele.dk!bofh.vszbr.cz!news.algonet.se!newsfeed1.telenordia.se!algonet!newsfeed.sunet.se!news01.sunet.se!news99.sunet.se!surfnet.nl!rl0001.unimaas.nl!not-for-mail From: Danny Hasselbaink Newsgroups: bionet.molbio.proteins Subject: protein precipitation Date: Thu, 08 Apr 1999 11:12:25 +0200 Organization: Universiteit Maastricht Lines: 7 Message-ID: <370C72F8.4C3172B6@fys.unimaas.nl> NNTP-Posting-Host: fys0225uns50.unimaas.nl Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit Disposition-Notification-To: Danny Hasselbaink X-Mailer: Mozilla 4.51 [en] (Win95; I) X-Accept-Language: en Can somebody tell me if it is possible to extract lipids (free fatty acids, triglycerides, phospholipids) and to precipitate proteins in one single step? Thank you. From owner-proteins@net.bio.net Wed Apr 07 23:00:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!newsfeed.berkeley.edu!newsfeed.cwix.com!152.163.199.19!portc03.blue.aol.com!audrey01.news.aol.com!not-for-mail From: baron0805@aol.com (Baron0805) Newsgroups: bionet.molbio.proteins Subject: Re: ENTER NOW...... GREAT AND 100% FREE LIVE SEX Lines: 4 NNTP-Posting-Host: ladder05.news.aol.com X-Admin: news@aol.com Date: 8 Apr 1999 20:19:50 GMT Organization: AOL http://www.aol.com References: <7eip21$j6l$8848@duke.telepac.pt> Message-ID: <19990408161950.24897.00000168@ng15.aol.com> Go to hell you piece of shit scumbag!!!!! Question everything!!!! From owner-proteins@net.bio.net Wed Apr 07 23:00:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!logbridge.uoregon.edu!cs.utexas.edu!geraldo.cc.utexas.edu!not-for-mail From: lnd@mail.utexas.edu Newsgroups: bionet.molbio.proteins Subject: Re: protein precipitation Date: Thu, 08 Apr 1999 10:44:45 -0600 Organization: The University of Texas at Austin, Austin, Texas Lines: 28 Message-ID: <370CDCF3.B234465D@mail.utexas.edu> References: <370C72F8.4C3172B6@fys.unimaas.nl> Reply-To: lnd@mail.utexas.edu NNTP-Posting-Host: dhcp-71-140.botany.utexas.edu Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii; x-mac-type="54455854"; x-mac-creator="4D4F5353" Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 4.5 (Macintosh; I; PPC) X-Accept-Language: en Danny Hasselbaink wrote: > Can somebody tell me if it is possible to extract lipids (free fatty > acids, triglycerides, phospholipids) and to precipitate proteins in one > single step? > > Thank you. I do precipitate ptoteins labeled with fatty acid(s) ...like myristic...palmitic.... What I do is following: -- after labeling of A.thaliana cellas with those fatty acids, grind mfrozen material and extract proteins by the buffer containing detergents. --- Precipitate proteins by ice cold acetone (1: 5 v/v) --- Centrifuge at 10,000 g for 10 min. 4 C ---- Doscard supe...and resuspend pellet in 1-2 ml Clhoroform/methanol 2: 1 ---- Incubate 10 min on ice ---- Centrifuge as above ---- Resuspend in c/m solution again and centrifuge --- resuspend final pellet in desired buffer Good luck Levan From owner-proteins@net.bio.net Wed Apr 07 23:00:00 1999 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!europa.clark.net!205.231.236.10!newspeer.monmouth.com!cyclone.news.idirect.com!island.idirect.com!news.tac.net!not-for-mail From: webmaster@cnet.net Newsgroups: bionet.molbio.proteins Subject: FREE COMPUTER Date: 9 Apr 1999 04:08:34 GMT Organization: Your Organization Lines: 38 Message-ID: <7ejug2$b0u$8@iceman.tac.net> NNTP-Posting-Host: calppp159203.3web.net X-Trace: iceman.tac.net 923630914 11294 209.197.159.203 (9 Apr 1999 04:08:34 GMT) X-Complaints-To: abuse@tac.net NNTP-Posting-Date: 9 Apr 1999 04:08:34 GMT Mime-Version: 1.0 Content-Type: multipart/mixed; boundary="PART_BOUNDARY_OJKRYJHSWR" --PART_BOUNDARY_OJKRYJHSWR Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit **************************************************************** * Posted by Newsgroup AutoPoster! It's NOT registered yet! * **************************************************************** --PART_BOUNDARY_OJKRYJHSWR Content-Type: text/html; charset=us-ascii; name="test.html" Content-Transfer-Encoding: 7bit Content-Disposition: inline; filename="test.html" Content-Base: "file:///C|/test.html" --PART_BOUNDARY_OJKRYJHSWR Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit From owner-proteins@net.bio.net Wed Apr 07 23:00:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!logbridge.uoregon.edu!sunqbc.risq.qc.ca!News.Dal.Ca!not-for-mail From: Biology Newsgroups: bionet.molbio.proteins Subject: Re: protein precipitation Date: Thu, 08 Apr 1999 19:01:56 -0300 Organization: dal Lines: 15 Message-ID: <370D2754.FFFD2EE3@hotmail.com> References: <370C72F8.4C3172B6@fys.unimaas.nl> NNTP-Posting-Host: lvining.biology.dal.ca Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Trace: News.Dal.Ca 923608896 17040 129.173.16.139 (8 Apr 1999 22:01:36 GMT) X-Complaints-To: postmaster@Dal.Ca NNTP-Posting-Date: 8 Apr 1999 22:01:36 GMT To: Danny Hasselbaink X-Mailer: Mozilla 4.05 [en] (Win95; I) After solublizzation of proteins or sonication of cell mass, (cell extract) usually centrifugaton in cold (eg, 10,000 for 15 min.) will cause the cell debrise to percipitate and lipids to float over the surface. mahmood Danny Hasselbaink wrote: > Can somebody tell me if it is possible to extract lipids (free fatty > acids, triglycerides, phospholipids) and to precipitate proteins in one > single step? > > Thank you. From owner-proteins@net.bio.net Thu Apr 08 23:00:00 1999 Path: biosci!agate!newsfeed.berkeley.edu!news-feed.inet.tele.dk!bofh.vszbr.cz!news.belnet.be!news.rediris.es!mercurio.cica.es!not-for-mail From: thode@uma.es Newsgroups: bionet.molbio.proteins Subject: Function of Tryptophan in the proteins? Date: Fri, 09 Apr 1999 11:45:14 +0000 Organization: University of Malaga Lines: 9 Message-ID: <370DE849.1404@uma.es> Reply-To: thode@uma.es NNTP-Posting-Host: gthode.genetica.uma.es Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 3.02 (Macintosh; I; PPC) I like knowing which is the special function of the Tryptophan that explain its low frequency in the proteins. For example the Cysteine is such little abundant aminoacid because it mainly allows the stablishment of the disulfide binding to give stability to the protein molecules. I would apreciate a answer to my question. Thanks in advanced, Antonio. From owner-proteins@net.bio.net Thu Apr 08 23:00:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!logbridge.uoregon.edu!iad-peer.news.verio.net!news.verio.net!news.harvard.edu!not-for-mail From: "RC" Newsgroups: bionet.molbio.proteins Subject: Re: mono Q HR5/5 column system Date: Fri, 09 Apr 1999 12:23:31 -0400 Organization: Harvard University Lines: 30 Distribution: world Message-ID: <7el9hi$40i$1@plato.harvard.edu> References: <19990407140917.20448.rocketmail@web215.mail.yahoo.com> NNTP-Posting-Host: max10.tch.harvard.edu Mime-Version: 1.0 Content-Type: text/plain; charset="US-ASCII" Content-Transfer-Encoding: 7bit X-Trace: plato.harvard.edu 923674994 4114 134.174.22.50 (9 Apr 1999 16:23:14 GMT) X-Complaints-To: news@harvard.edu NNTP-Posting-Date: 9 Apr 1999 16:23:14 GMT X-Newsreader: Microsoft Outlook Express for Macintosh - 4.01 (295) you would be making a HUGE mistake!! and you could throw away your column when your done. this type of column is for 'polishing' only, not crude cell extracts.. use Q seharose that you pack yourself instead! Rachel ---------- In article <19990407140917.20448.rocketmail@web215.mail.yahoo.com>, zhang1025@YAHOO.COM (yi zhang) wrote: > >Hi, > >Does anybody has experience on loading direcely the total protein on >the mono Q HR5/5 column without any pre-purification syep? > >I just simply lysis the mammalial cell with lysis buffer containing PBS >and Triton X-100, then centrifuge and filter the lysate to remove the >insoluable materials. I plan to use the FPLC SYSTEM to subdivide the >protein sample into severals parts and test the biological activity of >each part. I wonder if this way is feasible. the lysate definitely >contains the lipid component, Does lipid cause the column clog? I >appreciate any reply and suggestion. > >Brady >_________________________________________________________ >Do You Yahoo!? >Get your free @yahoo.com address at http://mail.yahoo.com > From owner-proteins@net.bio.net Thu Apr 08 23:00:00 1999 Path: biosci!UQTR.UQuebec.CA!Mario_Fragata From: Mario_Fragata@UQTR.UQuebec.CA (Mario Fragata) Newsgroups: bionet.molbio.proteins Subject: Silicon Graphics computer Date: 9 Apr 1999 04:54:23 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 14 Sender: daemon@net.bio.net Distribution: world Message-ID: <199904091149.HAA50032@neptune.uqtr.uquebec.ca> NNTP-Posting-Host: net.bio.net Good morning everybody, Has anyone a second-hand Silicon Graphics computer for sale ? Thank you very much for your attention to this matter Mario Fragata Dept. Chimie-Biologie Section chimie Univ. Quebec at Trois-Rivieres Trois-Rivieres, Que, G9A 5H7, Canada Tel (819)376-5077 Fax (819)376-5057 email fragata@uqtr.uquebec.ca From owner-proteins@net.bio.net Thu Apr 08 23:00:00 1999 Path: biosci!FREENET.BUFFALO.EDU!cm006 From: cm006@FREENET.BUFFALO.EDU ("") Newsgroups: bionet.molbio.proteins Subject: Re: Function of Tryptophan in the proteins? Date: 9 Apr 1999 10:53:07 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 24 Sender: daemon@net.bio.net Distribution: world Message-ID: References: <370DE849.1404@uma.es> NNTP-Posting-Host: net.bio.net On Fri, 9 Apr 1999 thode@uma.es wrote: > I like knowing which is the special function of the Tryptophan that > explain its low frequency in the proteins. > For example the Cysteine is such little abundant aminoacid because it > mainly allows the stablishment of the disulfide binding to give > stability to the protein molecules. > I would apreciate a answer to my question. > Thanks in advanced, > > Antonio. > The low frequency of tryptophan in proteins may be on account of its inherent bulkiness. Its presence would thereby be sterically hindered by nearby amino acids at many locations in a protein. Peace to you, always, William J. Kokolus, Ph.D., President Fountain Biological Enterprises 69 Ferndale Ave. Kenmore, N.Y. 14217-1003 phone or fax #: (716) 873-6940 e-mail: cm006@freenet.buffalo.edu From owner-proteins@net.bio.net Thu Apr 08 23:00:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!news-feed.inet.tele.dk!bofh.vszbr.cz!remarQ-uK!remarQ.com!supernews.com!rQdQ!remarQ69!news.remarQ.com!not-for-mail From: meyerdj@phibred.com (Dr. David J. Meyer) Newsgroups: bionet.molbio.proteins Subject: Re: protein precipitation Date: Fri, 09 Apr 1999 18:27:19 GMT Organization: Pioneer Hi-Bred International, Inc. Lines: 28 Message-ID: <923682413.274.87@news.remarQ.com> References: <370C72F8.4C3172B6@fys.unimaas.nl> NNTP-Posting-Host: 204.233.143.2 NNTP-Posting-Date: Fri, 09 Apr 1999 18:26:53 GMT X-Trace: 923682413.274.87 DNR0QL6DK8F02CCE9C usenet1.supernews.com X-Complaints-To: newsabuse@remarQ.com X-Newsreader: Forte Free Agent v0.55 Danny Hasselbaink wrote: >Can somebody tell me if it is possible to extract lipids (free fatty >acids, triglycerides, phospholipids) and to precipitate proteins in one >single step? >Thank you. Acetone will precipitate phopholipids as well. A method which I have used in the past can be found in: A