Sequence of Dijon

Nobody nobody at hgmp.mrc.ac.uk
Sun Sep 15 07:04:03 EST 2002



Dear Arabidopsis News Group readers,

I was trying to map an Arabidopsis mutation that causes
a change of mobility of 3 isoperoxidases. I found a
RAPD-marker, linked with the mutation. After several
reamplifications, I cloned the polymorphic DNA fragment
(2kb) and sequenced the ends of this fragment
(300 bp from each end).
To my surprise, both 300 bp sequences did not demonstrate
any significant homology to Arabidopsis genome DNA.
There was no homology to microorganism genomes or other
genomes as well.
My mutant was obtained by mutagenesis of ecotype Dijon.
Can anybody tell me where I can get the information about
genome sequence of Dijon?
I also would like to know, if it could be so, if ecotypes
of the one and the same species demonstrate differences over 300+300 bp
extent.
Or - what kind of mistakes could lead to this strange result?

Here are my sequences:
direct
CTGGGCACGAGCAGCAGTCTCTGTTGGCCAGAAGCATCAGCTTAGGAGTCTCGAGACTTA
GAACACTGGTTGCATTGCGTCGATAGCTACTTGTAAATACGACCGGCGAATTTTCAGCCT
GGCAAACTGCTAAGCTGACGCGAACGGCCGGGTTCGGCCAGAAGCGGACTTTGCTCGGTC
GCCCTTTCAGCCATTAATAAATCAATTAGCCAGAAGCTTTTGGCAAAGCCTCTCTCCAAG
CTTTTGCCTTGGCCCCTATTTCCATTGACTGTTGAATTACTGGCCTAAGAATTATTTTTT

revers
CTGGGCACGATGATAGAAGATGAGCCGGTAGTAAAAGAGCAGGCGAAGCTATAGCCGAGC
TGTACTATTCAAGCTTGCCGAAATGATTAGAAACAAGGGCTTGCAAGGCTACGATATTCA
ACTCCATAGTACAGCCGCCCGTGCGTAAGCTTCTGGTCTTAAAAGAGAATTCGGCATTCC
GTAGTTAGCTTCATAGCCCAAACAGCCATTGCCGCGCGGANCGTTAAATGCTGCGCTATT
CAACCTGACCACTTTCAATCGACTCCAAACACTTTAAACGGCACAACCAGTGAACGAATA


Thank you very much for you help in advance.

Sincerely,

Olga

PhD student Olga Lebedeva.
Department of Genetics
Biological faculty
Moscow State University
Moscow 119899
Russia
OLebedeva at newmail.ru



__________
www.newmail.ru -- =D7"=89=AB=9F=A1 =DE'=A6-'=A6 =91=A6=D7=A6=89.
---



More information about the Arab-gen mailing list