From owner-recombination@net.bio.net Sun Jun 02 23:00:00 1996 Path: biosci!rutgers!uwm.edu!vixen.cso.uiuc.edu!sdd.hp.com!hamblin.math.byu.edu!acs2.byu.edu!news.cuny.edu!msvax.mssm.edu!MING From: ming@msvax.mssm.edu Newsgroups: bionet.molbio.methds-reagnts,bionet.molbio.proteins,bionet.molbio.recombination,bionet.molbio.yeast Subject: Re: WE NEED YOUR INPUT Date: 3 Jun 1996 20:37:11 GMT Organization: Mount Sinai Medical Center, New York City Lines: 26 Message-ID: <4ovidn$pmh@news.cuny.edu> References: <4otll5$3ni$6@mhade.production.compuserve.com> Reply-To: ming@msvax.mssm.edu NNTP-Posting-Host: msvax.mssm.edu Xref: biosci bionet.molbio.methds-reagnts:45262 bionet.molbio.proteins:8027 bionet.molbio.recombination:194 bionet.molbio.yeast:5359 In article <4otll5$3ni$6@mhade.production.compuserve.com>, Survey Administration <74750.1341@CompuServe.COM> writes: >Please excuse this brief intrusion, but we are trying to locate >any and all holders of academic degrees conferred within the last >ten (10) years. > >The Kitty Knight Corporation, Boston, MA, is currently searching >for qualified individuals to participate in a ***PAID*** study >focusing on post-secondary, graduate, and professional education >in the United States. > >Holders of ALL types of degrees in ALL fields of study are needed. > We would like to hear from you as long as your degree was earned >at an accredited institution in the United States. > >After an initial screening, qualified participant will be asked to >complete a questionaire of approx 150 questions. Everyone who >completes the survey will receive a $100 stipend. Naturally, >*ALL* information will be held in the strictest confidence. > >To express interest, please send your name, mailing address, and >photocopies of **ALL** degrees you have earned to: The Kitty >Knight Corporation, Attn: Study 96-3H, Back Bay Annex, P O Box >546, Boston, MA 02117. (If not obvious from the degree, please >indicate the field of study.) > >Thank You Very Much! From owner-recombination@net.bio.net Sun Jun 02 23:00:00 1996 Path: biosci!bcm.tmc.edu!cs.utexas.edu!chi-news.cic.net!news.compuserve.com!news.production.compuserve.com!news From: Survey Administration <74750.1341@CompuServe.COM> Newsgroups: bionet.molbio.methds-reagnts,bionet.molbio.proteins,bionet.molbio.recombination,bionet.molbio.yeast Subject: WE NEED YOUR INPUT Date: 3 Jun 1996 03:20:05 GMT Organization: Kitty Knight Corporation Lines: 25 Message-ID: <4otll5$3ni$6@mhade.production.compuserve.com> Xref: biosci bionet.molbio.methds-reagnts:45225 bionet.molbio.proteins:8022 bionet.molbio.recombination:193 bionet.molbio.yeast:5356 Please excuse this brief intrusion, but we are trying to locate any and all holders of academic degrees conferred within the last ten (10) years. The Kitty Knight Corporation, Boston, MA, is currently searching for qualified individuals to participate in a ***PAID*** study focusing on post-secondary, graduate, and professional education in the United States. Holders of ALL types of degrees in ALL fields of study are needed. We would like to hear from you as long as your degree was earned at an accredited institution in the United States. After an initial screening, qualified participant will be asked to complete a questionaire of approx 150 questions. Everyone who completes the survey will receive a $100 stipend. Naturally, *ALL* information will be held in the strictest confidence. To express interest, please send your name, mailing address, and photocopies of **ALL** degrees you have earned to: The Kitty Knight Corporation, Attn: Study 96-3H, Back Bay Annex, P O Box 546, Boston, MA 02117. (If not obvious from the degree, please indicate the field of study.) Thank You Very Much! From owner-recombination@net.bio.net Sun Jun 02 23:00:00 1996 Path: biosci!bcm.tmc.edu!pendragon!news.msfc.nasa.gov!newsfeed.internetmci.com!in2.uu.net!taligent!ames!news.tulane.edu!news.starnet.net!newsreader.wustl.edu!biodec.wustl.edu!graham From: graham@biodec.wustl.edu (James Graham) Newsgroups: bionet.molbio.methds-reagnts,bionet.molbio.proteins,bionet.molbio.recombination,bionet.molbio.yeast Subject: Re: WE NEED YOUR INPUT Date: 3 Jun 1996 16:51:09 -0500 Organization: Washington University Biology, St. Louis, MO Lines: 12 Message-ID: References: <4otll5$3ni$6@mhade.production.compuserve.com> NNTP-Posting-Host: @biodec.wustl.edu X-Newsreader: NN version 6.5.0 #1 (NOV) Xref: biosci bionet.molbio.methds-reagnts:45267 bionet.molbio.proteins:8029 bionet.molbio.recombination:195 bionet.molbio.yeast:5360 > To express interest, please send your name, mailing address, and > photocopies of **ALL** degrees you have earned to: Careful folks. Why would it be necessary to send actual copies of anything in order to merely "express interest" in a survey? (They're probalby building a directed marketing database from the information you send "expressing interest".) Jim J. Graham PhD Biology Department From owner-recombination@net.bio.net Mon Jun 03 23:00:00 1996 Path: biosci!ODYSSEE.NET!dellaire From: dellaire@ODYSSEE.NET (Graham Dellaire) Newsgroups: bionet.molbio.recombination Subject: Long-Pcr... Experiences and suggestions?? Date: 3 Jun 1996 19:08:59 -0700 Organization: McGill Div. of Experimental Medicine Lines: 23 Sender: daemon@net.bio.net Distribution: world Message-ID: <31B397C2.2D9E@odyssee.net> NNTP-Posting-Host: net.bio.net Hello all, I am going to do some PCR cloning and I need to amplify a 2.5 kb piece of DNA from one plasmid to clone into another. I want to use one specific 20 mer and another 30mer with 20 bases specific and 10 more that contain a specific AscI site for cloning (gc rich). I am thinking about using Vent pol. but I have never amplified anything over 1Kb... Any suggestions on primer design... should I have the AscI site internal or is it better on the 5' end?? What are the pitfalls I should watch out for... besides standardizing my Mg conc and nucleotides?? I heard that the extension times should be increased... aproximately 1 minute/Kb....? Thanks for any and all suggestions, Graham Dellaire McGill Dept. of Medicine Div. Of Experimental Medicine dellaire@odyssee.net From owner-recombination@net.bio.net Wed Jun 05 23:00:00 1996 Path: biosci!rutgers!netnews.upenn.edu!dsinc!newsfeed.pitt.edu!newsflash.concordia.ca!torn!newsfeed.internetmci.com!in1.uu.net!01-newsfeed.univie.ac.at!03-newsfeed.univie.ac.at!news.tuwien.ac.at!atp6000.tuwien.ac.at!rams From: rams@atp6000.tuwien.ac.at (Ernesto Rams) Newsgroups: bionet.molbio.recombination Subject: Cuban microbiology publications Date: 6 Jun 1996 16:28:48 GMT Organization: Vienna University of Technology, Austria Lines: 133 Message-ID: <4p7100$3on@news.tuwien.ac.at> NNTP-Posting-Host: atp6000.tuwien.ac.at X-Newsreader: TIN [version 1.2 PL2] Elfos Scientiae publishes scientific books and journals on the following topics: - Human therapy with interferons, lymphokines, cytokines, growth factors, and other biomolecules; - molecular genetics, and recombinant DNA technology; - monoclonal antibodies, hybridomas, molecular immunology; - recombinant vaccines and new methods for diagnosis; - production and purification of recombinant molecules and biotechnological products; - scaling-up, downstream, process control and automatization; - application of recombinant DNA techniques and products in agriculture, animal science, and industry; - transgenesis. Our publications are: BIOTECNOLOGIA APLICADA This is a quarterly serial publication. It appeared in 1984 under the name of Interferon y Biotecnologia until 1989 (Vol. 6 No. 3) and since 1990 (Vol. 7 No. 1) it is published as BIOTECNOLOGIA APLICADA, sponsored by the Ibero-Latin-American Society of Biotechnology Applied to Health. It publishes original papers in the following sections: review articles, research articles, techniques, short reports, and focus. The Journal includes as well advertisements of products, services, courses, meetings and seminars. The articles are published in Spanish or English, indistinctly. The No. 1 of each volume contains the cumulative index of the preceding volume. ISSN 0864-4551 90-100 pages, 20 x 27 cm, chrome. English and/or Spanish. Prices (USD) Institutional Personal Subscriptions 1996: $75.00 $60.00 Separated issues: $24.00 $20.00 Back subscriptions: $48.00 $30.00 Back issues: $20.00 $16.00 ADVANCES IN MODERN BIOTECHNOLOGY This is a book series containing the structured short reports of the papers presented as oral or poster presentations in the Biotechnology Congresses of Havana. Their contents are divided in topics: therapy and disease prevention, monoclonal antibodies, immunotechnology and diagnosis, cellular and molecular biology, plant biotechnology, animal science, biotechnology industry, among others. Three volumes have been published: - volume 1, corresponds to the event organized in 1992. It contains 526 articles covering all the fields of modern biotechnology; - volume 2 (1994), with 450 papers, is related to biotechnology applied to human health; - volume 3 (1995), with 380 articles, is dedicated to a wide spectrum of biotechnology and its applications to agriculture, industry and animal science. 210-300 pages, 20 x 27 cm, bond, soft cover. In Spanish and/or English. Prices (USD) Vol. 1 (ISBN 959-235-001-9), 1992 $10.00 Vol. 2 (ISBN 959-235-002-7), 1994 $12.00 Vol. 3 (ISBN 959-235-003-5), 1995 $15.00 RECOMBINANT VACCINES FOR THE CONTROL OF CATTLE TICK This book addresses the important question of the control of ectoparasite employing new immunological approaches. The development of protective vaccines against Boophillus microplus, the first vaccine against ectoparasites and the first recombinant antiparasitic vaccine on the market is discussed in this book. Tick biology, antigen characterization, process design, analytical methods, computer simulation of both infestation and vaccination strategies and vaccine preclinical and clinical data collected in Australia, Canada, Colombia, Cuba and Mexico are presented in the book in an understandable way. The book, which is the first in the series Monograph published by Elfos Scientiae, is of interest for parasitologists, immunologists, veterinarians, molecular biologists, and engineers and biochemists involved in the design and characterization of new vaccines. The author, Dr. Jose de la Fuente, is the Director for Research and Development at the Center for Genetic Engineering and Biotechnology in Havana and is a member of the Cuban and New York Academies of Sciences. ISBN 959-235-005-1 242 p., 55 fig., 58 tab., 15 x 21 cm, soft cover. In English. Price: $30.00 USD ANTICUERPOS MONOCLONALES This book covers the basic theoretical elements and a detailed description of reproducible procedures of the technology for the generation of monoclonal antibodies secretory cells. This technique has revolutionized the possibilities of use of the immunoglobulins for research, diagnosis, therapy and industry. This book, first of the series Theory and Practice by Elfos Scientiae, is aimed for technicians and professional personnel interested in this technology. Its author, Jorge V. Gavilondo Cowley, works since 1982 on the obtainment of monoclonal antibodies from hybridomes. Dr. Gavilondo has published, in international scientific journals, over 80 articles related with Hodgkin's disease, tumoral transformation and dissemination, monoclonal antibodies and recombinant antibodies. He has been invited to collaborate and deliver conferences in scientific institutions and universities of more than twenty countries. He is a member of the Editorial Board of the journal BioTechniques and the Directive Boards of the Ibero-Latin-American Society of Biotechnology and the Cuban Society of Immunology. ISBN 959-235-004-3 180 p., 24 fig., 15 x 21 cm, soft cover. In Spanish. Price: $20.00 USD ---------------------------------------------------------------- Payments should be made by telegraph transfer by the equivalent of the amount to pay, according to the day's exchange rate, in any of the currencies and through one of following banks: Canadian Dollars National Bank of Canada, Montreal German Mark Deutsche Sudamerikanische Bank, Hamburg Pound Sterling National Westminster Bank, London Swiss Francs Union Bank of Switzerland, Zurich The transfers should be made to the Banco Financiero Internacional, S.A., Linea y O, Plaza, Havana, Cuba, to the account No. 402.01.8064 of the Centro de Ingenieria Genetica y Biotecnologia. Elfos Scientiae should be notified about the transfer data (date, amount, bank and purpose) and the correct address for delivery. ---------------------------------------------------------------- Elfos Scientiae ********************************* Telef: (53-7) 21-8164 / 21-6567 Nueva direccion de C-electronico 21-8008 / 21-8466 Fax (53-7) 21-8070 / 33-6008 elfos@cigb.edu.cu Apdo. 6072 La Habana 6 CP 10600 Cuba. New E-mail address ******************************** From owner-recombination@net.bio.net Thu Jun 06 23:00:00 1996 Path: biosci!rutgers!csn!nntp-xfer-1.csn.net!imci3!newsfeed.internetmci.com!torn!newshost.uwo.ca!usenet From: Jeff Clarke Newsgroups: bionet.molbio.recombination Subject: conjugation, transformation, and transduction Date: 7 Jun 1996 08:34:08 GMT Organization: The University of Western Ontario, London, Ont. Canada Lines: 9 Message-ID: <4p8pi0$5e4@falcon.ccs.uwo.ca> NNTP-Posting-Host: ts3-5.slip.uwo.ca Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Authenticated: jclarke@ts3-5.slip.uwo.ca X-Mailer: Mozilla 1.1N (Windows; I; 16bit) To: anyone I was wondering if anyone out there could give me their opinion on what they think is the most effective way of aquiring new genetic information: conjugation, transformation, or transduction? I would really appreciate your input. Jeff From owner-recombination@net.bio.net Thu Jun 06 23:00:00 1996 Path: biosci!rutgers!csn!nntp-xfer-1.csn.net!carbon!night.primate.wisc.edu!sdd.hp.com!swrinde!news.uh.edu!usenet From: benedik@uh.edu (Michael Benedik) Newsgroups: bionet.molbio.recombination Subject: Re: conjugation, transformation, and transduction Date: 7 Jun 1996 15:11:35 GMT Organization: University of Houston Lines: 25 Sender: benedik@menudo.uh.edu. Message-ID: <4p9gr7$l4h@masala.cc.uh.edu> References: <4p8pi0$5e4@falcon.ccs.uwo.ca> NNTP-Posting-Host: moose.bchs.uh.edu X-Newsreader: InterNews 2.0@moose.bchs.uh.edu.