method for the quantitative recovery of protein in dilute solution in the presence of detergents and lipids. Wessel D, Flügge UI Anal Biochem 1984 Apr 138:1 141-3 Good luck! David J. Meyer, Ph.D. Quality Traits Pioneer Hi-Bred International, Inc. 7300 NW 62nd Ave. Johnston, IA 50131-1004 Ph. 515/254-2639 FAX 515/254-2619 Email: meyerdj@phibred.com From owner-proteins@net.bio.net Sat Apr 10 23:00:00 1999 Path: biosci!SLIP.NET!grizzly From: grizzly@SLIP.NET (Michael Sherrell) Newsgroups: bionet.molbio.proteins Subject: LC/MS et al Date: 11 Apr 1999 08:08:03 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 30 Sender: daemon@net.bio.net Distribution: world Message-ID: <01BE83F1.E5A4EAA0@oak-hiper1b-82-82.dialup.slip.net> NNTP-Posting-Host: net.bio.net Newly available LC/mass spectrometers: Finnigan Navigator,18 months old; factory refurbished and installed with 90-day warranty included, $75,000. Micromass Platform II LC/MS, 1994, electrospray & APCI, Micromass-certified, LC included, $70,000 VG Quattro GC/LC-MS/MS, 1993, 4000 amu, EI/CI, LSIMS, ESI and APCI, working in lab now, price negotiable IonSpec MALDI FT-MS hi-res hi-sensitivity 1995 model; "most sensitive on market" (for specs see http://www.ionspec.com/hiresmaldi.html); < $100,000 I also have these peptide and oligo synthesizers and sequencers for sale: ABI 394 $12,500 (Valve blocks rebuilt; warranteed) ABI 390Z $4,000 (50-100uM yields) ABI 431 $12,500 (Rebuilt, warranteed) ABI 433 $19,000 (ABI upgrade) PerSeptive 9050+, $6,000 (As is/was working when decommissioned; add $3,500 for rebuild/warranty) ABI 373 stretch $9,000 (Big dye upgrade; still under warranty) ABI 373 stretch $7,000 (4-filter) ABI 377 $97,500 (XL; 96 lanes; transferrable ABI service contract) ABI Procise 492 $59,000 obo (ABI-certified) ABI Procise 494 $84,000 (ABI-certified) NMRs: Bruker AM360 $85,000 (Broadband; widebore; install included) Varian Gemini 300 $69,000 (Proton/carbon probe; freight, install, 90-day warr. included) Bruker AMX-500 $175,000 (4 probes; inverse electronics; 90-day warranty) Also available: HP 5989B LC/MS engine, extended mass range (2000 amu), hex ion guide (HPLC, installation & warranty available): $45,000 Hitachi 570 scanning electron microscope, Kevex detector, running now, $35,000. BD FACSVantage and assorted FACScans Various other seqencers, synthesizers etc. are available; please inquire or check the website. Michael Sherrell Grizzly Analytical 707 887 2919/fax 707 887 9834 www.grizzlyanalytical.com From owner-proteins@net.bio.net Sat Apr 10 23:00:00 1999 Path: biosci!newshost.lanl.gov!awabi.library.ucla.edu!208.134.241.18!newsfeed.cwix.com!195.252.142.107!newsfeed.tli.de!newsfeed.nacamar.de!nntp.news.xara.net!xara.net!server5.netnews.ja.net!daresbury!not-for-mail From: duy82@sweb.ch Newsgroups: bionet.molbio.proteins Subject: ADV: Premium TV Channels......No Monthly Bills! Date: 12 Apr 1999 04:27:21 +0100 Organization: Daresbury Laboratory, Warrington, U.K. Lines: 115 Message-ID: <7erp6p$su7$1@mserv2.dl.ac.uk> NNTP-Posting-Host: localhost.dl.ac.uk X-Trace: mserv2.dl.ac.uk 923887642 29641 127.0.0.1 (12 Apr 1999 03:27:22 GMT) X-Complaints-To: newsmaster@dl.ac.uk NNTP-Posting-Date: 12 Apr 1999 03:27:22 GMT Comments: Authenticated sender is Original-To: duy82@sweb.ch To be removed from our mailing list please call toll free 800-242-0363 ext.2748 This is really cool! PREMIUM CHANNELS........Descrambled! EASY to assemble plans for only $6.00 ! YOU WILL BE WATCHING all your FAVORITE PAY STATIONS featuring MOVIES, SPORTS. Adult entertainment, and any other scrambled signal NEXT WEEK! You can EASILY assemble a cable descrambler in less than 30 minutes! You have probably seen many advertisments for similar plans......... BUT OURS are BETTER! We have compared it to all the others and have actually IMPROVED the quality and SIMPLIFIED the design !!! ** We even include PHOTOS! ** OUR PLANS ARE BETTER! We have NEW, EASY TO READ,EASY to assemble plans for only $6.00! We have seen them advertised for as much as $29.00 and you have to wait weeks to receive them! WHAT THE OTHERS SAY IS TRUE! Parts are available at "The TV HUT" or any electronics store. Trademark rights do not allow us to use a national electronics retail chains' name but there is one in your town! Call and ask them BEFORE you order! They are very familiar with these plans! You will need these easy to obtain parts : 270-235 mini box 271-1325 2.2k ohm resistor 278-212 chasis connectors RG59 coaxial cable #12 copper wire Variable capacitor They may have to special order the variable capacitor, But WHY WAIT for a special order? WE have them! WE have secured a supply of the capacitors directly from the manufacturer and We WILL include one with your plans for an ADDITIONAL $10.00 only! All you need now is the EASY TO ASSEMBLE plans to show you how to assemble this educational device in only 30 MINUTES! It is LEGAL, providing of course you use these plans for EDUCATIONAL PURPOSES only. See first hand and LEARN how this SIMPLE circuitry works! If you intend to use these plans for any other purpose DO NOT ORDER them. IT'S FUN TO BUILD! We're sure you'll enjoy this project! This is a unique opportunity for hobbiest of ANY skill level to learn simple circuitry! Learn how easy descrambling is! $ 6.00 for plans only $10.00 for variable capacitor only $16.00 for The easy to assemble plans and one variable capacitor! Please send check or money order payable to: Kraftworks P.O. Box 11752 San Rafael, Ca. 94912 WE pay postage and handling! Please allow 14 days for delivery. * For express service please include a self address stamped envelope with .66 postage added Thank You 11 11 rom From owner-proteins@net.bio.net Sat Apr 10 23:00:00 1999 Path: biosci!SWEB.CH!zona18 From: zona18@SWEB.CH Newsgroups: bionet.molbio.proteins Subject: ADV: Premium TV Channels......No Monthly Bills! Date: 11 Apr 1999 20:46:43 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 114 Sender: daemon@net.bio.net Distribution: world Message-ID: <199904113732CAA47684@ItsSoEasy.hsr.it> NNTP-Posting-Host: net.bio.net To be removed from our mailing list please call toll free 800-242-0363 ext.2748 This is really cool! PREMIUM CHANNELS........Descrambled! EASY to assemble plans for only $6.00 ! YOU WILL BE WATCHING all your FAVORITE PAY STATIONS featuring MOVIES, SPORTS. Adult entertainment, and any other scrambled signal NEXT WEEK! You can EASILY assemble a cable descrambler in less than 30 minutes! You have probably seen many advertisments for similar plans......... BUT OURS are BETTER! We have compared it to all the others and have actually IMPROVED the quality and SIMPLIFIED the design !!! ** We even include PHOTOS! ** OUR PLANS ARE BETTER! We have NEW, EASY TO READ,EASY to assemble plans for only $6.00! We have seen them advertised for as much as $29.00 and you have to wait weeks to receive them! WHAT THE OTHERS SAY IS TRUE! Parts are available at "The TV HUT" or any electronics store. Trademark rights do not allow us to use a national electronics retail chains' name but there is one in your town! Call and ask them BEFORE you order! They are very familiar with these plans! You will need these easy to obtain parts : 270-235 mini box 271-1325 2.2k ohm resistor 278-212 chasis connectors RG59 coaxial cable #12 copper wire Variable capacitor They may have to special order the variable capacitor, But WHY WAIT for a special order? WE have them! WE have secured a supply of the capacitors directly from the manufacturer and We WILL include one with your plans for an ADDITIONAL $10.00 only! All you need now is the EASY TO ASSEMBLE plans to show you how to assemble this educational device in only 30 MINUTES! It is LEGAL, providing of course you use these plans for EDUCATIONAL PURPOSES only. See first hand and LEARN how this SIMPLE circuitry works! If you intend to use these plans for any other purpose DO NOT ORDER them. IT'S FUN TO BUILD! We're sure you'll enjoy this project! This is a unique opportunity for hobbiest of ANY skill level to learn simple circuitry! Learn how easy descrambling is! $ 6.00 for plans only $10.00 for variable capacitor only $16.00 for The easy to assemble plans and one variable capacitor! Please send check or money order payable to: Kraftworks P.O. Box 11752 San Rafael, Ca. 94912 WE pay postage and handling! Please allow 14 days for delivery. * For express service please include a self address stamped envelope with .66 postage added Thank You 11 From owner-proteins@net.bio.net Sun Apr 11 23:00:00 1999 Path: biosci!newshost.lanl.gov!awabi.library.ucla.edu!207.97.14.174!europa.clark.net!208.134.241.18!newsfeed.cwix.com!205.219.255.8!argos.tel.hr!not-for-mail From: "TEHMAR" Newsgroups: bionet.molbio.proteins Subject: whey protein production Date: Mon, 12 Apr 1999 11:25:10 +0200 Organization: HiNet Lines: 22 Message-ID: <7ese0q$6k3$1@as102.tel.hr> NNTP-Posting-Host: ar1-p18-ri.tel.hr Mime-Version: 1.0 Content-Type: text/plain; charset=US-ASCII Content-Transfer-Encoding: 7bit X-Trace: as102.tel.hr 923908954 6787 195.29.232.18 (12 Apr 1999 09:22:34 GMT) X-Complaints-To: news@tel.hr NNTP-Posting-Date: 12 Apr 1999 09:22:34 GMT X-Newsreader: Microsoft Outlook Express 4.72.3110.1 X-MimeOLE: Produced By Microsoft MimeOLE V4.72.3110.3 Hello, I am from Croatia. As we have huge production of inpure whey from milk that is totaly wasted or used for animal food - we are interested in technology of whey ULTRAFILTRATION. Huge amounts of whey here is wasted due to the reason of its inpurity. It would be very nice if we could use this quality raw material and produce high quality whey protein. If someone is interested in this and maybe is expert in whey ultrafiltration willing to share some knowledge, please contact me. Jadran fax +385 51 765 246 e-mail: tehmar@ri.tel.hr Croatia THANKS!!! From owner-proteins@net.bio.net Sun Apr 11 23:00:00 1999 Path: biosci!BWC.DE!zadee23 From: zadee23@BWC.DE Newsgroups: bionet.molbio.proteins Subject: ADV: Premium TV Channels......No Monthly Bills! Date: 12 Apr 1999 23:56:20 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 114 Sender: daemon@net.bio.net Distribution: world Message-ID: <199904124063GAA27179@ItsSoEasy.snu.ac.kr> NNTP-Posting-Host: net.bio.net To be removed from our mailing list please call toll free 800-242-0363 ext.2748 This is really cool! PREMIUM CHANNELS........Descrambled! EASY to assemble plans for only $6.00 ! YOU WILL BE WATCHING all your FAVORITE PAY STATIONS featuring MOVIES, SPORTS. Adult entertainment, and any other scrambled signal NEXT WEEK! You can EASILY assemble a cable descrambler in less than 30 minutes! You have probably seen many advertisments for similar plans......... BUT OURS are BETTER! We have compared it to all the others and have actually IMPROVED the quality and SIMPLIFIED the design !!! ** We even include PHOTOS! ** OUR PLANS ARE BETTER! We have NEW, EASY TO READ,EASY to assemble plans for only $6.00! We have seen them advertised for as much as $29.00 and you have to wait weeks to receive them! WHAT THE OTHERS SAY IS TRUE! Parts are available at "The TV HUT" or any electronics store. Trademark rights do not allow us to use a national electronics retail chains' name but there is one in your town! Call and