From owner-rapd@net.bio.net Fri Jul 01 23:00:00 1994 Newsgroups: bionet.molbio.rapd Path: biosci!agate!library.ucla.edu!news.ucdavis.edu!pbmac-5.ucdavis.edu!user From: tdlong@ucdavis.edu (Tony Long) Subject: Re: QTL analysis and variance of categorized data Message-ID: Followup-To: bionet.molbio.rapd Sender: usenet@ucdavis.edu (News Guru) Organization: Center for Population Biology References: <45334.jerbear@uxa.cso.uiuc.edu> Date: Sat, 2 Jul 1994 16:53:19 GMT Lines: 35 > In Message 1 Jul 1994 08:12:00 -0700, > MAL5@cornell.edu (Muhammad A. Lodhi) writes: > > > >In MAPMAKER/QTL we get variance explained for each QTL peak. My colleague > >says that variance can't be calculated in categorized data of a trait. > > > >My questions are; > >Whether he is right when he says that assigning a number to a trait like > >colors is not correct. Also whether his concern over the variance values > >is right? > I agree with your colleague and an earlier poster that it does not make sense to treat a categorical variable as a continuous variable, in MAPMAKER or any other regression technique. In fact you have a much simpler problem, analogous to mapping "mendelian" genes as opposed to QTL's. I suggest you write some SAS code to do a Chi-square analysis for each interval in your data, and use your p-values as support. For example: genotype AA Aa aa Colour red N1 N2 N3 blue etc ... where the N's are the number of observations in each class. If there is a QTL in the interval then you would expect a significant Chi-square. It should be fairly easy to modify this to incorporate intervals in which one or both chromatids are recombinant in the interval, although if you have a dense map you may not have to do this. Tony Long Center for Population Biology U. C. Davis Davis, CA tdlong@ucdavis.edu From owner-rapd@net.bio.net Sun Jul 03 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!pipex!uknet!bhamcs!bham!bcs88.bham.ac.uk!user From: A.C.Hilton@bham.ac.uk (Wiggy) Newsgroups: bionet.molbio.rapd Subject: Re: How long is the DNA we shold have in the rapd reaction? Followup-To: bionet.molbio.rapd Date: 4 Jul 1994 13:51:54 GMT Organization: University of Birmingham Lines: 30 Distribution: world Message-ID: References: <199407010353.UAA22645@net.bio.net> NNTP-Posting-Host: bcs88.bham.ac.uk In article <199407010353.UAA22645@net.bio.net>, FJUT042%TWNMOE10.BITNET@PUCC.PRINCETON.EDU (Josh Huang) wrote: > Dear netter: > > Rogers said "DNA 50-100kb in length can be obten without great > care being taken".(Plant Molcular Biology Manual A6: 1-10 (1988).) > > But how much infomation of the genome is there in the 50-100 kb > fragements? Does it contrain the most of the pattens that we could > obtain in the rapd reaction? If not, what length of the DNA we should > have? > > Several days ago I got an info, it said that if the length of > DNA is longer then 50 kb, the genome DNA that we seperated would > carry above 99% of the inforamtions that genome should have. > I do not know if it is right. If it is right, is there any reference? > > Any command is appreciated? > > > > Josh Huang > Fu Jen Univesity > Taiwan R.O.C. > fjus243@twnmoe10.edu.tw Well, I don't know about everyone else, but I'm confused!!!! From owner-rapd@net.bio.net Mon Jul 04 23:00:00 1994 Path: biosci!galaxy.ucr.edu!ihnp4.ucsd.edu!swrinde!gatech!howland.reston.ans.net!EU.net!uknet!bhamcs!bham!bcs88.bham.ac.uk!user From: A.C.Hilton@bham.ac.uk (Wiggy) Newsgroups: bionet.molbio.rapd Subject: Re: Separation of small DNA fragments Followup-To: bionet.molbio.rapd Date: 5 Jul 1994 16:36:25 GMT Organization: University of Birmingham Lines: 18 Message-ID: References: NNTP-Posting-Host: bcs88.bham.ac.uk In article , Ola.Karen@mykopat.slu.se (Ola Karen) wrote: > We have problems separating small DNA-fragments (75 to 400 bases) on agarose > gels. They will not show up sharp. Also the molecular weight markers will > not run even on both sides of the gel. Does anyone have a good solution for > this? > > Thanks in advance! > > Ola Krn What percentage agarose gels are you running? A 0.5% agarose gel separates well in the 30 bp - 1 kb range, maybe this will help. Wiggy. From owner-rapd@net.bio.net Mon Jul 04 23:00:00 1994 Path: biosci!galaxy.ucr.edu!ihnp4.ucsd.edu!swrinde!howland.reston.ans.net!EU.net!sunic!columba.udac.uu.se!populus.slu.se!mykodat!Ola.Karen From: Ola.Karen@mykopat.slu.se (Ola Karen) Newsgroups: bionet.molbio.rapd Subject: Separation of small DNA fragments Date: Tue, 5 Jul 1994 15:20:00 Organization: Department of Forest Mycology and Pathology, Swedish Univ. of Agr. Sciences Lines: 8 Message-ID: NNTP-Posting-Host: mykopat.mykopat.slu.se X-Newsreader: Trumpet for Windows [Version 1.0 Rev A] We have problems separating small DNA-fragments (75 to 400 bases) on agarose gels. They will not show up sharp. Also the molecular weight markers will not run even on both sides of the gel. Does anyone have a good solution for this? Thanks in advance! Ola Kårén From owner-rapd@net.bio.net Mon Jul 04 23:00:00 1994 Path: biosci!ABRSLE.AGR.CA!HACHEY From: HACHEY@ABRSLE.AGR.CA (john hachey) Newsgroups: bionet.molbio.rapd Subject: Re: Separation of small dna Date: 5 Jul 1994 12:12:14 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 42 Sender: daemon@net.bio.net Distribution: world Message-ID: <01HECNQJ6WYA000950@GW.AGR.CA> NNTP-Posting-Host: net.bio.net Date sent: 5-JUL-1994 13:00:22 >From: OTTGW::IN%"rapr@med.pitt.edu" 5-JUL-1994 12:19:43.00 >To: IN%"rapd@net.bio.net" >CC: >Subj: RE: Separation of small DNA fragments (fwd) > >Forwarded message: >> In article , Ola.Karen@mykopat.slu.se >> (Ola Karen) wrote: >> > We have problems separating small DNA-fragments (75 to 400 bases) on agarose >> > gels. They will not show up sharp. Also the molecular weight markers will >> > not run even on both sides of the gel. Does anyone have a good solution for >> > this? >> > Thanks in advance! >> > Ola Krn >> >> What percentage agarose gels are you running? >> A 0.5% agarose gel separates well in the 30 bp - 1 kb range, maybe this >> will help. >> Wiggy. >> >Excuse me, but 0.5% agarose is totally useless for 30bp-1kb. Check it out >in any standard protocols book if you don't believe me. For 75-400 bases, >acrylamide is a hundred times better than any kind of agarose for resolution. >Rob >rapr@med.pitt.edu.check.your.decimal.point.position.for.cripes.sake.wiggy Some new agaroses can work in this size range. Sigma's Wide Range agarose, FMC's Metaphor agarose and Diversified Biotech's Synergel are useful non-toxic alternatives to polacrylamide. ---------------------------------------------------------------------------- | John E. Hachey * Telephone : (403)327-4561 | | Agriculture Canada * Fax : (403)382-3156 | | Research Station * Email : hachey@abrsle.agr.ca | | P.O. Box 3000, Main * | | Lethbridge, AB * Everything in Moderation, | | Canada * Including Moderation | | T1J 4B1 * | |****************************************************************************| | DISCLAIMER : BUT THEN AGAIN, I LIKED HEE HAW | | | ---------------------------------------------------------------------------- From owner-rapd@net.bio.net Mon Jul 04 23:00:00 1994 Path: biosci!MED.PITT.EDU!rapr From: rapr@MED.PITT.EDU (Robert Preston) Newsgroups: bionet.molbio.rapd Subject: Re: Separation of small DNA fragments (fwd) Date: 5 Jul 1994 11:12:04 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 21 Sender: daemon@net.bio.net Distribution: world Message-ID: <9407051812.AA07838@deimos.med.pitt.edu> NNTP-Posting-Host: net.bio.net Forwarded message: > In article , Ola.Karen@mykopat.slu.se > (Ola Karen) wrote: > > We have problems separating small DNA-fragments (75 to 400 bases) on agarose > > gels. They will not show up sharp. Also the molecular weight markers will > > not run even on both sides of the gel. Does anyone have a good solution for > > this? > > Thanks in advance! > > Ola Krn > > What percentage agarose gels are you running? > A 0.5% agarose gel separates well in the 30 bp - 1 kb range, maybe this > will help. > Wiggy. > Excuse me, but 0.5% agarose is totally useless for 30bp-1kb. Check it out in any standard protocols book if you don't believe me. For 75-400 bases, acrylamide is a hundred times better than any kind of agarose for resolution. Rob rapr@med.pitt.edu.check.your.decimal.point.position.for.cripes.sake.wiggy From owner-rapd@net.bio.net Tue Jul 05 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!pipex!lyra.csx.cam.ac.uk!doc.ic.ac.uk!warwick!bham!bcs88.bham.ac.uk!user From: A.C.Hilton@bham.ac.uk (Wiggy) Newsgroups: bionet.molbio.rapd Subject: Re: Separation of small DNA fragments (fwd) Followup-To: bionet.molbio.rapd Date: 6 Jul 1994 09:45:17 GMT Organization: University of Birmingham Lines: 32 Distribution: world Message-ID: References: <9407051812.AA07838@deimos.med.pitt.edu> NNTP-Posting-Host: bcs88.bham.ac.uk In article , A.C.Hilton@bham.ac.uk (Wiggy) wrote: > In article <9407051812.AA07838@deimos.med.pitt.edu>, rapr@MED.PITT.EDU > (Robert Preston) wrote: > > > Forwarded message: > > > In article , Ola.Karen@mykopat.slu.se > > > (Ola Karen) wrote: > > > > We have problems separating small DNA-fragments (75 to 400 bases) on agarose > > > > gels. They will not show up sharp. Also the molecular weight markers will > > > > not run even on both sides of the gel. Does anyone have a good solution for > > > > this? > > > > Thanks in advance! > > > > Ola Krn > > > > > > What percentage agarose gels are you running? > > > A 0.5% agarose gel separates well in the 30 bp - 1 kb range, maybe this > > > will help. > > > Wiggy. > > > > > Excuse me, but 0.5% agarose is totally useless for 30bp-1kb. Check it out > > in any standard protocols book if you don't believe me. For 75-400 bases, > > acrylamide is a hundred times better than any kind of agarose for resolution. > > Rob > > rapr@med.pitt.edu.check.your.decimal.point.position.for.cripes.sake.wiggy > > Fair enough maybe the phrase "separates well" is not the best way to > describe it. I agree that acrylamide is far superior to agarose in the > smaller fragment range but if you care to look again at the original > question you will see it refers to agarose and so therefore did my > suggestion. P.S. I actually meant 1.5% not 0.5%.......sorry. From owner-rapd@net.bio.net Tue Jul 05 23:00:00 1994 Path: biosci!galaxy.ucr.edu!ihnp4.ucsd.edu!usc!howland.reston.ans.net!pipex!warwick!bham!bcs88.bham.ac.uk!user From: A.C.Hilton@bham.ac.uk (Wiggy) Newsgroups: bionet.molbio.rapd Subject: Re: Separation of small DNA fragments (fwd) Followup-To: bionet.molbio.rapd Date: 6 Jul 1994 09:37:24 GMT Organization: University of Birmingham Lines: 29 Distribution: world Message-ID: References: <9407051812.AA07838@deimos.med.pitt.edu> NNTP-Posting-Host: bcs88.bham.ac.uk In article <9407051812.AA07838@deimos.med.pitt.edu>, rapr@MED.PITT.EDU (Robert Preston) wrote: > Forwarded message: > > In article , Ola.Karen@mykopat.slu.se > > (Ola Karen) wrote: > > > We have problems separating small DNA-fragments (75 to 400 bases) on agarose > > > gels. They will not show up sharp. Also the molecular weight markers will > > > not run even on both sides of the