Primers on bottom Chromosome 1

Sarah Grant sgrant at email.unc.edu
Mon Jul 13 17:04:01 EST 1998


We are mapping a gene on Chromosome 1 between nga111 (position 111) and
ATHATPASE (position 114) but we have been having trouble to get reliable
banding patterns with ATHATPASE, ADH and PR5 markers. We are using the
following primers to amplify the sequences and the following conditions:
PR5     Forward primer          CTCTTCCTCGTGTTCATCAC
        Reverse primer          GTGAATTCGTAGTTAGCTCCGG
        conditions: 95 deg. C 3', 40X(95 deg. C 30", 55 deg. C 1', 72 deg C
2') 72 deg C 5'
        Cut with BamH1 enzyme
AP1     F primer                 ATGGGAAGGGGTAGGGTTCA
        R primer                 GCTCATTGCTTGCAAGTCTTC
        conditions: like PR5 but 60 deg. annealing temperatures, cut with Xmn1
ATHATPASE               F primer        CGTTAACGGTTCGATTCGAGC
                        R primer        GTTCACAGAGAGACTCATAAACCA
                        conditions      as for PR5
We would appreciate any suggestions on reliably amplifying these sequences
from Col-0 and Landsberg. We would also be grateful for information on any
other markers that people are using that lie in this region and are
polymorphic for Col-0 and La-er
Sarah Grant email: sgrant at email.unc.edu
and Darlene Lawson, email: dlawson at email. unc.edu.

Sarah Grant
Coker Hall CB#3280
Department of Biology
University of North Carolina
Chapel Hill, NC 27599-3280, USA
tel: (919) 962-7253
fax: (919) 962-1625
email: sgrant at email.unc.edu





More information about the Arab-gen mailing list