ask them BEFORE you order! They are very familiar with these plans! You will need these easy to obtain parts : 270-235 mini box 271-1325 2.2k ohm resistor 278-212 chasis connectors RG59 coaxial cable #12 copper wire Variable capacitor They may have to special order the variable capacitor, But WHY WAIT for a special order? WE have them! WE have secured a supply of the capacitors directly from the manufacturer and We WILL include one with your plans for an ADDITIONAL $10.00 only! All you need now is the EASY TO ASSEMBLE plans to show you how to assemble this educational device in only 30 MINUTES! It is LEGAL, providing of course you use these plans for EDUCATIONAL PURPOSES only. See first hand and LEARN how this SIMPLE circuitry works! If you intend to use these plans for any other purpose DO NOT ORDER them. IT'S FUN TO BUILD! We're sure you'll enjoy this project! This is a unique opportunity for hobbiest of ANY skill level to learn simple circuitry! Learn how easy descrambling is! $ 6.00 for plans only $10.00 for variable capacitor only $16.00 for The easy to assemble plans and one variable capacitor! Please send check or money order payable to: Kraftworks P.O. Box 11752 San Rafael, Ca. 94912 WE pay postage and handling! Please allow 14 days for delivery. * For express service please include a self address stamped envelope with .66 postage added Thank You 11 1 From owner-proteins@net.bio.net Mon Apr 12 23:00:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!uchinews2!yellow.newsread.com!netaxs.com!newsread.com!feeder.qis.net!news.maxwell.syr.edu!howland.erols.net!news.net.uni-c.dk!not-for-mail From: "Søren W. Rasmussen" Newsgroups: bionet.molbio.proteins Subject: Dnatools sequencing software Date: Tue, 13 Apr 1999 15:08:17 +0200 Organization: UNI-C Lines: 29 Message-ID: <371341C1.D85409F9@crc.dk> NNTP-Posting-Host: 130.226.182.97 Mime-Version: 1.0 Content-Type: text/plain; charset=iso-8859-1 Content-Transfer-Encoding: 8bit X-Trace: news.net.uni-c.dk 924009504 23772 130.226.182.97 (13 Apr 1999 13:18:24 GMT) X-Complaints-To: usenet@news.net.uni-c.dk NNTP-Posting-Date: 13 Apr 1999 13:18:24 GMT X-Mailer: Mozilla 4.03 [en] (Win95; I) The DNATools software package revision 5.1.424 is available for downloading at: http://www.crc.dk/phys/Dnatools/A01B04C04_Downloading.htm You can read more about the program at: http://www.crc.dk/phys/A01B04_dnatools.htm In case your Demo-licence has expired and you wish to try the upgraded version of DNATools, you can extend your demo-licence free of charge at: http://www.crc.dk/phys/Dnatools/A01B04C08_Registration.htm Regards Soeren -- Dr. scient. Søren W. Rasmussen Carlsberg Laboratory, Department of Physiology 10 Gl. Carlsbergvej, DK-2500, Copenhagen, Denmark Phone 45 3327 5230 / 45 3616 2259, Fax 45 3327 4766 E-mail swr@crc.dk, Homepage http://www.crc.dk/phys/ From owner-proteins@net.bio.net Mon Apr 12 23:00:00 1999 Path: biosci!internet!biosci!not-for-mail From: biohelp (BIOSCI Administrator) Newsgroups: bionet.molbio.proteins Subject: BIOSCI/bionet miniFAQ & Fundraiser Date: 13 Apr 1999 02:00:18 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 233 Sender: daemon@net.bio.net Distribution: world Message-ID: <199904130900.CAA04181@net.bio.net> NNTP-Posting-Host: net.bio.net (LAST REVISION: 30-JUL-95) This BIOSCI "miniFAQ" is designed to answer the questions that come up the *most frequently*. The main BIOSCI FAQ (Frequently Asked Questions) is accessible on the World Wide Web at URL http://www.bio.net/. If you can not find an answer to your question in this or other documentation, the BIOSCI technical support staff answers e-mail queries sent to biosci-help@net.bio.net We can only answer questions about the use of the newsgroups and mailing lists. We unfortunately do not have the staff to do Internet information searches or answer scientific questions. Please post those to the appropriate BIOSCI/bionet newsgroups. Contents: -------- 0) BIOSCI NEEDS YOUR SUPPORT!! 1) Using the WWW to access the BIOSCI/bionet newsgroups. 2) What to do about "spams," i.e., junk mail, ads, etc. 3) Examples of subscribing and unsubscribing to the mailing lists. 4) The BIOSCI user address and research interest directory. 0) BIOSCI NEEDS YOUR SUPPORT!! ------------------------------ BIOSCI's government funding has been expended, and we are now operating solely from advertising revenue that we have raised from our Web site at http://www.bio.net/. We need just a few minutes of your time to help us serve you. You can do two important things which will take very little time for you individually and will immensely help us continue to help you. First, please use our WWW system at http://www.bio.net/ to access the archives. You can post or reply to messages via your Web browser as described in item #1 below. Your usage helps attract sponsors. If you contact any of our sponsors, please be sure to thank them for supporting BIOSCI. It is critical for them to get this feedback if they are to continue their sponsorship for the long term. Second, if you work for a company or organization that provides products or services of interest to the biology community, please pass this message on to your marketing or marketing communications department or other appropriate group. Please ask them to help support BIOSCI by sponsoring our Web site and explain the uses and benefits of the system to the biology community. If they are interested, they can then contact us for further information at our tech support address, biosci-help@net.bio.net. 1) Using the WWW to access the BIOSCI/bionet newsgroups. -------------------------------------------------------- As of 10 December 1995, all BIOSCI/bionet full newsgroups are accessible through the World Wide Web (WWW) at URL http://www.bio.net. One can read and reply publicly or privately to both recent postings and archived messages through one's Web browser if it is configured properly to send e-mail. Each newsgroup is equipped with its own WAIS index. The main BIOSCI home page also has access to the BIO-JOURNALS Table of Contents database WAIS index and the BIOSCI user address database described in another item further below. 2) What to do about "spams," i.e., junk mail, ads, etc. ------------------------------------------------------- BIOSCI is a set of parallel USENET newsgroups (the "bionet" groups), mailing lists, and a hypermail archive at URL http://www.bio.net/. The same postings are distributed on all media (except for a small number of mailing-list-only groups at net.bio.net). Unfortunately it is becoming a despicable practice on the Internet (by a few people out to make a fast buck) to do automated mass postings to thousands of newsgroups and mailing lists. These attempts to grab free advertising are refered to as "spams" in the usual, somewhat boneheaded, net terminology. USENET is more susceptible to this practice, and many spams originate on the USENET groups and then are passed on to the mailing lists. However, spammers also get lists of mailing addresses and hit these too, so neither medium is immune. What should you do personally if you get junk mail? --------------------------------------------------- Just delete it and move on without reading it further. Filing a protest is becoming increasingly useless because spammers are often disguising the addresses where the messages are sent from. Unless you really understand Internet mail systems, your attempt at protest by sending replies to the message will often end up being sent to the address of an innocent person that the spammer is victimizing. What can BIOSCI/bionet do to protect its newsgroups? ---------------------------------------------------- The only solution currently available is to moderate the newsgroup. If this newsgroup is already moderated, then you are in good shape. Moderation protects the USENET distribution from about 95% of the spams that are being sent to date and protects the mailing lists completely. Moderation means, however, that someone has to take the time to review each message before it goes out. We have set up software here that simply allows the moderator to forward to an address at net.bio.net messages that (s)he wishes to have distributed. This takes no more time than that needed to read the message and pass it on, say about 1 min. per message. Most newsgroups currently have a discussion leader who is responsible for their newsgroup. The discussions leaders and their e-mail addresses are listed in the BIOSCI Information Sheet which is available on the Web at http://www.bio.net/. If a newsgroup is being hit with too many junk postings, please contact the discussion leader for that group and see if there is interest in moderating the group. Please do not assume that by simply posting a complaint to the newsgroup itself, anyone on the BIOSCI staff will act on your complaint. With close to 100 newsgroups to run, the BIOSCI staff has to rely on the discussion leaders of each newsgroup to report problems directly to us at biosci-help@net.bio.net. We will moderate any of our newsgroups if the discussion leader tells us that the readership of the group wishes to do so and if a moderator is willing to do the work. For most BIOSCI/bionet groups, this entails only a few minutes of work each day. Moderating a newsgroup will resolve probably 95% of the junk postings on the USENET distribution. Unfortunately there are easy ways for determined spammers to override the moderation mechanism on USENET, but we can protect our e-mail subscribers from unwanted postings if the newsgroup is moderated. You can also access our newsgroups over the WWW at URL http://www.bio.net. While this Web interface will not stop spammers from trying to post to the groups, this will give you yet another way, besides using USENET news, to keep the junk out of your personal mail files. For those of you with local USENET news systems, the Web interface will also give you faster access to new newsgroups and recent postings. 