IUBio

OMEGA_2 data bank announcement

Michel Semertzidis semerz at lmcp.jussieu.fr
Thu Feb 24 05:13:39 EST 1994




OMEGA_2 data bank for Mac is now at the
genome.inserm-vjf.fr (192.134.32.20) /pub/OMEGA.
Log in as `anonymous' and enter your email address as your password.

OMEGA_2 data bank is a compilation of recent structural information on proteins.

OMEGA_2 data bank was compiled by
Michel T. SEMERTZIDIS*, Sylvia DEPLANQUE and Jean-Paul MORNON
Département des Macromolécules Biologiques,
Laboratoire de Minéralogie - Cristallographie,
Université Pierre et Marie Curie (Paris 6) et
Denis Diderot (Paris 7), CNRS URA 09, Tour 16,
4 place Jussieu, CASE 115, F-75252 Paris Cedex 05, FRANCE
E-mail: "semerz at lmcp.jussieu.fr"
*To whom correspondence should be addressed

     Suggested citations for use of this data bank are:
Michel T. SEMERTZIDIS, Sylvia DEPLANQUE and Jean-Paul MORNON (1993)
"OMEGA: A 3D Databank for Protein Structures (a complement to PDB)",
CABIOS 9, 667-670.

     RELEASE 1:  JUNE, 1993:    401 proteins.
     RELEASE 2:  JANUARY, 1994: 537 proteins.

ABSTRACT
OMEGA is a compilation of recent structural information on
proteins derived from X-ray crystallography or NMR and
published in journals referenced by Current Contents.
To date, 401 entries have been included ( 334 X-ray, 28 NMR,
5 NMR + X-ray, 5 electron microscopy, 3 neutron scattering,
2 neutron diffraction,  1 electron microscopy + X-ray,
12 model, 11 miscellaneous ), with 5-10 new proteins being
added each week.
OMEGA can be accessed on Macintosh and is interrogated
through 32 key words (space group, resolution, secondary
structure, number of residues, etc). This pool of proteins
could be used for various purposes, including searches for
proteins with a particular set of secondary structures.
OMEGA will be continuously updated (every 6 months) and
may later include all proteins already reported in the PDB,
as well as structures reported in journals with smaller
readerships.

We would greatly appreciate any ideas for improving future
releases. We also apologize in advance for any errors or
omissions that may appear in the database, and would be
grateful to be informed of any errors.
We also welcome submission for entry in OMEGA of any new
publication related to the determination of a protein
structure, as well as the citing of this paper as a
reference for the OMEGA databank.
We would appreciate receiving reprints of publications
making use of OMEGA.

ACKNOWLEDGEMENTS:
This work was supported by the Universités Paris 6 and
Paris 7, CNRS, INSERM (contrats 889009 et 910912),
and Fondation pour la Recherche Médicale.
M.T.S. has a Ph.D. grant from the French government (MRE).


!!! The first time you will use omega it will take some time
for special 4D decompression !!!



TTGATTGCTAAACACTGGGCGGCGAATCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG
    MICHEL T. SEMERTZIDIS       Internet: SEMERZ at LMCP.JUSSIEU.FR
    University of  Paris 6        Bitnet:
    CNRS URA 09, CASE 115          Phone:
    Tour 16, 4 place Jussieu,        Fax:
    75252 Paris Cedex 05,       System managers do it with PRIVILEGES!
    F R A N C E   
    DISCLAIMER:As always,I speak only for myself,and,usually,only to myself.
LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu




More information about the Acedb mailing list

Send comments to us at biosci-help [At] net.bio.net