[R] X-Authenticated: benedik on POP host menudo.uh.edu. In article <4p8pi0$5e4@falcon.ccs.uwo.ca> Jeff Clarke writes: > I was wondering if anyone out there could give me their opinion on what > they think is the most effective way of aquiring new genetic information: > conjugation, transformation, or transduction? I would really appreciate > your input. > > Jeff > > This isn't a question that can be answered that easily because it is case dependent. For example, do you mean in nature or in the lab? If in nature, what bacteria, for example E. coli is not naturably transformable, Bacillus is, therefore the answer may be very different depending upon the organism. Give the specifics of what you are thinking about and someone might be able to answer your question. Michael Benedik Department of Biochemical Sciences University of Houston benedik@uh.edu From owner-recombination@net.bio.net Thu Jun 06 23:00:00 1996 Path: biosci!ODYSSEE.NET!dellaire From: dellaire@ODYSSEE.NET ("Graham Dellaire") Newsgroups: bionet.molbio.recombination Subject: RE: conjugation, transformation, and transduction Date: 7 Jun 1996 05:55:49 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 50 Sender: daemon@net.bio.net Distribution: world Message-ID: <199606071258.IAA28447@atlas.odyssee.net> NNTP-Posting-Host: net.bio.net ---------- > From: Jeff Clarke > To: recom@net.bio.net; anyone@net.bio.net > Subject: conjugation, transformation, and transduction > Date: Friday, June 07, 1996 4:34 AM > > I was wondering if anyone out there could give me their opinion on what > they think is the most effective way of aquiring new genetic information: > conjugation, transformation, or transduction? I would really appreciate > your input. > > Jeff > Dear Jeff, What do you mean by effective? From what point of view, from the bench (as creating a transgenic mouse or cell line), in the real world (as in viral, bacterial, protozoan systems) or from the point of view of gene therapy approaches? Viral transduction is certainly highly efficient but not necessarily effective in the case of targeting a specific gene. IF you just want to get a gene into a cell without caring where it goes or in how many copies than viral transduction is great. Different forms of transfection (I prefer this terms as, for me, transformation carries the connotation of oncogenic change) can be very "effective" (or as good as it gets right now) to targeting specific genes. Conjugation for many types of bacteria and protazoans seems to work just fine in spreading genes through a population.... just think about how fast antibiotic resistance spreads. If you define what "effective" is in the system(s) you are interested in then maybe people may be able to contribute specific suggestions and comments. (this is a thinnly veiled plea that someone else could try to field a question...hehe) G. Dellaire McGill University Dept of Medicine Div. of Experimental Medicine From owner-recombination@net.bio.net Sun Jun 09 23:00:00 1996 Path: biosci!agate!howland.reston.ans.net!psinntp!psinntp!psinntp!usenet From: lanier@pipeline.com Newsgroups: bionet.molbio.recombination Subject: Re: conjugation, transformation, and transduction Date: 10 Jun 1996 01:17:34 GMT Organization: PSINet/Pipeline USA Lines: 61 Message-ID: <4pft3e$c9t@news2.h1.usa.pipeline.com> References: <4p8pi0$5e4@falcon.ccs.uwo.ca> NNTP-Posting-Host: 38.8.231.5 In article <4p8pi0$5e4@falcon.ccs.uwo.ca>, Jeff Clarke writes: >I was wondering if anyone out there could give me their opinion on what >they think is the most effective way of aquiring new genetic information: > conjugation, transformation, or transduction? ***** I have looked at the other responses to your question. I agree that you have been unclear in your question. The way you phrase the question, however, suggests that you are not interested in the research problem of how to effectively carry out mating experiments or in the building of new strains, but, rather, are interested in which mechanism might be more effective in spreading genes in a natural population of bacteria. Phrased in this way, I read your question as: What is the most effective way a bacterium in its natural environment acquires new genetic information? Or... What is the most effective way a new gene spreads in a natural bacterial population? Both of these questions depend upon defining the species and natural environment. For example, we assume the natural environment for Escherichia coli is the mammalian gut. It is likely that all three mechanisms operate for E. coli (since calcium may be present in the gut and is necessary for transformation in E. coli). Probably the most effective mode for spreading new genes in this environment and with this species, because of the dynamics of bacteriophage infection, is either transduction or plasmid transfection. Consider the spread of a gene for resistance among the gut flora in a human taking an antibiotic. Strong selection for antibiotic-resistant strains, coupled with the rapid infection cycle of, say, lambda bacteriophage, might quickly result in a resistant population. Even more likely is the spread of plasmids from other bacterial species which carry genes for resistance. The opportunity for spread of the same gene by conjugation or the rare event of transformation is much less. In this model, the role of transformation might be important in mobilizing the gene, however. One might imagine the very rare transformation of a resistance gene from species "A" to species "B", then transduction moving the gene rapidly among members of species "B". What is "efficient"? Without entry into species "B", there would be no opportunity for rapid movement by transduction. Consider Bacillus subtilis in soil, however. It is likely that transformation and transduction are not only the most effective in spreading new genes, but the only major modes for spreading new genes. The population size would be dramatically different, the mode of spread from one part of the environment to another is different, and "efficient" may have a very different meaning. Mixed populations of bacteria in other environments become much more problematic. This area is not without literature. I don't have handy any references for you, but I suggest examining the reviews over the last 15-years. Wayne Lanier, PhD From owner-recombination@net.bio.net Tue Jun 11 23:00:00 1996 Path: biosci!rutgers!csn!nntp-xfer-1.csn.net!imci3!newsfeed.internetmci.com!howland.reston.ans.net!nntp.coast.net!swidir.switch.ch!swsbe6.switch.ch!scsing.switch.ch!news.belwue.de!news.uni-stuttgart.de!news From: "Igor M. Kulic" Newsgroups: bionet.molbio.recombination Subject: In vitro Integrase Systems Date: Wed, 12 Jun 1996 15:52:43 +0200 Organization: UNI-Stuttgart Lines: 18 Message-ID: <31BECBAB.41C6@cip.mathematik.uni-stuttgart.de> NNTP-Posting-Host: cip14.mathematik.uni-stuttgart.de Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 2.02 (X11; I; AIX 2) I have been searching for in VITRO INTEGRASE SYSTEMS that are already completely described with all cofactors needed in reactions . But the only Integrase System that I found in literature that is in vito extesively described seems to be Lambda-Phage Integration (Acting in E.coli) with cofactors Xis,IHF and Fis . Does anyone of you know any other similar systems that are described in in vitro reactions ? We do some extesive interdisciplidary research on complex in vitro recombinations and are presently trying to produce simple topological networks with desired strucure ,and we needed several nonhomologous Integartion systems to test and extend our results ! If anyone should know any useful reference (review article ) that could help or maybe a comercial company that sells different in vitro Integation Systems (with all cofactors required ) I would be vary thatkful to you ! Kindly yours Igor From owner-recombination@net.bio.net Thu Jun 13 23:00:00 1996 Path: biosci!ihnp4.ucsd.edu!munnari.OZ.AU!metro!metro!asstdc.scgt.oz.au!nsw.news.telstra.net!act.news.telstra.net!psgrain!newsfeed.internetmci.com!swrinde!news.uh.edu!usenet From: benedik@uh.edu (Michael Benedik) Newsgroups: bionet.molbio.recombination Subject: Re: In vitro Integrase Systems Date: 14 Jun 1996 16:07:34 GMT Organization: University of Houston Lines: 34 Sender: benedik@menudo.uh.edu. Message-ID: <4ps2o6$que@masala.cc.uh.edu> References: <31BECBAB.41C6@cip.mathematik.uni-stuttgart.de> NNTP-Posting-Host: moose.bchs.uh.edu X-Newsreader: InterNews 2.0@moose.bchs.uh.edu.[R] X-Authenticated: benedik on POP host menudo.uh.edu. In article <31BECBAB.41C6@cip.mathematik.uni-stuttgart.de> "Igor M. Kulic" writes: > I have been searching for in VITRO INTEGRASE SYSTEMS that are > already completely described with all cofactors needed in reactions . > But the only Integrase System that I found in literature that is in > vito extesively described seems to be Lambda-Phage Integration (Acting > in E.coli) with cofactors Xis,IHF and Fis . > Does anyone of you know any other similar systems that are described > in in vitro reactions ? > We do some extesive interdisciplidary research on complex in vitro > recombinations and are presently trying to produce simple topological > networks with desired strucure ,and we needed several nonhomologous > Integartion systems to test and extend our results ! > If anyone should know any useful reference (review article ) that > could help or maybe a comercial company that sells different in vitro > Integation Systems (with all cofactors required ) I would be vary > thatkful to you ! > > Kindly yours > Igor There are a number of systems: Cre/lox system of P1 Xer/Cer system Flp Michael Benedik Department of Biochemical Sciences University of Houston benedik@uh.edu From owner-recombination@net.bio.net Sun Jun 16 23:00:00 1996 Path: biosci!ERE.UMontreal.CA!szat From: szat@ERE.UMontreal.CA (Szatmari George) Newsgroups: bionet.molbio.recombination Subject: Re: In vitro Integrase Systems (fwd) Date: 17 Jun 1996 07:26:55 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 57 Sender: daemon@net.bio.net Distribution: world Message-ID: <199606171421.KAA28443@cyclone.ERE.UMontreal.CA> NNTP-Posting-Host: net.bio.net Forwarded message: > From BIOSCI-REQUEST@net.bio.net Fri Jun 14 13:47:41 1996 > To: recom@net.bio.net > From: benedik@uh.edu (Michael Benedik) > Subject: Re: In vitro Integrase Systems > Date: 14 Jun 1996 16:07:34 GMT > Sender: benedik@menudo.uh.edu > Message-ID: <4ps2o6$que@masala.cc.uh.edu> > NNTP-Posting-Host: moose.bchs.uh.edu > X-Newsreader: InterNews 2.0@moose.bchs.uh.edu.