3) Examples of subscribing and unsubscribing to the mailing lists. ------------------------------------------------------------------ PLEASE NOTE: The BIOSCI management does NOT act on subscription/unsubscription requests that are posted improperly to the newsgroups and mailing lists. People who do this only bother everyone on the lists to no avail. Please be sure to follow the proper procedures below. Gory details are in the BIOSCI Information sheets on the Web at http://www.bio.net. Below we give an example utilizing the METHODS-AND-REAGENTS list at both of our two BIOSCI sites: Users in the Americas and Pacific Rim countries who use the BIOSCI ------------------------------------------------------------------ node at computer net.bio.net: ---------------------------- A) Determine the "listname" which is the <=8 character mail address ^^^^^^^^^^^^^ for the group. These can be found in the BIOSCI Info. Sheet. For the METHODS-AND-REAGENTS group the mailing address is methods@net.bio.net. The listname is the portion of the address to the left of the @ sign, i.e., "methods". The listname is used with the "subscribe" and "unsubscribe" commands illustrated below. B) Mail all commands in the body of a mail message addressed to biosci-server@net.bio.net. Do NOT send commands to the newsgroup posting addresses! Leave the Subject: line blank, any text on it will be ignored. C) In the body of your message put one or more of the following commands with an "end" command on the last line, e.g., subscribe methods unsubscribe methods end Do NOT put your e-mail address or other text on these lines. The server only allows you to cancel your subscription if the address on your mail header matches the address on our mailing list. Please ask for help at biosci-help@net.bio.net if your address has changed, e.g., if you know you are on the list but the server tells you that you are not a member. Users in Europe, Africa, and Central Asia who use the BIOSCI node at -------------------------------------------------------------------- computer daresbury.ac.uk (also known as dl.ac.uk): ------------------------------------------------- To subscribe and unsubscribe to/from the BIOSCI lists, you need to specify the full USENET newsgroup name with "bionet-news." prepended. The USENET newsgroup names are listed in the BIOSCI Information sheet on the Web at http://www.bio.net/. For the METHODS-AND-REAGENTS list the USENET newsgroup name is bionet.molbio.methds-reagnts, thus the appropriate commands are sub bionet-news.bionet.molbio.methds-reagnts unsub bionet-news.bionet.molbio.methds-reagnts These commands are included in a message addressed to mxt@dl.ac.uk, NOT to the newsgroup mailing addresses. As usual, include the text in the body of the message as text on the Subject: line is ignored. To unsubscribe from all the lists at the UK node, use unsub bionet-news Please note that if the address in the list is different than the one in your mail message header, you will not be able to unsubscribe by this method. If you have problems, please mail biosci@daresbury.ac.uk. 4) The BIOSCI user address and research interest directory. ----------------------------------------------------------- Please take this opportunity to add your name, address, and research interest information to the BIOSCI User Address Database if you have not already done so. You can fill out the address form directly through our Web page at URL http://www.bio.net/adrform.html. The address database is reindexed nightly for WWW access (the URL is http://www.bio.net/). If you are not directly on the Internet but can reach it by e-mail, please use our waismail server to access the user directory. waismail use is described above. You can also request a user address form by e-mail from biosci-help@net.bio.net. Please check your database entry from time-to-time to see if your address information is still up-to-date. Because of our limited personnel resources, we ask that you resubmit a *complete* form to revise your entry; we only replace complete entries and do not have resources to edit old forms. From owner-proteins@net.bio.net Mon Apr 12 23:00:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!remarQ73!remarQ60!supernews.com!remarQ.com!news.total.net!not-for-mail From: "Julien Roy" Newsgroups: bionet.molbio.proteins Subject: ApoD S.O.S. Lines: 10 X-Priority: 3 X-MSMail-Priority: Normal X-Newsreader: Microsoft Outlook Express 5.00.2314.1300 X-MimeOLE: Produced By Microsoft MimeOLE V5.00.2314.1300 Message-ID: Date: Tue, 13 Apr 1999 10:33:35 -0400 NNTP-Posting-Host: 207.139.122.248 X-Complaints-To: support@total.net X-Trace: news.total.net 924014040 207.139.122.248 (Tue, 13 Apr 1999 10:34:00 EDT) NNTP-Posting-Date: Tue, 13 Apr 1999 10:34:00 EDT Organization: TotalNet Inc. Hello, I would like to have more information about apolipoprotein D and the Alzheimer's or Parkinson diseases. It's very important to me and I appreciate your collaboration. Thank you. ju98@total.net From owner-proteins@net.bio.net Tue Apr 13 23:00:00 1999 Path: biosci!HOTMAIL.COM!eskay24 From: eskay24@HOTMAIL.COM ("William Eskay") Newsgroups: bionet.molbio.proteins Subject: Liquid Scintillation Cocktail Date: 14 Apr 1999 21:57:16 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 13 Sender: daemon@net.bio.net Distribution: world Message-ID: <19990415045137.61301.qmail@hotmail.com> NNTP-Posting-Host: net.bio.net hi! I would like to use the Fonnum's radiochemical method for the determination of choline acetyltransferase. The choice of the liquid scintillation cocktail looks like very sensitive for the result. Which is the best commercial LSC for this method? Thank in advance for any assistance. Regards, _______________________________________________________________ Get Free Email and Do More On The Web. Visit http://www.msn.com From owner-proteins@net.bio.net Tue Apr 13 23:00:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!newsfeed.berkeley.edu!sunqbc.risq.qc.ca!carnaval.risq.qc.ca.POSTED!not-for-mail From: fbacha@PO-box.mcgill.ca Newsgroups: bionet.molbio.proteins Subject: cycloheximide??? X-Newsreader: SPRY News 3.03 (SPRY, Inc.) Lines: 8 Message-ID: <884R2.507$Ge5.29839@carnaval.risq.qc.ca> Date: Wed, 14 Apr 1999 17:21:08 GMT NNTP-Posting-Host: 206.167.227.2 X-Complaints-To: abuse@mcgill.ca X-Trace: carnaval.risq.qc.ca 924110468 206.167.227.2 (Wed, 14 Apr 1999 13:21:08 EDT) NNTP-Posting-Date: Wed, 14 Apr 1999 13:21:08 EDT Dear Readers, I would like to inhibit translation in my TNT couple Retic. Lys. So, I ordered cycloheximide from Sigma. From the literature, people use it at a concentration of 10 ng/ul for RRL. My question is: in what should I resuspend cycloheximide and is it stable at -20??? Can I resuspend my whole 1g and keep that at -20 or should I make it fresh for every experiments??? Hope someone can help!!! From owner-proteins@net.bio.net Tue Apr 13 23:00:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!newsfeed.berkeley.edu!cocoa.brown.edu!news From: Neil_Bansal@brown.edu (Neil Bansal) Newsgroups: bionet.molbio.proteins Subject: protein production Date: 15 Apr 1999 05:56:13 GMT Organization: Brown University, Providence, RI -- USA Lines: 2 Message-ID: <7f3v1t$ejf@cocoa.brown.edu> NNTP-Posting-Host: prv-ri1-19.ix.netcom.com Mime-Version: 1.0 Content-Type: Text/Plain; charset=US-ASCII X-Newsreader: WinVN 0.99.9 (Released Version with Kerberos support) (x86 32bit) hh From owner-proteins@net.bio.net Tue Apr 13 23:00:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!newsfeed.berkeley.edu!agate!not-for-mail From: lhom@OCF.Berkeley.EDU (Louis Hom) Newsgroups: bionet.molbio.proteins Subject: Re: cycloheximide??? Date: 14 Apr 1999 18:18:44 GMT Organization: Univ. of California Berkeley Open Computing Facility Lines: 10 Distribution: na Message-ID: <7f2m64$8t5$1@agate.berkeley.edu> References: <884R2.507$Ge5.29839@carnaval.risq.qc.ca> NNTP-Posting-Host: apocalypse.ocf.berkeley.edu not that it's a bad thing to ask here, but in the future if you want a fast answer, sigma tech support actually has a whole bunch of data on solubility, stability, and spectral stuff for most of the materials in their catalog. -- ______________________________________________________________________________ Lou Hom >K'93 lhom@ocf.berkeley.edu http://www.ocf.berkeley.edu/~lhom/ From owner-proteins@net.bio.net Tue Apr 13 23:00:00 1999 Date: Wed, 14 Apr 1999 20:33:24 +0200 From: "Tobias Straub" Newsgroups: bionet.molbio.proteins Subject: Re: glutathione-paramagnetic beads? References: <3709D042.BE444B29@mrc-lmb.cam.ac.uk> Organization: privat X-Newsreader: Microsoft Outlook Express Macintosh Edition - 4.5 (0410) Mime-version: 1.0 Content-Type: text/plain; charset="US-ASCII" Content-transfer-encoding: 7bit NNTP-Posting-Host: wpkd10.medpoliklinik.uni-wuerzburg.de Message-ID: <3714df5c.0@uni-wuerzburg.de> Lines: 37 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!logbridge.uoregon.edu!europa.clark.net!europa.netcrusader.net!194.162.162.196!newsfeed.nacamar.de!newsfeed.nacamar.de!uni-erlangen.de!uni-wuerzburg.de!wpkd10.medpoliklinik.uni-wuerzburg.de In my opinion it is impossible to use magnetic beads for protein purification. the problem is the unspecific binding of proteins to the beads. that's worse than sepharose. at least when I did some expts with Dynabeads almost every protein of a nuclear extract did bind to the beads and I could only remove them with SDS or NaOH. tobias ---------- In article <3709D042.BE444B29@mrc-lmb.cam.ac.uk>, Peter Wang wrote: > Dear all: > > Does anyone know of a supplier of glutathione conjugated to paramagnetic > beads (not Sepharose/agarose), for affinity isolation of GST-fusion > proteins? > > I tried asking on Methods & Reagents without success. I'm surprised > that such a product seems difficult to come by, given the popularity of > GST-fusion pulldown experiments. > > Cheers, > - Peter > > --------------------------------------------------------- > Peter Wang, M.D., Ph.D. > MRC Centre for Protein Engineering, > Hills Road, Cambridge, CB2 2QH, England > > Tel (01223) 402104 (international calls +44-1223-402104) > Fax (01223) 402140 ( " " +44-1223-402140) > > CrossTalk Society: http://www.corpus.cam.ac.uk/Activities/pcts/ > --------------------------------------------------------- > > From owner-proteins@net.bio.net Tue Apr 13 23:00:00 1999 Path: biosci!agate!newsfeed.berkeley.edu!cocoa.brown.edu!news From: Nitin_Bansal@brown.edu (Nitin_Bansal) Newsgroups: bionet.molbio.proteins Subject: protein production Date: 15 Apr 1999 05:53:52 GMT Organization: Brown University, Providence, RI -- USA Lines: 2 Message-ID: <7f3utg$ejf@cocoa.brown.edu> Reply-To: Nitin_Bansal@brown.edu NNTP-Posting-Host: prv-ri1-19.ix.netcom.com Mime-Version: 1.0 Content-Type: Text/Plain; charset=US-ASCII X-Newsreader: WinVN 0.99.9 (Released Version with Kerberos support) (x86 32bit) h From owner-proteins@net.bio.net Tue Apr 13 23:00:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!newsfeed.berkeley.edu!ctu-gate!news.nctu.edu.tw!ccnews.nchu.edu.tw!ccnews.thu.edu.tw!not-for-mail From: g846114@student.thu.edu.tw (Yukie Chen) Newsgroups: bionet.molbio.proteins Subject: Where can buy metmyoglobin (myoglobin with Fe+++) ? Date: Wed, 14 Apr 1999 13:22:50 GMT Organization: Tung-Hai University CC News Server, Taiwan. Lines: 20 Message-ID: <37149231.24299259@news.thu.edu.tw> Reply-To: g846114@student.thu.edu.tw NNTP-Posting-Host: tsa14.thu.edu.tw Mime-Version: 1.0 Content-Type: text/plain; charset=BIG5 Content-Transfer-Encoding: 8bit X-Trace: ccnews.thu.edu.tw 924095495 9465 140.128.96.144 (14 Apr 1999 13:11:35 GMT) X-Complaints-To: usenet@ccnews.thu.edu.tw NNTP-Posting-Date: 14 Apr 1999 13:11:35 GMT X-Newsreader: Forte Agent 1.5/32.452 I read a paper : Feldhusen, F., A. Warnatz, R. Erdmann & S. Wenzel. 