TAIL PCR

MALAMJ01 at MCRCR6.MED.NYU.EDU MALAMJ01 at MCRCR6.MED.NYU.EDU
Tue Sep 15 11:27:03 EST 1998


Path: mcrcr6!malamj01
From: malamj01 at mcrcr6.med.nyu.edu
Newsgroups: bionet.genome.arabidopsis
Subject: TAIL PCR
Message-ID: <SPLElwzq1fxz at mcrcr6>
Date: 15 Sep 98 00:48:59 EDT
Organization: NYU Medical Center, New York, NY 10016, USA
News-Moderator: Approval required for posting to bionet.genome.arabidopsis
Lines: 101

Thanks to everyone for their information about TAIL PCR primers.   Below is
a summary of the responses:

        I've been using TAIL PCR to isolate the ends of BACs during my
chromosome walk.  I obtained the sequences of my arbitrary primers from the
following sources:

Tsugeki et al., Plant Journal 10:  479-489 (1996)
Liu et al., Plant Journal 8:  457-463 (1995)
Liu and Whittier, Genomics 25:  674-681 (1995)

Some of the sequences are the same in the three papers, but have different
names.  I have found the primers that do NOT contain inosine to be the
best.  I haven't done any work with the Feldmann lines.  If you haven't
done this procedure yet, be aware that the technique is very finicky.  ThePCR
machine you use has all kinds of effects on whether or not it works.
MJ Research did not work well for me, but an antiquated Ericomp works
great.  I haven't tried Perkin Elmer, but since the authors used that
machine for theirs, it should work fine.  Good luck!

Robert B. McGrath, Ph.D.
Department of Biology
University of Pennsylvania
415 S. University Avenue
Philadelphia, PA  19104-6018
mcgrathr at sas.upenn.edu
--------------------------------------------------------------------------------
----------------------------
We have used the following primers:

WGG WAN CWG AWA NGC A
WCG WWG AWC ANG NCG A
WGC NAG TNA GWA NAA G
AWG CAN GNC WGA NAT A

The last two worked very well in a line we wanted to analyze.
Designing these primers, we have chosen mainly W for the degenerated positions
since the flanks fished with the Liu primers AD1-3 in previous
experiments had mostly A at the degenerated positions.

Ortrun Mittelsten Scheid
Friedrich Miescher-Institute
P.O.Box 2543 lab 2.58
CH-4002 Basel
Switzerland
phone 41-61-6975583
fax 41-61-6973976
e-mail ortrun at fmi.ch
--------------------------------------------------------------------------------
----------------------------

I have been using the TAIL-PCR method to clone my titan3 gene recently.
The line I was working on was also from Feldmann.  I used the left
border T-DNA in stead of the right border to design the primers, which
works very well in my hand.  If you like to see the details, plase visit
my webpage at http://mutant.lse.okstate.edu/chunming
If you have further questions, please contact me.

Chun-ming Liu
OSU-Botany
Please note this temporary email address will be changed
toliucm at osuunx.ucc.okstate.edu when an administrative update has been
completed.
--------------------------------------------------------------------------------
------------------------

Here are the T-DNA primers we use for TAIL-PCR in the Feldmann lab. They
were designed by Rod Winkler when he was in our lab several years ago
(to give credit where credit is due!).

Left border

primary rxn: 5'- TCGACGATATAGAGCAAGATGGAAAAT -3'

secondary: 5'- TGACTCCGCGCAATATTTACACAT -3'

tertiary: 5'- GATGCACTCGAAATCAGCCAATTTTAGAC -3'

Right border

primary rxn: 5'- GTACACGGCTGGAGCGAATAACTGC -3'
Also, you can try these arbitrary degenerate primers:

5'- SSTGGSTANATWATWCT -3'

5'- CGSATSTCSAANAAWAT -3'

where S = G or C, W = A or T, and N = A, C, G, or T

Hope this helps.

Dan Coury

**************************************
* Dan Coury                          *
* Graduate Associate                 *
* Department of Plant Sciences       *
* University of Arizona              *
* Tucson, AZ 85721 USA               *
* E-mail: dacoury at ag.arizona.edu     *
* Phone:  (520) 621-9701             *
* FAX:    (520) 621-7186             *
**************************************




More information about the Arab-gen mailing list