Hi,
I'm trying to do molecular identification of muck-inhabiting annelids
(morphologically they key to Lumbriculus) from Florida. I'm having zero
luck. The primers I am using have worked great with leeches. I get great
bands (with leeches) and 98% match to various leech species. The same
protocols produce no band or an ugly smear when using DNA extracted from
very fresh annelid tissue.
These are the primers that I have tried:
Primer name Used for Primer sequence Reference
12SE1 PCR, sequencing (12S) AAAACATGGATTAGATACCCRYCTAT Jamieson et al.
(2002)
12SH PCR, sequencing (12S) ACCTACTTTGTTACGACTTATCT Jamieson et al.
(2002)
16Sar-L PCR, sequencing (16S) CGCCTGTTTATCAAAAACAT Palumbi et al.
(1991)
16Sbr-H PCR, sequencing (16S) CCGGTCTGAACTCAGATCACGT Palumbi et al.
(1991)
16S AnnF PCR, sequencing (16S) GCGGTATCCTGACCGTRCWAAGGTA Sjölin et al.
(2005)
16S AnnR PCR, sequencing (16S) TCCTAAGCCAACATCGAGGTGCCAA Sjölin et al.
(2005)
TimA PCR, sequencing (18S) AMCTGGTTGATCCTGCCAG Tim Littlewood (pers.
comm. in Norén and Jondelius, 1999)
TimB PCR (18S) TGATCCATCTGCAGGTTCACCT Tim Littlewood (pers. comm. in
Norén and Jondelius, 1999)
1100R PCR, sequencing (18S) GATCGTCTTCGAACCTCTG Tim Littlewood (pers.
comm. in Norén and Jondelius, 1999)
660F PCR, sequencing (18S) GATCTCGGGTCCAGGCT Erséus et al. (2002)
600F PCR, sequencing (18S) GGTGCCAGCMGCCGCGGT Tim Littlewood (pers.
comm. in Norén and Jondelius, 1999)
They come from Envall et al. (2006) Molecular evidence for the
non-monophyletic status of Naidinae (Annelida, Clitellata, TubiWcidae).
I cannot use barcoding primers (Folmer et al / LCOI) because they
amplify other (non annelid) organisms from the same sample.
Any help would be appreciated.
--
Nathan D. Burkett-Cadena, PhD
Assistant Professor
University of Florida | IFAS
Florida Medical Entomology Laboratory
200 9th St. SE
Vero Beach, FL 32962
(772)778-7200*141
