extra, empty tags in acedumps

Dave Matthews matthews at GREENGENES.CIT.CORNELL.EDU
Thu Nov 2 16:58:33 EST 1995


I'm seeing some unwanted extra stuff in my acedumps, apparently related to
the timestamping.  For example, the empty tags Authority and Data_source in
this record:

// data dumped from tree display

Probe : "AC1"
Locus    "Xcnl1-7B"
General_remark   "Repeat sequences (TG)18"
General_remark   "Product size 157 in Geneva PI505819"
PCR
PCR_primers      "GCTGTAAACTCCATTGTTTGG"
PCR_primers      "CACAAATCGGCGAAAAC"
Amplification_conditions         "Annealing temperature 52 C, 2.50 mM MgCl2"
Wheat_polymorphism       "5 alleles \/ 18 germplasm lines"
Authority        "Blake, Tom"
Authority
Authority        "Sorrells, Mark E."
Data_source      "Blake, Tom" "95.08.24"
Data_source
Data_source      "Sorrells, Mark E." "95.09.13"

These are also present when the dump is made from tace.  No empty tags are
seen when the object is viewed with xace.  Tace shows this:

Probe : "AC1"
  <1995-09-22_10:58:33_>
  Locus   Xcnl1-7B
  General_remark      Repeat sequences (TG)18
                      Product size 157 in Geneva PI505819
  Type    PCR
  <1995-09-21_16:07:19_>
  PCR_primers     GCTGTAAACTCCATTGTTTGG
                  CACAAATCGGCGAAAAC
  <1995-09-22_10:58:33_>
  Amplification_conditions    Annealing temperature 52 C, 2.50 mM MgCl2
  Wheat_polymorphism      5 alleles / 18 germplasm lines
  <1995-09-21_16:07:19_>
  Clone   Authority   Blake, Tom
                      <1995-09-22_10:58:33_>
                      Sorrells, Mark E.
  Data_source     Blake, Tom      95.08.24
                  <1995-09-22_10:58:33_>
                  Sorrells, Mark E.   95.09.13

- Dave




More information about the Acedb mailing list