1995 (or 1994?) Influence of storage time on parameters of colour stability of beef. J. Meat Sci.:235-243. I hope follow their procedure to determine metmyoglobin-reducing activity. But I can't find horse Metmyoglobin in Sigma's catalog. If anyone know where to buy horse metmyoglobin, please tell me. Thanks. Yukie@tacocity.com.tw     §ÚÄ@±N§Ú¦ç¾Q¦b©p¸}¤U     ¦ý§Ú¤Ó½a °£¤F¹Ú¥H¥~§Ú¤@µL©Ò¦³     §Ú±N¹Ú¾Q¦b©p¸}¤U ½Ð©p»´»´¨«¹L     ¦]¬°©p½òªº¬O §Úªº¹Ú     http://tacocity.com.tw/Yukie/    ¢v¢v¢v¢v¢v¢v¢v¢v¢v¢v¢v¢v¢v¢v¢v¢v    From owner-proteins@net.bio.net Wed Apr 14 23:00:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!newsfeed.berkeley.edu!newsfeed.cwix.com!129.250.35.146!iad-peer.news.verio.net!news.verio.net!uunet!ffx.uu.net!in3.uu.net!news.tufts.edu!not-for-mail From: Pranav Garg Newsgroups: bionet.molbio.proteins Subject: Cysteine Blocking Date: Thu, 15 Apr 1999 17:29:26 -0400 Organization: Tufts University Lines: 44 Message-ID: <37165A35.6CDE1B79@tufts.edu> Reply-To: pgarg@tufts.edu NNTP-Posting-Host: 130.64.10.62 Mime-Version: 1.0 Content-Type: text/plain; charset=EUC-KR Content-Transfer-Encoding: 7bit X-Trace: news3.tufts.edu 924211891 23086 (None) 130.64.10.62 X-Complaints-To: news@news.tufts.edu X-Mailer: Mozilla 4.5 [en] (WinNT; I) X-Accept-Language: en X-Priority: 1 (Highest) I am working on a HPLC (Strong Cation Exchange) resolution of Lysozyme variants (that vary by the oxidation state, with remaining cysteines blocked; Lysozyme has 4 disulfide linkages in the Native form), or if you will, quenched (= blocking of cysteines to prevent further refolding) lysozyme intermediates that are obtained during the refolding of a denatured and completely reduced lysozyme back into its native structure. I am trying to identify a reagent that will 1. react "irreversibly", ie. not by a disulfide bond with the free cysteines on the protein 2. Impart a +ve charge on the cysteine site (thus increasing the binding ability of the intermediate to the Cation Exchange Column, based on the number of cysteines available for blocking) 3. Have the highest possible mass that may help resolution using a MALDI-TOF Mass Spec procedure. So far, I have seen "ethylenimine" that satisfies criteria 1 and 2, which is not bad, but ethylenimine seems to be out of commercial availability due to its extreme carcinogenicity. If anyone has come accross another good reagent for the purpose, that would be helpful. Thank You, Pranav Garg Biotechnology Center, Department of Chem. Eng. Tufts University Medford, MA 02155 Phone 617 6273900 Fax 617 6273991 Email pgarg@tufts.edu From owner-proteins@net.bio.net Wed Apr 14 23:00:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!newsfeed.berkeley.edu!news.he.net!nntp.news.xara.net!xara.net!server6.netnews.ja.net!daresbury!not-for-mail From: John Berges Newsgroups: bionet.molbio.proteins Subject: Lectureships Date: 15 Apr 1999 18:28:45 +0100 Organization: Daresbury Laboratory, Warrington, U.K. Lines: 98 Message-ID: <7f57kd$fdu$1@mserv2.dl.ac.uk> NNTP-Posting-Host: localhost.dl.ac.uk Mime-Version: 1.0 X-Trace: mserv2.dl.ac.uk 924197326 15808 127.0.0.1 (15 Apr 1999 17:28:46 GMT) X-Complaints-To: newsmaster@dl.ac.uk NNTP-Posting-Date: 15 Apr 1999 17:28:46 GMT Original-To: Protein Newsgroup X-Authentication: none I'd like to ask your help in spreading the word to anyone who might be interested. There follows a rather vaguely worded add from our School. Categories aside, the bottom line is that we are after good people. I know we are fighting Belfast's (in my opinion undeservedly) bad reputation. I'd be happy to have my name and email given as a point of informal (and not too badly biased) contact. -------------------------------------------------------------------------------------- The Queen's University of Belfast Investing in Excellence As part of a major programme of expansion, the University is supporting the School of Biology and Biochemistry with a major investment of posts to enhance its research and teaching activities. The School wishes to appoint people with a record of publications in quality, peer-reviewed journals, commensurate with age and experience. It is also looking for a lively and innovative teaching capability as part of the University's policy of balanced excellence. 2 Year Fixed Term Lectureship in Molecular Ecology and Evolution, Ref: 99/P142C Preferably with interests in Population Genetics, Eukaryote Genetics or Molecular Evolution Three Lectureships (Ref: 99/P141C) Applications are invited from individuals with strong research records and preferably, with some experience in tertiary level teaching in the following areas: Behaviour / Ecology Preferably with interests in Animal Behaviour, Animal Ecology/Conservation Biology, Ecological Modelling, or Physiology/Ecology of Aquatic Animals Biochemistry Preferably with interests in Molecular Recognition/Structure Prediction, Molecular Enzymology, Neurochemistry, or Signal Transduction Genetics/Molecular Biology Preferably with interests in Behavioural Genetics, Microbial Biotechnology, Molecular Biology of Infectious Diseases, Molecular Evolution/Bioinformatics Applicants must have an honours degree or equivalent in Biological Sciences or related discipline and a PhD in a relevant area together with a good track record of publications in premier scientific journals. Potential to obtain external funding and lead a team of researchers having impact nationally and internationally is essential for the three lectureships. The successful applicant for the fixed term lectureship must be able to contribute to lectures and practicals, and to supervise final year projects in the areas of population genetics, eukaryote genetics and molecular evolution. Successful candidates will be expected to develop independent research programmes complementing and collaborating with other members of the School of Biology and Biochemistry and the wider research community at Queen's and establishing strong national and international links. The successful candidates must also be committed to research-led teaching and preferably have some experience of lecturing and/or practical demonstration and/or supervision of student projects. Postdoctoral experience and a proven ability to acquire external funds are also desirable. Informal enquiries may be made to the School Office, Tel: 00 44 1232 335786 or email: sobb.office@qub.ac.uk Further information about the School can be obtained on its Home Web page: http://www.qub.ac.uk/bb Closing date: 5.00 pm, Friday 14 May 1999. Further particulars quoting reference number(s) are available from Personnel Office, The Queen's University of Belfast, Northern Ireland, BT7 1NN. Tel: (01232) 273044 or 273854 (answering machine). Fax: (01232) 324944 or email: personnel@qub.ac.uk Committed to an Equal Opportunities policy and selection on merit, the University welcomes applications from all sections of the community. ----------------------------------------------------------- "Ni dheanfaidh smaoineamh an treabhadh duit." -Irish proverb _/_/_/_/ _/ _/ _/_/_/ Dr. John A. Berges _/ _/ _/ _/ _/ _/ Biology and Biochemistry _/ _/ _/ _/ _/_/_/ Queen's University, Belfast _/ _/_/ _/ _/ _/ _/ BT9 7BL Northern Ireland _/_/_/_/ _/_/_/_/ _/_/_/ FAX: 44 (0)1232 236 505 _/ (homepage: http://www.qub.ac.uk/bb/jbpage/jbhome.htm) From owner-proteins@net.bio.net Wed Apr 14 23:00:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!newsfeed.berkeley.edu!agate!not-for-mail From: lhom@OCF.Berkeley.EDU (Louis Hom) Newsgroups: bionet.molbio.proteins Subject: Re: protein production Date: 15 Apr 1999 17:45:16 GMT Organization: Univ. of California Berkeley Open Computing Facility Lines: 7 Message-ID: <7f58jc$en9$1@agate.berkeley.edu> References: <7f3v1t$ejf@cocoa.brown.edu> NNTP-Posting-Host: apocalypse.ocf.berkeley.edu HHHHHHHHHHHH TTTTT BBBBBBBBBBBBBBBB TTTT BBBBBBBBBBBBBB . . . -- ______________________________________________________________________________ Lou Hom >K'93 lhom@ocf.berkeley.edu http://www.ocf.berkeley.edu/~lhom/ From owner-proteins@net.bio.net Wed Apr 14 23:00:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!su-news-feed4.bbnplanet.com!su-news-hub1.bbnplanet.com!news.gtei.net!nntp.flash.net!newsswitch.lcs.mit.edu!newsfeed.cwix.com!128.230.129.106!news.maxwell.syr.edu!dispose.news.demon.net!demon!news.demon.co.uk!demon!scotgate2.demon.co.uk!SCOTGATE2!chris From: chris@scotgate2.demon.co.uk (Chris H Lindley) Newsgroups: bionet.molbio.proteins Subject: Re: ApoD S.O.S. Date: Wed, 14 Apr 1999 21:46:19 GMT Sender: chris@SCOTGATE2.DEMON.CO.UK Message-ID: References: Reply-To: Chris@scotgate2.demon.co.uk NNTP-Posting-Host: scotgate2.demon.co.uk X-NNTP-Posting-Host: scotgate2.demon.co.uk:193.237.11.2 X-Trace: news.demon.co.uk 924204855 nnrp-04:11937 NO-IDENT scotgate2.demon.co.uk:193.237.11.2 X-Complaints-To: abuse@demon.net Mime-Version: 1.0 Content-Type: text/plain; charset=iso-8859-1 Content-Transfer-Encoding: 8bit User-Agent: slrn/0.9.5.4 (OS/2) Lines: 24 On Tue, 13 Apr 1999 10:33:35 -0400, ju98@total.net wrote: >Hello, > I would like to have more information about apolipoprotein D and the >Alzheimer's or Parkinson diseases. It's very important to me and I >appreciate your collaboration. Try a search on this site! http://www.ncbi.nlm.nih.gov/PubMed/ It's almost like doing a literature search!! Cheers Chris -- ATGCTGCTAGTCGTAGCATGCTGCTTGATCGATGCGGTACGTGATGATCGTAGCTAGCTGGGCTAGTGG ¦ Chris H. Lindley Yorkshire, UK ¦ ¦ chris@scotgate2.demon.co.uk Ferg on #os/2 and #os2uk, EFnet ¦ ¦ WarpUK:UK OS/2 Users group www.warp.in-uk.net ¦ ¦ Molecular Biology & OS/2 www.scotgate.demon.co.uk ¦ TACGACGATCAGCATCGTACGACGAACTAGCTACGCCATGCACTACTAGCATCGATCGACCCGATCACC From owner-proteins@net.bio.net Thu Apr 15 23:00:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!newsfeed.concentric.net!netnews.com!news-peer-europe.sprintlink.net!news.sprintlink.net!Sprint!news.algonet.se!newsfeed1.telenordia.se!algonet!newsfeed1.funet.fi!newsfeed.uninet.ee!news.ut.ee!not-for-mail From: Peeter Toomik Newsgroups: bionet.molbio.proteins Subject: Re: Cysteine Blocking Date: Fri, 16 Apr 1999 10:13:42 +0300 Organization: Tartu University Lines: 46 Message-ID: <3716E326.35E91BDC@ut.ee> References: <37165A35.6CDE1B79@tufts.edu> NNTP-Posting-Host: biochem3.bio.ut.ee Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Trace: kadri.ut.ee 924246656 25388 193.40.8.203 (16 Apr 1999 07:10:56 GMT) X-Complaints-To: usenet@news.ut.ee NNTP-Posting-Date: 16 Apr 1999 07:10:56 GMT X-Mailer: Mozilla 4.5 [en] (Win95; I) X-Accept-Language: en I think that you can generate ethyleneimine in situ from 2-cloroethylamine monohydrochloride (Aldrich, C4,020-0). Peeter Toomik Pranav Garg wrote: > I am working on a HPLC (Strong Cation Exchange) resolution of Lysozyme > variants (that vary by the oxidation state, with remaining cysteines > blocked; Lysozyme has 4 disulfide linkages in the Native form), or if > you will, quenched (= blocking of cysteines to prevent further > refolding) lysozyme intermediates that are obtained during the refolding > > of a denatured and completely reduced lysozyme back into its native > structure. I am trying to identify a reagent that will > > 1. react "irreversibly", ie. not by a disulfide bond with the free > cysteines on the protein > > 2. Impart a +ve charge on the cysteine site (thus increasing the > binding ability of the intermediate to > the Cation Exchange Column, based on the number of cysteines > available for blocking) > > 3. Have the highest possible mass that may help resolution using a > MALDI-TOF Mass Spec > procedure. > > So far, I have seen "ethylenimine" that satisfies criteria 1 and 2, > which is not bad, but ethylenimine seems to be out of commercial > availability due to its extreme carcinogenicity. > > If anyone has come accross another good reagent for the purpose, that > would be helpful. > > Thank You, > > Pranav Garg > Biotechnology Center, > Department of