gel. Does anyone have a good solution for > > > this? > > > Thanks in advance! > > > Ola Krn > > > > What percentage agarose gels are you running? > > A 0.5% agarose gel separates well in the 30 bp - 1 kb range, maybe this > > will help. > > Wiggy. > > > Excuse me, but 0.5% agarose is totally useless for 30bp-1kb. Check it out > in any standard protocols book if you don't believe me. For 75-400 bases, > acrylamide is a hundred times better than any kind of agarose for resolution. > Rob > rapr@med.pitt.edu.check.your.decimal.point.position.for.cripes.sake.wiggy Fair enough maybe the phrase "separates well" is not the best way to describe it. I agree that acrylamide is far superior to agarose in the smaller fragment range but if you care to look again at the original question you will see it refers to agarose and so therefore did my suggestion. From owner-rapd@net.bio.net Tue Jul 05 23:00:00 1994 Path: biosci!galaxy.ucr.edu!ihnp4.ucsd.edu!usc!cs.utexas.edu!howland.reston.ans.net!vixen.cso.uiuc.edu!newsfeed.ksu.ksu.edu!moe.ksu.ksu.edu!crcnis1.unl.edu!unlinfo.unl.edu!aszalans From: aszalans@unlinfo.unl.edu (allen szalanski) Newsgroups: bionet.molbio.rapd Subject: Re: Separation of small DNA fragments Date: 6 Jul 1994 17:53:00 GMT Organization: University of Nebraska--Lincoln Lines: 37 Message-ID: <2ver1s$oli@crcnis1.unl.edu> References: NNTP-Posting-Host: unlinfo.unl.edu X-Newsreader: TIN [version 1.2 PL2] Wiggy (A.C.Hilton@bham.ac.uk) wrote: : In article , Ola.Karen@mykopat.slu.se : (Ola Karen) wrote: : > We have problems separating small DNA-fragments (75 to 400 bases) on agarose : > gels. They will not show up sharp. Also the molecular weight markers will : > not run even on both sides of the gel. Does anyone have a good solution for : > this? : > : > Thanks in advance! : > : > Ola Krn : What percentage agarose gels are you running? : A 0.5% agarose gel separates well in the 30 bp - 1 kb range, maybe this : will help. : Wiggy. In our lab a minimum of a 3% agarose gel is need to see fragments down to 100 bp. We use agarose gels only for verification of amplification. A 8 to 12 percent polyacrylamide gel will give good resolution down to 20 bp and this is with ethidium bromide staining. Plus the acrylamide gels, we use Hoefer SE 600 system, only take 1.5 hours to run at 300 volts. Allen Szalanski Dept. Entomology University of Nebraska-Lincoln entm029@unlvm.unl.edu From owner-rapd@net.bio.net Tue Jul 05 23:00:00 1994 Path: biosci!galaxy.ucr.edu!ihnp4.ucsd.edu!swrinde!news.uh.edu!oac4.hsc.uth.tmc.edu!oac4.hsc.uth.tmc.edu!krg From: krg@utmdacc.mda.uth.tmc.edu (Karen Gravitt) Newsgroups: bionet.molbio.rapd Subject: Quantitation of Oligo Date: Wed, 6 Jul 1994 11:13:25 Organization: University of Texas Health Science Center Lines: 8 Message-ID: NNTP-Posting-Host: cellbio05.mda.uth.tmc.edu X-Newsreader: Trumpet for Windows [Version 1.0 Rev A] Hello Everyone!! I need to determine the concentration of my synthesized oligo (20mer). I know I need to read the absorbance at 260nm but I'm not sure what to do beyond that. Thanks in advance, Karen From owner-rapd@net.bio.net Wed Jul 06 23:00:00 1994 Newsgroups: bionet.molbio.rapd Path: biosci!agate!spool.mu.edu!torn!utnut!utcsri!newsflash.concordia.ca!sifon!clouso.crim.ca!athena.ulaval.ca!dietcola.rsvs.ulaval.ca!user From: lsimon@alnus.for.ulaval.ca (Luc Simon) Subject: Re: Quantitation of Oligo Content-Type: text/plain; charset=ISO-8859-1 Message-ID: Followup-To: bionet.molbio.rapd Sender: news@athena.ulaval.ca Nntp-Posting-Host: dietcola.rsvs.ulaval.ca Content-Transfer-Encoding: 8bit Organization: Universite Laval References: Mime-Version: 1.0 Date: Thu, 7 Jul 1994 01:37:18 GMT Lines: 16 In article , krg@utmdacc.mda.uth.tmc.edu (Karen Gravitt) wrote: > I need to determine the concentration of my synthesized oligo (20mer). I know > I need to read the absorbance at 260nm but I'm not sure what to do beyond that. > A 1mL solution of oligo that has 260nm DO of 1.0 contains 33 micrograms of that oligo. From that calculate what you have! -- Luc Simon 1125 pav. Marchand Universite Laval (418) 656-5496 Sainte-Foy, Que (418) 656-7176 fax G1K 7P4 lsimon@rsvs.ulaval.ca From owner-rapd@net.bio.net Wed Jul 06 23:00:00 1994 Path: biosci!DEAKIN.EDU.AU!huangbx From: huangbx@DEAKIN.EDU.AU Newsgroups: bionet.molbio.rapd Subject: Where can I get M13 sequence? Date: 6 Jul 1994 21:32:37 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 12 Sender: daemon@net.bio.net Distribution: world Message-ID: <199407070432.OAA06959@sol.ccs.deakin.edu.au> NNTP-Posting-Host: net.bio.net Greetings netters, Could someone over there direct me to the place to ftp or gopher phage M13 sequence? Or if someone has the sequence, could you email it to me please? Many thanks. With regards. Bixing Huang huangbx@deakin.edu.au From owner-rapd@net.bio.net Wed Jul 06 23:00:00 1994 Path: biosci!esvax.dnet.dupont.com!rafalski From: rafalski@esvax.dnet.dupont.com Newsgroups: bionet.molbio.rapd Subject: Agarose gel resolution Date: 7 Jul 1994 04:20:51 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 9 Sender: daemon@net.bio.net Distribution: world Message-ID: <9407071117.AA07014@esds01.es.dupont.com> NNTP-Posting-Host: net.bio.net Re: Resolution of small fragments on agarose gels: We use NuSieve and Metaphor agarose (FMC) for separating amplified plant microsatelites (simple sequence repeats) - fragments in the range of 90-150 bp. can be resolved if they differ by 4 bp, or even 2 bp (in this case resolve means being able to distinguish either homozygote from the heterozygote in a segregating population). Check FMC catalog for conditions. Antoni Rafalski From owner-rapd@net.bio.net Thu Jul 07 23:00:00 1994 Path: biosci!CAT.OHIOLINK.EDU!intbgu From: intbgu@CAT.OHIOLINK.EDU (/usr/spool/mail/intbgu) Newsgroups: bionet.molbio.rapd Subject: please subscribe me Date: 8 Jul 1994 10:24:36 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 18 Sender: daemon@net.bio.net Distribution: world Message-ID: <9407081725.AA16051@cat.ohiolink.edu> NNTP-Posting-Host: net.bio.net >From BIOSCI-REQUEST Tue May 10 07:41:00 1994 Return-Path: BIOSCI-REQUEST Received: (from daemon@localhost) by net.bio.net (8.6.8.1/8.6.6) id HAA09781 for rapd-list; Tue, 10 May 1994 07:41:00 -0700 Received: (from news@localhost) by net.bio.net (8.6.8.1/8.6.6) id HAA09777 for rapd-arpanet; Tue, 10 May 1994 07:40:59 -0700 To: rapd@net.bio.net From: huangb@phibred.com (Bin Huang (905)8464446) Subject: please subscribe me Date: 10 May 1994 07:40:57 -0700 Sender: daemon@net.bio.net Message-ID: <9405101447.AA16774@gw1.phibred.com> NNTP-Posting-Host: net.bio.net Please subscribe. HUANGB@PHIBRED.COM From owner-rapd@net.bio.net Fri Jul 08 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!usc!nic-nac.CSU.net!charnel.ecst.csuchico.edu!rat!decwrl!tribune.usask.ca!canopus.cc.umanitoba.ca!norton!frist From: frist@ccu.umanitoba.ca () Newsgroups: bionet.molbio.rapd Subject: Re: Quantitation of Oligo (correction) Date: 9 Jul 1994 22:07:38 GMT Organization: The Univeristy of Manitoba. Lines: 16 Distribution: world Message-ID: <2vn73a$6tu@canopus.cc.umanitoba.ca> References: <2vn60t$38p@canopus.cc.umanitoba.ca> Reply-To: frist@cc.umanitoba.ca NNTP-Posting-Host: norton.cc.umanitoba.ca In article 38p@canopus.cc.umanitoba.ca, frist@cc.umanitoba.ca () writes: > Knowing the molar extinction coefficient, you can calculate the mass of ^ | should be "amount in nanomoles" mass isn't particularly useful here > oligonucleotide in a sample by the formula > > C(nmol) = OD/E' x 1000 nmol/umol > Brian Fristensky From owner-rapd@net.bio.net Fri Jul 08 23:00:00 1994 Path: biosci!agate!library.ucla.edu!csulb.edu!nic-nac.CSU.net!charnel.ecst.csuchico.edu!rat!decwrl!tribune.usask.ca!canopus.cc.umanitoba.ca!norton!frist From: frist@cc.umanitoba.ca () Newsgroups: bionet.molbio.rapd Subject: Re: Quantitation of Oligo Date: 9 Jul 1994 21:49:17 GMT Organization: The Univeristy of Manitoba. Lines: 62 Distribution: world Message-ID: <2vn60t$38p@canopus.cc.umanitoba.ca> References: Reply-To: frist@cc.umanitoba.ca NNTP-Posting-Host: norton.cc.umanitoba.ca In article 060794213602@dietcola.rsvs.ulaval.ca, lsimon@alnus.for.ulaval.ca (Luc Simon) writes: > A 1mL solution of oligo that has 260nm DO of 1.0 contains 33 micrograms of > that oligo. From that calculate what you have! > -- > Luc Simon > 1125 pav. Marchand > Universite Laval (418) 656-5496 > Sainte-Foy, Que (418) 656-7176 fax > G1K 7P4 > > lsimon@rsvs.ulaval.ca Actually, you need to calculate the molar extinction coefficient E' for any given oligo. n --- \ E' = / E --- i i=1 where E is the molar extinction coefficient at position i in an oligonucleotide i -1 of length n. E =15.4, E =11.7, E =7.3, E =8.8 (umole ). For degenerate a g c t nucleotides, take the average of the components eg. E = (E + E )/2. w a t Knowing the molar extinction coefficient, you can calculate the mass of oligonucleotide in a sample by the formula C(nmol) = OD/E' x 1000 nmol/umol To show why you have to do this, let's compare the E' values for two 21-mers sequence E' ----------------------------------- aattccaaacaagagaaagcc 258.6 catcccccttagctttgtcag 201.3 This example compares two PCR primers used in our lab, whose actual concentrations would differ by over 28% if sequence had not been taken into account. =============================================================================== Brian Fristensky | Department of Plant Science | A question is like a knife that slices University of Manitoba | through the stage backdrop and gives us Winnipeg, MB R3T 2N2 CANADA | a look at what lies hidden behind. frist@cc.umanitoba.ca | Office phone: 204-474-6085 | Milan Kundera, THE UNBEARABLE LIGHTNESS FAX: 204-261-5732 | OF BEING =============================================================================== From owner-rapd@net.bio.net Sat Jul 09 23:00:00 1994 Path: biosci!CORNELL.EDU!MAL5 From: MAL5@CORNELL.EDU (Muhammad A. Lodhi) Newsgroups: bionet.molbio.rapd Subject: Summary: QTL analysis and variance of categorized data Date: 10 Jul 1994 08:56:41 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 67 Sender: daemon@net.bio.net Distribution: world Message-ID: <199407101557.LAA02290@postoffice.mail.cornell.edu> NNTP-Posting-Host: net.bio.net Here are couple of the messages that I received in reply to my posting. Thought it might be useful for others. Further comments are welcome and appreciated. Thanks Muhammad Lodhi > Dear Friends: > I had a discussion with a colleague of mine about the QTL analysis (through > MAPMAKER/QTL) of data that was divided into 4-5 categories instead of > continuous figures. The data was related with, say fruit color. I divided > the data into four arbitrary categories and gave a number to each category > for analysis purposes, e.g., 1=green, 2=pinkish green, 3=brownish green and > 4=purple. His concern is related with giving 1 to green, 4 to purple and > so on. He says how can we say that green is 1 and not 4. > Your friend was wrong. You use 1 to 4 to represent different catgories of color, just as a plant pathologist characterizes the disease severity (say, 1=resistant, 2= medium, 3=susceptable). For