[R] > X-Authenticated: benedik on POP host menudo.uh.edu. > > In article <31BECBAB.41C6@cip.mathematik.uni-stuttgart.de> > "Igor M. Kulic" writes: > > > I have been searching for in VITRO INTEGRASE SYSTEMS that are > > already completely described with all cofactors needed in reactions . > > But the only Integrase System that I found in literature that is in > > vito extesively described seems to be Lambda-Phage Integration (Acting > > in E.coli) with cofactors Xis,IHF and Fis . > > Does anyone of you know any other similar systems that are described > > in in vitro reactions ? > > We do some extesive interdisciplidary research on complex in vitro > > recombinations and are presently trying to produce simple topological > > networks with desired strucure ,and we needed several nonhomologous > > Integartion systems to test and extend our results ! > > If anyone should know any useful reference (review article ) that > > could help or maybe a comercial company that sells different in vitro > > Integation Systems (with all cofactors required ) I would be vary > > thatkful to you ! > > > > Kindly yours > > Igor > > There are a number of systems: > > Cre/lox system of P1 > Xer/Cer system > Flp > > > > Michael Benedik > Department of Biochemical Sciences > University of Houston > benedik@uh.edu > There are also the resolvase/invertase systems, like Tn3, Tn1000 (gamma-delta), gin, hin, pin, cin invertases, etc. George Szatmari Microbiologie, Univ de Montreal szat@ere.umontreal.ca From owner-recombination@net.bio.net Mon Jun 17 23:00:00 1996 Path: biosci!internet!biosci!not-for-mail From: biohelp (BIOSCI Administrator) Newsgroups: bionet.molbio.recombination Subject: IMPORTANT - BIOSCI Fundraising Update! Date: 18 Jun 1996 02:00:56 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 154 Sender: daemon@net.bio.net Distribution: world Message-ID: <199606180900.CAA23171@net.bio.net> NNTP-Posting-Host: net.bio.net BIOSCI is about halfway to its funding goal!! I'm interrupting the usual monthly posting of the BIOSCI miniFAQ to bring you up to date on BIOSCI fundraising progress, a topic of concern to your future use of this resource. Thank you in advance for taking the time to read this message carefully. Last year we announced that BIOSCI was going to adopt the U.S. Public Broadcasting System model to fund its operations after our DOE/NSF grant runs out later this year. Unlike PBS, we are not soliciting contributions from users; we are only selling ads on our Web pages solely to cover our operating costs. Our goal is to seek sponsorships until we build up an operating reserve of about $100,000 and then cease further promotions until we need to build the reserve back up. (The accountants among our readership will be familiar with the problem of deferred revenue which we can not safely utilize until ads have been displayed for a period of time.) We are only about halfway to our funding goal and need to raise further funds to avoid having to curtail services at net.bio.net. Fundraising is time-consuming, however, and we need your help as explained further below. Our operating costs consist of our network connection, phone lines, hardware maintenance (we will be getting newer and faster hardware soon!), plus 0.7 FTE of salaries covering UNIX systems admin, technical support, quality assurance, i.e., testing, of our system, and administrative costs (such as the time it takes to actually find/write/call potential sponsors and raise money!). Although the BIOSCI staff does get compensated for a portion of the work that they do, this project has always received a lot of free after-hours and "vacation" time labor, so we hope that no one will begrudge the time that we do charge to the project to serve you. All of the three part-time staff members, Dave Mack, Julie Lawrence, and myself, have full time day jobs and families in addition to working hard to keep this service running for all of you. Julie and Dave Mack are subcontractors for BIOSCI; my time that is charged to the project defrays a portion of my regular salary instead of adding to my income. Besides having to relocate the project, we were very busy this last year building new infrastructure such as our WWW hypermail interface to the system. This was released last December along with scores of WAIS indices for the newsgroups. Virtually everything is complete, although we do continue to find and fix bugs (many through your helpful feedback!). We are still having some problems with our WAIS indexing. The archives continue to grow rapidly. We are running over 100 indexes now versus three previously and any systems crashes cause greater havoc with the indexing than before! We are still working to fix this as fast as our resources permit and appreciate your patience, but we have been able to automate a lot of the infrastructure to reduce labor as compared to past requirements. We have also implemented new software to make moderation of BIOSCI/bionet newsgroups much easier and combat the growing problem of Internet junk mail and USENET "spamming." About 20% of our groups are now moderated, many of them by the BIOSCI staff! This, for example, made a major difference last year in the quality of content in our EMPLOYMENT/bionet.jobs.offered newsgroup which many commercial concerns and recruiting firms are using **without charge** to recruit candidates for positions in the biological sciences. We are also now in a position to have sponsors for individual newsgroups as you will have noticed if you have visited http://www.bio.net/ and clicked on "Access the BIOSCI/bionet newsgroups" recently. So, how can you help?? ---------------------- As noted above it can take a lot of time to contact potential sponsors if I have to do it all myself. Our request is quite simple. You can do two important things which will take very little time for you individually. First, please use our WWW system at http://www.bio.net/ to access the archives. You can now post or reply to messages via your Web browser. Your usage helps attract sponsors. If you contact any of our sponsors, please be sure to thank them for supporting BIOSCI. It is critical for them to get this feedback if they are to continue their sponsorship for the long term. Second, if you work for a company or organization that provides products or services of interest to the biology community, please pass this message on to your marketing or marketing communications department or other appropriate group. Please ask them to help support BIOSCI by sponsoring our Web site and explain the uses and benefits of the system to the biology community. If they are interested, they can then contact us for further information at our tech support address, biosci-help@net.bio.net. Our hope is to quickly raise several large corporate/institutional sponsors on our heavily-used WWW locations (some stats appended below), and then end this sponsorship campaign so that our resources can continue to be used for service provision, not fundraising. Many of our specialty newsgroup WWW archives are still used by small communities of scientists (and they haven't been heavily promoted yet). While these may be valuable niche markets to some advertisers, it will generate more labor and overhead having to find these sponsors, fairly price the locations, and deal with lots of smaller sponsorships than fewer mid-to large sponsors. We are striving to keep our operation as lean and efficient as possible since we are not trying to make careers out of running BIOSCI. We are trying if at all possible to avoid the administrative overhead entailed with processing lots of small payments to reach our fundraising goals. I'd like to thank all of you for your help in advance. In helping us, you are also helping yourselves, not only in keeping this resource available for all of the both large and small research communities that we serve, but also by alleviating the need for us to go back and compete with researchers for tight grant dollars! We promised NSF when we were awarded the BIOSCI grant that we would carry out this mission to make the service self-supporting. With your help, we will succeed in continuing BIOSCI's work into its second decade. Thank you very much! Sincerely, Dave Kristofferson BIOSCI/bionet Manager biosci-help@net.bio.net A list of our prime WWW sponsorship locations follow. Please contact us for further details. ---------------------------------------------------------------------- The overall BIOSCI WWW pages are currently visited by users from close to 5500 unique computer hosts per week. Web servers only log the Internet computer/host name and frequently more than one individual can connect to us from a particular host. Main home page, http://www.bio.net, visited recently by about 2100 unique hosts per week Main Newsgroups archives page, http://www.bio.net/archives.html, visited recently by about 1200 Unique hosts per week BIO-JOURNALS archive page, http://www.bio.net/BIO-JOURNALS.html, visited recently by about 1000 unique hosts per week. EMPLOYMENT archive pages: http://www.bio.net:80/hypermail/EMPLOYMENT/ and monthly header pages, visited recently by about 800 unique hosts per week. Address database search page, http://www.bio.net/addrsearch.html, visited recently by about 450 unique hosts per week. Methods newsgroup archive pages, http://www.bio.net:80/hypermail/METHDS- REAGNTS/ and monthly header pages, visited recently by about 350 unique hosts per week. Ads can also be displayed on various combinations of other BIOSCI/bionet newsgroups. Please contact us at biosci-help@net.bio.net for details. ---------------------------------------------------------------------- From owner-recombination@net.bio.net Wed Jun 19 23:00:00 1996 Newsgroups: bionet.molbio.recombination Path: biosci!daresbury!bioftp.unibas.ch!infobiogen.fr!jussieu.fr!oleane!tank.news.pipex.net!pipex!usenet.eel.ufl.edu!arclight.uoregon.edu!news.sprintlink.net!news-stk-200.sprintlink.net!EU.net!usenet2.news.uk.psi.net!uknet!usenet1.news.uk.psi.net!uknet!uknet!bcc.ac.uk!news From: Paul Wells Subject: PRACTICAL INTRODUCTION TO GENETIC ENGINEERING COURSE Message-ID: <1996Jun20.101140.53462@ucl.ac.uk> Date: Thu, 20 Jun 1996 10:11:40 GMT Organization: University College London Lines: 33 A one week practical course designed to teach the basic techniques in genetic engineering will be held from 5-9 August 1996 at the Dept. of Biochemistry and Molecular Biology University College London. A "hands on" approach will enable scientists from higher education and industry, clinicians and research workers who have had no practical experience of recombinant DNA technology to set up such techniques in their own laboratories. Techniques to be covered will include, Southern hybridisation DNA sequencing, PCR, and analysis of cloned DNA using enzyme restriction mapping. Course fee 850 pounds sterling (650 for full time postgraduate students) exclusive of accomodation. Bed and breakfast accomodation for the period of the course can be provided in a local hall of residence for 111 pounds sterling from Sunday 4th August until 10th August. Write for application forms and further details to: Dr. John Ward Department of Biochemistry & Molecular Biology University College London Gower Street London WC1E 6BT Fax: 0171 380 7193 Or e-mail either:- ward@bsm.bioc.ucl.ac.uk p.wells@ucl.ac.uk From owner-recombination@net.bio.net Wed Jun 19 23:00:00 1996 Path: biosci!ODYSSEE.NET!dellaire From: dellaire@ODYSSEE.NET ("Graham Dellaire") Newsgroups: bionet.molbio.recombination Subject: REPOST: GENE TARGETING VECTORS (Chris Patzy) Date: 19 Jun 1996 17:06:35 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 982 Sender: daemon@net.bio.net Distribution: world Message-ID: <199606200010.UAA13005@atlas.odyssee.net> NNTP-Posting-Host: net.bio.net Reposted from bionet.molbio.methds-regnts Gene targeting vectors Chris Paszty (pasz@mh1.lbl.gov) 19 Jun 1996 01:38:07 -0700 Messages sorted by: [ date ][ thread ][ subject ][ author ] Next message: P.-A. Menoud: "Re: Silver Staining Protocol" Previous message: WLC dos-Santos: "Antibodies against hamster cells" To: methods@net.bio.net From: pasz@mh1.lbl.gov (Chris Paszty) Subject: Gene targeting vectors Date: 19 Jun 1996 01:38:07 -0700 Netters: There was a posting requesting information on gene knock-out strategies and targeting vectors...here are 2 e-mail documents that I had put together which deal with these topics...I've passed this information along by e-mailing it to labs that I knew were doing knock-outs but I'm sure I've missed alot of them. If you know of someone doing knock-outs please pass this document on to them as they may find it useful.