Chem. Eng. > Tufts University > Medford, MA 02155 > > Phone 617 6273900 > Fax 617 6273991 > Email pgarg@tufts.edu From owner-proteins@net.bio.net Thu Apr 15 23:00:00 1999 Path: biosci!newshost.lanl.gov!awabi.library.ucla.edu!128.230.129.106!news.maxwell.syr.edu!newsfeed.nacamar.de!rz.uni-karlsruhe.de!news.uni-stuttgart.de!news.ruhr-uni-bochum.de!not-for-mail From: heiko.koch@ruhr-uni-bochum.de (Heiko Koch) Newsgroups: bionet.molbio.proteins Subject: Secundary Stucture Prediction Date: Fri, 16 Apr 1999 12:12:39 GMT Organization: Ruhr-Universitaet Bochum, Rechenzentrum Lines: 12 Message-ID: <371727e9.19603820@news.ruhr-uni-bochum.de> NNTP-Posting-Host: r06-596.molgen.ruhr-uni-bochum.de X-Trace: sunu789.rz.ruhr-uni-bochum.de 924264609 24252 134.147.135.206 (16 Apr 1999 12:10:09 GMT) NNTP-Posting-Date: 16 Apr 1999 12:10:09 GMT X-Newsreader: Forte Free Agent 1.11/32.235 Hi together can anyone explain me the principles how the secundary prediction Programms "ProteinPrediction" (Secondary structure prediction by PHDsec) and "3D-PSSM-Server" are working??? thanks for Your help Heiko Heiko.Koch@ruhr-uni-bochum.de From owner-proteins@net.bio.net Thu Apr 15 23:00:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!news-feed.inet.tele.dk!bofh.vszbr.cz!news-peer-europe.sprintlink.net!news.sprintlink.net!Sprint!feed2.news.luth.se!luth.se!fu-berlin.de!news-ber1.dfn.de!news-ham1.dfn.de!news.rz.uni-kiel.de!newsserver.rrzn.uni-hannover.de!not-for-mail From: Wolf-Dieter Stalz Newsgroups: bionet.molbio.proteins Subject: Re: Cysteine Blocking Date: Fri, 16 Apr 1999 16:05:15 +0200 Organization: RRZN - Newsserver Lines: 9 Message-ID: <3717439B.7840F80F@biologie.uni-osnabrueck.de> References: <37165A35.6CDE1B79@tufts.edu> NNTP-Posting-Host: cladia.biologie.uni-osnabrueck.de Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 4.5 [en] (WinNT; U) X-Accept-Language: en A lot of people use maleimide derivatives. These compounds form a thioether with the free thiol group of cysteines. Some maleimides are offered at "Moelcular Probes Inc., Eugene, OR" ( phone: 541/465-8300; try a look at "http://www.probes.com/handbook/ch02-toc.html"). Most of the compounds are fluorescent after forming the thiolether with their target. The molecular weight of the maleimides varies between 300 and 1000. Wody From owner-proteins@net.bio.net Fri Apr 16 23:00:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!uchinews2!yellow.newsread.com!netaxs.com!newsread.com!newspeer1.nac.net!newspeer.monmouth.com!solomon.io.com!news-feeds.jump.net!nntp2.dejanews.com!nnrp1.dejanews.com!not-for-mail From: Kresten Newsgroups: bionet.molbio.proteins Subject: BPLC ret. time prediction Date: Sat, 17 Apr 1999 13:28:30 GMT Organization: Deja News - The Leader in Internet Discussion Lines: 14 Message-ID: <7fa29q$dl$1@nnrp1.dejanews.com> NNTP-Posting-Host: 130.226.183.6 X-Article-Creation-Date: Sat Apr 17 13:28:30 1999 GMT X-Http-User-Agent: Mozilla/4.5 [en] (Win95; I) X-Http-Proxy: 1.0 www2.crc.dk:3128 (Squid/2.1.RELEASE), 1.0 x1.dejanews.com:80 (Squid/1.1.22) for client 130.226.182.217, 130.226.183.6 Does anybody know of a free program that will predict retention times in RP-HPLC? Thank you Kresten -- The address kresten@my-dejanews.com is for spambots only. Please mail me at LysLeuLeu@crc.dk , transforming the pre@-part into my initials. Kresten Lindorff Larsen, Dept. Yeast Genetics Carlsberg Laboratory, Denmark -----------== Posted via Deja News, The Discussion Network ==---------- http://www.dejanews.com/ Search, Read, Discuss, or Start Your Own From owner-proteins@net.bio.net Fri Apr 16 23:00:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!uchinews2!newsswitch.lcs.mit.edu!netnews.com!news.maxwell.syr.edu!nntp2.dejanews.com!nnrp1.dejanews.com!not-for-mail From: Kresten Newsgroups: bionet.molbio.proteins Subject: Re: BPLC ret. time prediction Date: Sat, 17 Apr 1999 13:37:57 GMT Organization: Deja News - The Leader in Internet Discussion Lines: 6 Message-ID: <7fa2rl$sb$1@nnrp1.dejanews.com> References: <7fa29q$dl$1@nnrp1.dejanews.com> NNTP-Posting-Host: 130.226.183.6 X-Article-Creation-Date: Sat Apr 17 13:37:57 1999 GMT X-Http-User-Agent: Mozilla/4.5 [en] (Win95; I) X-Http-Proxy: 1.0 www2.crc.dk:3128 (Squid/2.1.RELEASE), 1.0 x1.dejanews.com:80 (Squid/1.1.22) for client 130.226.182.217, 130.226.183.6 Sorry about the err. in the subject line. It is of course HPLC I am speaking about. Kresten -----------== Posted via Deja News, The Discussion Network ==---------- http://www.dejanews.com/ Search, Read, Discuss, or Start Your Own From owner-proteins@net.bio.net Sat Apr 17 23:00:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!uchinews2!yellow.newsread.com!netaxs.com!newsread.com!newspeer1.nac.net!news.maxwell.syr.edu!nntp2.dejanews.com!nnrp1.dejanews.com!not-for-mail From: Kresten Newsgroups: bionet.molbio.proteins Subject: S-(4-Pyridylethyl)cysteine Date: Sun, 18 Apr 1999 15:08:20 GMT Organization: Deja News - The Leader in Internet Discussion Lines: 19 Message-ID: <7fcsh1$7r3$1@nnrp1.dejanews.com> NNTP-Posting-Host: 130.226.183.6 X-Article-Creation-Date: Sun Apr 18 15:08:20 1999 GMT X-Http-User-Agent: Mozilla/4.5 [en] (Win95; I) X-Http-Proxy: 1.0 www2.crc.dk:3128 (Squid/2.1.RELEASE), 1.0 x2.dejanews.com:80 (Squid/1.1.22) for client 130.226.182.217, 130.226.183.6 I have blocked free cysteines in a protein by treatment with 4-vinylpyridine obtaining a pyridylethyl derivative. Can anybody tell me about the change in spectral-properties of my protein by this modification: 1. At which wavelengths does the pyridylethyl group absorb (lambda-max and possibly an epsilon as well)? 2. Does the group contribute to absorption at 280 nm? Thank You Kresten -- The address kresten@my-dejanews.com is for spambots only. Please mail me at LysLeuLeu@crc.dk , transforming the pre@-part into my initials. Kresten Lindorff Larsen, Dept. Yeast Genetics Carlsberg Laboratory, Denmark -----------== Posted via Deja News, The Discussion Network ==---------- http://www.dejanews.com/ Search, Read, Discuss, or Start Your Own From owner-proteins@net.bio.net Sun Apr 18 23:00:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!uchinews2!yellow.newsread.com!netaxs.com!newsread.com!news.servint.com!netnews.com!news.maxwell.syr.edu!news-was.dfn.de!news-han1.dfn.de!news.gwdg.de!not-for-mail From: Steffen Schmidt Newsgroups: bionet.molbio.proteins Subject: His-Tag and Folding Date: Mon, 19 Apr 1999 08:04:11 +0200 Organization: GWDG, Goettingen Lines: 37 Message-ID: <371AC75B.DC06AB7F@Uni-MolGen.gwdg.de> NNTP-Posting-Host: 134.76.70.65 Mime-Version: 1.0 Content-Type: multipart/mixed; boundary="------------FD8C577E513CC4EB5324AAC1" X-Mailer: Mozilla 4.5 [en] (WinNT; I) X-Accept-Language: en This is a multi-part message in MIME format. --------------FD8C577E513CC4EB5324AAC1 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit Hi, I remember that there was recently a discussion about the influence of His-Tags in folding. Unfortunately I unsubscribed afterwards without saving the discussion. Could someone please send me this discussion? Thanks, Steffen --------------FD8C577E513CC4EB5324AAC1 Content-Type: text/x-vcard; charset=us-ascii; name="sschmid2.vcf" Content-Transfer-Encoding: 7bit Content-Description: Card for Steffen Schmidt Content-Disposition: attachment; filename="sschmid2.vcf" begin:vcard n:Schmidt;Steffen tel;work:Arbeitsgruppe PD Dr. R. Sterner x-mozilla-html:FALSE url:http://www.gwdg.de/~sschmid3 org:Institut für Mikrobiologie und Genetik;Abteilung für molekulare Genetik und präparative Molekularbiologie adr:;;Grisebachstr. 8;37077 Göttingen;;; version:2.1 email;internet:sschmid2@Uni-MolGen.gwdg.de title:Georg-August Universität Göttingen fn:Steffen Schmidt end:vcard --------------FD8C577E513CC4EB5324AAC1-- From owner-proteins@net.bio.net Sun Apr 18 23:00:00 1999 Path: biosci!newshost.lanl.gov!not-for-mail From: Brian Foley Newsgroups: bionet.molbio.proteins,bionet.software Subject: Re: distance between amino acids and sequences Date: Mon, 19 Apr 1999 14:34:26 -0600 Organization: HIV Database Lines: 76 Message-ID: <371B9352.7D72@lanl.gov> References: <75i2c7$i14@maze.dpo.uab.edu> <7eg55a$r8c@populus.slu.se> <3716644A.19B@lanl.gov> <160419991851348998%learn@u.washington.edu> NNTP-Posting-Host: 128.165.24.115 Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Trace: newshost.lanl.gov 924554065 17853 128.165.24.115 (19 Apr 1999 20:34:25 GMT) X-Complaints-To: usenet@lanl.gov NNTP-Posting-Date: 19 Apr 1999 20:34:25 GMT To: Jerry Learn X-Mailer: Mozilla 3.01 (X11; U; SunOS 5.5.1 sun4m) Xref: biosci bionet.molbio.proteins:14254 bionet.software:23259 Jerry Learn wrote: > > Lev Zhivotovsky wrote: > > > > > >... > > > Is there any computer program to get the distance matrix > > > for a set of amino acid sequences ? > > >... Brian Foley replied: > > ... > > Often times, DNA distances and protein distances > > are not the same. So it is wise to look at both, if you are > > making phylogenetic inferences. > > Brian, > > I'm afraid that I must disagree here. Unless you are > seeing substantial saturation at the nucleotide level, > nucleotide sequence data are most likely better for > inferring phylogenetic relationships among sequences I agree. The original poster (Lev) was asking about protein distance only, so I wa hoping he would also look at the DNA. Even after substantial saturation of silent sites has been reached, the DNA still gives more phylogenetic information than the protein sequences. > (perhaps among species, but that is a different issue, > isn't it?). I'm afraid that I can't say precisely what > level of saturation you have to be at to get misleading > results. Maybe someone out there can add this, > but I suspect that this depends on how rich a sample of > taxa one is dealing with. As far as I can tell, misleading results using DNA sequences will not be cleared up by using protein sequences. Either molecule, DNA or protein, can give misleading results if the evolutionary model does not take into account saturation effects. If a gene evolves at 1% per year, it will not be 100% different after 100 years. > If one gets different answers from protein and nucleotide > data, that can tell you that something interesting is going > on. My problem with protein distance is that I have doubts > about how well it calibrates with time. Regardless of how > much faith one wants to put in a molecular clock, at least > the models dealing with nucleotide evolution scale better > with time. I am actively looking for a model of either DNA or protein evolution that can estimate time after substantial saturation of silent sites has been reached. I work with virus sequences, which leave no fossil record from which to benchmark ancient dates. We can measure how fast they are evolving at the tips of the branches (we have some frozen blood samples from many years ago, as well as many samples available today), but from that, it is difficult to extrapolate back far enough to answer my questions. My research seems to be showing me that the DNA models would scale well with time in non-coding DNA. But the sequences I work with are either coding or regulatory, so there are very few sites that are not under selective pressure. Phylogenetic trees built with such