a genetic analysis, you are not interested in these catigories per se, but in their FREQUENCIES in a population (cross). Therefore, the use of number symbols instead of color descriptors is a convenience and doesn't alter the nature of your data. > In MAPMAKER/QTL we get variance explained for each QTL peak. My colleague > says that variance can't be calculated in categorized data of a trait. > He was wrong again! You can calculate the variance for any variables, both continuous and catigorical. I believe his real concern in this case was that the categorized data you used for QTL analysis were not normally distributed. The normality is required for quantitative genetic analysis. For a categorical trait, such as your fruit color, you may want to consider some data transformations in order to make your data close to the normality. Hope this will help. Rong-Cai Yang University of Alberta ryang@gpu.srv.ualberta.ca ---------------------------------------------------------------------------- ---- I agree with your colleague and an earlier poster that it does not make sense to treat a categorical variable as a continuous variable, in MAPMAKER or any other regression technique. In fact you have a much simpler problem, analogous to mapping "mendelian" genes as opposed to QTL's. I suggest you write some SAS code to do a Chi-square analysis for each interval in your data, and use your p-values as support. For example: genotype AA Aa aa Colour red N1 N2 N3 blue etc ... where the N's are the number of observations in each class. If there is a QTL in the interval then you would expect a significant Chi-square. It should be fairly easy to modify this to incorporate intervals in which one or both chromatids are recombinant in the interval, although if you have a dense map you may not have to do this. Tony Long Center for Population Biology U. C. Davis Davis, CA tdlong@ucdavis.edu -------------------------------------------------------------------------------- From owner-rapd@net.bio.net Sun Jul 10 23:00:00 1994 Path: biosci!UXA.CSO.UIUC.EDU!jerbear From: jerbear@UXA.CSO.UIUC.EDU ("Jerry Hill") Newsgroups: bionet.molbio.rapd Subject: RE: RAPDs and Southerns Date: 11 Jul 1994 08:37:44 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 29 Sender: daemon@net.bio.net Distribution: world Message-ID: <38313.jerbear@uxa.cso.uiuc.edu> Reply-To: jerbear@uxa.cso.uiuc.edu NNTP-Posting-Host: net.bio.net In Message 11 Jul 1994 06:23:45 -0700, cushwa@CHARLY.UCDAVIS.EDU writes: > >I have cloned several RAPD fragments and I would like to use them as probes for >Southerns. I would certainly appreciate any information (e.g. protocols, >advice, etc.) that anyone could provide, using either isotopic or nonisotopic >methods. > This is very straight forward and works whether the insert is a RAPD fragment, cDNA clone, or sequence derived from any other source. We cut the insert out of the plasmid with the appropriate restriction enzymes and separate the fragments on a regular agarose gel. After cutting the desired band out of the gel, it can be used as is or purified by any number of means before using in the labeling reaction. We have used primarily USB's random primer labeling kit and protocol (mainly because we can get it on campus) with excellent results. To use the agarose gel band as is, you must heat the reaction mixture to above above 60 C to melt the agarose. That's no big deal, though, since you have to heat it to 95 C to denature the probe DNA anyway. Follow the instructions that come with the whatever brand of random primer labeling kit you buy and you shouldn't have any trouble. We have mainly made radioactive labels but the same kit can be used for biotin/avidin labels and probably other non-radioactive labels as well. Of course there are dozens and dozens of modifications to the blotting, prehybridization, hybridization, and washing conditions. It's much harder to give general advice in this area than in probe construction. Some of these will depend on the brand of nitrocellulose or nylon blotting paper you are using. Some will depend on the size of the probe and the degree of homology that you expect. From owner-rapd@net.bio.net Sun Jul 10 23:00:00 1994 Path: biosci!CHARLY.UCDAVIS.EDU!cushwa From: cushwa@CHARLY.UCDAVIS.EDU Newsgroups: bionet.molbio.rapd Subject: RAPDs and Southerns Date: 11 Jul 1994 06:23:45 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 13 Sender: daemon@net.bio.net Distribution: world Message-ID: <0098140D.E6EDE360.32066@charly.ucdavis.edu> NNTP-Posting-Host: net.bio.net July 11, 1994 I have cloned several RAPD fragments and I would like to use them as probes for Southerns. I would certainly appreciate any information (e.g. protocols, advice, etc.) that anyone could provide, using either isotopic or nonisotopic methods. Thanks, Willy Cushwa wtcushwa@ucdavis.edu From owner-rapd@net.bio.net Sun Jul 10 23:00:00 1994 Path: biosci!UXA.CSO.UIUC.EDU!jerbear From: jerbear@UXA.CSO.UIUC.EDU ("Jerry Hill") Newsgroups: bionet.molbio.rapd Subject: RE: Summary: QTL analysis and variance of categorized data Date: 11 Jul 1994 08:03:26 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 53 Sender: daemon@net.bio.net Distribution: world Message-ID: <36233.jerbear@uxa.cso.uiuc.edu> Reply-To: jerbear@uxa.cso.uiuc.edu NNTP-Posting-Host: net.bio.net In Message 10 Jul 1994 08:56:41 -0700, MAL5@CORNELL.EDU (Muhammad A. Lodhi) writes: >Here are couple of the messages that I received in reply to my posting. >Your friend was wrong. You use 1 to 4 to represent different catgories >of color, just as a plant pathologist characterizes the disease severity >(say, 1=resistant, 2= medium, 3=susceptable). For a genetic analysis, >you are not interested in these catigories per se, but in their FREQUENCIES >in a population (cross). Therefore, the use of number symbols instead of >color descriptors is a convenience and doesn't alter the nature of your data. Yes, as long as you don't want to do any statistics with them. >He was wrong again! You can calculate the variance for any variables, >both continuous and catigorical. I believe his real concern in this case >was that the categorized data you used for QTL analysis were not normally >distributed. The normality is required for quantitative genetic >analysis. For a categorical trait, such as your fruit color, you may >want to consider some data transformations in order to make your data >close to the normality. I differ significantly with Mr. Yang: First, a pathologist's designation of disease severity with a numerical code is simply a reduction of a quantitative character to a reduced set of classes, each represented by a number that corresponds monotonically to the actual disease severity. He could just as well measure the % of necrotic leaf area, or the number of lesions per unit area, or the % of affected plants. However, most of these types of measurements are time consuming and difficult to make for large field plots or a large number of samples. Most plant pathologists I know can give a fairly good disease severity estimate in the manner suggested because of their experience but they will acknowledge that the process is as subjective as it is useful. So, with disease severity ratings being modified class marks for actual numerical estimates, it makes sense to do statistical analysis on those numbers. Assigning a number to colors (unless you do it in a manner such as I suggested to Lodhi) and the statistics derived from it are meaningless (except for frequency, as Yang and Long suggested). You can calculate all kinds of statistics and comparisons for any set of numbers and do all the analyses on them that you want, but this does not guarantee they will mean anything. No amount of transformation on an ARBITRARY set of color numbers will turn them into PROPER quantitative variables that are normally distributed. Again, as I suggested to Lodhi earlier, picture what would happen to the statistics and distributions if you used color class values of 1, 10, 100, 1000, etc. If you want to use frequency of classes and do a chi-square analysis, as Long suggested, great! But you should NOT do means/variance analysis on such numbers. In fact, to do the chi-square analysis, you don't need to use a number to designate the color class -- leave it as a word descriptor. Jerry Hill From owner-rapd@net.bio.net Mon Jul 11 23:00:00 1994 Path: biosci!GPU.SRV.UALBERTA.CA!ryang From: ryang@GPU.SRV.UALBERTA.CA (Rong Yang) Newsgroups: bionet.molbio.rapd Subject: RE: Summary: QTL analysis and variance of categorized data Date: 12 Jul 1994 13:06:58 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 66 Sender: daemon@net.bio.net Distribution: world Message-ID: References: <36233.jerbear@uxa.cso.uiuc.edu> NNTP-Posting-Host: net.bio.net On 11 Jul 1994, Jerry Hill wrote: > > In Message 10 Jul 1994 08:56:41 -0700, > MAL5@CORNELL.EDU (Muhammad A. Lodhi) writes: > > >Here are couple of the messages that I received in reply to my posting. > > >Your friend was wrong. You use 1 to 4 to represent different catgories > >of color, just as a plant pathologist characterizes the disease severity > >(say, 1=resistant, 2= medium, 3=susceptable). For a genetic analysis, > >you are not interested in these catigories per se, but in their FREQUENCIES > >in a population (cross). Therefore, the use of number symbols instead of > >color descriptors is a convenience and doesn't alter the nature of your data. > > Yes, as long as you don't want to do any statistics with them. > > >He was wrong again! You can calculate the variance for any variables, > >both continuous and catigorical. I believe his real concern in this case > >was that the categorized data you used for QTL analysis were not normally > >distributed. The normality is required for quantitative genetic > >analysis. For a categorical trait, such as your fruit color, you may > >want to consider some data transformations in order to make your data > >close to the normality. > > I differ significantly with Mr. Yang: > > First, a pathologist's designation of disease severity with a numerical > code is simply a reduction of a quantitative character to a reduced set of > classes, each represented by a number that corresponds monotonically to the > actual disease severity. He could just as well measure the % of necrotic > leaf area, or the number of lesions per unit area, or the % of affected > plants. However, most of these types of measurements are time consuming > and difficult to make for large field plots or a large number of samples. > Most plant pathologists I know can give a fairly good disease severity > estimate in the manner suggested because of their experience but they will > acknowledge that the process is as subjective as it is useful. So, with > disease severity ratings being modified class marks for actual numerical > estimates, it makes sense to do statistical analysis on those numbers. > Assigning a number to colors (unless you do it in a manner such as I > suggested to Lodhi) and the statistics derived from it are meaningless > (except for frequency, as Yang and Long suggested). > > You can calculate