\ October 1995 Gene targeters: A couple of years ago I compiled the sequences of the PGKneo and PGKtk cassettes that make up pPNT [ref: Tybulewicz et al. Cell vol 65 p1153- 1163 (1991)]. This compilation contained quite a bit of unpublished sequence data and vector construction info that I got from a number of labs (the PGK promoter and terminator sequences that are in GenBank contain errors). At any rate, there were a number of requests for copies of it so I ended up e-mailing it out to a bunch of knock-out labs. For practical purposes this document is now kind of generic in form in that it contains the sequence of pPNT, the sequences of 2 additional pPNT based vectors: pPN2T [ref: Paszty et al. Nature Genetics vol 11 p33-39 (1995)] and pPN2T-hGHterm (unpublished), as well as some general things to keep in mind when deciding on a targeting strategy and when building targeting vectors. Please pass this document on to any interested colleagues. My only request is that people pass out the whole thing so that those individuals/labs that contributed to it are acknowledged. Chris Paszty, Ph.D. Human Genome Center Lawrence Berkeley Laboratory 1 Cyclotron Rd., (MS 74-157) Berkeley, CA 94720...U.S.A. tel: (510) 486-7498 fax: (510) 486-6746 e-mail: c_paszty@csa2.lbl.gov Contributors of unpublished data/info: Garry Hannan, CSIRO, Australia: PGK-1 promoter and terminator sequences Victor Tybulewicz, MRC, England: details of construction of pPNT Karen Jardine and Michael McBurney, U. of Ottawa, Canada: details of construction of pKJ1 Some general info: pPNT is a pUC/Bluescript based vector...see Cell paper. The most effective way to use pPNT and pPNT-derivatives is to clone the short arm (1-2 kb) in-between the PGKneo cassette and the PGKtk cassette, and then to clone the long arm (6-11 kb) in-between the other side of the PGKneo cassette (PGK promoter side) and the unique Not I site. For electroporation the resulting targeting vector can then be linearized at the unique Not I site. In an effort to increase the effectiveness of positive-negative selection I've introduced a second same orientation PGKtk cassette into the single HindIII site of pPNT to create pPN2T. The apparent negative selection enrichment obtained with an alpha globin targeting vector (pPN2T-alphaKO ) based on pPN2T was 3-5 fold higher than that obtained with a variety of different single PGKtk based targeting vectors that had been electroporated and selected under identical conditions as those used for pPN2T-alphaKO ie. same lab, same E.S. cells, same feeder cells, same reagents and same protocols. Although this has not been rigorously tested it is likely that the additional PGKtk cassette present in pPN2T-alphaKO is responsible for the high apparent enrichment values obtained with this targeting vector. Creating a null allele knock-out for small genes is usually not too difficult as one can just delete the whole gene or most of it to guarantee achieving complete loss of gene function. However, for larger genes, particularly those who's genomic structure has not been well mapped out, creating this type of whole gene deletion can be time consuming and difficult. The targeting strategy we've been using for such large genes is to create as extensive a deletion as is practical in the 5' region of the gene. The deletion is designed so as to include the presumed translational initiator codon and at least 1 kb of sequence upstream from the ATG in an effort to delete the promoter and thereby shut down transcription. Permanently shutting down transcription is an extremely effective way to achieve complete loss of gene function. In situations where transcription isn't shut down and a full length but mutated mRNA is produced one runs the risk that the mutagenic (translational stop codons in 3 frames etc...) neo cassette might be removed by normal or alternative splicing pathways. This may result in a "leaky" mutation rather than a null mutation or, even worse, a dominant negative mutation. Because some genes have multiple promoters which may be quite a distance upstream of the ATG, deleting a 1 kb region upstream of the ATG, even if it does inactivate one of the promoters, might not cause a complete shut down of transcription. An additional "tool" for shutting down transcription is transcriptional termination. For this reason it is desirable to end up with a targeting event that results in the insertion of a polyA-signal/terminator in the same orientation as the transcription of the gene in question. For pPNT and pPN2T if one's long arm is 5' of one's short arm within the gene to be inactivated then the structure of the final targeting event puts the PGKneo cassette in the same transcriptional orientation as that of the gene's. In this case, transcripts originating from the gene's promoter(s) will terminate at the PGK polyA-signal/terminator that is part of the PGKneo cassette. This leaves any downstream exons untranscribed and thus increases the probability of creating a null allele. However, for pPNT and pPN2T, if one's short arm is 5' of one's long arm within the gene to be inactivated then the structure of the final targeting event will put the PGKneo cassette in reverse transcriptional orientation with respect to that of the gene's. Thus the extra protection against the production of a "leaky" allele that is afforded by the premature termination of any transcripts originating from the gene's promoter(s) is lost. To retain the feature of transcriptional termination for this configuration of long and short arms we've introduced the polyA-signal/terminator from the human growth hormone N gene into pPN2T to create pPN2T-hGHterm. Although this is a human and not a murine polyA-signal/terminator, it is highly homologous to other mammalian growth hormone polyA-signal/terminators and has been extensively used in adenovirus based gene therapy vectors in mice, so it should work just fine for terminating transcription. The standard null allele type knock-out is usually the most straight forward to generate, however other approaches that should be considered are: 1) The inclusion of a reporter gene, such as lacZ (for example: Le Mouellic et al 1992 Cell vol 69, p246-251; Mountford et al 1994 PNAS vol 91 p4303-4307) in one's targeting vector. This allows one to examine the spatial and temporal pattern of gene expression of the targeted gene and also to follow cell fate. 2) A conditional knock-out using Cre-loxP (Gu et al 1994 Science vol 265 p103-106; Kuhn et al 1995 Science vol 269, p1427-1429) and/or FLP-frt (Fiering et al 1995 Genes and Development vol 9, p2203-2213). Cell fate can also be followed using these recombinase systems. Other variations on the basic knock-out theme will undoubtedly be developed in the future, so it's wise to check the latest literature. The particular approach one decides on is based on what information one is interested in, as well as how much of a hurry one is in. The standard null allele type is still the simplest and quickest to make. For many genes a fair amount of information can be gotten from a null allele knock-out. If one is still intrigued then a subsequent fancier knock-out can be generated. The sequences and reference points for pPNT, pPN2T and pPN2T-hGHterm are as follows: Reference points for the pPNT sequence (bprs): 7-23 T3 promoter in pBluescript SK(+) 54-61 single NotI site in pPNT 71-78 single Sse8387I site in pPNT 81-587 EcoRI(destroyed)-TaqI fragment of PGK-1 promoter 589-1418 PstI-HincII(destroyed) neo gene containing frag from pKJ1deltaB (derived from pKJ1 which was derived from pMC1neo). 600-602 neo start codon 1401-1403 neo stop codon 1419-1883 PvuII(destroyed)-HindIII(filled) frag of PGK-1 terminator 1914-1919 single EcoRI site in pPNT 1914-2421 EcoRI-TaqI fragment of PGK-1 promoter 2423-4253 PstI-PvuII(destroyed) frag from HSV-1 containing the tk gene. 2519-2521 tk start codon 3647-3649 tk stop codon 4257-4714 PstI-HindIII fragment of PGK-1 terminator 4714-7348 pUC18/Bluescript SK+ vector backbone pPNT sequence: GCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCGGT GGCGGCCGCTCGAGGGCCCCTGCAGGTCAATTCTACCGGGTAGGGGAGGCGC TTTTCCCAAGGCAGTCTGGAGCATGCGCTTTAGCAGCCCCGCTGGCACTTGGC GCTACACAAGTGGCCTCTGGCCTCGCACACATTCCACATCCACCGGTAGCGC CAACCGGCTCCGTTCTTTGGTGGCCCCTTCGCGCCACCTTCTACTCCTCCCCTA GTCAGGAAGTTCCCCCCCGCCCCGCAGCTCGCGTCGTGCAGGACGTGACAAA TGGAAGTAGCACGTCTCACTAGTCTCGTGCAGATGGACAGCACCGCTGAGCA ATGGAAGCGGGTAGGCCTTTGGGGCAGCGGCCAATAGCAGCTTTGCTCCTTC GCTTTCTGGGCTCAGAGGCTGGGAAGGGGTGGGTCCGGGGGCGGGCTCAGGG GCGGGCTCAGGGGCGGGGCGGGCGCGAAGGTCCTCCCGAGGCCCGGCATTCT CGCACGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTTCCTCATCTCC GGGCCTTTCGACCTGCAGCCAATATGGGATCGGCCATTGAACAAGATGGATT GCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGG GCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGC AGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAA CTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTT GCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATT GGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAG AAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGG CTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTAC TCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAG GGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACG GCGATGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTG GAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGG ACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGG CGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATT CGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGGGGATCGA TCCGTCCTGTAAGTCTGCAGAAATTGATGATCTATTAAACAATAAAGATGTCC ACTAAAATGGAAGTTTTTCCTGTCATACTTTGTTAAGAAGGGTGAGAACAGA GTACCTACATTTTGAATGGAAGGATTGGAGCTACGGGGGTGGGGGTGGGGTG GGATTAGATAAATGCCTGCTCTTTACTGAAGGCTCTTTACTATTGCTTTATGA TAATGTTTCATAGTTGGATATCATAATTTAAACAAGCAAAACCAAATTAAGG GCCAGCTCATTCCTCCCACTCATGATCTATAGATCTATAGATCTCTCGTGGGA TCATTGTTTTTCTCTTGATTCCCACTTTGTGGTTCTAAGTACTGTGGTTTCCA AATGTGTCAGTTTCATAGCCTGAAGAACGAGATCAGCAGCCTCTGTTCCAC ATACACTTCATTCTCAGTATTGTTTTGCCAAGTTCTAATTCCATCAGAAGCTG ACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTC TACCGGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGCGCTTTAG CAGCCCCGCTGGCACTTGGCGCTACACAAGTGGCCTCTGGCCTCGCACACA TTCCACATCCACCGGTAGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCTTCGC GCCACCTTCTACTCCTCCCCTAGTCAGGAAGTTCCCCCCCGCCCCGCAGCTCG CGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCACTAGTCTCGTGCA GATGGACAGCACCGCTGAGCAATGGAAGCGGGTAGGCCTTTGGGGCAGCGG CCAATAGCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGGAAGGGGTG GGTCCGGGGGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGCGGGCGCGAAGG TCCTCCCGAGGCCCGGCATTCTCGCACGCTTCAAAAGCGCACGTCTGCCGCGC TGTTCTCCTCTTCCTCATCTCCGGGCCTTTCGACCTGCAGCGACCCGCTTAACA GCGTCAACAGCGTGCCGCAGATCTTGGTGGCGTGAAACTCCCGCACCTCTTC GGCCAGCGCCTTGTAGAAGCGCGTATGGCTTCGTACCCCTGCCATCAACACG CGTCTGCGTTCGACCAGGCTGCGCGTTCTCGCGGCCATAACAACCGACGTAC GGCGTTGCGCCCTCGCCGGCAACAAAAAGCCACGGAAGTCCGCCTGGAGCAG AAAATGCCCACGCTACTGCGGGTTTATATAGACGGTCCCCACGGGATGGGGA AAACCACCACCACGCAACTGCTGGTGGCCCTGGGTTCGCGCGACGATATCGT CTACGTACCCGAGCCGATGACTTACTGGCGGGTGTTGGGGGCTTCCGAGACA ATCGCGAACATCTACACCACACAACACCGCCTCGACCAGGGTGAGATATCGG CCGGGGACGCGGCGGTGGTAATGACAAGCGCCCAGATAACAATGGGCATGC CTTATGCCGTGACCGACGCCGTTCTGGCTCCTCATATCGGGGGGGAGGCTGG GAGCTCACATGCCCCGCCCCCGGCCCTCACCCTCATCTTCGACCGCCATCCCA TCGCCGCCCTCCTGTGCTACCCGGCCGCGCGATACCTTATGGGCAGCATGACC CCCCAGGCCGTGCTGGCGTTCGTGGCCCTCATCCCGCCGACCTTGCCCGGCAC AAACATCGTGTTGGGGGCCCTTCCGGAGGACAGACACATCGACCGCCTGGCC AAACGCCAGCGCCCCGGCGAGCGGCTTGACCTGGCTATGCTGGCCGCGATTC GCCGCGTTTATGGGCTGCTTGCCAATACGGTGCGGTATCTGCAGGGCGGCGG GTCGTGGCGGGAGGATTGGGGACAGCTTTCGGGGGCGGCCGTGCCGCCCCAG GGTGCCGAGCCCCAGAGCAACGCGGGCCCACGACCCCATATCGGGGACACGT TATTTACCCTGTTTCGGGCCCCCGAGTTGCTGGCCCCCAACGGCGACCTGTAT AACGTGTTTGCCTGGGCTTTGGACGTCTTGGCCAAACGCCTCCGTCCCATGCA TGTCTTTATCCTGGATTACGACCAATCGCCCGCCGGCTGCCGGGACGCCCTGC TGCAACTTACCTCCGGGATGGTCCAGACCCACGTCACCACCCCAGGCTCCAT ACCGACGATCTGCGACCTGGCGCGCACGTTTGCCCGGGAGATGGGGGAGGCT AACTGAAACACGGAAGGAGACAATACCGGAAGGAACCCGCGCTATGACGGC AATAAAAAGACAGAATAAAACGCACGGGTGTTGGGTCGTTTGTTCATAAACG CGGGGTTCGGTCCCAGGGCTGGCACTCTGTCGATACCCCACCGAGACCCCAT TGGGACCAATACGCCCGCGTTTCTTCCTTTTCCCCACCCCAACCCCCAAGTTC GGGTGAAGGCCCAGGGCTCGCAGCCAACGTCGGGGCGGCAAGCCCTGCCAT AGCCACGGGCCCCGTGGGTTAGGGACGGGGTCCCCCATGGGGAATGGTTTAT GGTTCGTGGGGGTTATTATTTTGGGCGTTGCGTGGGGTCAGGTCCACGACTGG ACTGAGCAGACAGACCCATGGTTTTTGGATGGCCTGGGCATGGACCGCATGT ACTGGCGCGACACGAACACCGGGCGTCTGTGGCTGCCAAACACCCCCGACCC CCAAAAACCACCGCGCGGATTTCTGGCGCCGCCGGACGAACTAAACCTGACT ACGGCATCTCTGCCCCTTCTTCGCTGGTACGAGGAGCGCTTTTGTTTTGTATTG GTCACCACGGCCGAGTTTCCGCGGGACCCCGGCCAGGACCTGCAGAAATTGA TGATCTATTAAACAATAAAGATGTCCACTAAAATGGAAGTTTTTCCTGTCATA CTTTGTTAAGAAGGGTGAGAACAGAGTACCTACATTTTGAATGGAAGGATTG GAGCTACGGGGGTGGGGGTGGGGTGGGATTAGATAAATGCCTGCTCTTTACT GAAGGCTCTTTACTATTGCTTTATGATAATGTTTCATAGTTGGATATCATAATT TAAACAAGCAAAACCAAATTAAGGGCCAGCTCATTCCTCCCACTCATGATCT ATAGATCTATAGATCTCTCGTGGGATCATTGTTTTTCTCTTGATTCCCACTTTG TGGTTCTAAGTACTGTGGTTTCCAAATGTGTCAGTTTCATAGCCTGAAGAACG AGATCAGCAGCCTCTGTTCCACATACACTTCATTCTCAGTATTGTTTTGCCAA GTTCTAATTCCATCAG AAGCTTGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGA AAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCG CCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAG TTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTTCTCCTTAC GCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCT GCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCT GACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGC TGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCAC CGAAACGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTT AATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGG AAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATA TGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGA AAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTT TTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGA AAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAA CTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACG TTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTAT CCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCT CAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGA TGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATA ACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTA ACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTG GGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGA TGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTA CTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAA AGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTG CTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCA CTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGG GAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTG CCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATA CTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAA GATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGT TCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGAT CCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCT ACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGA AGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTG TAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATA CCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGT CGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAG CGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAAC GACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCA CGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTC GGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCT TTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGT GATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCC TTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCC TGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAG CTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGC GAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTG GCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGG GCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCC CAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAG CGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAA Reference points for the pPN2T sequence (bprs): 7-23 T3 promoter in pBluescript SK(+) 54-61 single NotI site in pPN2T 71-78 single Sse8387I site in pPN2T 81-587 EcoRI(destroyed)-TaqI fragment of PGK-1 promoter 589-1418 PstI-HincII(destroyed) neo gene containing frag from pKJ1deltaB (derived from pKJ1 which was derived from pMC1neo). 600-602 neo start codon 1401-1403 neo stop codon 1419-1883 PvuII(destroyed)-HindIII(filled) frag of PGK-1 terminator 1914-1919 single EcoRI site in pPN2T 1914-2421 EcoRI-TaqI fragment of PGK-1 promoter 2423-4253 PstI-PvuII(destroyed) frag from HSV-1 containing the tk gene. 2519-2521 tk start codon 3647-3649 tk stop codon 4257-4714 PstI-HindIII(filled) fragment of PGK-1 terminator 4718-5225 EcoRI(filled)-TaqI fragment of PGK-1 promoter 5227-7057 PstI-PvuII(destroyed) frag from HSV-1 containing the tk gene. 5323-5325 tk start codon 6451-6453 tk stop codon 7061-7518 PstI-HindIII(filled) fragment of PGK-1 terminator 7518-10152 pUC18/Bluescript SK+ vector backbone pPN2T sequence: GCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCGGT GGCGGCCGCTCGAGGGCCCCTGCAGGTCAATTCTACCGGGTAGGGGAGGCGC TTTTCCCAAGGCAGTCTGGAGCATGCGCTTTAGCAGCCCCGCTGGCACTTGGC GCTACACAAGTGGCCTCTGGCCTCGCACACATTCCACATCCACCGGTAGCGC CAACCGGCTCCGTTCTTTGGTGGCCCCTTCGCGCCACCTTCTACTCCTCCCCTA GTCAGGAAGTTCCCCCCCGCCCCGCAGCTCGCGTCGTGCAGGACGTGACAAA TGGAAGTAGCACGTCTCACTAGTCTCGTGCAGATGGACAGCACCGCTGAGCA ATGGAAGCGGGTAGGCCTTTGGGGCAGCGGCCAATAGCAGCTTTGCTCCTTC GCTTTCTGGGCTCAGAGGCTGGGAAGGGGTGGGTCCGGGGGCGGGCTCAGGG GCGGGCTCAGGGGCGGGGCGGGCGCGAAGGTCCTCCCGAGGCCCGGCATTCT CGCACGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTTCCTCATCTCC GGGCCTTTCGACCTGCAGCCAATATGGGATCGGCCATTGAACAAGATGGATT GCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGG GCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGC AGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAA CTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTT GCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATT GGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAG AAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGG CTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTAC TCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAG GGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACG GCGATGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTG GAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGG ACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGG CGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATT CGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGGGGATCGA TCCGTCCTGTAAGTCTGCAGAAATTGATGATCTATTAAACAATAAAGATGTCC ACTAAAATGGAAGTTTTTCCTGTCATACTTTGTTAAGAAGGGTGAGAACAGA GTACCTACATTTTGAATGGAAGGATTGGAGCTACGGGGGTGGGGGTGGGGTG GGATTAGATAAATGCCTGCTCTTTACTGAAGGCTCTTTACTATTGCTTTATGA TAATGTTTCATAGTTGGATATCATAATTTAAACAAGCAAAACCAAATTAAGG GCCAGCTCATTCCTCCCACTCATGATCTATAGATCTATAGATCTCTCGTGGGA TCATTGTTTTTCTCTTGATTCCCACTTTGTGGTTCTAAGTACTGTGGTTTCCA AATGTGTCAGTTTCATAGCCTGAAGAACGAGATCAGCAGCCTCTGTTCCAC ATACACTTCATTCTCAGTATTGTTTTGCCAAGTTCTAATTCCATCAGAAGCTG ACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTC TACCGGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGCGCTTTAG CAGCCCCGCTGGCACTTGGCGCTACACAAGTGGCCTCTGGCCTCGCACACA TTCCACATCCACCGGTAGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCTTCGC GCCACCTTCTACTCCTCCCCTAGTCAGGAAGTTCCCCCCCGCCCCGCAGCTCG CGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCACTAGTCTCGTGCA GATGGACAGCACCGCTGAGCAATGGAAGCGGGTAGGCCTTTGGGGCAGCGG CCAATAGCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGGAAGGGGTG GGTCCGGGGGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGCGGGCGCGAAGG TCCTCCCGAGGCCCGGCATTCTCGCACGCTTCAAAAGCGCACGTCTGCCGCGC TGTTCTCCTCTTCCTCATCTCCGGGCCTTTCGACCTGCAGCGACCCGCTTAACA GCGTCAACAGCGTGCCGCAGATCTTGGTGGCGTGAAACTCCCGCACCTCTTC GGCCAGCGCCTTGTAGAAGCGCGTATGGCTTCGTACCCCTGCCATCAACACG CGTCTGCGTTCGACCAGGCTGCGCGTTCTCGCGGCCATAACAACCGACGTAC GGCGTTGCGCCCTCGCCGGCAACAAAAAGCCACGGAAGTCCGCCTGGAGCAG AAAATGCCCACGCTACTGCGGGTTTATATAGACGGTCCCCACGGGATGGGGA AAACCACCACCACGCAACTGCTGGTGGCCCTGGGTTCGCGCGACGATATCGT CTACGTACCCGAGCCGATGACTTACTGGCGGGTGTTGGGGGCTTCCGAGACA ATCGCGAACATCTACACCACACAACACCGCCTCGACCAGGGTGAGATATCGG CCGGGGACGCGGCGGTGGTAATGACAAGCGCCCAGATAACAATGGGCATGC CTTATGCCGTGACCGACGCCGTTCTGGCTCCTCATATCGGGGGGGAGGCTGG GAGCTCACATGCCCCGCCCCCGGCCCTCACCCTCATCTTCGACCGCCATCCCA TCGCCGCCCTCCTGTGCTACCCGGCCGCGCGATACCTTATGGGCAGCATGACC CCCCAGGCCGTGCTGGCGTTCGTGGCCCTCATCCCGCCGACCTTGCCCGGCAC AAACATCGTGTTGGGGGCCCTTCCGGAGGACAGACACATCGACCGCCTGGCC AAACGCCAGCGCCCCGGCGAGCGGCTTGACCTGGCTATGCTGGCCGCGATTC GCCGCGTTTATGGGCTGCTTGCCAATACGGTGCGGTATCTGCAGGGCGGCGG GTCGTGGCGGGAGGATTGGGGACAGCTTTCGGGGGCGGCCGTGCCGCCCCAG GGTGCCGAGCCCCAGAGCAACGCGGGCCCACGACCCCATATCGGGGACACGT TATTTACCCTGTTTCGGGCCCCCGAGTTGCTGGCCCCCAACGGCGACCTGTAT AACGTGTTTGCCTGGGCTTTGGACGTCTTGGCCAAACGCCTCCGTCCCATGCA TGTCTTTATCCTGGATTACGACCAATCGCCCGCCGGCTGCCGGGACGCCCTGC TGCAACTTACCTCCGGGATGGTCCAGACCCACGTCACCACCCCAGGCTCCAT ACCGACGATCTGCGACCTGGCGCGCACGTTTGCCCGGGAGATGGGGGAGGCT AACTGAAACACGGAAGGAGACAATACCGGAAGGAACCCGCGCTATGACGGC AATAAAAAGACAGAATAAAACGCACGGGTGTTGGGTCGTTTGTTCATAAACG CGGGGTTCGGTCCCAGGGCTGGCACTCTGTCGATACCCCACCGAGACCCCAT TGGGACCAATACGCCCGCGTTTCTTCCTTTTCCCCACCCCAACCCCCAAGTTC GGGTGAAGGCCCAGGGCTCGCAGCCAACGTCGGGGCGGCAAGCCCTGCCAT AGCCACGGGCCCCGTGGGTTAGGGACGGGGTCCCCCATGGGGAATGGTTTAT GGTTCGTGGGGGTTATTATTTTGGGCGTTGCGTGGGGTCAGGTCCACGACTGG ACTGAGCAGACAGACCCATGGTTTTTGGATGGCCTGGGCATGGACCGCATGT ACTGGCGCGACACGAACACCGGGCGTCTGTGGCTGCCAAACACCCCCGACCC CCAAAAACCACCGCGCGGATTTCTGGCGCCGCCGGACGAACTAAACCTGACT ACGGCATCTCTGCCCCTTCTTCGCTGGTACGAGGAGCGCTTTTGTTTTGTATTG GTCACCACGGCCGAGTTTCCGCGGGACCCCGGCCAGGACCTGCAGAAATTGA TGATCTATTAAACAATAAAGATGTCCACTAAAATGGAAGTTTTTCCTGTCATA CTTTGTTAAGAAGGGTGAGAACAGAGTACCTACATTTTGAATGGAAGGATTG GAGCTACGGGGGTGGGGGTGGGGTGGGATTAGATAAATGCCTGCTCTTTACT GAAGGCTCTTTACTATTGCTTTATGATAATGTTTCATAGTTGGATATCATAATT TAAACAAGCAAAACCAAATTAAGGGCCAGCTCATTCCTCCCACTCATGATCT ATAGATCTATAGATCTCTCGTGGGATCATTGTTTTTCTCTTGATTCCCACTTTG TGGTTCTAAGTACTGTGGTTTCCAAATGTGTCAGTTTCATAGCCTGAAGAACG AGATCAGCAGCCTCTGTTCCACATACACTTCATTCTCAGTATTGTTTTGCCAA GTTCTAATTCCATCAGAAGCTAATTC TACCGGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGCGCTTTAG CAGCCCCGCTGGCACTTGGCGCTACACAAGTGGCCTCTGGCCTCGCACACA TTCCACATCCACCGGTAGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCTTCGC GCCACCTTCTACTCCTCCCCTAGTCAGGAAGTTCCCCCCCGCCCCGCAGCTCG CGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCACTAGTCTCGTGCA GATGGACAGCACCGCTGAGCAATGGAAGCGGGTAGGCCTTTGGGGCAGCGG CCAATAGCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGGAAGGGGTG GGTCCGGGGGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGCGGGCGCGAAGG TCCTCCCGAGGCCCGGCATTCTCGCACGCTTCAAAAGCGCACGTCTGCCGCGC TGTTCTCCTCTTCCTCATCTCCGGGCCTTTCGACCTGCAGCGACCCGCTTAACA GCGTCAACAGCGTGCCGCAGATCTTGGTGGCGTGAAACTCCCGCACCTCTTC GGCCAGCGCCTTGTAGAAGCGCGTATGGCTTCGTACCCCTGCCATCAACACG CGTCTGCGTTCGACCAGGCTGCGCGTTCTCGCGGCCATAACAACCGACGTAC GGCGTTGCGCCCTCGCCGGCAACAAAAAGCCACGGAAGTCCGCCTGGAGCAG AAAATGCCCACGCTACTGCGGGTTTATATAGACGGTCCCCACGGGATGGGGA AAACCACCACCACGCAACTGCTGGTGGCCCTGGGTTCGCGCGACGATATCGT CTACGTACCCGAGCCGATGACTTACTGGCGGGTGTTGGGGGCTTCCGAGACA ATCGCGAACATCTACACCACACAACACCGCCTCGACCAGGGTGAGATATCGG CCGGGGACGCGGCGGTGGTAATGACAAGCGCCCAGATAACAATGGGCATGC CTTATGCCGTGACCGACGCCGTTCTGGCTCCTCATATCGGGGGGGAGGCTGG GAGCTCACATGCCCCGCCCCCGGCCCTCACCCTCATCTTCGACCGCCATCCCA TCGCCGCCCTCCTGTGCTACCCGGCCGCGCGATACCTTATGGGCAGCATGACC CCCCAGGCCGTGCTGGCGTTCGTGGCCCTCATCCCGCCGACCTTGCCCGGCAC AAACATCGTGTTGGGGGCCCTTCCGGAGGACAGACACATCGACCGCCTGGCC AAACGCCAGCGCCCCGGCGAGCGGCTTGACCTGGCTATGCTGGCCGCGATTC GCCGCGTTTATGGGCTGCTTGCCAATACGGTGCGGTATCTGCAGGGCGGCGG GTCGTGGCGGGAGGATTGGGGACAGCTTTCGGGGGCGGCCGTGCCGCCCCAG GGTGCCGAGCCCCAGAGCAACGCGGGCCCACGACCCCATATCGGGGACACGT TATTTACCCTGTTTCGGGCCCCCGAGTTGCTGGCCCCCAACGGCGACCTGTAT AACGTGTTTGCCTGGGCTTTGGACGTCTTGGCCAAACGCCTCCGTCCCATGCA TGTCTTTATCCTGGATTACGACCAATCGCCCGCCGGCTGCCGGGACGCCCTGC TGCAACTTACCTCCGGGATGGTCCAGACCCACGTCACCACCCCAGGCTCCAT ACCGACGATCTGCGACCTGGCGCGCACGTTTGCCCGGGAGATGGGGGAGGCT AACTGAAACACGGAAGGAGACAATACCGGAAGGAACCCGCGCTATGACGGC AATAAAAAGACAGAATAAAACGCACGGGTGTTGGGTCGTTTGTTCATAAACG CGGGGTTCGGTCCCAGGGCTGGCACTCTGTCGATACCCCACCGAGACCCCAT TGGGACCAATACGCCCGCGTTTCTTCCTTTTCCCCACCCCAACCCCCAAGTTC GGGTGAAGGCCCAGGGCTCGCAGCCAACGTCGGGGCGGCAAGCCCTGCCAT AGCCACGGGCCCCGTGGGTTAGGGACGGGGTCCCCCATGGGGAATGGTTTAT GGTTCGTGGGGGTTATTATTTTGGGCGTTGCGTGGGGTCAGGTCCACGACTGG ACTGAGCAGACAGACCCATGGTTTTTGGATGGCCTGGGCATGGACCGCATGT ACTGGCGCGACACGAACACCGGGCGTCTGTGGCTGCCAAACACCCCCGACCC CCAAAAACCACCGCGCGGATTTCTGGCGCCGCCGGACGAACTAAACCTGACT ACGGCATCTCTGCCCCTTCTTCGCTGGTACGAGGAGCGCTTTTGTTTTGTATTG GTCACCACGGCCGAGTTTCCGCGGGACCCCGGCCAGGACCTGCAGAAATTGA TGATCTATTAAACAATAAAGATGTCCACTAAAATGGAAGTTTTTCCTGTCATA CTTTGTTAAGAAGGGTGAGAACAGAGTACCTACATTTTGAATGGAAGGATTG GAGCTACGGGGGTGGGGGTGGGGTGGGATTAGATAAATGCCTGCTCTTTACT GAAGGCTCTTTACTATTGCTTTATGATAATGTTTCATAGTTGGATATCATAATT TAAACAAGCAAAACCAAATTAAGGGCCAGCTCATTCCTCCCACTCATGATCT ATAGATCTATAGATCTCTCGTGGGATCATTGTTTTTCTCTTGATTCCCACTTTG TGGTTCTAAGTACTGTGGTTTCCAAATGTGTCAGTTTCATAGCCTGAAGAACG AGATCAGCAGCCTCTGTTCCACATACACTTCATTCTCAGTATTGTTTTGCCAA GTTCTAATTCCATCAGAAGCTAGCTT GGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGA AAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCG CCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAG TTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTTCTCCTTAC GCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCT GCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCT GACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGC TGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCAC CGAAACGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTT AATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGG AAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATA TGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGA AAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTT TTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGA AAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAA CTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACG TTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTAT CCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCT CAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGA TGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATA ACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTA ACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTG GGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGA TGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTA CTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAA AGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTG CTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCA CTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGG GAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTG CCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATA CTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAA GATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGT TCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGAT CCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCT ACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGA AGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTG TAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATA CCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGT CGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAG CGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAAC GACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCA CGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTC GGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCT TTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGT GATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCC TTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCC TGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAG CTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGC GAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTG GCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGG GCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCC CAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAG CGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAA Reference points for the pPN2T-hGHterm sequence (bprs): 7-23 T3 promoter in pBluescript SK(+) 54-61 single NotI site in pPN2T-hGHterm 71-78 single Sse8387I site in pPN2T-hGHterm 81-587 EcoRI(destroyed)-TaqI fragment of PGK-1 promoter 589-1418 PstI-HincII(destroyed) neo gene containing frag from pKJ1deltaB (derived from pKJ1 which was derived from pMC1neo). 