coding regions are not "nonsense", they are typically very good, even long after saturation of silent sites. But the distance vs. time plots are non-linear, and without fossils (or similar evidence) to put known dates on some parts of the curve, I cannot accurately predict the exact shape of the curve, I can only tell when I leave the near-linear portion. -- ____________________________________________________________________ |Brian T. Foley btf@t10.lanl.gov | |HIV Database (505) 665-1970 | |Los Alamos National Lab http://hiv-web.lanl.gov/index.html | |Los Alamos, NM 87544 U.S.A. | |____________________________________________________________________| From owner-proteins@net.bio.net Sun Apr 18 23:00:00 1999 Path: biosci!bcm.tmc.edu!news.msfc.nasa.gov!europa.clark.net!europa.netcrusader.net!209.113.65.250!korova.insync.net!uunet!ffx.uu.net!ffx4nh4!not-for-mail From: ddyuiw@usa.net Newsgroups: bionet.molbio.proteins Subject: cancer 9854 Date: 20 Apr 1999 05:27:26 GMT Organization: Lamar Electric Internet Services Lines: 5 Message-ID: <924586202.807168@fuse.lamarelectric.com> NNTP-Posting-Host: fuse.lamarelectric.com X-Trace: ffx2nh4.news.uu.net 924586046 16089 208.245.242.8 (20 Apr 1999 05:27:26 GMT) X-Complaints-To: news@ffx2nh4.news.uu.net NNTP-Posting-Date: 20 Apr 1999 05:27:26 GMT Cache-Post-Path: fuse.lamarelectric.com!unknown@aa-1-154.lamarelectric.com X-Cache: nntpcache 2.3.3 (see http://www.nntpcache.org/) Please help mom of four fight cancer by going to http://www.angelfire.com/tx2/cancer God Bless tsysdgrbektplgkdqnfegpklhigkjlte From owner-proteins@net.bio.net Mon Apr 19 23:00:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!logbridge.uoregon.edu!news.maxwell.syr.edu!newsspool.doit.wisc.edu!news.doit.wisc.edu!default From: klenchin@facstaff.REMOVE_TO_REPLY.wisc.edu (Dima Klenchin) Newsgroups: bionet.molbio.proteins Subject: Re: His-Tag and Folding Date: Tue, 20 Apr 1999 20:44:21 GMT Organization: UW-Madison Lines: 17 Message-ID: <7fiouv$mo8$2@news.doit.wisc.edu> References: <371AC75B.DC06AB7F@Uni-MolGen.gwdg.de> NNTP-Posting-Host: martinlab2.biochem.wisc.edu Mime-Version: 1.0 Content-Type: text/plain; charset=KOI8-R Content-Transfer-Encoding: 8bit X-Newsreader: News Xpress 2.01 X-No-Archive: Yes In article <371AC75B.DC06AB7F@Uni-MolGen.gwdg.de>, Steffen Schmidt wrote: :This is a multi-part message in MIME format. :--------------FD8C577E513CC4EB5324AAC1 :Content-Type: text/plain; charset=us-ascii :Content-Transfer-Encoding: 7bit : :Hi, : :I remember that there was recently a discussion about the influence of :His-Tags in folding. Unfortunately I unsubscribed afterwards without :saving the discussion. Could someone please send me this discussion? : search at www.dejanews.com - Dima From owner-proteins@net.bio.net Mon Apr 19 23:00:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!news-feed.inet.tele.dk!bofh.vszbr.cz!newsfeed.tli.de!newsfeed.nacamar.de!rz.uni-karlsruhe.de!news.uni-stuttgart.de!news.ruhr-uni-bochum.de!news-koe1.dfn.de!news-han1.dfn.de!news.gwdg.de!not-for-mail From: Steffen Schmidt Newsgroups: bionet.molbio.proteins Subject: Expression AND Codon-Usage Date: Tue, 20 Apr 1999 10:38:34 +0200 Organization: GWDG, Goettingen Lines: 40 Message-ID: <371C3D0A.D69D7B7F@Uni-MolGen.gwdg.de> NNTP-Posting-Host: 134.76.70.65 Mime-Version: 1.0 Content-Type: multipart/mixed; boundary="------------E9201DB853DEF7B40F798850" X-Mailer: Mozilla 4.5 [en] (WinNT; I) X-Accept-Language: en This is a multi-part message in MIME format. --------------E9201DB853DEF7B40F798850 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit Hi, we were wondering about heterologous expression of proteins in E. coli. There are some Codons which are not very often used in E. coli. So normally one changes the codons in his own DNA-Sequence or otherwise accepts a lower yield. Does anybody know whether there is literature about the phenonomen of codon usage correlated with protein-expression? Thanks, Steffen --------------E9201DB853DEF7B40F798850 Content-Type: text/x-vcard; charset=us-ascii; name="sschmid2.vcf" Content-Transfer-Encoding: 7bit Content-Description: Card for Steffen Schmidt Content-Disposition: attachment; filename="sschmid2.vcf" begin:vcard n:Schmidt;Steffen tel;work:Arbeitsgruppe PD Dr. R. Sterner x-mozilla-html:FALSE url:http://www.gwdg.de/~sschmid3 org:Institut für Mikrobiologie und Genetik;Abteilung für molekulare Genetik und präparative Molekularbiologie adr:;;Grisebachstr. 8;37077 Göttingen;;; version:2.1 email;internet:sschmid2@Uni-MolGen.gwdg.de title:Georg-August Universität Göttingen fn:Steffen Schmidt end:vcard --------------E9201DB853DEF7B40F798850-- From owner-proteins@net.bio.net Mon Apr 19 23:00:00 1999 Path: biosci!CMB.BIOSCI.WAYNE.EDU!myang From: myang@CMB.BIOSCI.WAYNE.EDU (maozhou yang) Newsgroups: bionet.molbio.proteins Subject: EST database? Date: 20 Apr 1999 06:43:00 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 8 Sender: daemon@net.bio.net Distribution: world Message-ID: <371C4C6C.573D@cmb.biosci.wayne.edu> NNTP-Posting-Host: net.bio.net Dear Colleagues: Would you please tell me how many EST databse I can access? Thanks in advance! Best wishes! Xue From owner-proteins@net.bio.net Mon Apr 19 23:00:00 1999 Path: biosci!agate!newsfeed.berkeley.edu!newsfeed.direct.ca!news.UVic.CA!not-for-mail From: Albert Newsgroups: bionet.molbio.proteins Subject: Contract Fermentation Date: Tue, 20 Apr 1999 21:27:11 -0700 Organization: University of Victoria Lines: 21 Message-ID: <371D539E.26329AF8@uvic.ca> NNTP-Posting-Host: biochemshop.bioc.uvic.ca Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Trace: uvaix7e1.comp.UVic.CA 924668724 27280 142.104.33.18 (21 Apr 1999 04:25:24 GMT) X-Complaints-To: abuse@UVic.CA NNTP-Posting-Date: 21 Apr 1999 04:25:24 GMT X-Mailer: Mozilla 4.5 [en] (Win98; I) X-Accept-Language: en University of Victoria Level II Fermentation Facility The Biochemistry and Microbiology Department of the University of Victoria, in British Columbia, Canada has established a Level II containment fermentation facility for use by both on and off-campus clients. We provide solutions for researchers interested in scale-up experiments and in pilot-plant scale production of bacteria and of recombinant products. Our Level II certification allows the culture and processing of Risk Group 2 organisms, a service that is normally found in larger organisations. For further infomation contact: Alistair Bell (albell@uvic.ca, 250-721-6134) Albert Labossiere (alabossi@uvic.ca, 250-721-7082) From owner-proteins@net.bio.net Mon Apr 19 23:00:00 1999 Path: biosci!CSHL.ORG!boyce From: boyce@CSHL.ORG (Joan Boyce) Newsgroups: bionet.molbio.proteins Subject: 1999 Source Book available for Free! Date: 20 Apr 1999 12:36:27 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 16 Sender: daemon@net.bio.net Distribution: world Message-ID: <371CD5EF.3C56@cshl.org> Reply-To: boyce@cshl.org NNTP-Posting-Host: net.bio.net Obtain a free copy of the 1999 Source Book (publication date May 10th), a comprehensive guide to bioresearch products, by filling in the request form at the BioSupplyNet site: http://www.biosupplynet.com. The Source Book provides up-to-date information about reagents, lab instrumentation, antibodies, custom services and supplies. The unique organization of the Source Book simplifies product searching and speeds the gathering of comparative information. The Source Book indexes products in 2650 categories, and provides up-to-date contact information, including WWW and e-mail addresses, for 3500 suppliers. Bench Basics comparative tables allow apples-to-apples comparisons of products. A special Lab Set-up Check List simplifies the process of putting together a new laboratory. Order your free copy at The BioSupplyNet web site at http://www.biosupplynet.com From owner-proteins@net.bio.net Tue Apr 20 23:00:00 1999 Path: biosci!newshost.lanl.gov!awabi.library.ucla.edu!128.32.206.55!newsfeed.berkeley.edu!remarQ73!remarQ60!supernews.com!remarQ.com!ihug.co.nz!not-for-mail From: "Marcel Dinger" Newsgroups: bionet.molbio.proteins Subject: Genamics.com for Journals, Software and Genomes Date: Wed, 21 Apr 1999 19:33:36 +1200 Organization: Genamics Lines: 38 Message-ID: <924683731.449763@ham.ihug.co.nz> Reply-To: "Marcel Dinger" NNTP-Posting-Host: ham.ihug.co.nz X-Priority: 3 X-MSMail-Priority: Normal X-Newsreader: Microsoft Outlook Express 5.00.2014.211 X-Mimeole: Produced By Microsoft MimeOLE V5.00.2014.211 Cache-Post-Path: ham.ihug.co.nz!unknown@p55-max5.ham.ihug.co.nz X-Cache: nntpcache 2.3.3 (see http://www.nntpcache.org/) GENAMICS.COM - An Internet Gateway for Molecular Biology, Biochemistry and Microbiology. We are providing a host of free information, mostly in the form of easily searchable databases, for molecular biologists, biochemists and microbiologists. Presently we offer information in three main areas: 1. Software Library - One of the most comprehensive collections of molecular biology and biochemistry software tools available on the Web for Windows, MS-DOS, Unix and Macintosh platforms. The library presently contains almost 400 hundred files, and is growing rapidly. Our server is very fast, so you are unlikely to suffer the lags and delays you may have experienced at other sites. 2. Genome Database - A fully searchable database of current information about microbial genome projects with links to relevant sites. The database contains over 100 entries. 3. Journal Index - A powerful, yet easy-to-use guide to hundreds of online journals, providing efficient access to a wealth of information. The Journal Index presently contains more than 260 different molecular biology, biochemistry and microbiology journal titles. We are in the process of extending the content on our site further. We are committed to keeping the information on the pages as up-to-date as possible and encourage input from our users. We don't require any sort of log-in procedure, and our pages are not loaded with cumbersome advertising banners. Come and check it out: http://genamics.com Marcel Dinger, Genamics. From owner-proteins@net.bio.net Tue Apr 20 23:00:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!newsfeed.berkeley.edu!newsfeed.wirehub.nl!surfnet.nl!eur.nl!news.fgg.eur.nl!usenet From: "AZR9358 from Int 1, l293" Newsgroups: bionet.molbio.proteins Subject: proteinase inhibitors & cell-culture Date: Wed, 21 Apr 1999 11:15:21 +0200 Organization: Erasmus university/ Rotterdam Academic Hospital Lines: 26 Message-ID: <371D9728.35CE9543@mail.fgg.eur.nl> Reply-To: saris@farma.fgg.eur.nl NNTP-Posting-Host: ns.azr.nl Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 4.04 [en] (Win95; I) Hi all, I'm currently trying to inhibit the specific proteolytic activation (after endocytosis) in two cell types (myocytes and HUVEC). I do not have clue for a simple biomarker system, but can easely detect small amounts of proteolytic activation with an immuno-assay. So far have I tested several general protease inhibitors, which we had in stock. My concern is that these inhibitors like pepstatin, leupeptin did not enter the cell during the preincubation step. Could anyone provide me with data of known cell-permeable protease inhibitors, hand-on knowledge or a good reference? Help will