dbEST retrievals for cDNA info

Thomas_C.Newman 22313TCN at MSU.EDU
Tue May 11 16:24:00 EST 1993


Arabidopsis Network:


The following is the help file for accessing ESTs by e-mail.
The Arabidopsis cDNA-EST list that was placed on the network earlier
can be used to access the ESTs by using the CLONEID which  is listed
as "clone" in the first column of the table.

As an example to retreive Actin 1 sequence send the following:


To:  est_report at ncbi.nlm.nih.gov
Subject:

DATATYPE NCBI
CLONEID 40F11T7

--------------------------------------------------------------------


SEE BELOW FOR FULL DETAILS OF THE dbEST RETRIEVAL AND WHAT IS INCLUDED IN
THE EST-REPORT

Tom Newman






	EST Report (Expressed Sequence Tag)

dbEST was developed by the National Center for Biotechnology
Information at the National Library of Medicine. The database contains
a collection of Expressed Sequence Tags from a variety of cDNA libraries.
ESTs are currently available from :
	Homo sapiens (brain)
	Plasmodium falciparum
        Mus musculus (testis)
        Caenorhabditis elegans
        Arabidopsis thaliana

You can access the EST Mail Server through a number of
different networks, including Internet, BITNET, EARN, NETNORTH and
JANET.

The EST report server allows you to request detailed reports for a set
of ESTs contained in dbEST, by specifying the NCBI id for each EST of
interest.


Accessing the EST Report Server

To access the server, send an electronic mail message containing the
set of NCBI EST ids, as described below, to the following internet
address:

	est_report at ncbi.nlm.nih.gov

If you are not on Internet, you may need to change the format of the
address.  Consult your systems manager to determine the correct
address format.


Obtaining Help

If you would like to receive instructions on using the EST server,
send a mail message to the address above containing the word "HELP" on
a single line of the mail message.  Leave the Subject line in the mail
header blank.

Formatting a Query

Queries consist of a mail message with  parameters identifying
the ESTs to be retrieved and the information field to be used for
retrieval. The id's of the ESTs to be retrieved
may appear on one or more lines of the mail message, each line
commencing with the keyword RPT. If multiple id's appear on a line,
they must be separated by a blank character (see example below).
The keyword DATATYPE must appear first on a line, followed by one
of the following options:
NCBI (the NCBI assigned id, Source (the name given by the contributor),
ATCC (the ATCC number), GenBank (the GenBank accession number),
GDB (the Genome Data Bank id), Clone (the clone id). If there is no
datatype line present, the default NCBI will be used.

Use your local mail program to send your query. Please follow  the
format in the following example PRECISELY, but note that the server
is case-insensitive, i.e. either upper or lower case letters
may be used.


EST REPORT MAIL QUERY EXAMPLE

Note that the first four lines in the example below are a mail header
that is automatically created when you address a mail message.
Nothing need be entered for the Subject.  NOTE: the text that you
enter into the body of the message begins with the "RPT"
keyword below (do not add blank lines in the message).  Each line of
information must be less than 80 characters in length.  Longer lines
will be truncated.


From:  drest at someaddress.somewhere.edu Tue Jun 14 21:36:38 1991
Date:  14 Jun 1991 2129:02-PDT
To:    est_report at ncbi.nlm.nih.gov
Subject:

RPT 35 126 793 2563 789
RPT 55 3961 24

The example above requests reports on 8 EST sequences using NCBI est ids
by default. The format of the reports you will receive is as follows:

NCBI_ID:	1
SourceEST_ID:	EST00001
GenBankID:	M61954
CloneID:	HHCI89
ATCC_ID:	65128
SeqPrimer	M13 Forward
Library:	Hippocampus, Stratagene (cat. #936205)
Organism	Homo sapiens
Description:
		Female, 2 years; oligo-dT + random primed cDNA synthesis; la
		mbdaZAP-II vector, 1.0kb average insert size.
SEQUENCE:
		GCCATCCTGCGTCTGGACCTGGCTGGCCGGGACCTGACTGACTACCTCATGAAGATCCTC
		ACCGAGCGCGGCTACAGCTTCACCACCACGGCCGAGCGGGAAATCGTGCGTGACATTAAG
		GAGAAGCTGTGCTACGTCGCCCTGGACTTCGAGCAAGAGATGGCCACGGCTGCTTCCAGC
		TCCTCCCTGGAGAAGAGCTACGAGCTGCCTGACGGCCAGGTCATCACCATTGGCAATGAG
		CGGTTCCGCTGCCCTGAGGCACTCTTCCAGCCTTCCTTCCTGGGCATGGAGTCCTGTGGC
		ATCCACGGAACTACCTTCAACTCCATCATGAAGTGTGACGTGGACATTCGGAAAGACCTG
		TACGGCAACACAGTGCT
Entered:	May 26 1992
MatchAuthor:	Actin, gamma, cytoskeletal
MatchNRDB:	SP:ACTB_XENBO ACTIN, CYTOPLASMIC TYPE 1 (BETA ACTIN...
Score:		654
pValue:		1.5e-90
SearchDate:	May 27, 1992

MedlineUI:	91262645
Citation:	Science, 252:1651 (1991)
Status:		Published

Source:		Kerlavage AR
SourceLab:	Receptor Biochemistry & Molecular Biology
Institution:	NIH
Address:	NIH/NINDS/RBMB,
		Park Building,
		Room 405,
		Bethesda,
		MD 20892
Tel:		3014968800
Fax:		3014808588
E-mail:		arkerlav at briggs.ninds.nih.gov

ATTC Contact:	American Type Culture Collection
		12301 Parklawn Drive
		Rockville, MD 20852-1776
		Sales: 301-881-2600
||


Retrieval using other fields.
============================
From:  drest at someaddress.somewhere.edu Tue Jun 14 21:36:38 1991
Date:  14 Jun 1991 2129:02-PDT
To:    est_report at ncbi.nlm.nih.gov
Subject:


DATATYPE GenBank
RPT M61944 M71786

This example requests reports on 2 EST sequences using GenBank
accession numbers for retrieval.
The format of the reports you will receive is the same for the
previous example.



More information about the Arab-gen mailing list