600-602 neo start codon 1401-1403 neo stop codon 1419-1883 PvuII(destroyed)-HindIII(filled) frag of PGK-1 terminator 1887-1892 single XbaI site in pPN2T-hGHterm 1893-2477 reverse orientation hGH-N gene polyA signal/terminator 2478-2483 single BamHI site in pPN2T-hGHterm 2498-2503 single EcoRI site in pPN2T-hGHterm 2498-3005 EcoRI-TaqI fragment of PGK-1 promoter 3007-4837 PstI-PvuII(destroyed) frag from HSV-1 containing the tk gene. 3103-3105 tk start codon 4231-4233 tk stop codon 4841-5298 PstI-HindIII(filled) fragment of PGK-1 terminator 5302-5809 EcoRI(filled)-TaqI fragment of PGK-1 promoter 5811-7641 PstI-PvuII(destroyed) frag from HSV-1 containing the tk gene. 5907-5909 tk start codon 7035-7037 tk stop codon 7645-8102 PstI-HindIII(filled) fragment of PGK-1 terminator 8102-10736 pUC18/Bluescript SK+ vector backbone pPN2T-hGHterm sequence: GCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCGGT GGCGGCCGCTCGAGGGCCCCTGCAGGTCAATTCTACCGGGTAGGGGAGGCGC TTTTCCCAAGGCAGTCTGGAGCATGCGCTTTAGCAGCCCCGCTGGCACTTGGC GCTACACAAGTGGCCTCTGGCCTCGCACACATTCCACATCCACCGGTAGCGC CAACCGGCTCCGTTCTTTGGTGGCCCCTTCGCGCCACCTTCTACTCCTCCCCTA GTCAGGAAGTTCCCCCCCGCCCCGCAGCTCGCGTCGTGCAGGACGTGACAAA TGGAAGTAGCACGTCTCACTAGTCTCGTGCAGATGGACAGCACCGCTGAGCA ATGGAAGCGGGTAGGCCTTTGGGGCAGCGGCCAATAGCAGCTTTGCTCCTTC GCTTTCTGGGCTCAGAGGCTGGGAAGGGGTGGGTCCGGGGGCGGGCTCAGGG GCGGGCTCAGGGGCGGGGCGGGCGCGAAGGTCCTCCCGAGGCCCGGCATTCT CGCACGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTTCCTCATCTCC GGGCCTTTCGACCTGCAGCCAATATGGGATCGGCCATTGAACAAGATGGATT GCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGG GCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGC AGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAA CTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTT GCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATT GGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAG AAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGG CTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTAC TCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAG GGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACG GCGATGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTG GAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGG ACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGG CGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATT CGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGGGGATCGA TCCGTCCTGTAAGTCTGCAGAAATTGATGATCTATTAAACAATAAAGATGTCC ACTAAAATGGAAGTTTTTCCTGTCATACTTTGTTAAGAAGGGTGAGAACAGA GTACCTACATTTTGAATGGAAGGATTGGAGCTACGGGGGTGGGGGTGGGGTG GGATTAGATAAATGCCTGCTCTTTACTGAAGGCTCTTTACTATTGCTTTATGA TAATGTTTCATAGTTGGATATCATAATTTAAACAAGCAAAACCAAATTAAGG GCCAGCTCATTCCTCCCACTCATGATCTATAGATCTATAGATCTCTCGTGGGA TCATTGTTTTTCTCTTGATTCCCACTTTGTGGTTCTAAGTACTGTGGTTTCCA AATGTGTCAGTTTCATAGCCTGAAGAACGAGATCAGCAGCCTCTGTTCCAC ATACACTTCATTCTCAGTATTGTTTTGCCAAGTTCTAATTCCATCAGAAGCTG ACTCTAGA CAGGCATCTACTGAGTGGACCCAACGCATGAGAGGACAGTGCCAAGCAAGC AACTCAAATGTCCCACCGGTTGGGCATGGCAGGTAGCCTATGCTGTGTCTGG ACGTCCTCCTGCTGGTATAGTTATTTTAAAATCAGAAGGACAGGGAAGGGA GCAGTGGTTCACGCCTGTAATCCCAGCAATTTGGGAGGCCAAGGTGGGTAGA TCACCTGAGATTAGGAGTTGGAGACCAGCCTGGCCAATATGGTGAAACCCCG TCTCTACCAAAAAAACAAAAATTAGCTGAGCCTGGTCATGCATGCCTGGAAT CCCAACAACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCAGGAGGCG GAGATTGCAGTGAGCCAAGATTGTGCCACTGCACTCCAGCTTGGTTCCCGAA TAGACCCCGCAGGCCCTACAGGTTGTCTTCCCAACTTGCCCCTTGCTCCATAC CACCCCCCTCCACCCCATAATATTATAGAAGGACACCTAGTCAGACAAAATG ATGCAACTTAATTTTATTAGGACAAGGCTGGTGGGCACTGGAGTGGCAACTT CCAAGGCCAGGAGA GGATCCCCGGGTACCGAGCTCGAATTCTACCGGGTAGGGGAGGCGCTTTTCCCAA GGCAGTCTGGAGCATGCGCTTTAGCAGCCCCGCTGGCACTTGGCGCTACACAAGT GGCCTCTGGCCTCGCACACATTCCACATCCACCGGTAGCGCCAACCGGCTCCGTTC TTTGGTGGCCCCTTCGCGCCACCTTCTACTCCTCCCCTAGTCAGGAAGTTCCCCCC CGCCCCGCAGCTCGCGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCACT AGTCTCGTGCAGATGGACAGCACCGCTGAGCAATGGAAGCGGGTAGGCCTTTGG GGCAGCGGCCAATAGCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGGAA GGGGTGGGTCCGGGGGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGCGGGCGC GAAGGTCCTCCCGAGGCCCGGCATTCTCGCACGCTTCAAAAGCGCACGTCTGCCG CGCTGTTCTCCTCTTCCTCATCTCCGGGCCTTTCGACCTGCAGCGACCCGCTTAACA GCGTCAACAGCGTGCCGCAGATCTTGGTGGCGTGAAACTCCCGCACCTCTTCGGC CAGCGCCTTGTAGAAGCGCGTATGGCTTCGTACCCCTGCCATCAACACGCGTCTGC GTTCGACCAGGCTGCGCGTTCTCGCGGCCATAACAACCGACGTACGGCGTTGCGC CCTCGCCGGCAACAAAAAGCCACGGAAGTCCGCCTGGAGCAGAAAATGCCCACGC TACTGCGGGTTTATATAGACGGTCCCCACGGGATGGGGAAAACCACCACCACGCA ACTGCTGGTGGCCCTGGGTTCGCGCGACGATATCGTCTACGTACCCGAGCCGATG ACTTACTGGCGGGTGTTGGGGGCTTCCGAGACAATCGCGAACATCTACACCACAC AACACCGCCTCGACCAGGGTGAGATATCGGCCGGGGACGCGGCGGTGGTAATGA CAAGCGCCCAGATAACAATGGGCATGCCTTATGCCGTGACCGACGCCGTTCTGGC TCCTCATATCGGGGGGGAGGCTGGGAGCTCACATGCCCCGCCCCCGGCCCTCACC CTCATCTTCGACCGCCATCCCATCGCCGCCCTCCTGTGCTACCCGGCCGCGCGATA CCTTATGGGCAGCATGACCCCCCAGGCCGTGCTGGCGTTCGTGGCCCTCATCCCG CCGACCTTGCCCGGCACAAACATCGTGTTGGGGGCCCTTCCGGAGGACAGACACA TCGACCGCCTGGCCAAACGCCAGCGCCCCGGCGAGCGGCTTGACCTGGCTATGCT GGCCGCGATTCGCCGCGTTTATGGGCTGCTTGCCAATACGGTGCGGTATCTGCAG GGCGGCGGGTCGTGGCGGGAGGATTGGGGACAGCTTTCGGGGGCGGCCGTGCC GCCCCAGGGTGCCGAGCCCCAGAGCAACGCGGGCCCACGACCCCATATCGGGGA CACGTTATTTACCCTGTTTCGGGCCCCCGAGTTGCTGGCCCCCAACGGCGACCTGT ATAACGTGTTTGCCTGGGCTTTGGACGTCTTGGCCAAACGCCTCCGTCCCATGCAT GTCTTTATCCTGGATTACGACCAATCGCCCGCCGGCTGCCGGGACGCCCTGCTGC AACTTACCTCCGGGATGGTCCAGACCCACGTCACCACCCCAGGCTCCATACCGAC GATCTGCGACCTGGCGCGCACGTTTGCCCGGGAGATGGGGGAGGCTAACTGAAA CACGGAAGGAGACAATACCGGAAGGAACCCGCGCTATGACGGCAATAAAAAGAC AGAATAAAACGCACGGGTGTTGGGTCGTTTGTTCATAAACGCGGGGTTCGGTCCC AGGGCTGGCACTCTGTCGATACCCCACCGAGACCCCATTGGGACCAATACGCCCG CGTTTCTTCCTTTTCCCCACCCCAACCCCCAAGTTCGGGTGAAGGCCCAGGGCTCG CAGCCAACGTCGGGGCGGCAAGCCCTGCCATAGCCACGGGCCCCGTGGGTTAGG GACGGGGTCCCCCATGGGGAATGGTTTATGGTTCGTGGGGGTTATTATTTTGGGC GTTGCGTGGGGTCAGGTCCACGACTGGACTGAGCAGACAGACCCATGGTTTTTGG ATGGCCTGGGCATGGACCGCATGTACTGGCGCGACACGAACACCGGGCGTCTGT GGCTGCCAAACACCCCCGACCCCCAAAAACCACCGCGCGGATTTCTGGCGCCGCC GGACGAACTAAACCTGACTACGGCATCTCTGCCCCTTCTTCGCTGGTACGAGGAGC GCTTTTGTTTTGTATTGGTCACCACGGCCGAGTTTCCGCGGGACCCCGGCCAGGAC CTGCAGAAATTGATGATCTATTAAACAATAAAGATGTCCACTAAAATGGAAGTTTTT CCTGTCATACTTTGTTAAGAAGGGTGAGAACAGAGTACCTACATTTTGAATGGAAG GATTGGAGCTACGGGGGTGGGGGTGGGGTGGGATTAGATAAATGCCTGCTCTTTA CTGAAGGCTCTTTACTATTGCTTTATGATAATGTTTCATAGTTGGATATCATAATTTA AACAAGCAAAACCAAATTAAGGGCCAGCTCATTCCTCCCACTCATGATCTATAGAT CTATAGATCTCTCGTGGGATCATTGTTTTTCTCTTGATTCCCACTTTGTGGTTCTAAG TACTGTGGTTTCCAAATGTGTCAGTTTCATAGCCTGAAGAACGAGATCAGCAGCCT CTGTTCCACATACACTTCATTCTCAGTATTGTTTTGCCAAGTTCTAATTCCATCAGAA GCTAATTC TACCGGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGCGCTTTAG CAGCCCCGCTGGCACTTGGCGCTACACAAGTGGCCTCTGGCCTCGCACACA TTCCACATCCACCGGTAGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCTTCGC GCCACCTTCTACTCCTCCCCTAGTCAGGAAGTTCCCCCCCGCCCCGCAGCTCG CGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCACTAGTCTCGTGCA GATGGACAGCACCGCTGAGCAATGGAAGCGGGTAGGCCTTTGGGGCAGCGG CCAATAGCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGGAAGGGGTG GGTCCGGGGGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGCGGGCGCGAAGG TCCTCCCGAGGCCCGGCATTCTCGCACGCTTCAAAAGCGCACGTCTGCCGCGC TGTTCTCCTCTTCCTCATCTCCGGGCCTTTCGACCTGCAGCGACCCGCTTAACA GCGTCAACAGCGTGCCGCAGATCTTGGTGGCGTGAAACTCCCGCACCTCTTC GGCCAGCGCCTTGTAGAAGCGCGTATGGCTTCGTACCCCTGCCATCAACACG CGTCTGCGTTCGACCAGGCTGCGCGTTCTCGCGGCCATAACAACCGACGTAC GGCGTTGCGCCCTCGCCGGCAACAAAAAGCCACGGAAGTCCGCCTGGAGCAG AAAATGCCCACGCTACTGCGGGTTTATATAGACGGTCCCCACGGGATGGGGA AAACCACCACCACGCAACTGCTGGTGGCCCTGGGTTCGCGCGACGATATCGT CTACGTACCCGAGCCGATGACTTACTGGCGGGTGTTGGGGGCTTCCGAGACA ATCGCGAACATCTACACCACACAACACCGCCTCGACCAGGGTGAGATATCGG CCGGGGACGCGGCGGTGGTAATGACAAGCGCCCAGATAACAATGGGCATGC CTTATGCCGTGACCGACGCCGTTCTGGCTCCTCATATCGGGGGGGAGGCTGG GAGCTCACATGCCCCGCCCCCGGCCCTCACCCTCATCTTCGACCGCCATCCCA TCGCCGCCCTCCTGTGCTACCCGGCCGCGCGATACCTTATGGGCAGCATGACC CCCCAGGCCGTGCTGGCGTTCGTGGCCCTCATCCCGCCGACCTTGCCCGGCAC AAACATCGTGTTGGGGGCCCTTCCGGAGGACAGACACATCGACCGCCTGGCC AAACGCCAGCGCCCCGGCGAGCGGCTTGACCTGGCTATGCTGGCCGCGATTC GCCGCGTTTATGGGCTGCTTGCCAATACGGTGCGGTATCTGCAGGGCGGCGG GTCGTGGCGGGAGGATTGGGGACAGCTTTCGGGGGCGGCCGTGCCGCCCCAG GGTGCCGAGCCCCAGAGCAACGCGGGCCCACGACCCCATATCGGGGACACGT TATTTACCCTGTTTCGGGCCCCCGAGTTGCTGGCCCCCAACGGCGACCTGTAT AACGTGTTTGCCTGGGCTTTGGACGTCTTGGCCAAACGCCTCCGTCCCATGCA TGTCTTTATCCTGGATTACGACCAATCGCCCGCCGGCTGCCGGGACGCCCTGC TGCAACTTACCTCCGGGATGGTCCAGACCCACGTCACCACCCCAGGCTCCAT ACCGACGATCTGCGACCTGGCGCGCACGTTTGCCCGGGAGATGGGGGAGGCT AACTGAAACACGGAAGGAGACAATACCGGAAGGAACCCGCGCTATGACGGC AATAAAAAGACAGAATAAAACGCACGGGTGTTGGGTCGTTTGTTCATAAACG CGGGGTTCGGTCCCAGGGCTGGCACTCTGTCGATACCCCACCGAGACCCCAT TGGGACCAATACGCCCGCGTTTCTTCCTTTTCCCCACCCCAACCCCCAAGTTC GGGTGAAGGCCCAGGGCTCGCAGCCAACGTCGGGGCGGCAAGCCCTGCCAT AGCCACGGGCCCCGTGGGTTAGGGACGGGGTCCCCCATGGGGAATGGTTTAT GGTTCGTGGGGGTTATTATTTTGGGCGTTGCGTGGGGTCAGGTCCACGACTGG ACTGAGCAGACAGACCCATGGTTTTTGGATGGCCTGGGCATGGACCGCATGT ACTGGCGCGACACGAACACCGGGCGTCTGTGGCTGCCAAACACCCCCGACCC CCAAAAACCACCGCGCGGATTTCTGGCGCCGCCGGACGAACTAAACCTGACT ACGGCATCTCTGCCCCTTCTTCGCTGGTACGAGGAGCGCTTTTGTTTTGTATTG GTCACCACGGCCGAGTTTCCGCGGGACCCCGGCCAGGACCTGCAGAAATTGA TGATCTATTAAACAATAAAGATGTCCACTAAAATGGAAGTTTTTCCTGTCATA CTTTGTTAAGAAGGGTGAGAACAGAGTACCTACATTTTGAATGGAAGGATTG GAGCTACGGGGGTGGGGGTGGGGTGGGATTAGATAAATGCCTGCTCTTTACT GAAGGCTCTTTACTATTGCTTTATGATAATGTTTCATAGTTGGATATCATAATT TAAACAAGCAAAACCAAATTAAGGGCCAGCTCATTCCTCCCACTCATGATCT ATAGATCTATAGATCTCTCGTGGGATCATTGTTTTTCTCTTGATTCCCACTTTG TGGTTCTAAGTACTGTGGTTTCCAAATGTGTCAGTTTCATAGCCTGAAGAACG AGATCAGCAGCCTCTGTTCCACATACACTTCATTCTCAGTATTGTTTTGCCAA GTTCTAATTCCATCAGAAGCTAGCTT GGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGA AAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCG CCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAG TTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTTCTCCTTAC GCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCT GCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCT GACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGC TGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCAC CGAAACGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTT AATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGG AAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATA TGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGA AAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTT TTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGA AAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAA CTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACG TTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTAT CCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCT CAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGA TGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATA ACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTA ACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTG GGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGA TGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTA CTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAA AGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTG CTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCA CTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGG GAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTG CCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATA CTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAA GATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGT TCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGAT CCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCT ACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGA AGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTG TAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATA CCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGT CGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAG CGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAAC GACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCA CGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTC GGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCT TTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGT GATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCC TTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCC TGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAG CTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGC GAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTG GCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGG GCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCC CAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAG CGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAA Good luck, Chris Paszty Dec 1995 Gene targeters: A couple of years ago I sent out the sequence compilations of the PGKneo and PGKtk cassettes that make up pPNT [Tybulewicz et al. Cell vol 65 p1153-1163 (1991)] with the goal of making it easier for people to construct targeting vectors using these 2 cassettes and to design screening strategies for identifying correctly targeted ES cell clones. The purpose of this follow up note is to address the issue of DNA rearrangement that can be encountered during vector construction. A good way to build one's targeting vector using pPNT has been to clone the short arm into the polylinker that is located between the PGKneo and PGKtk cassettes and to then clone the long arm into the unique XhoI site that lies on the other side of the PGKneo cassette. The final targeting vector can then be linearized at the unique NotI site. With regards to the effectiveness of negative selection by PGKtk in mammalian cells this configuration of the short and long arms as well as the linearization by NotI is ideal for two reasons. First, the distance between the PGKneo and PGKtk cassettes is minimized thereby making it more unlikely for events (such as endonuclease attack) other than homologous recombination to separate the two markers. Second, by linearizing with NotI the pUC/Bluescript region of the vector is left flanking the PGKtk cassette thereby decreasing the probability of PGKtk being inactivated by exonucleases. When building my first targeting vector I found that most (99%+) of the clones that were recovered after the last ligation step (cloning the long arm into the XhoI site) contained deletions and rearrangements. From talking to a number of people this seemed to be a fairly common occurrence when including both PGKneo and PGKtk in ones targeting construct. The unrearranged clone that I finally isolated turned out to be totally stable even when grown for many "passages". When miniprep DNA from this clone was retransformed into bacteria no rearrangement was observed. This seemed to indicate that the rearrangement problem was not due to the particular murine sequences that I had included in my targeting vector but was more likely due to the topology of the transforming DNA. Since I had used calf intestinal phosphatase (CIP) to dephosphorylate the XhoI ends of my XhoI cut short arm vector (to eliminate vector religation) the topology of DNA in my ligation mix was OC (open circular) containing dephosphorylated nicks. From the subsequent construction of a number of targeting vectors based on pPNT and a 2 tk version of pPNT (pPN2T) it is now clear that by not CIP treating the short arm vector during the cloning in of the long arm, the incidence of rearrangement is reduced to almost zero, thereby making it much easier to obtain the final targeting vector. With regards to vector religation without the CIP treatment one can still use the XhoI site for cloning in the long arm by playing with the insert-vector ratio to minimize vector religation. Alternatively, one could eliminate vector religation without using CIP and also get directional cloning of the long arm using the NotI and XhoI sites in pPNT, but because these two sites overlap in pPNT, achieving effective double digestion was thought to not be possible (93' NEB catalogue p 180). Recently the people at NEB (Moreira and Noren, Biotechniques 1995 vol 19 p56-59; Minimum Duplex Requirements for Restriction Enzyme Cleavage Near the Termini of Linear DNA Fragments) have reexamined the overlapping restriction enzyme site issue and their new results indicate that it should be possible to achieve effective double digestion of the NotI and XhoI sites in pPNT and pPNT derivatives by first cutting with NotI and then subsequently with XhoI. So although we haven't tried it , using NotI and XhoI may be a realistic option for the cloning in of the long arm. Another approach which we've been using successfully and prevents vector religation as well as allowing for forced directional cloning of the long arm is as follows: The recognition site for a fairly new 8 cutter, Sse8387I (CCTGCAGG, available from Amersham), is located between the NotI site and the PGKneo cassette in both pPNT and pPN2T. By double digesting the short arm-containing targeting vector with NotI and Sse8387I and then gel purifying it one can eliminate vector religation. The different cohesive ends also allow for the directional cloning of the long arm. There are various straightforward approaches for creating a NotI site and an Sse8387I site at either end of ones long arm: - if one is using PCR to obtain the long arm then it is easy to just include a NotI site on the 5' end of one of the primers and an Sse8387I site on the 5' end of the other primer. TA cloning of the product leaves one with a long arm that is ready to clone into one's short arm-containing vector. - another approach involves creating a blue/white vector that has a blunt end cloning site in-between a NotI site and an Sse8387I site. The long arm can then be blunt end cloned in both orientations into this intermediate vector. The proper orientation clone leaves one with a long arm that is ready to clone into one's short arm-containing vector. To make a blue/white NotI-Sse8387I intermediate vector one can modify the polylinker of any common blue/white vector using custom oligos. Alternatively one can combine complementary fragments from two different blue/white vectors...the 1892 bp XbaI-AlwNI fragment from pUC18 (polylinker contains an Sse8387I site) and the 833 bp XbaI-AlwNI fragment from pBluescript SK +/- (polylinker contains a NotI site) can be combined to create such a vector (pUCNotSse). This hybrid blue/white vector has a HincII site (blunt end cutter) in-between the NotI site and the Sse8387I site. pUCNotSse polylinker: gagctccaccgcggtggcggccgctctagagtcgacctgcaggcatgcaagctt Over the past year, using the sequence compilations of PGKneo and PGKtk as well as the NotI-Sse8387I long arm cloning strategy, we've significantly increased the speed and ease with which we build our targeting vectors. Hope this information is useful to others. Chris Paszty Lawrence Berkeley Laboratory C_Paszty@csa2.lbl.gov From owner-recombination@net.bio.net Mon Jun 24 23:00:00 1996 Path: biosci!daresbury!bioftp.unibas.ch!infobiogen.fr!jussieu.fr!oleane!plug.news.pipex.net!pipex!tank.news.pipex.net!pipex!usenet.eel.ufl.edu!gatech!newsfeed.internetmci.com!info.ucla.edu!newshub.sdsu.edu!hchen From: hchen@mail.sdsu.edu Newsgroups: bionet.molbio.recombination Subject: What's a good plasmid drawing program? Date: Tue, 25 Jun 1996 04:03:11 -0700 Organization: San Diego State University Lines: 7 Message-ID: NNTP-Posting-Host: ebb1p2.sdsu.edu X-Newsreader: Yet Another NewsWatcher 2.2.0b10 Can someone suggest a good plasmid drawing program for the Mac. I'm currently trying an old version of MacPlasmap, and it crashes on my PowerMac 9500. Any suggestion would be greatly appreciated. - Wayne Chen hchen@mail.sdsu.edu From owner-recombination@net.bio.net Mon Jun 24 23:00:00 1996 Path: biosci!daresbury!bioftp.unibas.ch!infobiogen.fr!jussieu.fr!esiee.fr!sgigate.sgi.com!nntp.coast.net!howland.reston.ans.net!tank.news.pipex.net!pipex!lade.news.pipex.net!pipex!laura.pcug.co.uk!imagen!dakodl Newsgroups: bionet.molbio.recombination Message-ID: <139@imagen.win-uk.net> Reply-To: dakodl@imagen.win-uk.net (DAKO Diagnostics Ltd) From: dakodl@imagen.win-uk.net (DAKO Diagnostics Ltd) Date: Tue, 25 Jun 1996 15:01:46 GMT Subject: recombinant HIV p24 and HBsAg Lines: 6 Dear reader, Does anybody work for a company or know of anybody that produces recombinant HIV p24 and/or HBsAg that is available for purchase so that I can develop an immunoassay?? Mark Dunn From owner-recombination@net.bio.net Mon Jun 24 23:00:00 1996 Path: biosci!daresbury!bioftp.unibas.ch!infobiogen.fr!jussieu.fr!esiee.fr!sgigate.sgi.com!swrinde!newsfeed.internetmci.com!EU.net!news2.EUnet.fr!Belgium.EU.net!news From: Jurgen Vanhauwe Newsgroups: bionet.molbio.recombination Subject: recombination or what? Date: 25 Jun 1996 07:01:01 GMT Organization: Janssen Pharmaceutica Lines: 22 Message-ID: <4qo2rd$3sl@news.Belgium.EU.net> NNTP-Posting-Host: pc4.cim.jrf.be Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit X-Mailer: Mozilla 1.1N (Windows; I; 16bit) As I want to study the interaction of two proteins in E. coli, I'm looking for some advice. I already expressed one protein in E. coli and now I'm up to the second protein. My question is: Wchich is the most feasible method to make this proteins interact in E. coli inner membranes? Is this coexpression by means of compatible plasmids or polycistronic plasmids or even genomic integration of one of the proteins, or might it be more intruiging to try to reconstitute that interaction by fusion of phospholipid vesicles (containing the purified second protein from a mammalian source) and E. coli membranes (or even lysozyme treated bacteria). In the last case I have the advantage that the second protein is posttranslational modified, but it hasn't really been shown that this modification is necessary for both proteins to interact. Since this is a very critical decision to make, I'd really appreciate any comment or suggestions. Jurgen Vanhauwe, Ph. D. student From owner-recombination@net.bio.net Wed Jun 26 23:00:00 1996 Path: biosci!bloom-beacon.mit.edu!news-res.gsl.net!news.gsl.net!sgigate.sgi.com!news1.best.com!nntp1.best.com!calydon.vip.best.com!user From: schreibr@cmgm.stanford.edu (Edgar Schreiber) Newsgroups: bionet.molbio.recombination Subject: Re: What's a good plasmid drawing program? Followup-To: bionet.molbio.recombination Date: 27 Jun 1996 05:43:14 GMT Organization: Best Internet Communications Lines: 16 Message-ID: References: NNTP-Posting-Host: calydon.vip.best.com In article , hchen@mail.sdsu.edu wrote: > Can someone suggest a good plasmid drawing program for the Mac. I'm > currently trying an old version of MacPlasmap, and it crashes on my > PowerMac 9500. Any suggestion would be greatly appreciated. > > - Wayne Chen > > hchen@mail.sdsu.edu a superb program for virtual cloning and plasmid drawing (pricey though; >800 $ I believe) is the Gene Construction Kit from Textco. No affiliation disclaimer etc. Edgar Schreiber schreibr@cmgm.stanford.edu From owner-recombination@net.bio.net Wed Jun 26 23:00:00 1996 Path: biosci!ODYSSEE.NET!dellaire From: dellaire@ODYSSEE.NET (Graham Dellaire) Newsgroups: bionet.molbio.recombination Subject: (Montreal) 2 Positions in Mech. and Structure Act. of Anti-Cancer Drugs Date: 27 Jun 1996 10:36:00 -0700 Organization: McGill Div. of Experimental Medicine Lines: 68 Sender: daemon@net.bio.net Distribution: world Message-ID: <31D2C2FF.2BEE@odyssee.net> NNTP-Posting-Host: net.bio.net PLEASE DO NOT REPLY TO VIA E-MAIL ... ALL APPLICATIONS RECEIVED IN SUCH A MANNER WILL NOT BE CONSIDERED! McGill University MONTREAL, Quebec, Canada Mechanistic Aspects and Structure Activity Relationships of Anti-Cancer Drugs Dr. B. Leyland-Jones Department of Oncology, McGill University Montreal, Quebec, Canada Project description: Mechanistic Aspects and Structure Activity Relationships of Anti-Cancer Drugs These posts are available immediately for a term of one year (renewable) and salary commensurate with experience (minimum $24,000/annum). In accordance with Canadian Immigration requirements, this