be appreciated. With regards, Jasper Saris Dept. Internal Medicine I Erasmus University Rotterdam saris@farma.fgg.eur.nl From owner-proteins@net.bio.net Tue Apr 20 23:00:00 1999 Path: biosci!agate!not-for-mail From: lhom@OCF.Berkeley.EDU (Louis Hom) Newsgroups: bionet.molbio.proteins Subject: Deglycosylating my protease Date: 21 Apr 1999 22:18:58 GMT Organization: Univ. of California Berkeley Open Computing Facility Lines: 26 Message-ID: <7flisi$k65$1@agate.berkeley.edu> NNTP-Posting-Host: apocalypse.ocf.berkeley.edu I've observed that using tunicamycin to block glycosylation of my protease results in an inactive enzyme that also cannot be chemically activated (the proenzyme can usually be induced to undergo maturation by treating with 0.5% SDS). So I'd like to deglycosylate the proenzyme using peptidyl N-glycosidase F (that step doesn't seem to be problematic) and see if that affects the chemical activatability of the protease. Unfortunately, my mock-deglycosylated proenzyme (i.e., treated identically except no PNGase F) seems to lose its ability to be activated in the process, so I can't make any determination about the deglycosylated proenzyme. Your insights would be most welcome. My conditions: 50 mM sodium phosphate (tried from pH 6.5 to 8.6 <--tris) 30 min @ 37 degrees C (conditions in which I at least know the mature protease is stable) Today I am going to try adding 5 mM BME (it's a cysteine protease; maybe this will help). We'll see. -- ______________________________________________________________________________ Lou Hom >K'93 lhom@ocf.berkeley.edu http://www.ocf.berkeley.edu/~lhom/ From owner-proteins@net.bio.net Tue Apr 20 23:00:00 1999 Path: biosci!AOL.COM!DOCTORHIM From: DOCTORHIM@AOL.COM Newsgroups: bionet.molbio.proteins Subject: Re: Deglycosylating my protease Date: 21 Apr 1999 18:54:58 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 2 Sender: daemon@net.bio.net Distribution: world Message-ID: Reply-To: DOCTORHIM@aol.com NNTP-Posting-Host: net.bio.net You might want to read the booklet that accompanies this deglycosylation kit. You can download a PDF copy from the web page. It may answer your questions. From owner-proteins@net.bio.net Tue Apr 20 23:00:00 1999 Newsgroups: bionet.molbio.proteins,bionet.general,sci.research.postdoc Path: biosci!news.stanford.edu!newsfeed.stanford.edu!uchinews2!uchinews!not-for-mail From: jm68@midway.uchicago.edu (Jim Mensch) Subject: Postdocs in biochemistry & molecular biology, U. of Chicago X-Nntp-Posting-Host: howard-nfs.uchicago.edu Message-ID: Sender: news@midway.uchicago.edu (News Administrator) Organization: The University of Chicago Distribution: na Date: Thu, 22 Apr 1999 00:24:32 GMT Lines: 20 Xref: biosci bionet.molbio.proteins:14266 bionet.general:32959 Two postdoctoral research positions will soon be available at the Kennedy Mental Retardation and Connective Tissue Research Center located at the University of Chicago, Chicago IL. These positions will involve research projects in the areas of protein biochemistry/enzymology and molecular biology. To be considered for these appointments, and for further information, please write to: Postdoctoral Search Kennedy Center, MC5058 5841 S. Maryland Ave. Chicago IL 60637 Please include curriculum vitae in your correspondence. No phone calls or email please. The person posting this announcement is not reviewing the applicants; all email responses will be discarded. ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ -- Jim Mensch "His mind is like a steel trap -- full of mice" -- Foghorn Leghorn From owner-proteins@net.bio.net Tue Apr 20 23:00:00 1999 From: Cornelius Krasel Subject: Re: proteinase inhibitors & cell-culture Newsgroups: bionet.molbio.proteins References: <371D9728.35CE9543@mail.fgg.eur.nl> User-Agent: tin/pre-1.4-980514 (UNIX) (Linux/2.0.36 (i486)) Date: Wed, 21 Apr 1999 17:33:36 +0200 Message-ID: NNTP-Posting-Host: wpxx02.toxi.uni-wuerzburg.de Lines: 15 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!news-feed.inet.tele.dk!bofh.vszbr.cz!news.belnet.be!uni-erlangen.de!uni-wuerzburg.de!not-for-mail AZR9358 from Int 1, l293 wrote: > My concern is that these inhibitors like pepstatin, leupeptin did not > enter the cell during the preincubation step. Leupeptin appears to be cell-permeable (although I have not verified this for myself). See Moore et al., J. Cell Sci. 112 (1999), 329-338, where incubation of cells with 100 uM Leupeptin is used to inhibit degradation of the beta2-adrenergic receptor. --Cornelius. -- /* Cornelius Krasel, U Wuerzburg, Dept. of Pharmacology, Versbacher Str. 9 */ /* D-97078 Wuerzburg, Germany email: phak004@rzbox.uni-wuerzburg.de SP4 */ /* "Science is the game we play with God to find out what His rules are." */ From owner-proteins@net.bio.net Thu Apr 22 23:00:00 1999 Path: biosci!agate!newsfeed.berkeley.edu!dispose.news.demon.net!demon!colt.net!news-lond.gip.net!news.gsl.net!gip.net!tank.news.pipex.net!pipex!uunet!ams.uu.net!ffx.uu.net!in2.uu.net!news.chilesat.net!not-for-mail From: "Ingeniería de Procesos" Newsgroups: bionet.molbio.proteins Subject: vimentin purification technique Date: 23 Apr 1999 14:36:17 GMT Organization: Siderúrgica Huachipato Message-ID: <01be8d96$ec5421a0$51311fc8@ingpro5> NNTP-Posting-Host: dial-asc81.chilesat.net X-Trace: ancud.chilesat.net 924878177 2011 200.31.49.81 (23 Apr 1999 14:36:17 GMT) X-Complaints-To: usenet@chilesat.net NNTP-Posting-Date: 23 Apr 1999 14:36:17 GMT X-Newsreader: Microsoft Internet News 4.70.1162 Lines: 7 Please send me information of the most appropiate technique for vimentin purification. Also I´ll would like to obtain reference to this subject. Thanks Claudia Flores e-mail:maflor@entelchile.net From owner-proteins@net.bio.net Thu Apr 22 23:00:00 1999 Path: biosci!news.stanford.edu!newsfeed.stanford.edu!newsfeed.berkeley.edu!newspeer.monmouth.com!solomon.io.com!news.tamu.edu!not-for-mail From: Ing-Nang Wang Newsgroups: bionet.molbio.proteins Subject: crosslink between peptidoglycan and protein? Date: Fri, 23 Apr 1999 11:28:49 -0500 Organization: Texas A&M University, College Station, Texas Lines: 10 Message-ID: <37209FC1.EEF4ABC9@unix.tamu.edu> References: <19990407140917.20448.rocketmail@web215.mail.yahoo.com> Reply-To: inw0137@unix.tamu.edu NNTP-Posting-Host: cowboy.tamu.edu Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit NNTP-Posting-Date: 23 Apr 1999 16:27:10 GMT X-Mailer: Mozilla 4.05 [en] (X11; I; IRIX 6.3 IP32) Dear people: I wonder if there is any chemical out there that can be used to perform crosslinking between components of bacterial peptidoglycan and proteins? Thanks. Ing-Nang Wang Dept. of Biochem. Texas A&M University From owner-proteins@net.bio.net Fri Apr 23 23:00:00 1999 Path: biosci!newshost.lanl.gov!awabi.library.ucla.edu!128.230.129.106!news.maxwell.syr.edu!news-ge.switch.ch!news.grnet.gr!not-for-mail From: "Evangelos Christodoulou" Newsgroups: bionet.molbio.proteins Subject: Re: vimentin purification technique Date: Sat, 24 Apr 1999 15:43:57 +0300 Organization: University of Athens Lines: 115 Message-ID: <7fsebd$3cq$1@foo.grnet.gr> References: <01be8d96$ec5421a0$51311fc8@ingpro5> NNTP-Posting-Host: 195.134.83.11 Mime-Version: 1.0 Content-Type: multipart/alternative; boundary="MS_Mac_OE_3007813438_4311137_MIME_Part" X-Newsreader: Microsoft Outlook Express Macintosh Edition - 4.5 (0410) > THIS MESSAGE IS IN MIME FORMAT. Since your mail reader does not understand this format, some or all of this message may not be legible. --MS_Mac_OE_3007813438_4311137_MIME_Part Content-type: text/plain; charset="ISO-8859-1" Content-transfer-encoding: 8bit "A rapid method for the large scale purification of the intermediate filament protein vimentin by single-stranded DNA cellulose affinity chromatography" W.J. Nelson, C.E. Vorgias and P. Traub BBRC (1982), 106, 1141-1147 Evangelos -- \ \ | / / (| @ ^ @ |) | (=) | \-----/ *** ---------------------------------------------- Evangelos E. Christodoulou University of Athens Biology Department Division of Biochemistry & Molecular Biology Biochemistry laboratory Panepistimiopolis, Zographou 157 01 Athens, GREECE Tel(office): +30-1-7274510 (direct) Tel (home) : +30-1-7292770 Fax(office): +30-1-7257572 http://powermac.db.uoa.gr/~Vangelis/index.html ICQ 29601806 ---------------------------------------------- ---------- >From: "Ingeniería de Procesos" In article <01be8d96$ec5421a0$51311fc8@ingpro5>, "Ingeniería de Procesos" wrote: > Please send me information of the most appropiate technique for vimentin > purification. > Also I´ll would like to obtain reference to this subject. > > Thanks > Claudia Flores > e-mail:maflor@entelchile.net --MS_Mac_OE_3007813438_4311137_MIME_Part Content-type: text/html; charset="ISO-8859-1" Content-transfer-encoding: quoted-printable Re: vimentin purification technique "A rapid method for the large scale purification of the intermediate f= ilament protein vimentin by single-stranded DNA cellulose affinity chromatog= raphy"
W.J. Nelson, C.E. Vorgias and P. Traub
BBRC (1982), 106, 1141-1147

Evangelos

--
            &nb= sp;     \ \ | / /
            &nb= sp;    (| @ ^ @ |)
            &nb= sp;     |  (=3D)  |
            &nb= sp;      \-----/
            &nb= sp;        ***
----------------------------------------------
Evangelos E. Christodoulou
University of Athens
Biology Department
Division of Biochemistry & Molecular Biology
Biochemistry laboratory
Panepistimiopolis, Zographou
157 01 Athens, GREECE
Tel(office): +30-1-7274510 (direct)
Tel (home) : +30-1-7292770
Fax(office): +30-1-7257572
http://powermac.db.uoa.gr/~Vangelis/index.html
ICQ  29601806
----------------------------------------------


----------
>From: "Ingenier=EDa de Procesos" <cshingpro@chilesat.net>=
In article <01be8d96$ec5421a0$51311fc8@ingpro5>, "Ingenier=EDa de = Procesos" <cshingpro@chilesat.net> wrote:


> Please send me information of the most appropiate technique for viment= in
> purification.
> Also I=B4ll would like to obtain reference to this subject.
>
> Thanks
> Claudia Flores
> e-mail:maflor@entelchile.net
--MS_Mac_OE_3007813438_4311137_MIME_Part-- From owner-proteins@net.bio.net Sat Apr 24 23:00:00 1999 Path: biosci!info.co.il!info From: info@info.co.il Newsgroups: bionet.molbio.proteins Subject: You won a prize! Date: 25 Apr 1999 08:56:22 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 4 Sender: daemon@net.bio.net Distribution: world Message-ID: <199904251556.IAA19389@net.bio.net> NNTP-Posting-Host: net.bio.net Hi protein-analysis You've won a Free Web Site! Go Get It at http://www.treeway.com From owner-proteins@net.bio.net Sun Apr 25 23:00:00 1999 From: Debbie Grippaudo Newsgroups: bionet.molbio.proteins Subject: ATCC EXTREMOPHILE WORKSHOP Date: Mon, 26 Apr 1999 09:17:38 -0500 Organization: George Mason University, Fairfax, Virginia, USA Lines: 8 Message-ID: <3723CD58.DF8D35CA@ib3.gmu.edu> NNTP-Posting-Host: 129.174.206.133 Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii; x-mac-type="54455854"; x-mac-creator="4D4F5353" Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 4.5 (Macintosh; I; PPC) X-Accept-Language: en Path: biosci!news.ic.sunysb.edu!news-nysernet-16.sprintlink.net!news-east1.sprintlink.net!news-peer1.sprintlink.net!news-backup-west.sprintlink.net!n