IUBio Biosequences .. Software .. Molbio soft .. Network News .. FTP

smRS-GFP error

Seth J. Davis sjdavis1 at students.wisc.edu
Thu Apr 10 10:54:15 EST 1997

Dear researcher,

We recently discovered that the Soluble-Modified Red-shifted
Green-Fluorescent Protein (smRS-GFP) clone we donated to the Arabidopsis
Biological Resource Center (ABRC) has a mutation that abolishes function.
This clone was available under order number CD3-327.  Our lab is repairing
this clone for replacement, and it should be available from the ABRC within
two months.

Clones psmGFP (CD3-326) and psmBFP (CD3-328) do not contain this mutation,
and are still available from the ABRC.

Specifics of mutation:

bp 184-220 relative to translational initiation

|||||||||||||||| |||||||||||||||||||
actactttcacttatggtgttcaatgcttttcaaga correct sequence

We apologize for any inconveniences this has caused.

Seth J. Davis
Rick D. Vierstra

More information about the Arab-gen mailing list

Send comments to us at biosci-help [At] net.bio.net