advertisement is directed to Canadian citizens and permanent residents of Canada. McGill University is committed to equity in employment. Positions: 2 Post Doc Positions For the first candidate, we are especially interested in identifying an individual who possesses skills in DNA sequencing techniques including ligation-mediated PCR, quantitative PCR, gene-specific DNA repair and in vitro and in vivo foot-printing. For the second candidate (who will be working with novel retinoid drugs), preference will be given to those with experience in binding/transactivation assays. It is expected that both candidates will possess a broad range of DNA, RNA and protein techniques and preferably in situ hybridization, immunofluorescence and quantitative flow cytometry. Both candidates should be able to work independently, supervise technicians, and teach at the graduate level. The candidates should also possess good interpersonal skills and the ability to work in a team. Grant writing experience is desirable. To Apply: Applications including a CV and the names of two references should be addressed: Dr. B. Leyland-Jones, Calciuim Research Laboratory, Room H4.67 Oncology, McGill University, 3655 Drummond, Room 701, McIntyre Medical Building, Montreal, Quebec, H3G 1Y. PLEASE REPLY BY MAIL ONLY From owner-recombination@net.bio.net Wed Jun 26 23:00:00 1996 Path: biosci!ODYSSEE.NET!dellaire From: dellaire@ODYSSEE.NET ("Graham Dellaire") Newsgroups: bionet.molbio.recombination Subject: RE: recombination or what? Date: 27 Jun 1996 10:21:54 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 62 Sender: daemon@net.bio.net Distribution: world Message-ID: <199606271727.NAA13138@atlas.odyssee.net> NNTP-Posting-Host: net.bio.net Hello , > > As I want to study the interaction of two proteins in E. coli, I'm > looking for some advice. I already expressed one protein in E. coli and > now I'm up to the second protein. > > My question is: Wchich is the most feasible method to make this proteins > interact in E. coli inner membranes? Is this coexpression by means of > compatible plasmids or polycistronic plasmids or even genomic integration > of one of the proteins, or might it be more intruiging to try to > reconstitute that interaction by fusion of phospholipid vesicles > (containing the purified second protein from a mammalian source) and E. > coli membranes (or even lysozyme treated bacteria). In the last case I > have the advantage that the second protein is posttranslational modified, > but it hasn't really been shown that this modification is necessary for > both proteins to interact. Since you say that you don't need to have the protien post translational modified you could try expressing them in the bacteria...... but if it is a big unknown it might be better to purify the proteins from say a baculovirus system (gives lots of protein) and this will provide post translationally modified protein. Then perhaps you could use some invitro reconstruction of bacterial membranes. What do you want to study about their interaction anyway? Just whether they interact? You could do that with immunoprecipitation studies after expressing the protein from a plasmid vector after simple electroporation.... e. coli is electroporated very easily. You have to make electrocompetent cells though (10% glycerol in sterile water wash 4 times). Or equally you could do in vitro studies for immunoprecipe aswell.... I just don't have a clear picture of what you want to do. Also why in bacteria? If one of these is post translationally modified it doesn't come from E. coli. So why don't you do it in the original organism. If it is yeast or mammalian cells this is really easy to do. Cheers, Graham Dellaire Experimental Medicine McGill University dellaire@odyssee.net > > Since this is a very critical decision to make, I'd really appreciate any > comment or suggestions. > > Jurgen Vanhauwe, Ph. D. student > > > > > > From owner-recombination@net.bio.net Wed Jun 26 23:00:00 1996 Path: biosci!galaxy.ucr.edu!ihnp4.ucsd.edu!munnari.OZ.AU!news.mel.connect.com.au!harbinger.cc.monash.edu.au!nntp.coast.net!sgigate.sgi.com!swrinde!newsfeed.internetmci.com!news.sprintlink.net!news-stk-200.sprintlink.net!arclight.uoregon.edu!news.bc.net!rover.ucs.ualberta.ca!news.ucalgary.ca!pc10.mid.ucalgary.ca!user From: sims@acs.ucalgary.ca (Kurt Sims) Newsgroups: bionet.molbio.recombination Subject: Re: What's a good plasmid drawing program? Date: Thu, 27 Jun 1996 08:39:53 -0700 Organization: University of Calgary Lines: 24 Message-ID: References: NNTP-Posting-Host: @pc10.mid.ucalgary.ca In article , schreibr@cmgm.stanford.edu (Edgar Schreiber) wrote: > In article , hchen@mail.sdsu.edu > wrote: > > > Can someone suggest a good plasmid drawing program for the Mac. I'm > > currently trying an old version of MacPlasmap, and it crashes on my > > PowerMac 9500. Any suggestion would be greatly appreciated. > a superb program for virtual cloning and plasmid drawing (pricey though; > >800 $ I believe) is the Gene Construction Kit from Textco. > No affiliation disclaimer etc. > Edgar Schreiber > schreibr@cmgm.stanford.edu I agree, its the best program we have ever used for this. It uses not only the plasmid map but the actual sequence as well. No more messing around with drawings on one program and your sequence on another. In our lab its been well worth the price just for time saved. I don't work for Textco either. Kurt From owner-recombination@net.bio.net Wed Jun 26 23:00:00 1996 Path: biosci!ODYSSEE.NET!dellaire From: dellaire@ODYSSEE.NET (Graham Dellaire) Newsgroups: bionet.molbio.recombination Subject: Ph.D. Position IMMEDIATELY in Montreal (Gene THERAPY and Molecular Genetics of Hemopoiesis) Date: 27 Jun 1996 10:41:32 -0700 Organization: McGill Div. of Experimental Medicine Lines: 96 Sender: daemon@net.bio.net Distribution: world Message-ID: <31D2C447.59AF@odyssee.net> NNTP-Posting-Host: net.bio.net Reply to Dr. Guy Sauvageau's e-mail sauvagg@ircm.umontreal.ca DO NOT USE REPLY ON YOUR NEWS READER OR E-MAIL CLIENT! All applications received by dellaire@odyssee.net will be deleted. +++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ 1 Ph.D. Positions Available Immediately GENE THERAPY AND MOLECUALR GENETICS OF HEMATOPOIETIC STEM CELLS Guy Sauvageau, M.D., Ph.D., FRCP(C) Institut de Recherche Clinique de Montreal (IRCM) Montreal, Quebec, Canada Project description: (description en francais) Our laboratory explores the hypothesis that transcription factors which control proliferation and differentiation of embryonic tissues may also regulate these processes in normal and possibly abnormal (e.g. leukemic, etc.) hematopoiesis. The following objectives are being persued in our laboratory: 1.to study the function of selected transcription factors whose expression is restricted to primitive hematopoietic stem cells, 2.to use these genes in order to manipulate the behaviour of hematopoietic stem cells and, 3.to identify and develop novel strategies to optimize gene transfer to these cells. These goals are being addressed by using different experimental strategies such as experimental bone marrow traplantation procedures (murine model), retroviral gene transfer, generation of cDNA library starting from a single cell, in vitro differentioation of embryonic stem (ES) cells and generation of transgenic and knock mice. Positions: *Ph.D. Position (MRC studentship available) required molecular biology/biochemistry background and grade point average greater 3.65. Applicant should be hard working and ethusiastic. Preference will be given to Canadian candidates Notes: *English or French as a minimum language reguirement To Apply: Please contact Dr. Guy Sauvageau Vox: (514) 987 5797 Fax (514) 987 5688 E-mail: sauvagg@ircm.umontreal.ca Curriculum Vitae and most recent transcripts will be requested. GENETIQUE MOLEDULAIRE DES CELLULES SOUCHES HEMOPOIETIQUES ET THERAPIE GENIQUE Guy Sauvageau, M.D., Ph.D., FRCP(C) Les mécanismes molé ulaires responsables de la prlifération et de la différentiation des cellules souches hémopoiétiques normales et leucémiques demeurent encore mal caractérisés. Les objectifs de notre laboratoire sont: 1.d'étudier la fonction de certain faceurs de transcription dont l'expression est spécifique aux cellules les plus primitives de la moelle osseuse, 2.d'utilieser ces gènes nouvellement caractérisés pour générer des cellules souches hemopoiétiques ayant une capcité accrue de repopulation, 3.de développer de nouvelles stratégies pour optimiser le transfert de gènes à ces cellules. Les principaux modèles expérimentaux utilisées pour ces études incluent la tranplantation de moelle osseuse (modèle murin), le transfert de gène(s) à l'aide de rétrovirus recombinants, la génération de libraires d'ADN complémentaires à partir d'une seule cellule purifiée, la différentiation in vitro de cellules embryonnaire de souris (ES), et la génération de souris transgéniques et "knock out". From owner-recombination@net.bio.net Wed Jun 26 23:00:00 1996 Path: biosci!galaxy.ucr.edu!ihnp4.ucsd.edu!munnari.OZ.AU!news.mel.connect.com.au!harbinger.cc.monash.edu.au!nntp.coast.net!howland.reston.ans.net!swrinde!newsfeed.internetmci.com!news.ac.net!news.cais.net!nntp.uio.no!nntp.uib.no!usenet From: Olav Vestrheim Newsgroups: bionet.molbio.recombination Subject: Re: What's a good plasmid drawing program? Date: 27 Jun 1996 13:29:12 GMT Organization: Center of biotechnologi , University of Bergen , NORWAY Lines: 4 Message-ID: <4qu2b8$2mi@ugress.uib.no> References: NNTP-Posting-Host: mac10.mbl.uib.no Mime-Version: 1.0 Content-Type: text/plain; charset=iso-8859-1 Content-Transfer-Encoding: 8bit X-Mailer: Mozilla 1.12(Macintosh; I; 68K) To: hchen@mail.sdsu.edu X-URL: news:hchen-2506960403110001@news.sdsu.edu The mac´s gene construction kit GCK is very nice for plasmid drawing. TER From owner-recombination@net.bio.net Sat Jun 29 23:00:00 1996 Path: biosci!MAIL.UTEXAS.EDU!houston.peter From: houston.peter@MAIL.UTEXAS.EDU (Peter Houston) Newsgroups: bionet.molbio.recombination Subject: Yeast DSB pathway Date: 30 Jun 1996 14:51:48 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 32 Sender: daemon@net.bio.net Distribution: world Message-ID: <199606302148.QAA07094@mail.utexas.edu> NNTP-Posting-Host: net.bio.net 6/20/96 Peter Houston Dept. of Chemistry and Biochemistry The University of Texas at Austin Austin, TX 78712 (512)471-7299 Associates: I am a member of Tom Kodadek's group investigating homologous recombination in yeast. Specifically, I am using rad51 protein affinity chromatography to isolate potential members of the DNA double strand break repair machinery. I have been anaylizing the elutions from the column with antibodies and so far I have pulled out the rad51 and rad54 proteins. I feel that this is an exciting result in light of recent identification of a rad54 dependent pathway for double strand break repair in tightly packaged regions of the genome. Given my recent experimental results, I would like to further characterize proteins being retained on my rad51 column. In this regard, I was wondering if anyone might supply me with antibodies that you may have for proteins that may interact with the rad51 protein, or let me know of other labs that may maintain such antibodies. Furthermore, I would appreciate any advice you might have. All the Best, Peter Houston From owner-recombination@net.bio.net Sun Jun 30 23:00:00 1996 Path: biosci!VAXA.CIS.UWOSH.EDU!lansman From: lansman@VAXA.CIS.UWOSH.EDU (Bob Lansman) Newsgroups: bionet.molbio.recombination Subject: Do synaptic failures lead to speciation? Date: 1 Jul 1996 12:33:52 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 7 Sender: daemon@net.bio.net Distribution: world Message-ID: <01I6K8OD6JO20070W7@vaxa.cis.uwosh.edu> NNTP-Posting-Host: net.bio.net I am interested in the possibility that the failure of two sibling species to produce fertile hybrids could be the result of synaptic failure and major disturbances in homolog segregation. First, I would be interested in any published discussion of this possibility. Second, I would be very interested in argument(s) against such a thing existing. Any response would be welcome. Thanks, Bob From owner-recombination@net.bio.net Sun Jun 30 23:00:00 1996 Path: biosci!WOLF.BIOENERGY.COM!doneill From: doneill@WOLF.BIOENERGY.COM (Dennis O'Neill) Newsgroups: bionet.molbio.recombination Subject: Re: What's a good plasmid drawing program? Date: 1 Jul 1996 10:35:41 -0700 Organization: BIOSCI International Newsgroups for Molecular Biology Lines: 3 Sender: daemon@net.bio.net Distribution: world Message-ID: NNTP-Posting-Host: net.bio.net We have a 7500/100 MHz PowerMac and use MacDNASIS. It is a bit pricy, but offers great features for plasmid map construction. Also has great alignment features. Compared to MacPlasmap, it is worth the extra money, if you can afford it.