Ba1-5' junc

Tatsuya Sawasaki d0676510 at sci.hiroshima-u.ac.jp
Thu Dec 12 01:31:29 EST 1996


program  blastn
datalib  DNA
wordsize 10
begin
>Ba1-5' junc
AACACATTGATCGCATTTCGCCTAAGGCTTCCACGAGATGGCTTAACGAAGTTGTGGCGTAGCTGTTCTCCACGGA
AAATTGATATAAACTTGATGTTCGCGGCGAGCATCCTTGCGGTTCATTTAGATGAGACCACGAGAGATAGAGTTAA
TTATTTAAGTAAGGGTTATTTTGCACATCTAATATACATGATCACAATTGAGACAAAGCCAAGTGATTTTGGTCAA
TAATTTAAAAGAAATACCCTAAAATAACACGAAAACAAATTTTATAGACACATATAACACACACACTCCATAATTT
TTCAAAATTAACATAAGTGAGTTTACACATTAATTATTATATCGTATCTAATTATGTACAATAATAAAATCAATTA
CAATTTAGAATCATGATTAGAATACGATCGCATGAAGCATCAATCAAATGCTTATATTAGTTTCTTAATAATAAAT
TCCTTACCTTTTTGGAACTTTGGAGATGGTGTGCTTAACTTGGTAACAAAATCAGAATTAAAATAAAGTCAGTTGC
TAGTCTTAATTATAGTAAATGAATAGTATTAAGGACCACTGCAACAATTATAAGGCCCAAAATCAAATAATTATTT
GACCAATGTAAAATAGGTTGGAAACTTCATAACATGGAAAATCTAACCAAATAATCGAATGCAAATTGCAAAGTAG
ACAAAGGTTTAGCCAATCCATTTACAGAGATGACTAGTTGATTAGTAGACCCTTCGATGGTTAATAAATATTGTTT
GACCAACCGTATTTATTTACCAAAAGCTTAAGCGAGGAAGCGGAAGAGCGCCCAATACGC
//




More information about the Arab-gen mailing list