all kinds of statistics and comparisons for any set of > numbers and do all the analyses on them that you want, but this does not > guarantee they will mean anything. No amount of transformation on an > ARBITRARY set of color numbers will turn them into PROPER quantitative > variables that are normally distributed. Again, as I suggested to Lodhi > earlier, picture what would happen to the statistics and distributions if > you used color class values of 1, 10, 100, 1000, etc. If you want to use > frequency of classes and do a chi-square analysis, as Long suggested, great! > But you should NOT do means/variance analysis on such numbers. In fact, to > do the chi-square analysis, you don't need to use a number to designate the > color class -- leave it as a word descriptor. > > Jerry Hill > > Hi, Jerry: I see your point, but my response was mainly the response to the statement " ... variance can't be calculated in categorized data of a trait ...". Anyhow, let's take Long's suggestion and do much simpler genetic analysis based on FREQUENCIES of different fruit colors, which we all agree upon. Rong-Cai Yang From owner-rapd@net.bio.net Mon Jul 11 23:00:00 1994 Newsgroups: bionet.molbio.rapd Path: biosci!galaxy.ucr.edu!ihnp4.ucsd.edu!usc!nic-nac.CSU.net!charnel.ecst.csuchico.edu!olivea!uunet!news.unr.edu!hoelzer.biology.unr.edu!user From: hoelzer@unr.edu (Dr. Guy Hoelzer) Subject: Microsatellite primers for lagomorphs? Message-ID: Followup-To: bionet.molbio.rapd Sender: usenet@news.unr.edu (USENET News Administration) Organization: Biology Department Date: Tue, 12 Jul 1994 16:51:23 GMT Lines: 14 A colleage of mine, Mary Peacock, is seeking information on primers that amplify Simple-Sequence-Repeats in lagomorphs. She is working specifically on pikas, but it would certainly be worth trying primers developed for rabbits. Please contact me directly by e-mail if you have any relevant information. ****************************************************************************** Guy Hoelzer hoelzer@unr.edu Dept. of Biology University of Nevada Reno Reno, NV 89557 ****************************************************************************** From owner-rapd@net.bio.net Mon Jul 11 23:00:00 1994 Path: biosci!agate!library.ucla.edu!psgrain!ee.und.ac.za!inet.up.ac.za!ccnet.up.ac.za!laurie From: laurie@ccnet.up.ac.za Newsgroups: bionet.molbio.rapd Subject: test Date: Mon, 11 Jul 1994 14:48:27 GMT Organization: University of Pretoria Lines: 1 Message-ID: NNTP-Posting-Host: 137.215.128.189 test From owner-rapd@net.bio.net Mon Jul 11 23:00:00 1994 Path: biosci!daresbury!trane.uninett.no!eunet.no!nuug!EU.net!uunet!world!news.mtholyoke.edu!news.umass.edu!nic.umass.edu!usenet From: AAT@UCSVAX.UCS.UMASS.EDU (Gus Trautweiler) Newsgroups: bionet.molbio.rapd Subject: RE: RAPDs and Southerns Date: 12 Jul 1994 14:01:23 GMT Organization: University of Massachusetts Lines: 18 Distribution: world Message-ID: <2vu7nj$lig@nic.umass.edu> References: <38313.jerbear@uxa.cso.uiuc.edu> NNTP-Posting-Host: phobos.ucs.umass.edu X-News-Reader: VMS NEWS v1.25 In-Reply-To: jerbear@UXA.CSO.UIUC.EDU's message of 11 Jul 1994 08:37:44 -0700 In <38313.jerbear@uxa.cso.uiuc.edu> jerbear@UXA.CSO.UIUC.EDU writes: -SNIP- :Q To use the agarose gel band as is, you must heat the :Q reaction mixture to above above 60 C to melt the agarose. That's no big :Q deal, though, since you have to heat it to 95 C to denature the probe DNA :Q anyway. If using a sefadex column to separate probe and unincorporated bases, heat the tracking dye and chase buffer. This prevents the agarose from solidifying in the column. #######################* *##* *##* *##* *##* Gus Trautweiler | | | # # | | # # | | # # | | # # | | Plant & Soil Science Dept: Biotechnology| | | | # | | | | # | | | University of Massachusetts # | | # # | | # # | | # # | | AAT@BIO.UMASS.EDU *##* *##* *##* *##* *##* From owner-rapd@net.bio.net Mon Jul 11 23:00:00 1994 Path: biosci!UXA.CSO.UIUC.EDU!jerbear From: jerbear@UXA.CSO.UIUC.EDU ("Jerry Hill") Newsgroups: bionet.molbio.rapd Subject: RE: Summary: QTL analysis and variance of categorized data Date: 12 Jul 1994 15:33:45 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 8 Sender: daemon@net.bio.net Distribution: world Message-ID: <63268.jerbear@uxa.cso.uiuc.edu> Reply-To: jerbear@uxa.cso.uiuc.edu NNTP-Posting-Host: net.bio.net > Anyhow, let's take Long's suggestion >and do much simpler genetic analysis based on FREQUENCIES of different >fruit colors, which we all agree upon. > >Rong-Cai Yang Yes, we all agree there. Jerry From owner-rapd@net.bio.net Tue Jul 12 23:00:00 1994 Path: biosci!UKCC.UKY.EDU!EQUIGENE From: EQUIGENE@UKCC.UKY.EDU ("T. L. Lear") Newsgroups: bionet.molbio.rapd Subject: RAPDs and mt genome Date: 13 Jul 1994 10:03:54 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 10 Sender: daemon@net.bio.net Distribution: world Message-ID: <199407131703.KAA28088@net.bio.net> NNTP-Posting-Host: net.bio.net I would like to find out if anyone knows what percentage of RAPD markers could be attributed to the mitochondrial genome for mammalian systems? Are Southerns and sequencing the only way to distinguish between mtDNA and nuclear markers? In other words, do mtDNA markers exhibit any specific banding patterns? Any comments would be appreciated. Thanks. Teri L. Lear Dept. of Veterinary Science University of Kentucky Lexington, KY 40546-0099 From owner-rapd@net.bio.net Tue Jul 12 23:00:00 1994 Newsgroups: bionet.molbio.rapd Path: biosci!galaxy.ucr.edu!ihnp4.ucsd.edu!library.ucla.edu!news.ucdavis.edu!pbmac-5.ucdavis.edu!user From: tdlong@ucdavis.edu (Tony Long) Subject: Q: cloning PCR products Message-ID: Followup-To: bionet.molbio.rapd Sender: usenet@ucdavis.edu (News Guru) Organization: Center for Population Biology Date: Wed, 13 Jul 1994 21:42:17 GMT Lines: 10 Some time ago someone suggested a method for cloning PCR products, making use of the fact that such product leave a 3' A overhang. The protocol involved filling in an overhang to create a 3' T, I believe. Can someone repost (or e-mail me directly) the protocol. Tony Long Center for Population Biology U. C. Davis Davis, CA tdlong@ucdavis.edu From owner-rapd@net.bio.net Tue Jul 12 23:00:00 1994 Path: biosci!esvax.dnet.dupont.com!rafalski From: rafalski@esvax.dnet.dupont.com Newsgroups: bionet.molbio.rapd Subject: Primers for SSR Date: 13 Jul 1994 04:25:25 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 14 Sender: daemon@net.bio.net Distribution: world Message-ID: <9407131122.AA01931@esds01.es.dupont.com> NNTP-Posting-Host: net.bio.net In response to a question by Guy Hoelzer: You may want to look up a paper we recently published which provides a general method to amplify SSR (microsatellite) loci without the need to use species- specific primers: Zietkiewicz, Rafalski and Labuda, Genomics 20 (1994) 176-183. The method uses 5'- and 3'-anchored primers directed towards SSR sequence to amplify segments of DNA between closely spaced SSRs. It is a great fingerprinting method and is also useful for mapping (see figures in the above cited paper). Antoni Rafalski From owner-rapd@net.bio.net Tue Jul 12 23:00:00 1994 Path: biosci!UMBSKY.CC.UMB.EDU!dole From: dole@UMBSKY.CC.UMB.EDU (JEFF DOLE) Newsgroups: bionet.molbio.rapd Subject: Summary: QTL analysis and variance of categorized data Date: 12 Jul 1994 17:47:56 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 21 Sender: daemon@net.bio.net Distribution: world Message-ID: <199407130027.AA26874@ns.umb.edu> NNTP-Posting-Host: net.bio.net In the recent discussion regarding use of categorical data in QTL mapping, there has been no mention of the likelihood that the scoring method (assignment to classes) reflects underlying linear action of genes. The obvious first step in any regression mapping technique would seem to verify that that the distribution of scores in a segregating population are symmetric about their means; in particular, that the classes 1, 2, 3, 4, and 5 represent the means of P1, BC1, F1/F2, BC2, P2, respectively. Mather and Jinks (Biometrical Genetics) have an extensive discussion of scaling, transformations, etc. in this regard. One respondent suggested that the midpoint of classes could be used, e.g., the mean of F3 family values. If families are large enough, this would also normalize the data (central limit theorem).om). The prevailing opinion seems to suggest chi-square analysis of 2 or Jeff Dole Univ. of Mass. Boston, Massachussetts 02125 617-287-6643 E-mail: dole@umbsky.cc.umb.edu From owner-rapd@net.bio.net Tue Jul 12 23:00:00 1994 Path: biosci!galaxy.ucr.edu!ihnp4.ucsd.edu!swrinde!cs.utexas.edu!news.tamu.edu!mam4339 From: mam4339@tamsun.tamu.edu. (mam4339) Newsgroups: bionet.molbio.rapd Subject: primer dimerization? Date: 13 Jul 1994 19:29:20 GMT Organization: Texas A&M University, College Station, TX Lines: 9 Message-ID: <301fag$bda@news.tamu.edu> NNTP-Posting-Host: medmicrotb.tamu.edu X-Posted-From: InterNews 1.0@news.tamu.edu. I've just begun doing RAPDs and they've gone well so far except for one thing: we keep getting a band in the blank, of all places. The blanks we use are the excess of the master mix, which includes only dNTPs, AmpliTaq, and primer. And the band only occurs in one blank (using one blank per primer). Could there be primer dimerization going on here? It's all I can think of, unless something else is aggregating to a size big enough to show up on the gel (1.4% agarose, BTW), but I'm only a sophomore student technician, so I'm probably missing something obvious. I'd appreciate any suggestions anyone might have. From owner-rapd@net.bio.net Wed Jul 13 23:00:00 1994 Path: biosci!ento.csiro.au!thomasb From: thomasb@ento.csiro.au (Thomas Boyce) Newsgroups: bionet.molbio.rapd Subject: Re: RAPDs and mt genome Date: 13 Jul 1994 22:25:56 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 23 Sender: daemon@net.bio.net Distribution: world Message-ID: <9407140525.AA28004@spider.ento.csiro.au> NNTP-Posting-Host: net.bio.net Burachai Sonthayanon replying to T. L. Lear wrote: > >> I would like to find out if anyone knows what percentage of RAPD markers could >> be attributed to the mitochondrial genome for mammalian systems? > > It should be very low, right ? For a 15 kb mammalian mtDNA versus >3 billion bp of haploid genomic DNA the chance is around 5 in a million. > > Except for the greater number of mitochondrial genomes per nuclear genome. I suppose you could get an estimate of number of mitochondria per cell, although I doubt that it would be 200,000. __________________________________________________________________________ Dr. Thomas M. Boyce FAX: 61-6-2464173 Entomology, CSIRO Telephone: 61-6-2464159 GPO Box 1700 Internet: thomasb@spider.ento.csiro.au Canberra, ACT 2601 AUSTRALIA __________________________________________________________________________ From owner-rapd@net.bio.net Wed Jul 13 23:00:00 1994 Path: biosci!MUCC.MAHIDOL.AC.TH!scbst From: scbst@MUCC.MAHIDOL.AC.TH (Burachai Sonthayanon - SCBC) Newsgroups: bionet.molbio.rapd Subject: Re: RAPDs and mt genome Date: 13 Jul 1994 20:59:53 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 12 Sender: daemon@net.bio.net Distribution: world Message-ID: References: <199407131703.KAA28088@net.bio.net> NNTP-Posting-Host: net.bio.net Hi, On 13 Jul 1994, T. L. Lear wrote: > I would like to find out if anyone knows what percentage of RAPD markers could > be attributed to the mitochondrial genome for mammalian systems? It should be very low, right ? For a 15 kb mammalian mtDNA versus 3 billion bp of haploid genomic DNA the chance is around 5 in a million. From owner-rapd@net.bio.net Wed Jul 13 23:00:00 1994 Path: biosci!galaxy.ucr.edu!ihnp4.ucsd.edu!agate!howland.reston.ans.net!news.cac.psu.edu!news.tc.cornell.edu!travelers.mail.cornell.edu!newsstand.cit.cornell.edu!NewsWatcher!user From: wfl1@cornell.edu (Warren Frank Lamboy) Newsgroups: bionet.molbio.rapd Subject: Re: RAPDs and mt genome Followup-To: bionet.molbio.rapd Date: Thu, 14 Jul 1994 09:42:45 +0100 Organization: Cornell University Lines: 33 Sender: wfl1@cornell.edu (Verified) Distribution: world Message-ID: References: <9407140525.AA28004@spider.ento.csiro.au> NNTP-Posting-Host: 132.236.3.43 In article <9407140525.AA28004@spider.ento.csiro.au>, thomasb@ento.csiro.au (Thomas Boyce) wrote: > Burachai Sonthayanon replying to T. L. Lear wrote: > > > >> I would like to find out if anyone knows what percentage of RAPD markers could > >> be attributed to the mitochondrial genome for mammalian systems? > > > > It should be very low, right ? For a 15 kb mammalian mtDNA versus > >3 billion bp of haploid genomic DNA the chance is around 5 in a million. > > > > > > Except for the greater number of mitochondrial genomes per nuclear genome. > I suppose you could get an estimate of number of mitochondria per cell, > although I doubt that it would be 200,000. > > To follow up a bit on the above, in the plant genus Brassica (cabbages, canola, Chinese cabbage, mustard, etc.) it has been shown in one study by Thormann and Osborn (1992) "Use of RAPD and RFLP Markers for Germplasm Evaluation" published in the Proceedings of the Symposium: Applications of RAPD Technology to Plant Breeding, that approximately 5% of the observed RAPD markers were homologous to mitochondrial genome sequences, while < 0.5% were homologous to chloroplast genome sequences. Warren F. Lamboy Dept. of Horticultural Sciences and USDA-ARS Plant Genetic Resources Unit Cornell University Geneva, New York 14456-0462 warren_lamboy@cornell.edu From owner-rapd@net.bio.net Wed Jul 13 23:00:00 1994 Path: biosci!MED.PITT.EDU!bsh From: bsh@MED.PITT.EDU (Basavaraju Shankarappa) Newsgroups: bionet.molbio.rapd Subject: primer dimerization Date: 14 Jul 1994 07:08:21 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 24 Sender: daemon@net.bio.net Distribution: world Message-ID: <9407141408.AA06544@deimos.med.pitt.edu> NNTP-Posting-Host: net.bio.net Your email address did not work, so here is my 0.00001 c; In article <301fag$bda@news.tamu.edu> you write: >I've just begun doing RAPDs and they've gone well so far except for one >thing: we keep getting a band in the blank, of all places. The blanks >we use are the excess of the master mix, which includes only dNTPs, >AmpliTaq, and primer. And the band only occurs in one blank (using one >blank per primer). Could there be primer dimerization going on here? >It's all I can think of, unless something else is aggregating to a size >big enough to show up on the gel (1.4% agarose, BTW), but I'm only a >sophomore student technician, so I'm probably missing something >obvious. I'd appreciate any suggestions anyone might have. It is very likely that the water or the air has a contaminant DNA that is giving you this band. One way to rule it out is the presence of same bands in your sample lanes also. However, it may not be as simple as the presence of your test DNA can skew amplification from the contaminant DNA. I would use water from a different source to start with and probably do the setup at another place. If it is primer dimer you should be able to characterize it more clearly from the size. Good luck. Raj Shankarappa bsh@med.pitt.edu From owner-rapd@net.bio.net Wed Jul 13 23:00:00 1994 Path: biosci!YVAX.BYU.EDU!FARMERJ From: FARMERJ@YVAX.BYU.EDU Newsgroups: bionet.molbio.rapd Subject: Re: primer dimerization Date: 14 Jul 1994 10:03:33 -0700 Organization: Brigham Young University Lines: 3 Sender: daemon@net.bio.net Distribution: world Message-ID: <01HEP02TWCYG8Y5QUF@yvax.byu.edu> NNTP-Posting-Host: net.bio.net The presence of bands in negative controls has been discussed at great length. Check the archives of bionet.rapd. They are ubiquitous. James Farmer From owner-rapd@net.bio.net Wed Jul 13 23:00:00 1994 Path: biosci!MERCURY.UARK.EDU!DRHOADS From: DRHOADS@MERCURY.UARK.EDU ("Doug Rhoads") Newsgroups: bionet.molbio.rapd Subject: Re: primer dimerization Date: 14 Jul 1994 13:24:33 -0700 Organization: University of Arkansas Lines: 48 Sender: daemon@net.bio.net Distribution: world Message-ID: <33D5EC1DEC@uamercury.uark.edu> NNTP-Posting-Host: net.bio.net >To: rapd@net.bio.net >From: bsh@med.pitt.edu (Basavaraju Shankarappa) >Subject: primer dimerization >Date sent: 14 Jul 1994 07:08:21 -0700 >Your email address did not work, so here is my 0.00001 c; > >In article <301fag$bda@news.tamu.edu> you write: > >I've just begun doing RAPDs and they've gone well so far except for one > >thing: we keep getting a band in the blank, of all places. The blanks > >we use are the excess of the master mix, which includes only dNTPs, > >AmpliTaq, and primer. And the band only occurs in one blank (using one > >blank per primer). Could there be primer dimerization going on here? > >It's all I can think of, unless something else is aggregating to a size > >big enough to show up on the gel (1.4% agarose, BTW), but I'm only a > >sophomore student technician, so I'm probably missing something > >obvious. I'd appreciate any suggestions anyone might have. > > It is very likely that the water or the air has a contaminant > DNA that is giving you this band. One way to rule it out is the > presence of same bands in your sample lanes also. However, it may > not be as simple as the presence of your test DNA can skew amplification > from the contaminant DNA. I would use water from a different source > to start with and probably do the setup at another place. > If it is primer dimer you should be able to characterize it > more clearly from the size. > Good luck. > Raj Shankarappa > bsh@med.pitt.edu > I agree that the test of water and location is good but in our hands there can be another more insidious source of contaminating DNA, the polymerase. We have had several lots of Promega Taq that gave no bands in the noDNA control. Most batches give a few bands that disappear when any other DNA is added. But the last lot of enzyme gives bands in the no DNA control that stay around when we add our target DNA. This has been confirmed by switching target DNAs, buffer, water, etc. The best control was when we switched lots of Taq the artifactual band disappeared. When we tested the bad lot by fluorimetry we detected about 30ng/ul DNA. I suspect this DNA is probably partially fragmented and so can act as both a target and partial primer. Doug Rhoads || Dept. of Biological Sciences drhoads@mercury.uark.edu || 601 Science Engineering drhoads@uafsysb.uark.edu || University of Arkansas 501-575-3251 || Fayetteville, AR 72701 From owner-rapd@net.bio.net Wed Jul 13 23:00:00 1994 Newsgroups: bionet.molbio.rapd Path: biosci!galaxy.ucr.edu!ihnp4.ucsd.edu!swrinde!howland.reston.ans.net!vixen.cso.uiuc.edu!newsfeed.ksu.ksu.edu!moe.ksu.ksu.edu!osuunx.ucc.okstate.edu!vms.ucc.okstate.edu!shufran From: shufran@vms.ucc.okstate.edu Subject: primer dimer? Message-ID: <1994Jul14.114638.1@vms.ucc.okstate.edu> Lines: 6 Sender: news@osuunx.ucc.okstate.edu (USENET News System) Nntp-Posting-Host: vms.ucc.okstate.edu Organization: Oklahoma State University Computer Center Date: Thu, 14 Jul 1994 16:46:38 GMT What is "primer dimer" exactly? Is this where we see two faint bands on either size of a bright, well amplified band? How can you tell if this is occuring? Thanks in advance, Kevin Shufran From owner-rapd@net.bio.net Thu Jul 14 23:00:00 1994 Path: biosci!YVAX.BYU.EDU!FARMERJ From: FARMERJ@YVAX.BYU.EDU Newsgroups: bionet.molbio.rapd Subject: Re: Primer dimers Date: 15 Jul 1994 12:29:43 -0700 Organization: Brigham Young University Lines: 82 Sender: daemon@net.bio.net Distribution: world Message-ID: <01HEQJHOWMHU8Y5WDB@yvax.byu.edu> NNTP-Posting-Host: net.bio.net From: IN%"Chris.Bolch@ml.csiro.au" 14-JUL-1994 16:34:14.18 To: IN%"FARMERJ@yvax.byu.edu" CC: Subj: RE: primer dimerization dear James, Could you post this to the rapd news group, I do not seem to be able to find the thread on the posting list. you write in response to primer dimers: >The presence of bands in negative controls has been discussed at great length. >Check the archives of bionet.rapd. They are ubiquitous. >James Farmer I have not seen the archived discussions but I have not had any trouble with bands in my negative control. Ubiquitous may be too strong a word for the negative control bands. We use Perkin Elmer reagents and AmpliTaq polymerase. Our double distilled water is autoclaved with the lid screwed on tightly. It is used only for PCR loads and is stored in a special separate PCR loading room. The PCR machine is in the main lab, not in the loading room and PCR product is forbidden in the PCR loading room. Loads are carried out with "loading only" pippettes which never leave the loading room. Maybe I've just bene lucky so far!! Chris ___________________________ Christopher J. S. Bolch, CSIRO Division of Fisheries, GPO Box 1538, Hobart, Tasmania, Australia, 7001. Australia PH. 002 325314 FAX 002-325000 International PH. 061-02-325314 FAX. 061-02-325000 ___________________________ ============================================== Farmer's response: Dear Chris: Perhaps "ubiquitous" is too strong, but nearly every lab I know about sees bands in negative controls. I have taken precautions about contaminants too, and sometimes we don't see bands in negative controls, but if we run enough of them, we will eventually see some. Nearly always, the bands in negative controls do not correspond to positions or intensities of RAPD bands from tubes containing primer DNA. I have seen everything blamed for their presence. I have quit worrying about them, since they do not seem to introduce any spurious RAPD information. In fact, in my lab, those "control bands" do not appear in RAPD reactions which have template DNA. Doug Rhoades' comments today make me suspect that it may be possible to get rid of them if the Taq is the source. I will have to try another brand of Taq and see if I still get the same result. A different enzyme I tried (not Taq) was really loaded with contaminating DNA, so this seems like a viable possibility. Thanks, Doug. The only purpose of my previous message was to call to the attention of new readers that there is an archive which contains more than one series of discussions on this point. Some persons may wish to review what has been said before. If anyone does not know how to access the archives, send a request for