Fasta2Ace? and Using Blixem in AceDB
Ed Griffiths
edgrif at sanger.ac.uk
Thu Jan 23 03:44:31 EST 2003
Steve,
> I don't have a background in biology, but am setting up a bioinformatics
> analysis chain (phred - lucy - TIGR_Assembler - WU-Blast) for a group of
> plant geneticists at our lab. I'm trying to enter the results of blastn
> searchs into acedb, and I'd like to access blixem within acedb to
> evaluate and visualize the results.
>
> So far, I've been able to convert blastn output into .ace files using
> MSPcrunch -4 and have loaded the resulting files into acedb. Problem
> is, I also understand that blixem requires our query sequence input
> data that blastn was matching NCBI sequence data against. These
> sequences are contained in a fasta file that was one of the outputs of
> TIGR_Assembler. So, I'm guessing that my next step is to parse that
> fasta file into an ace file. Looking over the acedb.org web site's page
> regarding loading .ace files doesn't say anything about fasta parsing
> that I can see. In looking over the bionet usegroup I seem to remember a
> reply that basically said these parsers have to be written by the user
> on an as-needed basis. After browsing thru Mary O' Callaghan's 'Guide
> to Models and Ace Files' it seems that writing such a parser wouldn't be
> too hard. Two Questions:
>
> I) Am I on the right track in trying to make blixem work within acedb? I
> know people have had problems similar to mine before (e.g. Florent
> Crepineau queried this usegroup with a similar question a few years
> back, but I can't find a reply that described how his problem was
> resolved).
Well that depends....if _all_ you want to do is to use blixem then you can
download it from the acedb web site as a separate stand alone program and you
might as well input data into just blixem. If however you want to look at your
sequence with associated features and perhaps annotate it etc. then you should
seriously think about loading the data into acedb and using the interface that
acedb provides to blixem. acedb will do a lot for you including:
- integrates blixem with "fmap" (acedbs sequence viewer) so that
you can click on homologies in fmap and see them aligned to the
fmap sequence in blixem.
- converts sequences it holds for input to blixem
- gets blixem to call efetch or pfetch for sequences that it
doesn't have
- starts up blixem either as part of the xace executable or as a
separate stand alone blixem (meaning you can have as many
blixem windows as you like).
> II) Does anyone out there know of a 'fasta2ace' parser that has already
> been written?
Well it shouldn't be too hard I think, lets assume that we have a sequence
called "bA404F10", then in fasta format it would be:
>bA404F10
ggaagtggcttcatttcagtggctgacttccagagagcaatatggctggt
tccccaacatgcctcaccctcatctatatcctttggcagctcacagggtc
and to create a sequence in acedb that could input to acedb you would create an
ace file containing:
Sequence : "bA404F10"
DNA "bA404F10" 100
DNA : "bA404F10"
ggaagtggcttcatttcagtggctgacttccagagagcaatatggctggt
tccccaacatgcctcaccctcatctatatcctttggcagctcacagggtc
this would make two objects in the database, a Sequence class object which would
be needed for display in fmap, this contains a reference to a DNA class object
which contains the actual DNA.
You will need to do more than this to really use blixem from within the acedb
fmap but it should get you started.
cheers Ed
--
------------------------------------------------------------------------
| Ed Griffiths, Acedb development, Informatics Group, |
| Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, |
| Hinxton, Cambridge CB10 1SA, UK |
| |
| email: edgrif at sanger.ac.uk Tel: +44-1223-494780 Fax: +44-1223-494919 |
------------------------------------------------------------------------
More information about the Acedb
mailing list