information to BIOSCI-HELP@NET.BIO.NET (or to the DARESBURY address). Best wishes, James Farmer From owner-rapd@net.bio.net Thu Jul 14 23:00:00 1994 Path: biosci!MED.PITT.EDU!bsh From: bsh@MED.PITT.EDU (Basavaraju Shankarappa) Newsgroups: bionet.molbio.rapd Subject: primer dimers->rRNA contamination? Date: 14 Jul 1994 17:40:07 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 26 Sender: daemon@net.bio.net Distribution: world Message-ID: <9407150040.AA27436@mercury.med.pitt.edu> NNTP-Posting-Host: net.bio.net > agree that the test of water and location is good but in our hands there >can be another more insidious source of contaminating DNA, the polymerase. > We have had several lots of Promega Taq that gave no bands in the noDNA >control. Most batches give a few bands that disappear when any other DNA >is added. But the last lot of enzyme gives bands in the no DNA control >that stay around when we add our target DNA. This has been confirmed by >switching target DNAs, buffer, water, etc. The best control was when we >switched lots of Taq the artifactual band disappeared. When we tested the >bad lot by fluorimetry we detected about 30ng/ul DNA. I suspect this DNA >is probably partially fragmented and so can act as both a target and >partial primer. > > >Doug Rhoads || Dept. of Biological Sciences >drhoads@mercury.uark.edu || 601 Science Engineering >drhoads@uafsysb.uark.edu || University of Arkansas >501-575-3251 || Fayetteville, AR 72701 Some time back when our lab was trying to amplify ribosomal RNA the same problem kept propping up. I think one of our attempt was to use DNAase on the polymerase before using it for amplification. Is there anyone who does amplify ribosomal RNA who found the right solution. I mean the bacterial where contamination from Taq could be problematic? Raj Shankarappa bsh@med.pitt.edu From owner-rapd@net.bio.net Sun Jul 17 23:00:00 1994 Path: biosci!POPGEN.BIOLOGY.UMT.EDU!tmo From: tmo@POPGEN.BIOLOGY.UMT.EDU (Thomas Mitchell-Olds) Newsgroups: bionet.molbio.rapd Subject: Postdoc in Molecular Evolution Date: 18 Jul 1994 09:13:31 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 47 Sender: daemon@net.bio.net Distribution: world Message-ID: <9407181618.AA06382@popgen.biology.umt.edu> NNTP-Posting-Host: net.bio.net Postdoc to study molecular evolutionary genetics of Arabidopsis thaliana and its wild relative, Arabis fecunda. We are studying population differentiation and DNA sequence evolution at loci controlling initiation of flowering. Regulatory genes controlling flowering have pleiotropic effects on life histories and important components of fitness (e.g., fecundity and age of first reproduction). We are studying DNA sequence polymorphisms and mapping quantitative trait loci to infer evolutionary factors causing population differentiation and its ecological consequences. This research is part of a long term analysis of ecological genetics in natural plant populations. We have five years of field data on life histories, demography and natural selection in five wild populations. This postdoctoral position will examine DNA sequence variation at loci that are responsible for life history variation. Applicants should be experienced with methods of molecular biology and concepts of evolutionary genetics. The University of Montana has an active group in evolutionary genetics and population biology. Laboratory facilities include a fully equipped lab for plant molecular evolution, and a departmental facility for automated DNA sequencing and related procedures. A new controlled environment facility is available for plant growth. Computing and network resources are excellent. Missoula is a town of about 50,000 in the mountains of western Montana. Quality of living is high, with year-round recreational opportunities and a modest cost of living. Application deadline: 1 September 1994, or until a suitable candidate is found. For further information contact: Thomas Mitchell-Olds Division of Biological Sciences University of Montana Missoula, MT 59812 phone: 406-243-4954 e-mail: tmo@popgen.biology.umt.edu From owner-rapd@net.bio.net Mon Jul 18 23:00:00 1994 Path: biosci!molbiol.uct.ac.za!ED From: ED@molbiol.uct.ac.za ("RYBICKI, ED") Newsgroups: bionet.molbio.rapd Subject: rapds on maize seeds Date: 19 Jul 1994 07:11:13 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 19 Sender: daemon@net.bio.net Distribution: world Message-ID: Reply-To: ed@molbiol.uct.ac.za NNTP-Posting-Host: net.bio.net Subject line says it all: rumour has it there are people who are having a great deal of success with RAPDs on DNA from maize seeds - which are apparently a lot more reproducible than from leaf DNA. Anyone out there with any experience in this who is willing to share methods? Will post summary in this group. Ta! _________________________________________________________________ | Ed Rybicki, PhD | Well, I tip my hat | | (ed@micro.uct.ac.za) | To the new constitution | | Dept Microbiology | Take a bow for the new revolution... | | University of Cape Town | Then I get on my knees and pray | | Private Bag, Rondebosch | We don't get get fooled again... | | 7700, South Africa | | | fax: xx27-21-650 4023 | - Pete Townshend, 1972 | | tel: xx27-21-650 3265 | (Won't get fooled again) | ------------------------------------------------------------------ From owner-rapd@net.bio.net Mon Jul 18 23:00:00 1994 Path: biosci!bcm!cs.utexas.edu!howland.reston.ans.net!usc!nic-nac.CSU.net!charnel.ecst.csuchico.edu!olivea!uunet!newstf01.cr1.aol.com!search01.news.aol.com!not-for-mail From: dzaitlin@aol.com (Dzaitlin) Newsgroups: bionet.molbio.rapd Subject: DNA extraction from field collected maize tissur Date: 19 Jul 1994 13:30:02 -0400 Organization: America Online, Inc. (1-800-827-6364) Lines: 18 Sender: news@search01.news.aol.com Message-ID: <30h2iq$jns@search01.news.aol.com> NNTP-Posting-Host: search01.news.aol.com This is in response to the queries on this subject posted in June by Nick Tinker and Dave Knorr. I have worked extensively in maize molecular genetics and RFLP, and can offer the following suggestions: The youngest leaves taken from the whorl of plants 1-2 feet high will give adequate DNA yields (CTAB extraction) if harvested early in the morning when the previous day's starch accumulation has been depleted. The leaf tissue can be frozen at -80 C in zip-lock bags for long periods of time prior to being powdered in a mortar with liquid nitrogen. Alternatively, the leaves can be harvested immediately into a jar containing reagent alcohol (mostly ethanol, from Baxter) and stored almost indefinately. To extract DNA, drain off the alcohol and allow the pieces of tissue to dry overnight on paper towels. The tissue can then be powdered and the DNA extracted as in the original Saghai-Maroof CTAB method from 1984. This last method worked well for me with leaves of Brassicas, and is not published. If you make use of it, please let me know. Dave Zaitlin DataGenetics Corporation From owner-rapd@net.bio.net Tue Jul 19 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!xlink.net!scsing.switch.ch!news.belwue.de!newsserv.zdv.uni-tuebingen.de!mailserv.zdv.uni-tuebingen.de!ccisc01 From: ccisc01@mailserv.zdv.uni-tuebingen.de (Lieselotte Schilde) Newsgroups: bionet.molbio.rapd Subject: Sweetpotato PCR primers for RAPD ? Date: 20 Jul 94 08:02:01 GMT Organization: InterNetNews at ZDV Uni-Tuebingen Lines: 11 Message-ID: NNTP-Posting-Host: mailserv.zdv.uni-tuebingen.de Keywords: sweet potato, RAPD, PCR primers, Ipomoea We want to make contact with groups that are involved on sweetpotato PCR analysis. If there are some suggestions about primers which could be useful for sweetpotato RAPD anlysis. A.Gutierrez-Rosati Josef Maier L.Schilde Any answers should be send to: ccisc01@mailserv.zdv.uni-tuebingen.de From owner-rapd@net.bio.net Tue Jul 19 23:00:00 1994 Newsgroups: bionet.molbio.rapd Path: biosci!galaxy.ucr.edu!ihnp4.ucsd.edu!usc!howland.reston.ans.net!vixen.cso.uiuc.edu!news.uoregon.edu!netnews.nwnet.net!ns1.nodak.edu!badlands!dahleen From: dahleen@badlands.NoDak.edu (Lynn S Dahleen) Subject: problem with primers? Sender: usenet@ns1.nodak.edu (Usenet login) Message-ID: Date: Wed, 20 Jul 1994 16:52:43 GMT Nntp-Posting-Host: badlands.nodak.edu Organization: North Dakota Higher Education Computing Network X-Newsreader: TIN [version 1.2 PL2] Lines: 20 I have a set of specific primers to a barley locus which seemed to work well in the past. In fact, I have even used these primers to map the locus on the Steptoe x Morex mapping population with no troubles. Recently however, on a set of progeny from a cross whose parents readily give amplification with the primers, _most_ of the progeny simply give a smear. Only about 10% or so give the expected amplification products. The DNA from all of progeny support amplification with other primers from a different but closely linked locus, and additional purification (ie RNasing, phenol, chloroform extractions and EtOH precipitations) did not solve the problem. I even ordered new primers, but that also proved futile. The DNAs all look similar when run out on a gel, and the DNAs that support amplification do so in a reproducible manner. Does anyone have any ideas why I am all of the sudden having problems with this primer set? Has anyone else had simmilar problems? Any advice would be appreciated. Thanks in advance! Dave Horvath USDA/ARS/NCSL Fargo, ND Dahleen@badlands.nodak.edu From owner-rapd@net.bio.net Tue Jul 19 23:00:00 1994 Newsgroups: bionet.immunology,nz.molbio,bionet.women-in-bio,bionet.virology,bionet.journals.note,umn.bioc.class.5025,umo.biomed.inroads,umo.biomed.engrg,bionet.n2-fixation,bionet.biology.n2-fixation,bionet.molbio.rapd,bionet.drosopila,bionet.molbio.yeast,fj.sci.bio Path: biosci!galaxy.ucr.edu!ihnp4.ucsd.edu!usc!nic-nac.CSU.net!csus.edu!netcom.com!syllabus From: syllabus@netcom.com (Syllabus Press) Subject: Higher Education Technology Conference Message-ID: Organization: NETCOM On-line Communication Services (408 261-4700 guest) Date: Wed, 20 Jul 1994 21:35:12 GMT Lines: 60 Xref: biosci bionet.immunology:1712 bionet.women-in-bio:1238 bionet.virology:701 bionet.journals.note:294 bionet.biology.n2-fixation:185 bionet.molbio.rapd:699 bionet.molbio.yeast:1354 UC-Santa Cruz and Syllabus Press (publishers of Syllabus magazine) are co-sponsoring a conference on the use of technology in higher education. Due to the location of conference, we will be having some diving activities in Monterey Bay, probably a boat dive and myabe a few beach dives. Below is a brief synopsis of the conference. For either a print or electronic conference registration package, please contact Syllabus Press via e-mail or or call 800-773-0670. Syllabus Ô94 A Higher Education Technology Conference August 14-17 University of CaliforniaÐSanta Cruz Santa Cruz, CA USA Co-sponsored by Syllabus Press and Board of Education, UC-Santa Cruz Learn the latest about new technology for higher education AND enjoy the spectacular Monterey Bay region this August! Syllabus Ô94 is a conference for faculty, department chairs, administrators, and technology staff who want to learn about the latest technology for higher education. Professionals who work in technology and textbook publishing companies are also invited to attend this conference. In addition to the informative topical sessions, ample opportunities will allow participants to interact with their colleagues from around the world and learn more about issues relating to the use of technology in higher education. The conference will be held at the University of California, Santa Cruz, a campus of uncommon natural beauty, set in a Redwood forest overlooking beautiful Monterey Bay and the Pacific Ocean. Numerous Òextra-conferenceÓ activities are planned to take advantage of the location of this summertime conference. Cross-platform and cross-technology: All computer and technology platforms will be covered, including DOS/Windows, Macintosh, and UNIX, as well as multimedia, laser discs, presentation devices, quantitative tools and other technologies. Cross-discipline focus: The commonalities of technology use across disciplines will be emphasized to stimulate participantsÕ thinking about the use of technology in their respective fields. Pre-conference Workshops: Sunday, August 13 will include a full day of workshops providing detailed instruction and hands-on use of a variety of technologies. Monday, Tuesday, and Wednesday Mornings: A variety of plenary sessions will be devoted to important higher education technologies, including demonstrations. Monday, Tuesday, and Wednesday Afternoons: Hands-on labs will give participants an opportunity to explore the technology firsthortunity to explore the technology firsthand; discussion groups will explore other issues of concern to higher education professionals. Tours and off-site activities will allow participants to enjoy the Monterey Bay region. For conference fees and registration information, send an e-mail to: Syllabus@netcom.com and request a conference brochure. Registration is available by phone at (800) 773-0670. -- syllabus@netcom.com From owner-rapd@net.bio.net Tue Jul 19 23:00:00 1994 Path: biosci!galaxy.ucr.edu!ihnp4.ucsd.edu!swrinde!howland.reston.ans.net!europa.eng.gtefsd.com!library.ucla.edu!csulb.edu!nic-nac.CSU.net!charnel.ecst.csuchico.edu!psgrain!quagga.ru.ac.za!ucthpx!uctvax.uct.ac.za!uctvax.uct.ac.za!nntp Newsgroups: bionet.molbio.rapd Subject: Re: rapds on maize seeds Message-ID: <1994Jul20.173748.207157@uctvax.uct.ac.za> From: Molapo Qhobela Date: 20 Jul 94 17:37:47 +0200 Followup-To: Ed Rybicki Distribution: world Organization: Univ of Cape Town Keywords: Maize, Sorghum Nntp-Posting-Host: pc21.mic.uct.ac.za Lines: 21 In article ED@molbiol.uct.ac.za ("RYBICKI, ED") writes: >Subject line says it all: rumour has it there are people who are >having a great deal of success with RAPDs on DNA from maize seeds - >which are apparently a lot more reproducible than from leaf DNA. > >Anyone out there with any experience in this who is willing to share >methods? Will post summary in this group. > >Ta! > Ed, Does the romour say that you get better RAPDs if you use DNA isolated from seed than from leaf tissue??!! I have been having good results with SORGHUM [The crop of future generations!]. My DNA is extracted from germinated seed .. using CTAB. Nip off the first leaves and you have enough DNA for more RAPDs than you may care to do! Cheers, Q From owner-rapd@net.bio.net Wed Jul 20 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!swrinde!pipex!uknet!daresbury!not-for-mail From: Newsgroups: bionet.molbio.rapd Subject: RAPDPLOT Date: 21 Jul 1994 14:44:47 +0100 Lines: 8 Sender: daemon@mserv1.dl.ac.uk Distribution: bionet Message-ID: <30lu4f$85u@mserv1.dl.ac.uk> Original-To: rapd@dl.ac.uk Dear netters, Does anyone know if there is an FTP site for the program RAPDPLOT written by W.C. Black? Many thanks, Moira From owner-rapd@net.bio.net Wed Jul 20 23:00:00 1994 Path: biosci!VTVM1.CC.VT.EDU!LKUEHNEL From: LKUEHNEL@VTVM1.CC.VT.EDU (Laurel Kuehnel) Newsgroups: bionet.molbio.rapd Subject: (none) Date: 21 Jul 1994 09:25:13 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 1 Sender: daemon@net.bio.net Distribution: world Message-ID: <199407211625.JAA09919@net.bio.net> NNTP-Posting-Host: net.bio.net subscribe From owner-rapd@net.bio.net Wed Jul 20 23:00:00 1994 Path: biosci!QMRELAY.MAIL.CORNELL.EDU!reisch_lab From: reisch_lab@QMRELAY.MAIL.CORNELL.EDU ("Reisch Lab") Newsgroups: bionet.molbio.rapd Subject: Percentage of microsatellit Date: 21 Jul 1994 13:31:22 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 11 Sender: daemon@net.bio.net Distribution: world Message-ID: <94Jul21.163140edt.584177-8@cornell.edu> NNTP-Posting-Host: net.bio.net Subject: Time:16:19 OFFICE MEMO Percentage of microsatellite DNA Date:7/21/94 Dear Netters: Does anybody has any idea what is the percentage of microsatellite and/or minisatellite DNA of the total genomic or repetitive DNA in plants or animals? I need this information for a discussion on genetic mapping via RAPD markers. Any information will be highly appreciated. Thanks in advance Regards Atif Khan From owner-rapd@net.bio.net Wed Jul 20 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!vixen.cso.uiuc.edu!newsfeed.ksu.ksu.edu!moe.ksu.ksu.edu!darenmac.usgmrl.ksu.edu!user From: stauth@crunch.usgmrl.ksu.edu (Darren Stauth) Newsgroups: bionet.molbio.rapd Subject: test Followup-To: bionet.molbio.rapd Date: Thu, 21 Jul 1994 09:46:07 -0600 Organization: USDA/ARS Lines: 4 Message-ID: NNTP-Posting-Host: 129.130.148.166 test -- Darren M. Stauth -- stauth@crunch.usgmrl.ksu.edu From owner-rapd@net.bio.net Mon Jul 25 23:00:00 1994 Path: biosci!agate!spool.mu.edu!howland.reston.ans.net!EU.net!uknet!daresbury!not-for-mail From: Andreas Langsdorf Newsgroups: bionet.molbio.rapd Subject: rapd with grasses Date: 26 Jul 1994 13:41:04 +0100 Lines: 11 Sender: daemon@mserv1.dl.ac.uk Distribution: bionet Message-ID: <313090$n4n@mserv1.dl.ac.uk> MIME-Version: 1.0 Original-To: rapd@dl.ac.uk Hello, I am working with grasses from the sahel-region, doing rapds with 44 degrees annealing temperature and 10mer primers. I wonder, because some guys say it won`t work above 40 degrees with 10mer primers. Well, I`m not afraid of that, because the cycles run quicker than before using lower temperatures. So I`m interested, if you made the same experience with your cycler. I`m using an Omnigene thermocycler from hybaid and Microtiterplates and tubes too. Ok, that`s all, I`m waiting for your response. Bye, bye From owner-rapd@net.bio.net Mon Jul 25 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!pipex!uknet!daresbury!not-for-mail From: Louis van de Zande Newsgroups: bionet.molbio.rapd Subject: Re: rapd with grasses Date: 26 Jul 1994 14:16:45 +0100 Organization: Department of Biology, RUGroningen Lines: 24 Sender: daemon@mserv1.dl.ac.uk Distribution: bionet Message-ID: <3132bt$p5a@mserv1.dl.ac.uk> Reply-To: ZANDELPW@BIOL.RUG.nl Original-To: rapd@dl.ac.uk > Hello, > I am working with grasses from the sahel-region, doing rapds with 44 degrees > annealing temperature and 10mer primers. I wonder, because some guys say > it won`t work above 40 degrees with 10mer primers. Well, I`m not afraid > of that, because the cycles run quicker than before using lower temperatures. > So I`m interested, if you made the same experience with your cycler. > I`m using an Omnigene thermocycler from hybaid and Microtiterplates and > tubes too. > Ok, that`s all, I`m waiting for your response. > Bye, bye > > Hello to you too, I do not get the message. Are you saying that you get perfectly nice reproducible RAPDs at 44 annealing? Could be. The highest temp I ever dared to go was 39. It worked too and yes of course the cycles run quicker. There is a rule of thumb that determines the Tm of an oligo by adding 4 degrees for each C or G and 2 degrees for each A or T. So for a ten- mer consisting only of C and T that should give a Tm of 40 degrees. However the REAL Tm could be significantly different. See how far you can go. Cheers Louis From owner-rapd@net.bio.net Tue Jul 26 23:00:00 1994 Path: biosci!rutgers!gatech!newsfeed.pitt.edu!uunet!news.mtholyoke.edu!news.amherst.edu!not-for-mail From: walin@unix.amherst.edu (Athena Wen-chuan Lin) Newsgroups: bionet.molbio.rapd Subject: test Date: 27 Jul 1994 14:22:12 -0400 Organization: Amherst College, Amherst MA, USA Lines: 2 Message-ID: <3168kk$3pd@amhux3.amherst.edu> NNTP-Posting-Host: amhux3.amherst.edu X-Newsreader: TIN [version 1.2 PL0] just a test From owner-rapd@net.bio.net Tue Jul 26 23:00:00 1994 Path: biosci!agate!library.ucla.edu!europa.eng.gtefsd.com!gatech!swrinde!pipex!uknet!daresbury!not-for-mail From: "Naresh C. Pancholi" Newsgroups: bionet.molbio.rapd Subject: Help on DNA quantification and RAPD... Date: 27 Jul 1994 14:37:05 +0100 Lines: 34 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <315nu1$rph@mserv1.dl.ac.uk> Original-To: Methods-and-Reagents , RAPD Hello Netters, I would appreciate any help on the following questions: 1. I am using CTAB DNA extraction method for banana leaves. I tried to quantify DNA through UV spectrophotometer but this reading is not reliable as CTAB also absorbs fluorescence. Then I tried fluorimeter but I am still not happy. It seems that my samples have very low DNA because my starting leaf material is only 50-70 mg. Can someone tell me a reliable, quick and cheap method for DNA quantification? 2. On the basis of this, I am going to use RAPD and I have a big sample size (300 plants) and less time (2 months only). I use primer kits from Operon. I noticed a strange phenomenon in my RAPD reaction. I tried 10, 25 and 50 ng of template DNA (based on fluorimeter readings) per 25 ul reaction. There was an increase in the total number of bands as the concentration of DNA increased. What I understand that this should not happen, though I am a novice for this technique and therefore, would like to receive your advice on this matter. 3. Is any one there who is comparing a big sample size like mine, through RAPD? If so, would you please write general or any specific advice for it? I would appreciate any feedback on this matter from you. I have also posted this message to Methods group so sorry if you have come across again. Thanks a lot in advance. +-----------------------------------------------+ | Naresh Pancholi abrpanch@reading.ac.uk | | Agricultural Botany Phone: +44 734 318092 | | Reading University Fax: +44 734 316577 | | Reading RG6 2AS | | UK | +-----------------------------------------------+ From owner-rapd@net.bio.net Tue Jul 26 23:00:00 1994 Path: biosci!agate!ames!purdue!lerc.nasa.gov!magnus.acs.ohio-state.edu!dsammata From: dsammata@magnus.acs.ohio-state.edu (Diana Sammataro) Newsgroups: bionet.molbio.methds-reagnts,bionet.molbio.rapd Subject: Ancient Bee DNA Date: 27 Jul 1994 16:10:06 GMT Organization: The Ohio State University Lines: 16 Message-ID: <3160su$k6u@charm.magnus.acs.ohio-state.edu> NNTP-Posting-Host: top.magnus.acs.ohio-state.edu Keywords: Ancient DNA, extraction Xref: biosci bionet.molbio.methds-reagnts:16677 bionet.molbio.rapd:707 Dear Netters: I have just obtained some bees (mostly chitin and little muscle tissue) from a archeological site. They are around 800 years old and I wish to extract the DNA, if any, that may be there. I have done RAPDs on bees and mites but I don't know how to extract this old DNA. Suggestions would be helpful. Thanks in advance. Diana Sammataro Ohio State University Dept. Entomology 1735 Neil Ave Columbus, OH 43210 1220 Phone: 614 292 9089 From owner-rapd@net.bio.net Tue Jul 26 23:00:00 1994 Path: biosci!CORNELL.EDU!MAL5 From: MAL5@CORNELL.EDU (Muhammad A. Lodhi) Newsgroups: bionet.molbio.rapd Subject: Re: Help on DNA quantification and RAPD... Date: 27 Jul 1994 14:48:53 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 37 Sender: daemon@net.bio.net Distribution: world Message-ID: <199407272149.RAA02831@postoffice.mail.cornell.edu> NNTP-Posting-Host: net.bio.net In response to N.C.Pancholi@reading.ac.uk, Dear Naresh: As far as DNA quantification is concerned, I did some work on it with different models of spectrophotometer, fluorometer and gel quantification. The results in all cases were quite different. I compared the results of DNA quantification via different methods, with RAPD amplification. DNA was amplified satisfactorily with all other methods except quantified with spec., generally spec was reading about 5-10 times more DNA than the actual amount. Some of these results are mentioned in my thesis that is ready to be submitted. The only published thing that I have, is my DNA extraction protocol that has produced good results in several different plant species. The protocol was published in Plant Molecular Biology Reporter(1994), 12(1):6-13. I can send you a reprint if you don't have access to it. If you have access to fluorometer, it is the very reliable if you don't then you can stick even with spec. but simply use abot 5-10 times more DNA. Regarding the effect of DNA conc. on amplificaton, it is again not a simple problem. I think that with increased concentration one should see changes in the amplification of bands. These changes could also be in the form of new bands because at lower conc. some of the target sites were not amplified enough to be detectable with EtBr. I would refer you to our article on this issue which may be little difficult to get but again I can send you a xerox copy of this article if you are unable to get it. Weeden NF, Timmerman GM, Hemmat M, Kneen BE, Lodhi MA (1992) Inheritance and reliability of RAPD markers. In: Proc. Joint Plant Breeding Symposium Series. Applications of RAPD Technology to Plant Breeding. Crop Science Society of America, American Society for Horticultural Science and American Genetic Association, pp 12-17 Hope it will be helpful Muhammad A. Lodhi NYSAES, Cornell University Geneva, NY 14456 From owner-rapd@net.bio.net Wed Jul 27 23:00:00 1994 Path: biosci!sfu.ca!corley From: corley@sfu.ca ("Graham Corley-Smith") Newsgroups: bionet.molbio.rapd Subject: Re: Help on DNA quantification...One more question... Date: 28 Jul 1994 12:26:39 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 55 Sender: daemon@net.bio.net Distribution: world Message-ID: <44582.corley@sfu.ca> Reply-To: corley@sfu.ca NNTP-Posting-Host: net.bio.net >After posting my problems I have received a few responses. I would like >to add one more point here. > >I am still confused about spectrophotometer and fluorimeter readings. >For example, one of my samples gave > >760 ng/ul (spectrophotometer) but only >64 ng/ul (fluorimeter) > >So the differences between two methods are so great that I am in a complete >confusion. I tried to run a minigel with a known DNA standards and it tells >the concentration about 75 ng/ul. Now the question is on which method should >I rely to finalize the required concentration of template DNA for RAPD? Hi, Spectophotometer: Reads absorbance of Uv light. Must be done in quartz cuvette. RNA and protein absorb uv light at 260 nm (approximately the wavelength at which DNA absorbs maximally). Thus O.D. 260 measurements can give over estimation of DNA concentration if sample contains RNA and/or protein. Fluorometer: Hoescht 33258 binds preferentially to a specific tetranucleotide sequence in double stranded DNA. Thus, protein and RNA contamination will have less affect on the fluorometric reading. Thus, this method is preferable if you have 1) A good set of standards of known DNA concentration to calibrate instrument, 2) a DNA sample which RNA and/or protein contamination. I use tissue homogenates for my RAPD reactions and thus fluorometry is more appropriate than spectophotometry to determine DNA concentration. Ethidium Bromide Dot Blots: Quick and dirty method. Ethidium Bromide intercalates between the stacked bases of RNA and DNA. Thus, you DNA concentration will be affected by RNA contamination. As to your question. Spec reading will should be greater than fluorometer reading when RNA and DNA are also in sample. Is it possible that you have lots of RNA in your sample? More importantly than determining accurately your DNA concentration, is finding a method that you can reuse to get the same concentration of DNA each time you run your RAPD reaction. Hope this information helps. Graham ---------------- Graham E. Corley-Smith Institute of Molecular Biology and Biochemistry Biological Sciences Department Simon Fraser University Burnaby, B.C., V5A 1S6 Canada Phone: (604) 291-3021 Fax: (604) 291-5583 e-mail: corley@sfu.ca From owner-rapd@net.bio.net Wed Jul 27 23:00:00 1994 Path: biosci!agate!doc.ic.ac.uk!daresbury!not-for-mail From: "Naresh C. Pancholi" Newsgroups: bionet.molbio.rapd Subject: Re: Help on DNA quantification...One more question... Date: 28 Jul 1994 12:06:53 +0100 Lines: 35 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <3183gd$m16@mserv1.dl.ac.uk> Reply-To: "Naresh C. Pancholi" Original-To: RAPD Hello Netters, After posting my problems I have received a few responses. I would like to add one more point here. I am still confused about spectrophotometer and fluorimeter readings. For example, one of my samples gave 760 ng/ul (spectrophotometer) but only 64 ng/ul (fluorimeter) So the differences between two methods are so great that I am in a complete confusion. I tried to run a minigel with a known DNA standards and it tells the concentration about 75 ng/ul. Now the question is on which method should I rely to finalize the required concentration of template DNA for RAPD? I have already extracted 300 samples and so they are ready for quantification. +-----------------------------------------------+ | Naresh Pancholi abrpanch@reading.ac.uk | | Agricultural Botany Phone: +44 734 318092 | | Reading University Fax: +44 734 316577 | | Reading RG6 2AS | | UK | +-----------------------------------------------+ From owner-rapd@net.bio.net Wed Jul 27 23:00:00 1994 Newsgroups: bionet.molbio.methds-reagnts,bionet.molbio.rapd Path: biosci!daresbury!doc.ic.ac.uk!uknet!pipex!jura.sasa.gov.uk!news From: odonnell@sasa.gov.uk (Kevin O'Donnell) Subject: Re: Ancient Bee DNA Organization: Scottish Agricultural Science Agency Date: Thu, 28 Jul 1994 07:29:42 GMT Message-ID: X-Newsreader: WinVN 0.91.3 References: <3160su$k6u@charm.magnus.acs.ohio-state.edu> Sender: news@jura.sasa.gov.uk (Usenet) Lines: 33 Xref: biosci bionet.molbio.methds-reagnts:16729 bionet.molbio.rapd:711 In article <3160su$k6u@charm.magnus.acs.ohio-state.edu>, dsammata@magnus.acs.ohio-state.edu (Diana Sammataro) says: > >Dear Netters: > >I have just obtained some bees (mostly chitin and little muscle tissue) from a >archeological site. They are around 800 years old and I wish to extract the >DNA, if any, that may be there. I have done RAPDs on bees and mites but I don't >know how to extract this old DNA. > >Suggestions would be helpful. Thanks in advance. > >Diana Sammataro >Ohio State University >Dept. Entomology >1735 Neil Ave >Columbus, OH 43210 1220 > >Phone: 614 292 9089 A good source of info for this kind of thing is the Ancient DNA Newsletter. This is available from Dr R. K. Wayne Institute of Zoology Zoological Society of London Regent's Park London NW1 4RY Kevin O'Donnell Scottish Agricultural Science Agency Edinburgh Scotland From owner-rapd@net.bio.net Thu Jul 28 23:00:00 1994 Path: biosci!agate!howland.reston.ans.net!EU.net!sunic!trane.uninett.no!daresbury!not-for-mail From: "Dr. G.W.Griffith" Newsgroups: bionet.molbio.rapd Subject: 11/12-mer primers Date: 29 Jul 1994 18:58:56 +0100 Lines: 15 Sender: lpddist@mserv1.dl.ac.uk Distribution: bionet Message-ID: <31bg10$pfj@mserv1.dl.ac.uk> Original-To: rapd@dl.ac.uk (BIONET.MOLBIO RAPD) Fellow RAPDers, Has anybody tested the effect of making 11-mer or 12-mer primers based on existing, useful 10-mers? If anybody has tried this out, is the info published anywhere? Are there any commercial sources of 11/12-mers? Let me know if this topic has been discussed before on bionet.rapd (and approximately when) so that I can go and consult the archives. Cheers, Gareth Wyn Griffith University of Wales, Bangor BSS097@bangor.ac.uk From owner-rapd@net.bio.net Thu Jul 28 23:00:00 1994 Path: biosci!med.cam.ac.uk!rafalski From: rafalski@med.cam.ac.uk (Dr Antoni Rafalski) Newsgroups: bionet.molbio.rapd Subject: DNA concentration Date: 29 Jul 1994 02:28:01 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 10 Sender: daemon@net.bio.net Distribution: world Message-ID: <9407290715.AA02309@fugu.med.cam.ac.uk> NNTP-Posting-Host: net.bio.net In response to a question by Naresh Pancholi, It is liely that your DNA prep contains both DNA and RNA (most miniprep methods isolate a mixture of both, with about 10x more RNA then DNA), so you measure both DNA and RNA with the spectrophotometer, and mostly DNA with a fluorimeter. It is best to calibrate your RAPDs by running a dilution series over a wide range of concentratioons, and use whatever works best for your particular DNA. Antoni Rafalski From owner-rapd@net.bio.net Sat Jul 30 23:00:00 1994 Path: biosci!MED.PITT.EDU!rapr From: rapr@MED.PITT.EDU (Robert Preston) Newsgroups: bionet.molbio.rapd Subject: ammonium in PCR revisited Date: 30 Jul 1994 23:34:24 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 19 Sender: daemon@net.bio.net Distribution: world Message-ID: <9407301332.AA07216@venus.med.pitt.edu> NNTP-Posting-Host: net.bio.net Hi, netfolks. A couple of days ago I raised the spectre of NH3 loss from PCR buffers possibly causing a pH drop in some systems, and showed that that was not a problem in PE9600 microamp tubes with strip caps. It now occurs to me that (NH4)2SO4 in PCR buffers might actually PREVENT the drop in pH at high temperatures that is caused by the temperature- dependence of the pK of tris. The pKa of NH4+ is 9.2, so buffers that contain high levels of NH4+ relative to tris, and are adjusted to pH 8.5-9.5 at room temp, should remain relatively alkaline compared to tris buffers that lack (NH4)2SO4. If, as Wayne Barnes suggested, depurination at non-alkaline pH is a yield-limiting factor in LA-PCR, then the use of (NH4)2SO4 rather than KCl is possibly essential for that reason. (I am assuming that the pKa of NH4+ lacks the screwy temperature-dependence seen with tris - need to look that up yet - does anyone know?) Rob Preston rapr@med.pitt.edu